Title of Invention	"EXPRESSION VECTOR FOR ENCODING THE CLASS I VIRAL FUSION PROTEIN GENE AND AS DNA VACCINE CANDIDATE
Abstract	The present invention relates to an expression vector for cloning the Class I viral fusion protein gene and as DNA vaccine candidate against virus infection diseases.

Full Text

AN EXPRESSION VECTOR ENCODING CORONAVIRUS-LIKE PARTICLE Field of the Invention [0001] The invention relates to the field of recombinant DNA technology, more in particular to the field of DNA vaccine. In particular the invention relates to a new expression vector encoding a virus-like particle for cloning the Class I viral fusion protein gene and as DNA vaccine candidate. Background of the Invention [0002] Vaccination has played a key role in the control of viral diseases during the past 30 years. Vaccination is based on a simple principle of immunity: once exposed to an infectious agent, an animal mounts an immune defense that protects against infection by the same agent. The goal of vaccination is to induce the animal to mount the defense prior to infection. Conventionally, this has been accomplished through the use of live attenuated or killed forms of the virus as immunogens. The success of these approaches in the past has been due in part to the presentation of native antigen and the ability of attenuated virus to elicit the complete range of immune responses obtained in natural infection. However, conventional vaccine methodologies have always been subject to a number of potential limitations. Attenuated strains can mutate to become more virulent or non-immunogenic; improperly inactivated vaccines may cause the disease that they are designed to prevent. [0003] Recombinant DNA technology offers the potential for eliminating some of the limitations of conventional vaccines, by making possible the development of vaccines based on the use of defined antigens, rather than the intact infectious agent, as immuriogens. These include peptide vaccines, consisting of chemically synthesized, immunoreactive epitopes; subunit vaccines, produced by expression of viral proteins in recombinant heterologous cells; and the use of live viral vectors for the presentation of one or a number of defined antigens. Both peptide and subunit vaccines are subject to a number of potential limitations. A major problem is the difficulty of ensuring that the conformation of the engineered proteins mimics that of the antigens in their natural environment. Suitable adjuvants and, in the case of peptides, carrier proteins, must be used to boost the immune response. In addition, these vaccines elicit primarily humoral responses, and thus may fail to evoke effective immunity. [0004] Many different methods have been developed to introduce new genetic information into target cells. Currently, the most efficient means of introducing DNA into target cells is by employing modified viruses, so-called recombinant viral vectors. The most frequently used viral vector systems are based on retroviruses, adenoviruses, herpes viruses or the adeno-associated viruses (AAV). All systems have their specific advantages and disadvantages. Some of the vector systems possess the capacity to integrate their DNA into the host cell genome, whereas others do not. From some vector systems the viral genes can be completely removed from the vector while in other systems this is not yet possible. Some vector systems have very good in vivo delivery properties, while others do not. Some vector types are very easy to produce in large amounts, while others are very difficult to produce. [0005] Coronaviruses carry three or four proteins in their envelopes. The M protein is the most abundant component. The small E protein is a minor but essential viral component. The importance of the S protein in pathogenesis is consistent with its biologic function in both viral entry and viral spread (Collins, A. R. , et al. , 1982, Virology 119:358-371; Williams, R. K. , et al., 1991, Proc. Natl. Acad. Sci. USA 88:5533-5536). When expressed on the virion envelope, S protein binds to the cellular receptor and induces the fusion of viral and cell membranes during viral entry. Subsequent to infection, S protein expressed on the plasma membrane of infected cells induces cell cell fusion. S protein also plays a role in the immune response to viral infection, as a target for neutralizing antibodies (Collins, A. R., et al. , 1982, Virology 119:358-371) and as an inducer of a cell-mediated immunity (Bergmann, C. C., et al., 1996, J. Gen. Virol. 77:315-325; Castro, R. P., and S. Perlman, 1995, J. Virol. 69:8127-8131) . The M and E proteins are the minimum protein units for virus assembly (Baudoux, P., et al., 1998, J. Virol. 72:8636-8643; Bos, E. C., 1996, Virology 218:52-60; de Haan, C. A. M., et al. , 1998, J. Virol. 72:6838-6850; Godeke, G.-J., et al., 2000, J. Virol. 