Indian Patents. 251696:"PEPTIDE-BASED HAIR REAGENTS FOR PERSONAL CARE"

Title of Invention	"PEPTIDE-BASED HAIR REAGENTS FOR PERSONAL CARE"
Abstract	A diblock, peptide-based hair colorant having the general structure (HBP)n - C, wherein HBP is a hair-binding peptide, C is a coloring agent and n ranges from 1 to about 10,000.

Full Text	This patent application is a continuation in part of United States Patent Application, 10/935642, filed September 7, 2004, which claims the benefit of United States Provisional Application 60/501498, filed September 8, 2003, now expired. The invention relates to the field of personal care products. More specifically, the invention relates to skin conditioners, hair conditioners, hair colorants, nail colorants, and skin colorants based upon specific skin-binding, hair-binding, and nail-binding peptides. BACKGROUND OF THE INVENTION Film-forming substances are widely used in compositions for skin and hair care as conditioning agents and moisturizers, and to protect the skin and hair against environmental and chemical damage. These substances adsorb onto and/or absorb into the skin or hair, forming a protective coating. Commonly used film-forming substances include synthetic polymers, such as silicones, polyvinylpyrrolidone, acrylic acid polymers, and polysaccharides, and proteins, such as collagen, keratin, elastin, casein, silk, and soy proteins. Many proteins are known to be particularly effective film-forming agents. Because of their low solubility at the conditions used in skin and hair care products, proteins are commonly used In the form of peptides, formed by the hydrolysis of the proteins. In hair care and hair coloring compositions, film-forming substances are used to form a protective film on the surface of the hair to protect it from damage due to grooming and styling, shampooingrand exposure to ultraviolet light and the reactive chemicals commonly used In permanent wave agents, hair coloring products, bleaches, and hair straighteners, which denature the hair keratin protein. Moreover, these film-forming substances improve the elasticity of the hair. Film-forming substances that have been used in hair care products include proteins, such as keratin, collagen, soy, and silk proteins and hydrolysates thereof, and polymeric materials, such as polyacrylates, long chain alkyl quaternized amines, and siloxane polymers. For example, Cannell at al. in U.S. Patent No. 6,013,250 describe a hair care composition for treating hair against chemical and ultraviolet light damage. That composition comprises hydrolyzed protein, having an abundance of anionic amino acids, particularly, sulfur-containing amino acids, and divalent cations. It is proposed in that disclosure that the anionic components of the hydrolyzed protein bind to the hair by means of cationic bridges. Amino acids and their derivatives have also been used in hair care compositions to condition and strengthen hair. For example, OToole et al. in WO 0051556 describe hair care compositions containing four or more amino acid compounds selected from histidine, lysine, methionine, tyrosine, tryptophan, and cysteine compounds. Film-forming substances are also used in skin care compositions to form a protective film on the skin. These films can serve to lubricate and coat the skin to passively impede the evaporation of moisture and smooth and soften the skin. Commonly used film-forming substances in skin care compositions include hydrolyzed animal and vegetable proteins (Puchalski et al., U.S. Patent No. 4,416,873, EI-Menshawy et al., U.S. Patent No. 4,482,537, and Kojima et al., JP 02311412) and silk proteins (Philippe et al., U.S. Patent No. 6,280,747 and Fahnestock et al., copending U.S. Patent Application No. 10/704337). Amino acids and derivatives have also been used in skin care compositions as conditioning agents. For example, Kojima et al. in JP 06065049 describe skin care compositions containing amino acids and/or their derivatives and docosahexaenoic acid, its salts or its esters. Hair coloring agents may be divided into three categories, specifically, permanent, semi-permanent or direct, and temporary. The permanent hair dyes are generally oxidative dyes that provide hair color that lasts about four to six weeks. These oxidative hair dyes consist of two parts, one part contains the oxidative dyes in addition to other ingredients, while the second part contains an oxidizing agent such as hydrogen peroxide. The two components are mixed immediately prior to use. The oxidizing agent oxidizes the dye precursors, which then combine to form large color molecules within the hair shaft. Although the oxidative hair dyes provide long-lasting color, the oxidizing agents they contain cause hair damage. The semi-permanent or direct hair dyes are preformed dye molecules that are applied to the hair and provide color for about six to twelve shampoos. This type of hair dye is gentler to the hair because it does not contain peroxides, but the hair color does not last as long. Some improved durability is achieved by the use of nanoparticle hair coloring materials with a particle size of 10 to 500 nm, as described by Hensen et al. in WO 01045652. These nanoparticle hair coloring materials are conventional direct hair dyes that are treated to obtain nanoscale dimensions and exhibit increased absorption into the hair. Temporary hair dyes are coloring agents that are applied to the hair surface and are removed after one shampoo. It would be desirable to develop a hair coloring agent that provides the durability of the permanent hair dyes without the use of oxidizing agents that damage hair. The major problem with the current skin care and hair care compositions, non-oxidative hair dyes, as well as nail coloring agents is that they lack the required durability required for long-lasting effects. For this reason, there have been attempts to enhance the binding of the cosmetic agent to the hair, skin or nails. For example, Richardson et al. in U.S. Patent No. 5,490,980 and Green et al. in U.S. Patent No. 6,267,957 describe the covalent attachment of cosmetic agents, such as skin conditioners, hair conditioners, coloring agents, sunscreens, and perfumes, to hair, skin, and nails using the enzyme transglutaminase. This enzyme crosslinks an amine moiety on the cosmetic agent to the glutamine residues in skin, hair, and nails. Similarly, Green et al. in WO 0107009 describe the use of the enzyme lysine oxidase to covalently attach cosmetic agents to hair, skin, and nails. In another approach, cosmetic agents have been covalently attached to proteins or protein hydrolysates. For example, Lang et al. in U.S. Patent No. 5,192,332 describe temporary coloring compositions that contain an