Indian Patents. 272788:"A NUCLEIC ACID CONSTRUCT FOR GENE EXPRESSION"

Title of Invention	"A NUCLEIC ACID CONSTRUCT FOR GENE EXPRESSION"
Abstract	The present invention relates to a gene expression system that is both efficient and economical. A bi-directionally active promoter sequence is used to express more than one gene. This invention does not require use of specialized strains for gene expression. This invention also includes a process for producing gene products

Full Text	FORM 2 THE PATENTS ACT, 1970 (39 of 1970) THE PATENTS RULES, 2003 COMPLETE SPECIFICATION (See section 10; rule 13) TITLE OF THE INVENTION A Nucleic Acid Construct for Gene Expression APPLICANT INDIAN INSTITUTE OF TECHNOLOGY BOMBAY Preamble of the Description The following specification particularly describes the invention and the manner in which it is to be performed FIELD OF INVENTION This invention relates to the field of biotechnology, in particular to a nucleic acid construct for gene expression. More particularly, the invention is directed to nucleic acid construct for the production of recombinant protein. The present invention allows efficient and economical expression of gene products by means of a bi-directionally active promoter sequence. BACKGROUND OF THE INVENTION Production of biomolecules for therapeutic or industrial uses is usually carried out by incorporating a nucleic acid containing the gene of interest in a living cell, which is called a host. The nucleic acid containing the gene may either be integrated in the host genome, or may be incorporated in an autonomous nucleic acid molecule called episome or plasm id. Depending on the gene product, the host cell may be eukaryotic or prokaryotic. Escherichia coli is the most commonly used host organism due to ease of genetic manipulation, simple growth requirements and fast doubling time. For expression of the gene of interest, the nucleic acid containing the gene is placed downstream of another nucleic acid sequence that controls expression of the gene of interest. This controlling element is called a promoter. The promoter may be constitutive or inducible. Constitutive promoters allow expression of genes placed downstream to occur at all times, while inducible promoters allow expression of genes placed downstream to occur only under certain conditions. Generally, inducible promoter sequences are preferred so as to allow controlled expression of the nucleic acid of interest. A number of promoter sequences are known in the prior art. Examples of commonly used promoter sequences in E. coli include the lac promoter and variants thereof, which are inducible by addition of molecules like isopropyl β-D-thiogalactopyranoside (IPTG). Promoters like λ pL and λ pR are inducible by a shift in temperature. Induction of expression by means of chemicals or temperature changes is not feasible in large-scale fermentation. Moreover, strong induction of a nucleic acid coding for a protein may lead to formation of insoluble inclusion bodies. Additionally, for use of some promoters, like the commonly used T7 or T5 promoters, specific E. coli strains must be used, which may be undesirable in some applications. The expression of more than one nucleic acid molecule in the same host may be desirable in processes like biotransformation. This is currently achieved by either expressing the nucleic acid molecules of interest (each under the control of a different promoter) from two different episomal molecules, or by means of operably linking the nucleic acid molecules to two promoter sequences resident on the same episomal molecule. In the first situation, the host is burdened with two episomal molecules, which may affect growth rate, while in the second, the two promoters may be induced by the same mechanism, leading to expression at similar levels of both nucleic acid molecules. If the promoters are induced by different mechanisms, cost of induction will be a consideration. Thus, a need exists for conveniently and efficiently expressing one or more than one nucleic acid molecule in a single host organism. The object of the present invention is to address this need. BRIEF DESCRIPTION OF DRAWINGS Figure 1: shows cell density, glucose concentration and GFP fluorescence off. coli BW25113 transformed with plasmids pPROBE-NT and pNT-csgDp Figure 2: shows GFP fluorescence of E. coli BW25113 transformed with plasmids pPROBE-NT, pNT-csgDp and pNT-csgBp F igure 3: shows GFP and mCherry fluorescence of E. coli BW25113 transformed with plasmid pNT-GFP-mC DESCRIPTION OF INVENTION In the present invention, a 754 base pair (bp) DNA sequence from the Escherichia coli genome is used to conveniently, inexpensively and efficiently express nucleic acid molecule(s) of interest operably linked to the said DNA sequence. The nucleic acid sequence of the positive strand of the said 754 bp DNA sequence is given below: SEQIDNo. 