74:1566-1571; Vennema, H., et al. , 1996, EMBO J. 15:2020-2028). Both are integral membrane proteins. The expression of M and E proteins together is sufficient to trigger the formation of virus-like particles (VLP). When S protein is coexpressed with M and E proteins, the S protein is incorporated into VLP with presumably authentic conformation. This has now been demonstrated for mouse hepatitis virus (MHV) (Bos, E. C., 1996, Virology 218:52-60; de Haan, C. A. M., et al., 1998, J. Virol. 72:6838-6850; Vennema, H., et al. , 1996, EMBO J. 15:2020-2028), transmissible gastroenteritis virus (Bauaoux, F. , et al. , 1998, J. Virol. 72:8636-8643), and feline infectious peritonitis virus (Godeke, G.-J., et al. , 2000, J. Virol. 74:1566-1571). There is a hypothesis that the coronavirus membrane basically consists of a dense; matrix of laterally interacting M proteins, which in some way requires the E protein for budding and in which the S and HE glycoproteins are incorporated, if available, by specific interactions with M via carboxyl terminal and the transmembrane region of Spike (de Haan, C. A. M., 1999, J. Virol. 73:7441-7452; Nguyen, V.-P., and B. G. Hogue. 1997, J. Virol. 71:9278-9284; Opstelten, D.-J. E., et al., 1995, J. Cell Biol. 131:339-349; Vennema, H., et al., 1996, EMBO J. 15:2020-2028) . Such Spike-containing VLP can infect cells with the same infectivity like authentic virus (Bos, E. C., 1996, Virology 218:52-60) . However, no effective DNA vectors are developed for use as DMA vaccine. [0006] Therefore, there is a need to develop an effective DNA vector encoding virus-like particles that can present functional viral fusion protein in the surface of VLPs and these VLPs will be an excellent candidate as a potential vaccine against virus infection diseases. Summary Of the Invention [0007] The present invention relates to an expression vector for cloning the Class I viral fusion protein gene and as DNA vaccine candidate, the expression vector comprising: i) a first transcription unit comprising a membrane protein gene (M protein gene) of Coronavirus, an envelope protein gene (E protein gene) of Coronavirus and an internal ribosome entry sites (IRES) sequence, wherein the IRES is inserted into the junction of the membrane protein gene and the envelop protein gene; ii) a first eukaryotic promoter operably linked to the membrane protein gene wherein the first promoter is located upstream of the M protein gene and drives the expression of the first transcription unit; iii) a second transcription unit comprising a SpikeCT gene of Coronavirus and a multiple cloning site (MCS) for cloning or in-framed insertion of Class I viral fusion protein gene, wherein the MCS is located at the beginning of SpikeCT gene and has restriction enzymes cutting sites; and iv) a second eukaryotic promoter operably linked to the SpikeCT gene wherein the second promoter is located upstream of the SpikeCT gene and drives the expression of the second transcription unit; wherein the transcription activity of the first eukaryotic promoter is stronger than the second eukaryotic promoter. Brief Description of the Drawing [0008] Figure 1 shows the plasmid map of one preferred embodiment of the expression vector of the invention. Detailed Description of the Invention [0009] Genes encoding viral polypeptides capable of self assembly into defective, non-self propagating viral particles can be obtained from the genomic DNA of a DNA virus or the genomic cDNA of an RNA virus or from available subgenomic clones containing the genes. These genes will include those encoding viral capsid proteins (i.e., proteins that comprise the viral protein shell) and, in the case of enveloped viruses, such as retroviruses, the genes encoding viral envelope glycoproteins. The virus-like particles may be isolated and used themselves as immunogens for vaccination against pathogenic viruses, or for therapeutic purposes, such as enhancing immune responses in an infected individual, or for targeted delivery of therapeutic agents, such as cytotoxic drugs, to specific cell types. [0010] The present invention provides an expression vector for cloning the Class I viral fusion protein gene and as DNA vaccine candidate, the expression vector comprising: i) a first transcription unit comprising a membrane protein gene (M protein gene) of Coronavirus, an envelope protein gene (E protein gene) of Coronavirus and an internal ribosome entry sites (IRES) sequence, wherein the IRES is inserted into the junction of the membrane protein gene and the envelop protein gene; ii) a first eukaryotic promoter operably linked to the membrane protein gene wherein the first promoter is located upstream of the M protein gene and drives the expression of the first transcription unit; iii) a second transcription unit comprising a SpikeCT gene of Coronavirus and a multiple cloning site (MCS) for cloning or in-framed insertion of Class I viral fusion protein gene, wherein the MCS is located at the beginning of SpikeCT gene and has restriction enzymes cutting sites; and iv) a second eukaryotic promoter operably linked to the SpikeCT gene wherein the second promoter is located upstream of the SpikeCT gene and drives the expression of the second transcription unit; wherein the