animal or vegetable protein, or hydrolysate thereof, which contain residues of dye molecules grafted onto the protein chain. In those compositions, the protein serves as a conditioning agent and does not enhance the binding of the cosmetic agent to hair, skin, or nails. Horikoshi et al. in JP 08104614 and Igarashi et al. in U.S. Patent No. 5,597,386 describe hair coloring agents that consist of an anti-keratin antibody covalently attached to a dye or pigment. The antibody binds to the hair, thereby enhancing the binding of the hair coloring agent to the hair. Similarly, Kizawa et al. in JP 09003100 describe an antibody that recognizes the surface layer of hair and its use to treat hair. A hair coloring agent consisting of that anti-hair antibody coupled to colored latex particles is also described. The use of antibodies to enhance the binding of dyes to the hair is effective in increasing the durability of the hair coloring, but these antibodies are difficult and expensive to produce. Terada et al. in JP 2002363026 describe the use of conjugates consisting of single-chain antibodies, preferably anti-keratin, coupled to dyes, ligands, and cosmetic agents for skin and hair care compositions. The single-chain antibodies may be prepared using genetic engineering techniques, but are still difficult and expensive to prepare because of their large size. Findlay in WO 00048558 describes the use of calycin proteins, such as p-lactoglobulin, which contain a binding domain for a cosmetic agent and another binding domain that binds to at least a part of the surface of a hair fiber or skin surface, for conditioners, dyes, and perfumes. Again these proteins are large and difficult and expensive to produce. Linter in U.S. Patent No. 6,620,419 describes peptides grafted to a fatty acid chain and their use in cosmetic and dermopharmaceutical applications. The peptides described in that disclosure are chosen because they stimulate the synthesis of collagen; they are not specific binding peptides that enhance the durability of hair and skin conditioners, and hair, nail, and skin colorants. Since its introduction in 1985, phage display has been widely used to discover a variety of ligands including peptides, proteins and small molecules for drug targets (Dixit, J. ofSci. & Ind. Research, 57:173-183 (1998)). The applications have expanded to other areas such as studying protein folding, novel catalytic activities, DNA-binding proteins with novel specificities, and novel peptide-based biomaterial scaffolds for tissue engineering (Hoess, Chem. Rev. 101:3205-3218 (2001) and Holmes, Trends Biotechnol. 20:16-21 (2002)). Whaley et al. (Nature 405:665-668 (2000)) disclose the use of phage display screening to identify peptide sequences that can bind specifically to different crystallographic forms of inorganic semiconductor substrates. A modified screening method that comprises contacting a peptide library with an anti-target to remove peptides that bind to the anti-target, then contacting the non-binding peptides with the target has been described (Estell et al. WO 0179479, Murray et al. U.S. Patent Application Publication No. 2002/0098524, and Janssen et al. U.S. Patent Application Publication No. 2003/0152976). Using that method, a peptide sequence that binds to hair and not to skin, given as SEQ ID NO:1, and a peptide sequence that binds to skin and not hair, given as SEQ ID N0:2, were identified. Using the same method, Janssen et al. (WO 04048399) identified other skin-binding and hair-binding peptides, as well as several binding motifs. Although the potential use of these peptides in personal care applications is suggested in those disclosures, the coupling of these peptides to coloring agents and conditioning agents to prepare high-affinity hair conditioners, skin conditioners, hair colorants, nail colorants and skin colorants is not described. A method for identifying high-affinity phagepeptide clones is also described in those disclosures. The method involves using PCR to identify peptides that remain bound to the target after acid elution. Reisch (Chem. Eng. News 80:16-21 (2002)) reports that a family of peptides designed to target an ingredient of specific human tissue has been developed for personal care applications. However, no description of peptide-based conditioners or coloring agents are disclosed in that publication. One of the peptide binding sequences of the instant invention, given as SEQ ID NO:3, has been reported for several other purposes. For example, Hupp et al. in WO 02065134 disclose the peptide sequence 5 SEQ ID N0:3 as a peptide for use in modulating the binding of a p53 polypeptide to a p300 polypeptide, useful for regulating the mammalian cell cycle or to induce or prevent cell death. Liu et al. in U.S. Patent No. 6,344,443 describe the use of that same peptide sequence to inhibit binding of tumor necrosis factor alpha to its receptor for preventing or reversing inflammatory changes in patients with arthritis and other inflammatory diseases. Another peptide binding sequence of the instant invention, given as SEQ ID NO:4, was reported by Jagota et al. in WO 03102020 as a carbon nanotube-binding peptide. In view of the above, a need exists for hair and skin conditioners, and hair, nail, and skin colorants that provide improved durability for long lasting effects and are easy and inexpensive to prepare. Applicants have met the stated needs by identifying peptide sequences using phage display screening that specifically bind to body surfaces, such as, hair, skin, nails, teeth, gums, cornea! tissue, and oral cavity surfaces, with high affinity and using them to design peptide-based body surface reagents, such as, hair conditioners, skin conditioners, hair colorants, nail colorants, skin colorants, and oral care reagents. SUMMARY OF THE INVENTION The invention provides peptide sequences that bind with high affinity to hair, skin and nails. The invention also provides' peptide-based conditioners and colorants for hair, skin, and nails. In one embodiment, the peptide-based conditioners and colorants are diblock compositions. Accordingly the invention provides a hair-binding peptide selected from the group consisting of SEQ ID N0s:5, 6,7, 8, 9, 10, 11,12, 13,14, 15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 64, 66, 69, and 70. Similarly the invention provides a nail-binding peptide as set forth in SEQ ID NO:60. In another embodiment the invention provides a skin-binding peptide as set forth in SEQ ID NO:61. In one embodiment the invention provides a diblock, peptide based body surface reagent having the general structure (BSBP)n - BA, wherein a) BSBP is a body surface binding peptide; b) BA is a benefit agent; and c) n ranges from 1 to