1: GATGAAACCCCGCTTTTTTTATTGATCGCACACCTGACAGCTGCCTCTAAAATAGAAGCACCAGAAGTA CrGACAGATGTTGCACTGCTGTGTGTAGTAATAAATCAGCCCTAAATGGGTAAAATATAAAACTAATGG ATTACATCTGATTTCAATCTAGCCATTACAAATCTTAAATCAAGTGTTAAACATGTAACTAAATGTAAC TCGTTATATTAAAATGTTAACCTTAAGGTTTTATTAAGTTTAGAAATGATAGAAAAGTTGTACATTTGG T TTTTATTGCACAAT TTTAAAAAATCATACAAATGGTGATAACT TACTAATAATGCATATAAAAAATAT TTCGGTGTAGTCCTTTCGTCATGTAAAACGTTCTTGTTTTTTCTCCACACCTCCGTGGACAATTTTTTA CTGCAAAAAGACGAGGTTTGTCACGGCTTGTGCGCAAGACATATCGCAGCAATCAGCGACGGGCAAGAA GAATGACTGTCTGGTGCTTTTTGATAGCGGAAAACGGAGATTTAAAAGAAAACAAAATATTTTTTTGCG TAGATAACAGCGTATTTACGTGGGTTTTAATACTTTGGTATGAACTAAAAAAGAAAAATACAACGCGCG GGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTAACGCAGCGTTAACAAAATACAGGTT GCGTTAACAACCAAGTTGAAATGATTTAATTTCTTAAATGTACGACCAGGTCCAGGGTGACAAC The said DNA sequence contains divergent promoter elements, one on each DNA strand. Shine-Dalgarno ribosomal binding sequence may be operably linked to either end of SEQ ID No. 1 for initiation of protein synthesis. An example of Shine-Dalgarno sequence is AGGAGG. DNA sequence coding for gene of interest can be operably linked to either end of the said DNA, allowing expression therefrom. In an embodiment of the present invention, the said sequence may be used to achieve expression of at least two genes that are operably linked to either ends of the said sequence. Nucleic acid sequences that are at least 60% similar to SEQ ID No. 1, or which exhibit substantially similar functionality form a further aspect of the present invention. The construct may be contained in an episome, plasmid or a host cell. The host cell may be a bacterium, preferably from the Enterobacteriaceae family, more particularly E. coli. The present invention also relates to a process of producing gene products using the expression system described herein. The present invention further includes gene products obtained by the process described herein, In an embodiment of the invention, the expression system thus constructed may be used to express the gene of interest by transforming into E. coli or related bacterial species and cultivating the host cell under conditions that allow expression of the gene or genes of interest. The gene of interest may encode an RNA nucleic acid molecule that may or may not be translated into a protein. Preferably, the gene of interest encodes a protein. Recombinant protein production using a promoter that is bidirectionally active is not reported in literature. In the present invention, a region of the E, coli genome is used that contains more than one promoter regions, and ribosomal binding sites are incorporated to facilitate translation of the nucleic acid molecule present downstream. This genetic construct can be used to express either one or more than one nucleic acid molecules that are operably linked to one or either ends of the genetic construct. Expression of a gene of interest operably linked downstream of SEQ ID No. 1 is maximal at temperatures less than 30°C. In an embodiment of the invention, expression of a gene of interest operably linked downstream of SEQ ID No. 1 can be controlled by cultivating the host cell at temperatures above 30°C. The present expression system can be used to achieve expression of the gene of interest in any E. coli or related bacterial strain, thus avoiding the constraint of using special or specific host strains. This invention also includes a process for the production of a gene product such as a protein and like biomolecules which comprises the step of culturing a host cell having a nucleic acid construct under known culture condition for expressing the gene product which may be isolated and purified. STATEMENT OF INVENTION This invention relates to a nucleic acid construct for gene expression which comprises at least one nucleic acid molecule of Sequence ID No.l, GATGAAACCCCGCTTTTTTTATTGATCGCACACCTGACAGCTGCCTCTAAAATAGAAGCACCAGAAGTA CTGACAGATGTTGCACTGCTGTGTGTAGTAATAAATCAGCCCTAAATGGGTAAAATATAAAACTAATGG ATTACATCTGATTTCAATCTAGCCATTACAAATCTTAAATCAAGTGTTAAACATGTAACTAAATGTAAC TCGTTATATTAAAATGTTAACCTTAAGGTTTTATTAAGTTTAGAAATGATAGAAAAGTTGTACATTTGG TTTTTATTGCACAATTTTAAAAAATCATACAAATGGTGATAACTTACTAATAATGCATATAAAAAATAT TTCGGTGTAGTCCTTTCGTCATGTAAAACGTTCTTGTTTTTTCTCCACACCTCCGTGGACAATTTTTTA CTGCAAAAAGACGAGGTTTGTCACGGCTTGTGCGCAAGACATATCGCAGCAATCAGCGACGGGCAAGAA GAATGACTGTCTGGTGCTTTTTGMAGCGGAAAACGGAGATTTAAAAGAAAACAAAATATTTTTTTGCG TAGATAACAGCGTATTTACGTGGGTTTTAATACTTTGGTATGAACTAAAAAAGAAAAATACAACGCGCG GGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTAACGCAGCGTTAACAAAATACAGGTT GCGTTAACAACCAAGTTGAAATGATTTAATTTCTTAAATGTACGACCAGGTCCAGGGTGACAAC or a sequence having at least 60% similar thereto, operably linked to at least one Shine-Dalgarno ribosomal binding sequence. For a better understanding of the present invention, reference is made to the following examples. These examples are merely meant to describe and illustrate embodiments of the present invention, and are not meant to limit the invention or its working in any manner whatsoever. Examples Materials and Methods All media components used were supplied by Himedia (Mumbai). Restriction enzymes, Taq polymerase, T4 DNA ligase and other molecular biology reagents were purchased from Fermentas. Oligos for carrying out polymerase chain reaction (PCR) were obtained from Sigma. All standard molecular biology protocols used were as detailed by Sambrook J and Russell DW in Molecular Cloning: A Laboratory Manual (CSHL Press, 2001). Example 1 The negative strand of the 754 bp curli intergenic region was amplified by PCR from E. coli MG1655 genomic DNA using primers SR31 (5'-cgcggatccgcggttgtca ccctggacctgg; BamHl recognition sequence underlined) and SR32 (5'-ccggaattcc gggatgaaaccccgc; EcoRl recognition sequence underlined). The PCR conditions were as follows: initial denaturation for 10 minutes at 95°C; followed by 30 cycles each comprising of denaturation for 2 minutes at 95°C, annealing for 40 seconds at 60°C, and extension for 1 minute at 72°C; extension for 10 minutes at 72°C, and final hold at 4°C. The PCR product was digested with BamHl and EcoRl and cloned into the corresponding sites of plasmid pPROBE-NT (Miller WG, Leveau JHJ, Lindow SE. (2000) Improved gfp and inaZ broad-host-range promoter-probe vectors. Mol. Plant Microbe Interact 13, 1243-1250), which contains a promoterless gfp gene. The Hgated product (named pNT-csgDp) was transformed in calcium chloride-competent E. coli DH5a cells and verified by sequencing (Macrogen Inc., South Korea). Example 2 E. coli DH5α cells containing pPROBE-NT (parent vector) and pNT-csgDp were inoculated in 5 ml Luria-Bertani (LB) medium containing 50 μg/μJ kanamycin. The cultures were incubated at 37°C for 18 hours on an orbital shaker (250 rpm). Absorbance at 600 nm and green fluorescent protein (GFP) fluorescence intensity (excitation at 490 nm; emission at 510 nm) were determined for both cultures, Table 1: Cell density and GFP fluorescence of E. coli DH5ct transformed with plasmids pPROBE-NT and pNT-csgDp DH5α/pPROBE-NT DH5α/pNT-csgDp OD600 2.875 2.505 GFP (ref.fluores.) 230.496 2941.125 Example 3 E. coli BW25113 cells transformed with pPROBE-NT (parent vector) and pNT-csgDp were inoculated in 5 ml M9 medium (6 g Na2HPO4, 3 g KH2PO4, 1 g NH4C1, 0.5 g NaCl, 246.5 mg MgS04.7H20, 14.7 mg CaCI2, 1 mg thiamine per litre) supplemented with 1% glucose containing 50 μg/μl kanamycin. The cultures were incubated at 37°C for 18 hours on an orbital shaker (250 rpm). Cells from both cultures were then resuspended in 50 ml M9 medium supplemented with 0.2% glucose containing 50 μg/μ1 kanamycin, and incubated at 37°C on an orbital shaker (250 rpm). Aliquots were withdrawn at regular time intervals, and absorbance at 600 nm and GFP fluorescence intensity (excitation at 490 nm; emission at 510 nm) were determined. Example 4 The positive strand of the 754 bp curli intergenic region was amplified by PCR from E. coli MG1655 genomic DNA using primers SR33 (5'-cgcggatccgcggatgaaaccccgc; BamH1 recognition sequence underlined) and SR34 (5'-ccggaattccgggttgtcaccctggac; EcoRl recognition sequence underlined). The PCR conditions were as follows: initial denaturation for 10 minutes at 95°C; followed by 30 cycles each comprising of denaturation for 2 minutes at 95°C, annealing for 40 seconds at 60°C, and extension for 1 minute at 72°C; extension for 10 minutes at 72°C, and final hold at 4°C. The PCR product was digested with BamHl and EcoRl and cloned into the corresponding sites of plasmid pPROBE-NT. The ligated product (named pNT-csgBp) was transformed in calcium chloride-competent E. coli DH5a cells. Example 5 E. coli BW25113 cells transformed with pPROBE-NT (parent vector), pNT-csgDp and pNT-csgBp were inoculated in 3 ml CFA medium (10 g casamino acids, 1 g yeast extract, 50 mg MgS04, 5 mg of MnCl2 per litre, pH 7.4) (Evans DG, Evans Jr DJ, Tjoa W. (1977) Hemagglutination of human group A erythrocytes by enterotoxigenic Escherichia coli isolated from adults with diarrhea: correlation with colonization factor. Infect Immun 18, 330-337) containing 50 μg/μl kanamycin. The cultures were incubated at 26°C for 18 hours on an orbital shaker (100 rpm). 