transcription activity of the first eukaryotic promoter is stronger than the second eukaryotic promoter. [0011] According to the invention, the expression vector comprises a first transcription unit comprising a membrane protein gene (M protein gene) of Coronavirus, an envelope protein gene (E protein gene) of Coronavirus and an internal ribosome entry sites (IRES) sequence, wherein the IRES is inserted into the junction of the membrane protein gene and the envelop protein gene. [0012] According to the invention, the envelope protein gene of the invention encodes envelope protein (E protein) of Coronavirus. The E protein is a small, envelope-associated protein. The E protein is a minor but essential viral component. In cells, it accumulates in and induces the coalescence of the membranes of the intermediate compartment (1C), giving rise to typical structures. A fraction of the proteins appear extracellularly in membranous structures of unknown identity. Preferably, the coronvirus of the invention is pig, human or avian Coronavirus. More preferably, the coronavirus is pigTGEV coronavirus, human 229E coronavirus or human SARS virus. More preferably, the E protein gene of the invention has the sequence as set forth in SEQ ID NO:I. The coding sequence of SARS E gene (SEQ ID NO:1) ATGGCATACT CTTTTGTGTC TGAGGAAACT GGCACTCTGA TCGTGAACTC TGTACTGCTG TTTCTCGCTT TTGTGGTATT CCTGCTGGTC ACTCTCGCTA TCCTCACTGC TCTTCGTCTG TGTGCCTACT GTTGTAATAT CGTGAACGTG TCTCTGGTTA AGCCTACTGT GTATGTGTAT TCTCGTGTGA AAAATCTCAA TTCTTCTGAA GGAGTTCCCG ATCTGCTGGT CTAG [0013] According to the invention, the membrane protein gene of the invention encodes membrane protein (M protein) of Coronavirus. The M protein is the most abundant component; it is a type III glycoprotein consisting of a short amino-terminal ectodomain, three successive transmembrane domains, and a long carboxy-terminal domain on the inside of the virion (or in the cytoplasm). Preferably, the coronvirus of the invention is pig, human or avian coronvirus. More preferably, the coronavirus is pig TGEV coronavirus, human 229E coronavirus or human SARS virus. More preferably, the M protein gene of the invention has the sequence as set forth in SEQ ID NO:2. The coding sequence of SARS M gene (SEQ ID NO:2) ATGGCAGATA ACGGCACTAT TACTGTGGAG GAACTGAAAC AACTGCTGGA ACAATGGAAC CTCGTAATCG GCTTTCTCTT TCTGGCTTGG ATTATGTTGT TACAGTTTGC GTATTCTAAT CGTAACCGTT TCCTCTACAT TATTAAGCTC GTTTTCCTGT GGTTGTTGTG GCCTGTAACT CTTGCTTGCT TTGTGCTTGC TGCTGTCTAT CGTATCAACT GGGTTACTGG TGGTATTGCT ATCGCTATGG CTTGTATTGT AGGCTTGATG TGGCTGTCTT ATTTCGTTGC TTCTTTCCGT CTGTTTGCTC GTACTCGCTC TATGTGGTCC TTTAATCCTG AGACTAATAT CCTGCTGAAT GTTCCGCTCC GTGGTACTAT CGTTACTAGA CCGCTGATGG AATCTGAACT GGTTATTGGT GCCGTCATTA TCCGTGGTCA TTTGCGTATG GCTGGTCACT CTCTGGGTCG TTGCGATATT AAGGATCTGC CAAAGGAAAT CACTGTAGCC ACTTCTCGTA CTCTGTCTTA CTATAAACTC GGTGCATCGC AACGTGTGGG AACTGATTCG GGCTTCGCTG CGTATAATCG TTATCGTATT GGCAACTATA AACTGAACAC CGACCACGCA GGCTCTAATG ACAACATCGC TCTCCTCGTT CAGTGA [0014] According to the invention, for assembly of the coronavirus envelope, only the M protein and the E protein are needed (Cornells A. M. de Haan et al. , Journal of Virology, June 2000, p. 4967-4978). Expression in cells of the genes coding for these proteins leads to the formation and release of viruslike particles (VLPs) similar in size and shape to authentic virions. [0015] According to the invention, the first transcription unit comprises an internal ribosome entry sites (IRES) sequence that is inserted into the junction of M gene and E gene. The IRES allows the translation of two or more proteins from a di- or polycistronic mRNA. The IRES units are fused to 5' ends of one or more additional coding sequences which are then inserted into the vectors at the end of the original coding sequence, so that the coding sequences are separated from one another by IRES. According to the invention, any IRES derivatives also can be used in the plasmid construct of the invention. The IRES sequence allows the ribosomal machinery to initiate translation from a secondary site, within a single transcript. [0016] According to the invention, the expression vector of the invention comprises a first eukaryotic promoter operably linked to the membrane protein gene wherein the first promoter is located upstream of the M protein gene and drives the expression of the first transcription unit. Preferably, the first eukaryotic promoter is viral derived promoter like CMV, SV40, RSV, HIV-1 LTR and the hybrid Beta-actin/CMV promoter enhancer and muscle-specific desmin, creatine kinase, beta-Actin promoter and other ubiquitous expression promoter like EFlalpha , Ubiquitin promoter. The most preferably, the first eukaryotic promoter is pCMV, Hybrid Beta-actin/CMV promoter enhancer, beta-Actin promoter. [0017] According to the invention, a second transcription unit comprises a SpikeCT gene and a multiple cloning site (MCS) having restriction enzymes cutting sites, wherein the MCS is located at the beginning of SpikeCT gene. The SpikeCT gene interacts with the M protein