about 10,000. Alternatively the invention provides, a triblock, peptide based body surface reagent having the general structure [(BSBP)m - S]n - BA, wherein a) BSBP is a body surface binding peptide; b) BA is a benefit agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000. In another embodiment the invention provides a diblock, peptidebased hair conditioner having the general structure (HBP)n - HCA, wherein a) HBP is a hair-binding peptide; b) HCA is a hair conditioning agent; and c) n ranges from 1 to about 1000. Similarly the invention provides a diblock, peptide-based skin conditioner having the general structure (SBP)n - SCA, wherein a) SBP is a skin-binding peptide; b) SCA is a skin conditioning agent; and c) n ranges from 1 to about 1000. In an alternate embodiment the invention provides a diblock, peptide-based hair colorant having the general structure (HBP)n- C, wherein a) HBP is a hair-binding peptide; b) C is a coloring agent; and c) n ranges from 1 to about 10,000. In another embodiment the invention provides a diblock, peptidebased nail colorant having the general structure (NBP)n - C, wherein 7 a) NBP is a nail-binding peptide; b) C is a coloring agent; and c) n ranges from 1 to about 10,000. In another embodiment the invention provides a diblock, peptidebased skin colorant having the general structure (SBP)n - C, wherein a) SBP is a skin-binding peptide; b) C is a coloring agent; and c) n ranges from 1 to about 10,000. In a similar embodiment the invention provides a triblock, peptidebased hair conditioner having the general structure [(HBP)m - S]n - HCA, wherein a) HBP is a hair-binding peptide; b) HCA is a hair conditioning agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 1000. Alternatively the invention provides a triblock, peptide-based skin conditioner having the general structure [(SBP)m - S]n - SCA, wherein a) SBP is a hair-binding peptide; b) SCA is a skin conditioning agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 1000. Similarly the invention provides a triblock, peptide-based hair colorant having the general structure [(HBP)m - S]n - C, wherein a) HBP is a hair-binding peptide; b) C is a coloring agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000. 8 In another embodiment the invention provides a triblock, peptidebased nail colorant having the general structure [(NBP)m - S]n - C, wherein a) NBP is a hair-binding peptide; b) C is a coloring agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000. In another embodiment the invention provides a triblock, peptidebased skin colorant having the general structure [(SBP)m - S]n - C, wherein a) SBP is a hair-binding peptide; b) C is a coloring agent; c) Sis a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000. In an alternate embodiment the invention provides a diblock, peptide-based oral care reagent having the general structure (OBP)n - OBA, wherein a) OBP is an oral cavity surface-binding peptide; b) OBA is an oral care benefit agent; and c) n ranges from 1 to about 10,000. Similarly the invention provides a triblock, peptide-based oral care reagent having the general structure [(OBP)m - S]n - OBA, wherein a) OBP is an oral cavity surface-binding peptide; b) OBA is an oral care benefit agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000. Additionally the invention provides a method for generating a high affinity body surface binding- peptide comprising: a) providing a library of combinatorial generated phage-peptides; b) contacting the library of (a) with a body surface sample to form a reaction solution comprising: (i) phage-peptide-body surface sample complexes; (ii) unbound body surface sample, and (iii) uncomplexed peptides; c) isolating the phage-peptide-body surface sample complexes of (b); d) eluting the weakly-bound phage-peptides from the isolated phage-peptide complex of (c); e) infecting bacterial host cells directly with the phege-peptide-body surface sample complexes remaining after step (d); f) growing the infected cells of step (e) in a suitable growth medium; and g) isolating and identifying the phage-peptides from the grown cells of step (f), wherein the phage-peptides have a high binding affinity for a body surface. In a preferred embodiment the invention provides methods for forming a protective layer of a peptide-based conditioner on hair comprising applying the composition of the invention to the hair and allowing the formation of said protective layer. Similarly the invention provides methods for forming a protective layer of a peptide-based conditioner on skin or lips comprising applying the composition of the invention to the skin or lips and allowing the formation of said protective layer. In one embodiment the invention provides a method for applying a benefit agent to a body surface comprising contacting a body surface with the peptide based body surface reagent of either of claims 4 or 5, comprising a body surface binding peptide and a benefit agent, with a body surface under conditions whereby the body surface binding peptide adheres to the body surface. In another embodiment the invention provides a method for coloring hair, eyebrows, skin or nails comprising applying the hair, eyebrows, skin or nail coloring composition of the invention to the hair, eyebrows, skin or 10 nails for a period of time sufficient to cause coloration of the hair, eyebrows, skin or nails. In a preferred embodiment the invention provides a method for coloring hair, eyebrows or eyelashes comprising the steps of: a) providing a hair coloring composition comprising a hair colorant selected from the group consisting of: i)(HBP)n-C;and ii) [(HBP)m - S]k - C wherein 1) HBP is a hair-binding peptide; 2) C is a coloring agent; 3) n ranges from 1 to about 10,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 10,000; and wherein the hair binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phagepeptides; B) contacting the library of (A) with a hair sample to form a reaction solution comprising: (i) phage-peptide-hair complex; (ii) unbound hair, and (iii) uncomplexed peptides; C) isolating the phage-peptide-hair complex of (B); D) eluting the weakly bound peptides from the isolated peptide complex of (C); E) identifying the remaining bound phage-peptides either by using the polymerase chain reaction directly with the phage-peptide-hair complex remaining after step (D), or by infecting bacterial host cells directly with the phage-peptide-hair complex remaining after step (D), growing the infected cells in a suitable growth medium, and isolating and identifying the phage-peptides from the grown cells, wherein the phage-peptides are from about 7 to about 25 amino acids and have a binding affinity for hair, measured as MBso, equal