0.3 ml from these cultures were then inoculated in30mlC FA medium containing 50 μg/μ1 kanamycin, and incubated at 26°C on an orbital shaker (100 rpm). Aliquots were withdrawn at regular time intervals, and absorbance at 600 nm and GFP fluorescence intensity (excitation at 490 nm; emission at 510 nm) were determined. Example 6 The mCherry gene was amplified by PCR from plasmid pAW8-mCherry (Watson AT, Garcia V, Bone N, Carr AM, Armstrong J (2008) Gene tagging and gene replacement using recombinase-mediated cassette exchange in Schizosaccharomyces pombe. Gene 407, 63-74) using primers SR41a (5'-cgcggatccgcgaggaggaaaaacatat ggtgagcaagggcgagg; BamHl recognition sequence underlined; ribosomal binding site incorporated) and SR42 (5'-cccaagcttgggttacttgtacagctcgtcc; Hindlll recognition sequence underlined). The PCR conditions were as follows: initial denaturation for 10 minutes at 95e,C; followed by 30 cycles each comprising of denaturation for 2 minutes at 95°C, annealing for 40 seconds at 60°C, and extension for 1 minute at 72°C; extension for 10 minutes at 72°C, and final hold at 4°C. The PCR product was digested with BamHl and Hindlll and cloned into the corresponding sites of plasmid pPROBE-csgDp. The ligated product (named pNT-GFP-mC) was transformed in calcium chloride-competent E coli DH5a cells. Example 7 E. coli BW25113 cells transformed with pNT-GFP-mC were inoculated in 3 ml CFA medium containing 50 μg/μ1 kanamycin, and incubated at 26°C for 18 hours on an orbital shaker (100 rpm). 0.3 ml from this culture was then inoculated in 30 ml CFA medium containing 50 μg/μ1 kanamycin, and incubated at 26°C on an orbital shaker (100 rpm). Aliquots were withdrawn at regular time intervals, and absorbance at 600 nm and fluorescence intensities (excitation at 490 nm and emission at 510 nm for GFP; excitation at 587 nm and emission at 610 nm for mCherry) were determined. Variations of the embodiments illustrated and other features and advantages of the present invention will be evident to a person of ordinary skill, and are within the scope and ambit of the claims appended herein below. WE CLAIM 1) A nucleic acid construct for gene expression comprising at least one nucleic acid molecule of Sequence ID No. 1, GATGAAACCCCGCTTTTTTTATTGATCGCACACCTGACAGCTGCCTCTAAAATAGAAGCACCAGAAGTA CTGACAGATGTTGCACTGCTGTGTGTAGTAATAAATCAGCCCTAAATGGGTAAAATATAAAACTAATGG ATTACATCTGATTTCAATCTAGCCATTACAAATCTTAAATCAAGTGTTAAACATGTAACTAAATGTAAC TCGTTATATTAAAATGTTAACCTTAAGGTTTTATTAAGTTTAGAAATGATAGAAAAGTTGTACATTTGG TTTTTATTGCACAATTTTAAAAAATCATACAAATGGTGATAACTTACTAATAATGCATATAAAAAATAT TTCGGTGTAGTCCTTTCGTCATGTAAAACGTTCTTGTTTTTTCTCCACACCTCCGTGGACAATTTTTTA CTGCAAAAAGACGAGGTTTGTCACGGCTTGTGCGCAAGACATATCGCAGCAATCAGCGACGGGCAAGAA GAATGACTGTCTGGTGCTTTTTGATAGCGGAAAACGGAGATTTAAAAGAAAACAAAATATTTTTTTGCG TAGATAACAGCGTATTTACGTGGGTTTTAATACTTTGGTATGAACTAAAAAAGAAAAATACAACGCGCG GGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTAACGCAGCGTTAACAAAATACAGGTT GCGTTAACAACCAAGTTGAAATGATTTAATTTCTTAAATGTACGACCAGGTCCAGGGTGACAAC or a sequence having at least 60% similar thereto, operably linked to at least one Shine-Dalgarno ribosomal binding sequence. 2) The nucleic acid construct as claimed in claim J, having at least one nucleic acid molecule of interest operably linked to either ends thereof. 3) The nucleic acid construct as claimed in claim 1, having more than one nucleic acid molecules of interest operably linked to either ends thereof. 4) The nucleic acid construct as claimed in claims 2 and 3, wherein said nucleic acid molecules of interest code for a protein. 5) The nucleic acid construct as claimed in claims 1 to 4, wherein said nucleic acid construct is contained in an episome, plasmid or a chromosome in a host cell. 6) A host cell containing the nucleic acid construct as claimed in claims 1 to 4. 7) The host cell as claimed in claim 6, wherein said host cell is a bacterium. 8) The host cell as claimed in claim 7, wherein said bacterium is from Enterobacteriaceae. 9) The host cell as claimed in claim 7, wherein said bacterium is Escherichia coli. 10) The host cell as claimed in claim 9, wherein said bacterium is Escherichia coli DH5a orBW25113. 11) A process for the production of gene products such as protein and like biomolecules comprising the step of culturing a host cell of claims 6 to 10 for expressing said products. 12) The process as claimed in claim 11, wherein said gene products are purified. 13) Gene products obtained by a process as claimed in claim 11. 14) Gene products obtained by a process comprising use of the nucleic acid construct as claimed in claims 1 to 4. 15) A nucleic acid construct for gene expression substantially as described herein.