interaction domain, which encodes C-terminal heptad repeat located upstream of an aromatic residue-rich region juxtaposed to the trarismembrane segment of Spike protein of coronavirus. The multiple cloning site (MCS) has several restriction enzymes cutting sites. The restriction enzyme cutting site includes, but not limited to, Smal, BsaB 1, EcoR V and BspE I. The MCS is located at the beginning of SpikeCT gene and can be used for cloning or in-framed insertion of Class I viral fusion protein gene. The Class I viral fusion protein gene includes, but not limited to, gpl6O of HIV, HA of influenza virus and Spike of SARS virus. The Class I viral fusion protein gene is derived form the viruses that adapt Class I viral fusion mechanism comprises coronavirus , HIV, and influenza virus, into cloning expression vector of the invention and then used as DNA vaccine candidate. Preferably, the SpikeCT gene having the sequence as set forth in SED ID No:3. The coding sequence of SpikeCT gene (SEQ ID NO:3) GATATCTCCGGA ATCAATGCGA GCGTAGTGAA CATCCAGAAA GAGATTGACC GTTTGAATGA AGTTGCTAAA AATCTGAATG AACCTCTGAT TGACCTCCAA GAACTCGGCA AATATGAGCA ATACATTAAA TGGCCTTGGT ATGTCTGGTT GGGTTTCATC GCAGGTCTCA TCGCTATCGT TATGGTGACT ATTCTGCTGT GTTGTATGAC TTCTTGTTGC TCTTGTCTGA AAGGTGCGTG TTCTTGTGGT TCTTGTTGTA AGTTTGATGA GGATGATTCT GAGCCAGTTC TGAAGGGTGT GAAGCTGCAT TATACCTAGT TCGAA [0018] According to the invention, the expression vector of the invention can produce a virus-like particle and express the functional fusion gene of the Class I viruses on the surface of virus-like particle. Thus, there are several restriction enzymes cutting sites (multiple cloning site ,MCS) including, but not limiting to, Smal, BsaB I, EcoR V, BspE I located at the beginning of "SpikeCT" gene and these sites can be used for insertion or cloning Class I viral fusion protein gene into the cloning /expression vector of the invention and then used as DNA vaccine candidate. The viruses that adapt Class I viral fusion mechanism includes, but not limited to, coronavirus, HIV, influenza virus, and so on. [0019] According to the invention, the second promoter is located upstream of the SpikeCT gene and drives the expression of the second transcription unit. Preferably, the second eukaryotic promoter is viral derived promoter like CMV, SV40, RSV, HIV-1 LTR and the hybrid Beta-actin/CMV promoter enhancer and muscle-specific desmin, creatine kinase, beta-Actin promoter and other ubiquitous orcontitutive expression promoter like EFlalpha, Ubiquitin promoter. The most preferably, the second eukaryotic promoter is pCMV, SV40, beta-Actin and EFlalpha promoter. [0020] According to the invention, the transcription units of the invention comprise a polyA sigal. Persons skilled in the art can recognize that any transcription has the polyA signal. Preferably, the transcription units of the invention comprises BGH polyA signal. [0021] According to the invention, the expression vector further comprises a replication origin for the propagation plasmid in a host cell. The determination of the replication origin depends on the types of the host cells. [0022] According to the invention, the expression vector of the invention further comprises an antibiotics-resistant gene as the selection marker. [0023] According to the invention, the expression vector of the invention can spontaneously form virus-like particles. The virus-like particles can be used as vaccine candidate against virus infection. The virus-like particle lacks the genetic materials of the virus. Therefore, such particles do not have infectious ability. The expression vector of the invention can be administrated to animals and transfected with host cells to produce the virus-like particles. [0024] Most viruses consist of few proteins only with structural restrictions impinged on them. In fact, using these few proteins, viruses are forced to generate a quasi-crystalline, highly repetitive surface. Such highly repetitive antigens efficiently cross-link B cell receptors, a process which generates strong activation signal in B cells. In contrast, self-antigens are usually not highly organized, in particular not those accessible to B cells. Thus, B cells use antigen organization as a marker for infectious non-self. Vaccines based on virus like particles (VLPs) exploit this basic phenomenon, since VLPs exhibit surfaces as repetitive and organized as those of viruses. Consequently, similar to viruses, VLPs are able to trigger strong B cell responses in the absence of adjuvants. Based on the above principle, the virus-like particles produced through the expression of the expression vector of the invention in the cells can be used as a vaccine candidate against virus diseases. EXAMPLE E gene synthesized by PCR [0025] The polymerase chain reaction (PCR) was used to synthesize the E gene of SARS virus. The PCR template (0.1 pmole) of SARS E gene is the mixture of primers that listed below and PCR reaction was performed using the standard PCR method described by Innis et al. (PCR protocols. A guide to methods and