to or less than 10 M; and b) applying the hair colorant of (a) to hair, eyebrows or eyelashes for a time sufficient for the peptide-based colorant to bind to hair, eyebrows or eyelashes. In another embodiment the invention provides a method for forming a protective layer of a peptide-based conditioner on hair comprising the steps of: a) providing a hair care composition comprising a hair conditioner selected from the group consisting of: i)(HBP)n-HCA;and ii) [(HBP)m - S]k - HCA wherein 1) HBP is a hair-binding peptide; 2) HCA is a hair conditioning agent; 3) n ranges from 1 to about 1,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 1,000; and wherein the hair binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phagepeptides; B) contacting the library of (A) with a hair sample to form a reaction solution comprising: (i) phage-peptide-hair complex; (ii) unbound hair, and (iii) uncomplexed peptides; C) isolating the phage-peptide-hair complex of (B) D) eluting the weakly bound peptides from the isolated peptide complex of (C); E) identifying the remaining bound phage-peptides 1 either by using the polymerase chain reaction directly with the phage-peptide-hair complex remaining after step (D), or by infecting bacterial host cells directly with the phage-peptide-hair complex remaining after step (D), growing the infected cells in a suitable growth medium, and isolating and identifying the phage-peptides from the grown cells, wherein the phage-peptides are from about 7 to about 25 amino acids and have a binding affinity for hair, measured as MBso, equal to or less than 10" M; and b) applying the hair conditioner of (a) to hair and allowing the formation of said protective layer. Alternatively the invention provides a method for forming a protective layer on skin or lips comprising the steps of: a) providing a skin care composition comprising a skin conditioner selected from the group consisting of: i)(SBP)n-SCA;and ii) I(SBP)m - S]k - SCA wherein 1) SBP is a skin-binding peptide; 2) SCA is a skin conditioning agent; 3) n ranges from 1 to about 1,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 1,000; and wherein the skin binding peptide is selected by a method comprising the steps of: 13 A) providing a library of combinatorial generated phagepeptides; B) contacting the library of (A) with a skin sample to form a reaction solution comprising: (i) phage-peptide-skin complex; (ii) unbound skin, and (iii) uncomplexed peptides; C) isolating the phage-peptide-skin complex of (B); D) eluting the weakly bound peptides from the isolated peptide complex of (C); E) identifying the remaining bound phage-peptides either by using the polymerase chain reaction directly with the phage-peptide-skin complex remaining after step (D), or by infecting bacterial host cells directly with the phage-peptide-skin complex remaining after step (D), growing the infected cells in a suitablegrowth medium, and isolating and identifying the phage-peptides from the grown cells, wherein the phage-peptides are from about 7 to about 25 amino acids and have a binding affinity for skin, measured as MBso, equal to or less than 10" M; and b) applying the skin conditioner of (a) to skin or lips and allowing the formation of said protective layer. In another embodiment the invention provides a method for coloring skin or lips comprising the steps of: a) providing a cosmetic composition comprising a skin colorant selected from the group consisting of: i)(SBP)n-C;and ii)[(SBP)m-S]k-C wherein 1) SBP is a skin-binding peptide; 2) C is a coloring agent; 3) n ranges from 1 to about 10,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 10,000; and wherein the skin binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phagepeptides; B) contacting the library of (A) with a skin sample to form a reaction solution comprising: (i) phage-peptide-skin complex; (ii) unbound skin, and (iii) uncomplexed peptides; C) isolating the phage-peptide-skin complex of (B); D) eluting the weakly bound peptides from the isolated peptide complex of (C); E) identifying the remaining bound phage-peptides either by using the polymerase chain reaction directly with the phage-peptide-skin complex remaining after step (D), or by infecting bacterial host cells directly with the phage-peptide-skin complex remaining after step (D), growing the infected cells in a suitable growth medium, and isolating and identifying the phagepeptides from the grown cells, wherein the phagepeptides are from about 7 to about 25 amino acids and have a binding affinity for skin, measured as MBso, equal to or less thanIO M; and b) applying the skin colorant of (a) to the skin or lips. Alternatively the invention provides a method for coloring nails comprising the steps of: a) providing a nail polish composition comprising a nail colorant selected from the group consisting of: i)(NBP)n-C;and ii) [(NBP)m - S]k - C wherein 1) NBP is a nail-binding peptide; 2) C is a coloring agent; 3) n ranges from 1 to about 10,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 10,000; and wherein the nail binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phagepeptides; B) contacting the library of (A) with a nail sample to form a reaction solution comprising: (i) phage-peptide-nail complex; (ii) unbound nail, and (iii) uncomplexed peptides; C) isolating the phage-peptide-nail complex of (B); D) eluting the weakly bound peptides from the isolated peptide complex of (C); E) identifying the remaining bound phage-peptides either by using the polymerase chain reaction directly with the phage-peptide-nail complex remaining after step (D), or by infecting bacterial host cells directly with the phage-peptide-nail complex remaining after step (D), growing the infected cells in a suitable growth medium, and isolating and identifying the phagepeptides from the grown cells, wherein the phagepeptides are from about 7 to about 25 amino acids and have a binding affinity for nails, measured as , equal to or less thanl0" M; and b) applying the nail colorant of (a) to the nails. In another embodiment the invention provides a method for applying an oral care benefit reagent to an oral cavity surface comprising the steps of: a) providing an oral care reagent selected from the group consisting of: i) (OBP)n - OBA; and ii) l(OBP)m - S]k - OBA wherein 1) OBP is an oral cavity surface-binding peptide; 2) OBA is an oral care benefit agent; 3) n ranges from 1 to about 10,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 10,000; and wherein the oral cavity surface-binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phagepeptides; B) contacting the library of (A) with an oral cavity surface sample to form a reaction solution comprising: (i) phage-peptide-oral