Full Text

FORM 2
THE PATENTS ACT, 1970
(39 of 1970)
THE PATENTS RULES, 2003
COMPLETE
SPECIFICATION
(See section 10; rule 13)
TITLE OF THE INVENTION
A Nucleic Acid Construct for Gene Expression
APPLICANT
INDIAN INSTITUTE OF TECHNOLOGY BOMBAY
Preamble of the Description
The following specification particularly describes
the invention and the manner in which it is to be performed

FIELD OF INVENTION
This invention relates to the field of biotechnology, in particular to a nucleic acid construct for gene expression. More particularly, the invention is directed to nucleic acid construct for the production of recombinant protein. The present invention allows efficient and economical expression of gene products by means of a bi-directionally active promoter sequence.
BACKGROUND OF THE INVENTION
Production of biomolecules for therapeutic or industrial uses is usually carried out by incorporating a nucleic acid containing the gene of interest in a living cell, which is called a host. The nucleic acid containing the gene may either be integrated in the host genome, or may be incorporated in an autonomous nucleic acid molecule called episome or plasm id. Depending on the gene product, the host cell may be eukaryotic or prokaryotic. Escherichia coli is the most commonly used host organism due to ease of genetic manipulation, simple growth requirements and fast doubling time.
For expression of the gene of interest, the nucleic acid containing the gene is placed downstream of another nucleic acid sequence that controls expression of the gene of interest. This controlling element is called a promoter. The promoter may be constitutive or inducible. Constitutive promoters allow expression of genes placed downstream to occur at all times, while inducible promoters allow expression of genes placed downstream to occur only under certain conditions. Generally, inducible promoter sequences are preferred so as to allow controlled expression of the nucleic acid of interest.
A number of promoter sequences are known in the prior art. Examples of commonly used promoter sequences in E. coli include the lac promoter and variants thereof, which are inducible by addition of molecules like isopropyl β-D-thiogalactopyranoside (IPTG). Promoters like λ pL and λ pR are inducible by a shift in

temperature. Induction of expression by means of chemicals or temperature changes is not feasible in large-scale fermentation. Moreover, strong induction of a nucleic acid coding for a protein may lead to formation of insoluble inclusion bodies. Additionally, for use of some promoters, like the commonly used T7 or T5 promoters, specific E. coli strains must be used, which may be undesirable in some applications.
The expression of more than one nucleic acid molecule in the same host may be desirable in processes like biotransformation. This is currently achieved by either expressing the nucleic acid molecules of interest (each under the control of a different promoter) from two different episomal molecules, or by means of operably linking the nucleic acid molecules to two promoter sequences resident on the same episomal molecule. In the first situation, the host is burdened with two episomal molecules, which may affect growth rate, while in the second, the two promoters may be induced by the same mechanism, leading to expression at similar levels of both nucleic acid molecules. If the promoters are induced by different mechanisms, cost of induction will be a consideration.
Thus, a need exists for conveniently and efficiently expressing one or more than one nucleic acid molecule in a single host organism. The object of the present invention is to address this need.
BRIEF DESCRIPTION OF DRAWINGS
Figure 1: shows cell density, glucose concentration and GFP fluorescence off. coli BW25113 transformed with plasmids pPROBE-NT and pNT-csgDp
Figure 2: shows GFP fluorescence of E. coli BW25113 transformed with plasmids pPROBE-NT, pNT-csgDp and pNT-csgBp
F igure 3: shows GFP and mCherry fluorescence of E. coli BW25113 transformed with plasmid pNT-GFP-mC

DESCRIPTION OF INVENTION
In the present invention, a 754 base pair (bp) DNA sequence from the Escherichia coli genome is used to conveniently, inexpensively and efficiently express nucleic acid molecule(s) of interest operably linked to the said DNA sequence. The nucleic acid sequence of the positive strand of the said 754 bp DNA sequence is given below:
SEQIDNo. 1:
GATGAAACCCCGCTTTTTTTATTGATCGCACACCTGACAGCTGCCTCTAAAATAGAAGCACCAGAAGTA CrGACAGATGTTGCACTGCTGTGTGTAGTAATAAATCAGCCCTAAATGGGTAAAATATAAAACTAATGG ATTACATCTGATTTCAATCTAGCCATTACAAATCTTAAATCAAGTGTTAAACATGTAACTAAATGTAAC TCGTTATATTAAAATGTTAACCTTAAGGTTTTATTAAGTTTAGAAATGATAGAAAAGTTGTACATTTGG T TTTTATTGCACAAT TTTAAAAAATCATACAAATGGTGATAACT TACTAATAATGCATATAAAAAATAT TTCGGTGTAGTCCTTTCGTCATGTAAAACGTTCTTGTTTTTTCTCCACACCTCCGTGGACAATTTTTTA CTGCAAAAAGACGAGGTTTGTCACGGCTTGTGCGCAAGACATATCGCAGCAATCAGCGACGGGCAAGAA GAATGACTGTCTGGTGCTTTTTGATAGCGGAAAACGGAGATTTAAAAGAAAACAAAATATTTTTTTGCG TAGATAACAGCGTATTTACGTGGGTTTTAATACTTTGGTATGAACTAAAAAAGAAAAATACAACGCGCG GGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTAACGCAGCGTTAACAAAATACAGGTT GCGTTAACAACCAAGTTGAAATGATTTAATTTCTTAAATGTACGACCAGGTCCAGGGTGACAAC
The said DNA sequence contains divergent promoter elements, one on each DNA strand. Shine-Dalgarno ribosomal binding sequence may be operably linked to either end of SEQ ID No. 1 for initiation of protein synthesis. An example of Shine-Dalgarno sequence is AGGAGG. DNA sequence coding for gene of interest can be operably linked to either end of the said DNA, allowing expression therefrom. In an embodiment of the present invention, the said sequence may be used to achieve expression of at least two genes that are operably linked to either ends of the said sequence.
Nucleic acid sequences that are at least 60% similar to SEQ ID No. 1, or which exhibit substantially similar functionality form a further aspect of the present invention. The construct may be contained in an episome, plasmid or a host cell. The host cell may be a bacterium, preferably from the Enterobacteriaceae family, more particularly E. coli.