applications, 1990, Academic Press) using KOD Taq polymerase (Novagene.com). The PCR primers are shown below: 5'-ACC ATG GCA TAC TCT TTT GTG TCT GAG GAA ACT G-31* (SEQ ID NO: 4) E1L 5 ' -ACA GCA GTA CAG ACT TCA CGA TCA GAG TGC CAG TTT CCT CAG ACA CAA AAG-3' (SEQ ID NO: 5) E2L 5'-TGA CCA GCA GGA ATA CCA CAA AAG CGA GAA ACA GCA GTA CAG AGT TCA CGA-3' (SEQ ID NO: 6) E3L 5 ' -GCA CAC AGA CGA AGA GCA GTG AGG ATA GCG AGA GTG ACC AGC AGG AAT ACC ACA-3' (SEQ ID NO: 7) E4L 5 ' -ACC AGA GAC ACG TTC ACG ATA TTA CAA CAG TAG GCA CAC AGA CGA AGA GCA G-3' (SEQ ID NO: 8) E5L 5 ' -GAT TTT TCA CAC GAG AAT ACA CAT ACA CAG TAG GCT TAA CCA GAG ACA CGT TCA CGA T-31* (SEQ ID NO: 9) E6L 5'-TCT AGA CCA GCA GAT CGG GAA CTC CTT CAG AAG AAT TGA GAT TTT TCA CAC GAG AAT ACA CA-3' (SEQ ID NO: 10) E7L 5'-TCT AGA CCA GCA GAT CGG GA-3' (SEQ ID NO: 11) [0026] The DNA template is initial denaturized at: 95D for 3 minutes. The PCR conditions are listed as follow: First_PCR reaction with IQcycles of 3 steps 1.Annealing: 58D for 20 seconds 2.Extension: 72D for 40 seconds 3.Denaturation: 95D for 1 minutes §*=condJ!?CR.jceac^tion with 20 cycles of 3 steps 1.Denaturation: 95D for 1 minutes 2.Annealing: 62D for 20 seconds 3.Extension: 72D for 40 seconds [0027] The resultant double-stranded full-length of E gene products were analyzed on 1.2% agarose gel and purified with QIAquick PCR purification kit (Qiagen Inc.) and then ligated with pGEM-T vector (Promega Co.) to obtain pGEM(T)/EA+ clones. The sequence of E gene is as set forth in SEQ ID NO: 1. M gene synthesized by splicing-over PCR [0028] The synthesis of M gene of SARS virus was similar to the PCR method as mentioned in the above and the PCR template (0.1 pmole) of SARS M gene is the mixture of primers that listed below by using KOD Taq polymerase (Novagene.com) are as follows: The PCR primers are listed as follows: M1-1U 5'-TGA TCA TGG CAG ATA ACG GCA C-3 ' (SEQ ID NO: 12) M1U 5'-TGA TCA TGG CAG ATA ACG GCA CTA TTA CTG TGG AGG A-3' (SEQ ID NO: 13) MIL 5'-GTT CCA TTG TTC CAG CAG TTG TTT CAG TTC CTC CAC AGT AAT ACT GCC G-3' (SEQ ID NO: 14) M2L 5'-AAG CCA GAA AGA GAA AGC CGA TTA CGA GGT TCC ATT GTT CCA GCA GTT G-31 (SEQ ID NO: 15) M3L 5'-AGA ATA CGC AAA CTG TAA CAA CAT AAT CCA AGC CAG AAA GAG AAA GCC GA-3' (SEQ ID NO: 16) M4L 5'-CGA GCT TAA TAA TGT AGA GGA AAC GGT TAG GAT TAG AAT ACG CAA ACT GTA ACA ACA-3' (SEQ ID NO: 17) M5L 5'-CAA GAG TTA CAG GCC ACA ACA ACC ACA GGA AAA CGA GCT TAA TAA TGT AGA GGA AA-3' (SEQ ID NO: 18) M6L 5'-TTG ATA CGA TAG ACA GCA GCA AGC ACA AAG CAA GCA AGA GTT ACA GGC CAC AAC A-3' (SEQ ID NO: 19) M7L 5'-CAA GCC ATA GCG ATA GCA ATA CCA CCA GTA ACC CAG TTG ATA CGA TAG ACA GCA GCA A-3' (SEQ ID NO: 20) M8L 5'-AAC GAA ATA AGA CAG CCA CAT CAA GCC TAG AAT ACA AGC CAT AGC GAT AGC AAT AC-3' (SEQ ID NO: 21) M9L 5'-ACA TAG AGC GAG TAG GAG CAA ACA GAG GGA AAG AAG CAA CGA AAT AAG ACA GCC ACA TC-31 (SEQ ID NO: 22! M10U 5'-TCC TGC TGA ATG TTC CGC TC-31 (SEQ ID NO: 23) M10L 5'-GAG CGG AAC ATT CAG CAG GAT ATT AGT CTC AGG ATT AAA GGA CCA CAT AGA GCG ACT ACG AGC AA-31 (SEQ ID NO: 24) 5 ' - CAT CAG CGG TCT ACT AAC GAT ACT ACC ACG GAG CGG AAC ATT CAG CAG GA-31 (SEQ ID NO : 25) M12L 5 ' -ACC ACG GAT AAT GAC GGC ACC AAT AAC CAG TTC AGA TTC CAT CAG CGG TCT AGT AAC GAT- 3 ' (SEQ ID NO : 26) M13L 5 ' -ATA CGC AAA TGA CCA CGG ATA ATG ACG GCA C-3 ' (SEQ ID NO : 27) M14L 5 ' -AAC GAC CCA GAG AGT GAC CAG CCA TAG GCA AAT GAC CAC GGA TAA-31 (SEQ ID NO: 28) M15L 5 ' - TAC AGT GAT TTC CTT TGG CAG ATC CTT AAT ATC GCA ACG ACC CAG AGA GTG-3' (SEQ ID NO: 29) M16L 5'-CCG AGT TTA TAG TAA GAC AGA GTA CGA GAA GTG GCT ACA GTG ATT TCC TTT GGC AGA- 3 ' (SEQ ID NO: 30) M17L 5 ' - CGA AGC CCG AAT CAG TTC CCA CAC GTT GCG ATG CAC CGA GTT TAT AGT AAG ACA GAG T-31 (SEQ ID NO: 31) M18L 5 ' - CAG TTT ATA GTT GCC AAT ACG ATA ACG ATT ATA CGC AGC GAA GCC CGA ATC AGT TCC C-31 (SEQ ID NO: 32) M19L5'-GAG AGC GAT GTT GTC ATT AGA GCC TGC GTG GTC GGT GTT CAG TTT ATA GTT GCC AAT ACG AT- 3' (SEQ ID NO : 33) M20L 5'-TCA CTG AAC GAG GAG AGC GAT GTT GTC ATT AGA G-3 ' (SEQ ID NO: 34) [0029] The PCR conditions are essentially as mentioned above. The resultant double -stranded full-length of M gene products were analyzed on 1.0% agarose gel and purified with QIAquick PCR purification or gel extraction kit (Qiagen Inc.) and then ligated with pGEM-T vector (Promega Co.) to obtain pGEM(T)/M clones. The sequence of M gene is of as set forth in SEQ ID NO: 2. [0030] The "SpikeCT" gene Encoding a heptad region 2 and transmembrane domain of Spike Protein Gene of SARS Virus Synthesized by PCR. [0031] The PCR method and condition, purification and cloning of the PCR products are as mentioned above. The DNA template (O.lpmole) of SpikeCT gene is the mixture of primers listed below: The PCR primers are listed as follows: Spiked up-EcoRV 5'-GAT ATC TCC GGA ATC AAT GCG AGC GT-3' (SEQ ID NO: 35) DI-lU/BspEI S'-S'-TCC GGA ATC AAT GCG AGC GTA GTG AAC ATC CAG AA-3' (SEQ ID NO: 36) DI-1L 5'-GCA ACT TCA TTC AAA CGG TCA ATC TCT TTC TGG ATG TTC ACT ACG CTC-3' (SEQ ID NO: 37) DI-2L 5'-ATC AGA GAT TCA TTC AGA TTT TTA GCA ACT TCA TTC AAA CGG