cavity surface sample complex; (ii) unbound oral cavity surface sample, and (iii) uncomplexed peptides; C) isolating the phage-peptide- oral cavity surface sample complex of (B); D) eluting the weakly bound peptides from the isolated peptide complex of (C); E) identifying the remaining bound phage-peptides either by using the polymerase chain reaction directly with the phage-peptide- oral cavity surface sample complex remaining after step (D), or by infecting bacterial host cells directly with the phage-peptideoral cavity surface sample complex remaining after step (D), growing the infected cells in a suitable growth medium, and isolating and identifying the phage-peptides from the grown cells, wherein the phage-peptides are from about 7 to about 25 amino acids and have a binding affinity for oral cavity surface sample, measured as MBsn, equal to or less than 10" M; and b) applying the oral care benefit agent of (a) to an oral cavity surface for a time sufficient for the peptide-based oral care agent to bind to an oral cavity surface. BRIEF DESCRIPTION OF SEQUENCE DESCRIPTIONS The invention can be more fully understood from the following detailed description and the accompanying sequence descriptions, which form a part of this application. The following sequences conform with 37 C.F.R. 1.821-1.825 ("Requirements for Patent Applications Containing Nucleotide Sequences and/or Amino Acid Sequence Disclosures - the Sequence Rules") and consistent with World Intellectual Property Organization (WIPO) Standard ST.25 (1998) and the sequence listing requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administrative Instructions). The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1.822. SEQ ID NO:1 is the amino acid sequence of a hair-binding peptide. SEQ ID NO:2 is the amino acid sequence of a skin-binding peptide. SEQ ID NOs:3-52, 54-59 are the amino acid sequences of hairbinding peptides of the present invention SEQ ID N0:53 is the amino acid sequence of a hair-binding and nail-binding peptide of the present invention. SEQ ID NO:60 is the amino acid sequence of a nail-binding peptide of the present invention. SEQ ID NO:61 is the amino acid sequence of a skin-binding peptide of the present invention. SEQ ID NO:62 is the oligonucleotide primer used to sequence phage DNA. SEQ ID NO:63 is the amino acid sequence of a peptide used as a control in the EL1SA binding assay. SEQ ID NO:64 is the amino acid sequence of a cysteine-attached hair-binding peptide. SEQ ID NO:65 is the amino acid sequence of the Caspase 3 cleavage site. SEQ ID NOs:66, 69, and 70 are the amino acid sequence of shampoo-resistant hair-binding peptides. SEQ ID NOs:67 and 68 are the nucleotide sequences of the primers used to amplify shampoo-resistant, hair-binding phage peptides, as described in Example 8. SEQ ID NOs:71-74 are the amino acid sequences of the biotinylated hair-binding and skin-binding peptides used Example 9. SEQ ID NO:75 is the amino acid sequence of the fully protected D21 peptide used in Example 16. SEQ ID NOs:76-98 are the amino acid sequences of hair-binding peptides. SEQ ID NOs:99-104 are the amino acid sequences of skin-binding peptides. DETAILED DESCRIPTION OF THE INVENTION The present invention provides peptide sequences that specifically bind to human body surfaces such as hair, skin, nails, teeth, gums, and the like with high affinity. Additionally, the present invention provides peptide based body surface reagents that are comprised of body surface binding peptides coupled with various benefit agents that convey a benefit to the body surface. Typical of the compositions of the invention are peptide-based hair and skin conditioners, and hair, nail, and skin colorants with improved durability. The peptide based body surface reagents of the invention provide benefits and an advance over the art in the development of personal care products. Because the reagents are peptide based they are able to bind strongly to surfaces from an aqueous environment, thus in many cases being both water soluble and water fast. Additionally, because of the aqueous nature of the reagents they may be removed from body surfaces without of the use of odor producing chemicals. The reagents of the invention bind almost immediately to the target body surface, eliminating the need for long drying times, typical of most personal care applications. Additionally the reagents of the invention are specific in their affinity for body surfaces, making the need to isolate their application to a specific surface unnecessary. Thus a regent that binds hair for coloring will not bind skin and visa versa. Most importantly, the peptide nature of the reagents makes them virtually non-toxic and non-irritating to exposed body surfaces such as the skin and the membranes of the eyes and mouth. The following definitions are used herein and should be referred to for interpretation of the claims and the specification. "HBP" means hair-binding peptide. ^ "SBP" means skin-binding peptide. "NBP" means nail-binding peptide. "OBP" means oral cavity surface-binding peptide. "TBP" means tooth-binding peptide. "HCA" means hair conditioning agent. "SCA" means skin conditioning agent. "C" means coloring agent for hair, skin, or nails. "OBA" means oral benefit agent. "S" means spacer. "BSBP" means body surface binding peptide. "BA" means benefit agent. The term "peptide" refers to two or more amino acids joined to each other by peptide bonds or modified peptide bonds. The term "body surface" will mean any surface of the human body that may serve as a substrate for the binding of a peptide carrying a benefit agent. Typical body surfaces include but are not limited to hair, skin, nails, teeth, gums, and corneal tissue. The term "benefit agent' is a general term applying to a compound or substance that may be coupled with a binding peptide for application to a body surface. Benefit agents typically include conditioners, colorants, fragrances, whiteners and the like along with other substances commonly used in the personal care industry. The term "hair" as used herein refers to human hair, eyebrows, and eyelashes. The term "skin" as used herein refers to human skin, or pig skin, Vitro-Skin and EpiDerm™ which are substitutes for human skin. Skin as used herein as a body surface will generally comprise a layer of epithelial cells and may additionally comprise a layer of endothelial cells. The term "nails" as used herein refers to human fingernails and toenails. The terms "coupling" and "coupled" as used herein refer to any chemical association and includes both covalent and non-covalent interactions. The term "stringency" as it is applied to the selection of the hairbinding, skin-binding, and nail-binding peptides