The present invention also relates to a process of producing gene products using the expression system described herein. The present invention further includes gene products obtained by the process described herein,
In an embodiment of the invention, the expression system thus constructed may be used to express the gene of interest by transforming into E. coli or related bacterial species and cultivating the host cell under conditions that allow expression of the gene or genes of interest. The gene of interest may encode an RNA nucleic acid molecule that may or may not be translated into a protein. Preferably, the gene of interest encodes a protein.
Recombinant protein production using a promoter that is bidirectionally active is not reported in literature. In the present invention, a region of the E, coli genome is used that contains more than one promoter regions, and ribosomal binding sites are incorporated to facilitate translation of the nucleic acid molecule present downstream. This genetic construct can be used to express either one or more than one nucleic acid molecules that are operably linked to one or either ends of the genetic construct.
Expression of a gene of interest operably linked downstream of SEQ ID No. 1 is maximal at temperatures less than 30°C. In an embodiment of the invention, expression of a gene of interest operably linked downstream of SEQ ID No. 1 can be controlled by cultivating the host cell at temperatures above 30°C.
The present expression system can be used to achieve expression of the gene of interest in any E. coli or related bacterial strain, thus avoiding the constraint of using special or specific host strains.
This invention also includes a process for the production of a gene product such as a protein and like biomolecules which comprises the step of culturing a host cell having a nucleic acid construct under known culture condition for expressing the gene product which may be isolated and purified.

STATEMENT OF INVENTION
This invention relates to a nucleic acid construct for gene expression which comprises at least one nucleic acid molecule of Sequence ID No.l,
GATGAAACCCCGCTTTTTTTATTGATCGCACACCTGACAGCTGCCTCTAAAATAGAAGCACCAGAAGTA
CTGACAGATGTTGCACTGCTGTGTGTAGTAATAAATCAGCCCTAAATGGGTAAAATATAAAACTAATGG
ATTACATCTGATTTCAATCTAGCCATTACAAATCTTAAATCAAGTGTTAAACATGTAACTAAATGTAAC
TCGTTATATTAAAATGTTAACCTTAAGGTTTTATTAAGTTTAGAAATGATAGAAAAGTTGTACATTTGG TTTTTATTGCACAATTTTAAAAAATCATACAAATGGTGATAACTTACTAATAATGCATATAAAAAATAT
TTCGGTGTAGTCCTTTCGTCATGTAAAACGTTCTTGTTTTTTCTCCACACCTCCGTGGACAATTTTTTA CTGCAAAAAGACGAGGTTTGTCACGGCTTGTGCGCAAGACATATCGCAGCAATCAGCGACGGGCAAGAA GAATGACTGTCTGGTGCTTTTTGMAGCGGAAAACGGAGATTTAAAAGAAAACAAAATATTTTTTTGCG TAGATAACAGCGTATTTACGTGGGTTTTAATACTTTGGTATGAACTAAAAAAGAAAAATACAACGCGCG GGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTAACGCAGCGTTAACAAAATACAGGTT GCGTTAACAACCAAGTTGAAATGATTTAATTTCTTAAATGTACGACCAGGTCCAGGGTGACAAC
or a sequence having at least 60% similar thereto, operably linked to at least one Shine-Dalgarno ribosomal binding sequence.
For a better understanding of the present invention, reference is made to the following examples. These examples are merely meant to describe and illustrate embodiments of the present invention, and are not meant to limit the invention or its working in any manner whatsoever.
Examples
Materials and Methods
All media components used were supplied by Himedia (Mumbai). Restriction enzymes, Taq polymerase, T4 DNA ligase and other molecular biology reagents were purchased from Fermentas. Oligos for carrying out polymerase chain reaction (PCR) were obtained from Sigma. All standard molecular biology protocols used were as

detailed by Sambrook J and Russell DW in Molecular Cloning: A Laboratory Manual (CSHL Press, 2001).
Example 1
The negative strand of the 754 bp curli intergenic region was amplified by PCR from E. coli MG1655 genomic DNA using primers SR31 (5'-cgcggatccgcggttgtca ccctggacctgg; BamHl recognition sequence underlined) and SR32 (5'-ccggaattcc gggatgaaaccccgc; EcoRl recognition sequence underlined). The PCR conditions were as follows: initial denaturation for 10 minutes at 95°C; followed by 30 cycles each comprising of denaturation for 2 minutes at 95°C, annealing for 40 seconds at 60°C, and extension for 1 minute at 72°C; extension for 10 minutes at 72°C, and final hold at 4°C. The PCR product was digested with BamHl and EcoRl and cloned into the corresponding sites of plasmid pPROBE-NT (Miller WG, Leveau JHJ, Lindow SE. (2000) Improved gfp and inaZ broad-host-range promoter-probe vectors. Mol. Plant Microbe Interact 13, 1243-1250), which contains a promoterless gfp gene. The Hgated product (named pNT-csgDp) was transformed in calcium chloride-competent E. coli DH5a cells and verified by sequencing (Macrogen Inc., South Korea).
Example 2
E. coli DH5α cells containing pPROBE-NT (parent vector) and pNT-csgDp were inoculated in 5 ml Luria-Bertani (LB) medium containing 50 μg/μJ kanamycin. The cultures were incubated at 37°C for 18 hours on an orbital shaker (250 rpm). Absorbance at 600 nm and green fluorescent protein (GFP) fluorescence intensity (excitation at 490 nm; emission at 510 nm) were determined for both cultures,
Table 1: Cell density and GFP fluorescence of E. coli DH5ct transformed with
plasmids pPROBE-NT and pNT-csgDp
DH5α/pPROBE-NT DH5α/pNT-csgDp
OD600 2.875 2.505
GFP (ref.fluores.) 230.496 2941.125