TCA-3' (SEQ ID NO: 38) DI-3I. 5'-TCA TAT TTG CCG ACT TCT TGG AGG TCA ATC AGA GAT TCA TTC AGA TTT TTA-3' (SEQ ID NO: 39) DI-4L. 5'-CAA GGC CAT TTA ATG TAT TGC TCA TAT TTG CCG ACT TCT TGG A-3' (SEQ ID NO: 40) DI-5L .V-ACC TGC GAT GAA ACC CAA CCA GAC ATA CCA AGG CCA TTT AAT GTA TTG CT-3' (SEQ II) NO: 41) Dl-61 5'-CAG AAT ACT CAC CAT AAC GAT AGC GAT GAG ACC TGC GAT GAA ACC CAA CC-3' (SEQ ID NO: 42) DI-7L S-(AGA GCA ACA AGA AGT CAT ACA ACA CAG CAG AAT AGT CAC CAT AAC GAT AG-3' (SEQ ID NO: 43) DI-8L 5'-ACC ACA AGA ACA CGC ACC TTT CAG ACA AGA GCA ACA AGA AGT CAT ACA AC-3' (SEQ ID NO: 44) D1-9L 5'-GAA TCA TCC TCA TCA AAC TTA CAA CAA GAA CCA CAA GAA CAC GCA CCT TT-3' (SEQ ID NO: 45) DI-101 5'-GCT TCA CAC CCT TCA GAA CTG GCT CAG AAT CAT CCT CAT CAA ACT TAC A-3' (SEQ ID NO: 46) DM 11 5'-CCT AGG TAT AAT GCA GCT TCA CAC CCT TCA GAA CT-31 (SEQ ID NO: 47) Spikeddn-BstB I 5'- TTCGAACT AGG TAT AAT GCA GCT TCA C -3' (SEQ ID NO: 48) [0032] The PCR conditions are as mentioned above. The resultant double-stranded SCT320 gene products were purified with Qiagen/PCR purification kit (Qiagen Inc.) and cloned with pGEM-T vector (Promega Co.) to obtain pGEM(T)/SpikeCT(EcoRV/BstBI). The pGEM(T)/ SpikeCT (EcoRV/BstBI) plasmid in which containing a gene encodes C-terminal heptad repeat located upstream of an aromatic residue-rich region juxtaposed to the transmembrane segment of Spike protein of SARS coronavirus. The coding sequence of "SCT320" gene is as set forth in SEQ ID NO: 3. Construction of Expression vector of the Invention [0033] The manipulation of DNA is instructed by Sambrook and Russell et al DMolecular cloning third editionD , Cold Spring Harbor Laboratory Express D The restriction enzymes, T4DNA ligase, Klenow enzyme are purchased from New England Biolab.com and performed by manufacture's recommendation. I. Construction of pCMV promoter-driven SARS M gene plasmid [0034] The pGEM(T)/M clone was used as DNA template for PCR with T7 and SPG promoter primer, and the PCR condition, except the Annealing temperature was set at 50 D for 20 seconds, are same as mentioned above. The resulting M gene PCR products were purified with QIAquick PCR purification kit (Qiagen Inc.) and digested with Bel I and NotI to obtain DNA inserts containing SARS M gene. The pEGFP-Nl plasmid (Clontech Co.) was digested with Bglll and Not I and the resulting Bgl II , Not I digested pEGFP-Nl plasmid were uesd as DNA vector for ligation with Bel I , Not I digested SARS M gene DNA inserts to obtain pNl/M DNA plasmid. The pNl/M DNA plasmid was digested with Nhel and Not I to obtain DNA inserts containing SARS M gene. The pACT plasmid (Promega Co.) was digested with Nhe I and Not I. The resulting Nhe I, Not I digested pACT DNA vector were ligated with Nhe I, Not I digested SARS M gene DNA inserts to obtain pACT/M DNA plasmid. The pACT/M DNA plasmid was digested with Bgl II and Asp 718 to obtain DNA inserts containing CMV promoter and SARS M gene. The pCDNA3.1(+) plasmid (Invitrogen Co.) was digested with Bglll and Asp718. The resulting Bglll, Asp718 digested pCDNA3.1(+)DNA vector were ligated with Bglll, Asp718 digested DNA containing CMV promoter and SARS M gene inserts to obtain pCDNA 3.1+M DNA plasmid. II. Constructing IRES-SARS E gene plasmid [0035] The pIRES2-EGFP (Clontech Co.) was digested with Xho I and Nco I to get "IRES" DNA insert. The GL3basic vector (Promega Co.) was digested with Xho I and Nco I. The Xho I,Nco I digested pGL3basic DNA vector were ligated with Xho I,Nco I digested IRES DNA insert by using T4 DNA ligase (NEB Co.). The ligation mix was transformed into E. coli DH5 acompetent cells to obtain pGL3B/IRES-luciferase DNA plasmid. The T/EA+ clone, containing SARS E gene with second Alanine insertion mutant, was digested with Ncol and Xbal to obtain SARS E gene DNA inserts. The pGL3B/IRES-luciferase DNA plasmid was digested with Ncol and Xbal. The Nco I, Xba I digested pGL3B/IRES-lucif erase DNA vector was ligated with Nco I, Xba I digested SARS EA+ gene DNA inserts to get pGL3B/IRES-EA+ DNA plasmid. III. Construction of pCMV-driven M+E gene expression plasmid (CoronaVirus-Like Particle (CoVLP) expression vector) [0036] The pGL3B/IRES-EA"" DNA plasmid was digested with BamHI and Xbal to obtain DNA inserts containing IRES and SARS EA+ gene. The pCDNA3.1+M DNA plasmid was digested with BamHI and Xbal. The resultant BamH I, Xba I digested pCDNA3.1+M DNA vector were ligated with BamH I, Xba I digested DNA inserts containing IRES and SARS EA+ fused gene to obtain pCDNA3 .1+M/IRES-EA+ plasmid. IV. Constructing the DNA vector of invention [0037] The pGEM(T)/ SpikeCT (EcoRV/BstBI) plasmid, in which containing a gene encodes C-terminal heptad repeat located upstream of an aromatic residue-rich region juxtaposed to the transmembrane segment of Spike protein of SARS coronavirus, was digested with Spe I and filled-in by Klenow enzyme and dNTPs. After separated onto 1.2% agarose gel, the DNA fragment were purified with QIAquick gel extraction kit (QIAGEN. Com.) and further digested with BstB I. The resultant "SpikeCT" gene