of the present invention, refers to the concentration of the eluting agent (usually detergent) used to elute peptides from the hair, skin, or nails. Higher concentrations of the eluting agent provide more stringent conditions. The term "peptide-body surface sample complex" means structure comprising a peptide bound to a sample of a body surface via a binding site on the peptide. The term "peptide-hair complex" means structure comprising a peptide bound to a hair fiber via a binding site on the peptide. The term "peptide-skin complex" means structure comprising a peptide bound to the skin via a binding site on the peptide. The term "peptide-nail complex" means structure comprising a peptide bound to fingernails or toenails via a binding site on the peptide. The term "peptide-substrate complex" refers to either peptide-hair, peptide-skin, or peptide-nail complexes. The term "MBso" refers to the concentration of the binding peptide that gives a signal that is 50% of the maximum signal obtained in an ELISA-based binding assay, as described in Example 9. The MBso provides an indication of the strength of the binding interaction or affinity of the components of the complex. The lower the value of MBso, the stronger the interaction of the peptide with its corresponding substrate. The term "binding affinity" refers to the strength of the interaction of a binding peptide with its respective substrate. The binding affinity is defined herein in terms of the MBso value, determined in an ELISA-based binding assay. The term "nanoparticles" are herein defined as particles with an average particle diameter of between 1 and 100 nm. Preferably, the average particle diameter of the particles is between about 1 and 40 nm. As used herein, "particle size" and "particle diameter" have the same meaning. Nanoparticles include, but are not limited to, metallic, semiconductor, polymer, or silica particles. The term "amino acid" refers to the basic chemical structural unit of a protein or polypeptide. The following abbreviations are used herein to identify specific amino acids: Three-Letter One-Letter Amino Acid Abbreviation Abbreviation Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutamine Gin Q (Table Removed) "Gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (51 non-coding sequences) and following (3' non-coding sequences) the coding sequence. "Native gene" refers to a gene as found in nature with its own regulatory sequences "Chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. A "foreign" gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. "Synthetic genes" can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art. These building blocks are ligated and annealed to form gene segments which are then enzymatically assembled to construct the entire gene. "Chemically synthesized", as related to a sequence of DMA, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DMA may be accomplished using well-established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines. Accordingly, the genes can be tailored for optimal gene expression based on optimization of nucleotide sequence to reflect the codon bias of the host cell. The skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available. "Coding sequence" refers to a DMA sequence that codes for a specific amino acid sequence. "Suitable regulatory sequences" refer to nucleotide sequences located upstream (51 non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure. i "Promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coxiing sequence is located 3' to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even 20 comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity. The term "expression", as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide. The term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" organisms. The term "host cell" refers to cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence. The terms "plasmid", "vector" and "cassette" refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular doublestranded DMA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DMA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell. "Transformation cassette" refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitate transformation of a particular host cell. "Expression cassette" refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host. The term "phage" or "bacteriophage" refers to a virus that infects bacteria. Altered forms may be used for the purpose of the present invention. The preferred bacteriophage is derived from the "wild" phage, called M13. The M13 system can grow inside a bacterium, so that it does not destroy the cell it infects but causes it to make new phages continuously. It is a single-stranded DNA phage. The term "phage display" refers to the display of functional foreign peptides or small proteins on the surface of bacteriophage or phagemid particles. Genetically engineered phage may be used to present peptides as segments of their native surface proteins. Peptide libraries may be produced by populations of phage with different gene sequences. "PCR" or "polymerase chain reaction" is a technique used for the amplification of specific DNA segments (U.S. Patent Nos. 4,683,195 and 4,800,159). Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) (hereinafter "Maniatis"); and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Press Spring Harbor, NY (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987). The present invention comprises specific hair-binding, skin-binding, and nail-binding peptides and their use in conditioners and coloring agents for the hair, skin, and nails. Body Surfaces Body surfaces of the invention are any surface on the human body that will serve as a substrate for a binding peptide. Typical body surfaces include, but are not limited to hair, skin, nails, teeth, gums, corneal tissue and the tissues of the oral cavity. In many cases the body surfaces of the invention will be exposed to air, however in some instances, the oral cavity for example, the surfaces will be internal. Accordingly body surfaces may include layers of both epithelial and well as endothelial cells. Samples of body surfaces are available from a variety of sources. For example, human hair samples are available commercially, for example from International Hair Importers and Products (Bellerose, NY), in different colors, such as brown, black, red, and blond, and in various types, such as African-American, Caucasian, and Asian. Additionally, the hair samples may be treated for example using hydrogen peroxide to obtain bleached hair. Pig skin, available from butcher shops and supermarkets, Vitro- Skin®, available from IMS Inc. (Milford, CT), and EpiDerm™, available