Example 3
E. coli BW25113 cells transformed with pPROBE-NT (parent vector) and pNT-csgDp were inoculated in 5 ml M9 medium (6 g Na2HPO4, 3 g KH2PO4, 1 g NH4C1, 0.5 g NaCl, 246.5 mg MgS04.7H20, 14.7 mg CaCI2, 1 mg thiamine per litre) supplemented with 1% glucose containing 50 μg/μl kanamycin. The cultures were incubated at 37°C for 18 hours on an orbital shaker (250 rpm). Cells from both cultures were then resuspended in 50 ml M9 medium supplemented with 0.2% glucose containing 50 μg/μ1 kanamycin, and incubated at 37°C on an orbital shaker (250 rpm). Aliquots were withdrawn at regular time intervals, and absorbance at 600 nm and GFP fluorescence intensity (excitation at 490 nm; emission at 510 nm) were determined.
Example 4
The positive strand of the 754 bp curli intergenic region was amplified by PCR from E. coli MG1655 genomic DNA using primers SR33 (5'-cgcggatccgcggatgaaaccccgc; BamH1 recognition sequence underlined) and SR34 (5'-ccggaattccgggttgtcaccctggac; EcoRl recognition sequence underlined). The PCR conditions were as follows: initial denaturation for 10 minutes at 95°C; followed by 30 cycles each comprising of denaturation for 2 minutes at 95°C, annealing for 40 seconds at 60°C, and extension for 1 minute at 72°C; extension for 10 minutes at 72°C, and final hold at 4°C. The PCR product was digested with BamHl and EcoRl and cloned into the corresponding sites of plasmid pPROBE-NT. The ligated product (named pNT-csgBp) was transformed in calcium chloride-competent E. coli DH5a cells.
Example 5
E. coli BW25113 cells transformed with pPROBE-NT (parent vector), pNT-csgDp and pNT-csgBp were inoculated in 3 ml CFA medium (10 g casamino acids, 1 g yeast extract, 50 mg MgS04, 5 mg of MnCl2 per litre, pH 7.4) (Evans DG, Evans Jr DJ, Tjoa W. (1977) Hemagglutination of human group A erythrocytes by enterotoxigenic

Escherichia coli isolated from adults with diarrhea: correlation with colonization factor. Infect Immun 18, 330-337) containing 50 μg/μl kanamycin. The cultures were incubated at 26°C for 18 hours on an orbital shaker (100 rpm). 0.3 ml from these cultures were then inoculated in30mlC FA medium containing 50 μg/μ1 kanamycin, and incubated at 26°C on an orbital shaker (100 rpm). Aliquots were withdrawn at regular time intervals, and absorbance at 600 nm and GFP fluorescence intensity (excitation at 490 nm; emission at 510 nm) were determined.
Example 6
The mCherry gene was amplified by PCR from plasmid pAW8-mCherry (Watson AT, Garcia V, Bone N, Carr AM, Armstrong J (2008) Gene tagging and gene replacement using recombinase-mediated cassette exchange in Schizosaccharomyces pombe. Gene 407, 63-74) using primers SR41a (5'-cgcggatccgcgaggaggaaaaacatat ggtgagcaagggcgagg; BamHl recognition sequence underlined; ribosomal binding site incorporated) and SR42 (5'-cccaagcttgggttacttgtacagctcgtcc; Hindlll recognition sequence underlined). The PCR conditions were as follows: initial denaturation for 10 minutes at 95e,C; followed by 30 cycles each comprising of denaturation for 2 minutes at 95°C, annealing for 40 seconds at 60°C, and extension for 1 minute at 72°C; extension for 10 minutes at 72°C, and final hold at 4°C. The PCR product was digested with BamHl and Hindlll and cloned into the corresponding sites of plasmid pPROBE-csgDp. The ligated product (named pNT-GFP-mC) was transformed in calcium chloride-competent E coli DH5a cells.
Example 7
E. coli BW25113 cells transformed with pNT-GFP-mC were inoculated in 3 ml CFA medium containing 50 μg/μ1 kanamycin, and incubated at 26°C for 18 hours on an orbital shaker (100 rpm). 0.3 ml from this culture was then inoculated in 30 ml CFA medium containing 50 μg/μ1 kanamycin, and incubated at 26°C on an orbital shaker (100 rpm). Aliquots were withdrawn at regular time intervals, and absorbance at 600

nm and fluorescence intensities (excitation at 490 nm and emission at 510 nm for GFP; excitation at 587 nm and emission at 610 nm for mCherry) were determined.
Variations of the embodiments illustrated and other features and advantages of the present invention will be evident to a person of ordinary skill, and are within the scope and ambit of the claims appended herein below.