fragments were used as DNA inserts and ligated with BsaB I, BstB I digested, gel purified pCDNA3.1+M/IRES-EA+ DNA vector plasmid. After transformation into E. coli DHBalpha cells, gist the DNA vector of invention, so-called CoVLP-cloning vector. There are several restriction enzymes cutting sites (multiple cloning site, MCS) including Smal, BsaB I, EcoR V, BspE I located at the beginning of "SpikeCT" gene and these sites can be used for cloning or in-frame fused Class I viral fusion protein gene with SpikeCT gene in the vector of invention and then the resultant DNA plasmid can be used as DNA vaccine candidate. The map of the CoVLP-cloning vector is shown in Figure 1. The sequence of the CoVLP-cloning vector is as set forth in SEQ ID NO:49. The DNA sequence of CoVLP cloning vector (pCDNA3.1+M+IRES-E+SpikeCT) (SEQ ID NO:49) (JACGGATCGGGagatctTCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAAT CAATAITGGCTATTG GCCAfrrGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCCAATATG ACCGCCATGTTGGCATT GATrA'ITGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGG AGTTCCGCGTTACATAA CTTAC'GGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAAT GACGTATGTTCCCATAGT AACGC:CAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACT TGGCAGTACATCAAGTGT ATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTAT GCCCAGTACATGACCTTA CGGGACTTTCCTAC1TGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGG TITTGGCAGTACACCAA IGGGCXJTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATG GGAGTT TGTTTTGGCACC AAAATCAACGGGACrrTCCAAAATGTCGTAACAACTGCGATCGCCCGCCCCGTTGACGCAAA TGGGC 'GGTAGGCGTGTAC GGTGCiGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATT GCGG'i AGTTTATCACAGT TAAATTGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGTGACTC TCTTAAGGTAGCCTTGCA GAAGTTGGTCGTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGA CCAA'l 'AGAAACTGGGCTrC We Claim: 1. An expression vector for cloning the Class I viral fusion protein gene and as DNA vaccine candidate, the expression vector comprising: i) a first transcription unit comprising a membrane protein gene (M protein gene) of Coronavirus, an envelope protein gene (E protein gene) of Coronavirus and an internal ribosome entry sites (IRES) sequence, wherein the IRES is inserted into the junction of the membrane protein gene and the envelop protein gene; ii) a first eukaryotic promoter operably linked to the membrane protein gene wherein the first promoter is located upstream of the M protein gene and drives the expression of the first transcription unit; iii) a second transcription unit comprising a SpikeCT gene of Coronavirus and a multiple cloning site (MCS) for cloning or in-framed insertion of Class I viral fusion protein gene, wherein the MCS is located at the beginning of SpikeCT gene and has restriction enzymes cutting sites; and iv) a second eukaryotic promoter operably linked to the SpikeCT gene wherein the second promoter is located upstream of the SpikeCT gene and drives the expression of the second transcription unit; wherein the transcription activity of the first eukaryotic promoter is stronger than the second eukaryotic promoter. 2. The expression vector as claimed in Claim 1, wherein the Coronavirus is pig, human or avian coronvirus. 3. The expression vector as claimed in Claim 1, wherein the Coronavirus pig TGEV coronvirus, human 229E coronvirus or human SARS virus. 4. The expression vector as claimed in Claim 1, wherein the envelope protein gene has the sequence as set forth in SEQ ID NO: 1. 5. The expression vector as claimed in Claim 1, wherein the membrane protein gene has the sequence as set forth in SEQ ID NO: 2. 6. The expression vector as claimed in Claim 1, wherein the SpikeCT gene has the sequence as set forth in SEQ ID NO: 3. 7. The expression vector as claimed in Claim 1, which further comprises a replication origin for the propagation plasmid in a host cell. 8. The expression vector as claimed in Claim 1, which further comprises an antibiotics-resistant gene as the selection marker. 9. The expression vector as claimed in Claim 1, wherein the first and second transcription units have polyA signal. 10. The expression vector as claimed in Claim 9, wherein the polyA signal BGH polyA signal. 11. The expression vector as claimed in Claim 1, which has the sequence as set forth in SEQID NO:49. 12. The expression vector as claimed in Claim 1, wherein the SpikeCT gene encodes C-terminal heptad repeat located upstream of an aromatic residue-rich region juxtaposed to the transmembrane segment of Spike protein of coronavirus. 13. The expression vector as claimed in Claim 1, the multiple cloning site comprises the restriction site selected from the group consisting of Smal, BsaB I, EcoR V and BspE I. 14. The expression vector as claimed in Claim 1, wherein the Class I viral fusion protein gene is a Spike of SARS virus. 15. The expression vector as claimed in Claim 1, wherein the first eukaryotic promoter is a pCMV promoter. 16. The expression vector as claimed in Claim 1, wherein the second eukaryotic promoter is a pCMV promoter.