from MatTek Corp. (Ashland, MA), are good substitutes for human skin. Human fingernails and toenails may be obtained from volunteers. Extracted human teeth and false teeth may be obtained from Dental offices. Additionally, hydroxyapatite, available in many forms for example from Berkeley Advanced Biomaterials, Inc. (San Leandro, CA) may be used as a model for human teeth. Body Surface-Binding Peptides Body surface-binding peptides as defined herein are peptide sequences that specifically bind with high affinity to specific body surfaces, including, but not limited to hair, skin, nails, teeth, tongue, cheeks, lips, gums, corneal tissue and the tissues of the oral cavity, for example. Body surface-binding peptides of the present invention are from about 7 amino acids to about 45 amino acids, more preferably, from about 7 amino acids to about 20 amino acids. The binding peptides of the invention have a binding affinity for their respective substrate, as measured values, of less than or equal to about 10~2 M, less than or equal to about 10~3 M, less than or equal to about 10~4 M, less than or equal to about 10~5 M, preferably less than or equal to about 10~6 M, and more preferably less than or equal to about 10~7 M. Suitable body surface-binding peptide sequences may be selected using methods that are well known in the art. The peptides of the present invention are generated randomly and then selected against a specific body surface, for example, hair, skin, nail ,or oral cavity surface sample, based upon their binding affinity for the surface of interest. The generation of random libraries of peptides is well known and may be accomplished by a variety of techniques including, bacterial display (Kemp, D.J.; Proc. Natl. Acad. Sci. USA 78(7):4520-4524 (1981), and Helfman et al., Proc. Natl. Acad. Sci. USA 80(1):31-35, (1983)), yeast display (Chien et al., Proc Natl Acad Sci USA 88(21 ):9578-82 (1991)), combinatorial solid phase peptide synthesis (U.S. Patent No. 5,449,754, U.S. Patent No. 5,480,971, U.S. Patent No. 5,585,275, U.S. Patent No.5,639,603), and phage display technology (U.S. Patent No. 5,223,409, U.S. Patent No. 5,403,484, U.S. Patent No. 5,571,698, U.S. Patent No. 5,837,500). Techniques to generate such biological peptide libraries are described in Dani, M, J. of Receptor & Signal Transduction Res., 21(4):447-468 (2001). A preferred method to randomly generate peptides.is by phage display. Phage display Is an in vitro selection technique in which a peptide or protein is genetically fused to a coat protein of a bacteriophage, resulting in display of fused peptide on the exterior of the phage virion, while the DNA encoding the fusion resides within the virion. This physical linkage between the displayed peptide and the DNA encoding it allows screening of vast numbers of variants of peptides, each linked to a corresponding DNA sequence, by a simple in vitro selection procedure called "biopanning". In its simplest form, biopanning is carried out by incubating the pool of phage-displayed variants with a target of interest that has been immobilized on a plate or bead, washing away unbound phage, and eluting specifically bound phage by disrupting the binding interactions between the phage and the target. The eluted phage is then amplified in vivo and the process is repeated, resulting in a stepwise enrichment of the phage pool in favor of the tightest binding sequences. After 3 or more rounds of selection/amplification, individual clones are characterized by DNA sequencing. After a suitable library of peptides has been generated, they are then contacted with an appropriate amount of the test substrate, specifically a body surface sample. The library of peptides is dissolved in a suitable solution for contacting the sample. The body surface sample may be suspended in the solution or may be immobilized on a plate or bead. A preferred solution is a buffered aqueous saline solution containing a surfactant. A suitable solution is Tris-buffered saline (TBS) with 0.5% Tween® 20. The solution may additionally be agitated by any means in order to increase the mass transfer rate of the peptides to body surface sample, thereby shortening the time required to attain maximum binding. Upon contact, a number of the randomly generated peptides will bind to the body surface sample to form a peptide-body-surface complex, for example a peptide-hair, peptide-skin, peptide-nail, or peptide-oral cavity surface complex. Unbound peptide may be removed by washing. After all unbound material is removed, peptides having varying degrees of binding affinities for the test surface may be fractionated by selected washings in buffers having varying stringencies. Increasing the stringency of the buffer used increases the required strength of the bond between the peptide and body surface in the peptide-body surface complex. A number of substances may be used to vary the stringency of the buffer solution in peptide selection including, but not limited to, acidic pH (1.5-3.0); basic pH (10-12.5); high salt concentrations such as MgCfe (3-5 M) and LiCI (5-10 M); water; ethylene glycol (25-50%); dioxane (5-20%); thiocyanate (1-5 M); guanidine (2-5 M); urea (2-8 M); and various concentrations of different surfactants such as SDS (sodium dodecyl sulfate), DOC (sodium deoxycholate), Nonidet P-40, Triton X-100, Tween® 20, wherein Tween® 20 is preferred. These substances may be prepared in buffer solutions including, but not limited to, Tris-HCI, Tris-buffered saline, Tris-borate, Tris-acetic acid, triethylamine, phosphate buffer, and glycine-HCl, wherein Tris-buffered saline solution is preferred. It will be appreciated that peptides having increasing binding affinities for body surface substrates may be eluted by repeating the selection process using buffers with increasing stringencies. The eluted peptides can be identified and sequenced by any means known in the art. Thus, the following method for generating the body surface-binding peptides, for example, hair-binding peptides, skin-binding peptides, nailbinding peptides, or oral cavity surface-binding peptides, of the present invention was used. A library of combinatorial generated phage-peptides is contacted with the body surface of interest, to form phage peptide-body surface complexes. The phage-peptide-body-surface complex is separated from uncomplexed peptides and unbound substrate, and the bound phage-peptides from the phage-peptide-body surface complexes is eluted from the complex, preferably by acid treatment. Then, the eluted peptides are identified and sequenced. To identify peptide sequences that bind to one substrate but not to another, for example peptides that bind to hair, but not to skin or peptides that bind to