WE CLAIM
1) A nucleic acid construct for gene expression comprising at least one nucleic acid
molecule of Sequence ID No. 1,
GATGAAACCCCGCTTTTTTTATTGATCGCACACCTGACAGCTGCCTCTAAAATAGAAGCACCAGAAGTA CTGACAGATGTTGCACTGCTGTGTGTAGTAATAAATCAGCCCTAAATGGGTAAAATATAAAACTAATGG ATTACATCTGATTTCAATCTAGCCATTACAAATCTTAAATCAAGTGTTAAACATGTAACTAAATGTAAC TCGTTATATTAAAATGTTAACCTTAAGGTTTTATTAAGTTTAGAAATGATAGAAAAGTTGTACATTTGG TTTTTATTGCACAATTTTAAAAAATCATACAAATGGTGATAACTTACTAATAATGCATATAAAAAATAT TTCGGTGTAGTCCTTTCGTCATGTAAAACGTTCTTGTTTTTTCTCCACACCTCCGTGGACAATTTTTTA CTGCAAAAAGACGAGGTTTGTCACGGCTTGTGCGCAAGACATATCGCAGCAATCAGCGACGGGCAAGAA GAATGACTGTCTGGTGCTTTTTGATAGCGGAAAACGGAGATTTAAAAGAAAACAAAATATTTTTTTGCG TAGATAACAGCGTATTTACGTGGGTTTTAATACTTTGGTATGAACTAAAAAAGAAAAATACAACGCGCG GGTGAGTTATTAAAAATATTTCCGCAGACATACTTTCCATCGTAACGCAGCGTTAACAAAATACAGGTT GCGTTAACAACCAAGTTGAAATGATTTAATTTCTTAAATGTACGACCAGGTCCAGGGTGACAAC
or a sequence having at least 60% similar thereto, operably linked to at least one Shine-Dalgarno ribosomal binding sequence.
2) The nucleic acid construct as claimed in claim J, having at least one nucleic acid molecule of interest operably linked to either ends thereof.
3) The nucleic acid construct as claimed in claim 1, having more than one nucleic acid molecules of interest operably linked to either ends thereof.
4) The nucleic acid construct as claimed in claims 2 and 3, wherein said nucleic acid molecules of interest code for a protein.
5) The nucleic acid construct as claimed in claims 1 to 4, wherein said nucleic acid construct is contained in an episome, plasmid or a chromosome in a host cell.
6) A host cell containing the nucleic acid construct as claimed in claims 1 to 4.

7) The host cell as claimed in claim 6, wherein said host cell is a bacterium.
8) The host cell as claimed in claim 7, wherein said bacterium is from Enterobacteriaceae.
9) The host cell as claimed in claim 7, wherein said bacterium is Escherichia coli.
10) The host cell as claimed in claim 9, wherein said bacterium is Escherichia coli DH5a orBW25113.
11) A process for the production of gene products such as protein and like biomolecules comprising the step of culturing a host cell of claims 6 to 10 for expressing said products.
12) The process as claimed in claim 11, wherein said gene products are purified.
13) Gene products obtained by a process as claimed in claim 11.
14) Gene products obtained by a process comprising use of the nucleic acid construct as claimed in claims 1 to 4.
15) A nucleic acid construct for gene expression substantially as described herein.

Documents:

http://ipindiaonline.gov.in/patentsearch/GrantedSearch/viewdoc.aspx?id=Y1vyw/YfMhmd+kWsCgW1Fg==&loc=vsnutRQWHdTHa1EUofPtPQ==

« Previous Patent

Next Patent »

Patent Number

272788

Indian Patent Application Number

1426/MUM/2011

PG Journal Number

18/2016

Publication Date

29-Apr-2016

Grant Date

27-Apr-2016

Date of Filing

09-May-2011

Name of Patentee

INDIAN INSTITUTE OF TECHNOLOGY, BOMBAY.

Applicant Address

BIOSCIENCES AND BIOENGINEERING, POWAI,, MUMBAI-400076. MAHARASHTRA.INDIA;INDIAN

Inventors:

#	Inventor's Name	Inventor's Address
1	PROF. SANTOSH B.	NORONHA OF INDIAN INSTITUTE OF TECHNOLOGY,BOMBAY, DEPARTMENT OF CHEMICAL ENGINEERING, POWAI, MUMBAI 400 076 MAHARASHTRA.INDIA;INDIAN,
2	SHAMLAN M.S. RESHAMWALA	INDIAN INSTITUTE OF TECHNOLOGY, BOMBAY, DEPARTMENT OF BIOSCIENCES AND BIOENGINEERING,POWAI, MUMBAI-400 076. MAHARASHTRA.INDIA;INDIAN

PCT International Classification Number

C12N 15/00

PCT International Application Number

N/A

PCT International Filing date

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1			NA