Documents:

3967-DELNP-2007-Abstract-(07-03-2012).pdf

3967-delnp-2007-abstract.pdf

3967-DELNP-2007-Claims-(07-03-2012).pdf

3967-delnp-2007-claims.pdf

3967-DELNP-2007-Correspondence Others-(07-03-2012)..pdf

3967-delnp-2007-Correspondence Others-(30-03-2012).pdf

3967-delnp-2007-correspondence-others 1.pdf

3967-DELNP-2007-Correspondence-Others-(24-02-2011).pdf

3967-delnp-2007-correspondence-others.pdf

3967-delnp-2007-description (complete).pdf

3967-delnp-2007-drawings.pdf

3967-DELNP-2007-Form-1-(07-03-2012).pdf

3967-delnp-2007-form-1.pdf

3967-delnp-2007-form-18.pdf

3967-DELNP-2007-Form-2-(07-03-2012).pdf

3967-delnp-2007-form-2.pdf

3967-DELNP-2007-Form-3-(07-03-2012)..pdf

3967-DELNP-2007-Form-3-(07-03-2012).pdf

3967-delnp-2007-form-3.pdf

3967-delnp-2007-form-5.pdf

3967-DELNP-2007-GPA-(07-03-2012).pdf

3967-DELNP-2007-GPA-(24-02-2011).pdf

3967-delnp-2007-Petition-137-(30-03-2012).pdf