skin, but not to hair, a subtractive panning step is added. Specifically, the library of combinatorial generated phage-peptides is first contacted with the non-target to remove phage-peptides that bind to it. Then, the non-binding phage-peptides are contacted with the desired substrate and the above process is followed. Alternatively, the library of combinatorial generated phage-peptides may be contacted with the non-target and the desired substrate simultaneously. Then, the phage-peptide-body surface complexes are separated from the phage-peptide-non-target complexes and the method described above is followed for the desired phage-peptide-body surface complexes. One embodiment of the present invention provides a modified phage display screening method for isolating peptides with a higher affinity for body surfaces. In the modified method, the phage-peptide-body surface complexes are formed as described above. Then, these complexes are treated with an elution buffer. Any of the elution buffers described above may be used. Preferably, the elution buffer is an acidic solution. Then, the remaining, elution-resistant phage-peptide-body surface complexes are used to directly infect a bacterial host cell, such as £. co// ER2738. The infected host cells are grown in an appropriate growth medium, such as LB (Luria-Bertani) medium, and this culture is spread onto agar, containing a suitable growth medium, such as LB medium with IPTG (isopropyl p-D-thiogalactopyranoside) and S-Gal™. After growth, the plaques are picked for DNA isolation and sequencing to identify the peptide sequences with a high binding affinity for the body surface of interest. In another embodiment, PCR may be used to identify the elutionresistant phage-peptides from the modified phage display screening method, described above, by directly carrying out PCR on the phagepeptide- body surface complexes using the appropriate primers, as described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976, which is incorporated herein by reference. Hair-binding, skin-binding, and nail-binding peptides have been identified using the above methods. Specifically, binding peptides were isolated that have a high affinity for normal brown hair, given as SEQ ID N0s:3-18, 28-38, 40-56, and 64; shampoo resistant, normal brown hair, given as SEQ ID NO:66, 69 and 70; bleached hair, given as SEQ ID NOs:7, 8, 19-27, 38-40, 43, 44, 47, 57, 58, and 59, fingernail, given as SEQ ID NOs:53 and 60; and skin, given as SEQ ID NO:61. Additionally, the fingernail-binding peptides were found to bind to bleached hair and may be used in the peptide-based hair conditioners and hair colorants of the invention. The bleached hair-binding peptides will bind to fingernails and may be used in the peptide-based nail colorants of the invention. Production of Binding Peptides The binding peptides of the present invention may be prepared using standard peptide synthesis methods, which are well known in the art (see for example Stewart et al., Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, IL, 1984; Bodanszky, Principles of Peptide Synthesis, Springer-Verlag, New York, 1984; and Pennington etal., Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994). Additionally, many companies offer custom peptide synthesis services. Alternatively, the peptides of the present invention may be prepared using recombinant DMA and molecular cloning techniques. Genes encoding the hair-binding, skin-binding or nail-binding peptides may be produced in heterologous host cells, particularly In the cells of microbial hosts. Preferred heterologous host cells for expression of the binding peptides of the present invention are microbial hosts that can be found broadly within the fungal or bacterial families and which grow over a wide range of temperature, pH values, and solvent tolerances. Because transcription, translation, and the protein biosynthetic apparatus are the same irrespective of the cellular feedstock, functional genes are expressed irrespective of carbon feedstock used to generate cellular biomass. Examples of host strains include, but are not limited to, fungal or yeast species such as Aspergillus, Trichoderma, Saccharomyces, Pichia, Candida, Hansenula, or bacterial species such as Salmonella, Bacillus, Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Pseudomonas, Methylomonas, Methylobacter, Alcaligenes, Synechocystis, Anabaena, Thiobacillus, Methanobacterium and Klebsiella. A variety of expression systems can be used to produce the peptides of the present invention. Such vectors include, but are not limited to, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from insertion elements, from yeast episoms, from viruses such as baculoviruses, retroviruses and vectors derived from combinations thereof such as those derived from piasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression system constructs may contain regulatory regions that regulate as well as engender expression. In general, any system or vector suitable to maintain, propagate or express polynucleotide or polypeptide in a host cell may be used for expression in this regard. Microbial expression systems and expression•» vectors contain regulatory sequences that direct high level expression of foreign proteins relative to the growth of the host cell. Regulatory sequences are well known to those skilled in the art and examples include, but are not limited to, those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of regulatory elements in the vector, for example, enhancer sequences. Any of these could be used to construct chimeric genes for production of the any of the binding peptides of the present invention. These chimeric genes could then be introduced into appropriate microorganisms via transformation to provide high level expression of the peptides. Vectors or cassettes useful for the transformation of suitable host cells are well known in the art. Typically the vector or cassette contains sequences directing transcription and translation of the relevant gene, one or more selectable markers, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5' of the gene, which harbors transcriptional initiation controls and a region 3' of the DMA fragment which controls transcriptiona! termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host. Selectable marker genes provide a phenotypic trait for selection of the transformed host cells such as tetracycline or ampicillin resistance in E, coll. Initiation control regions or promoters which are useful to drive expression of the chimeric gene in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving the gene is suitable for producing the binding peptides of the present invention including, but not limited to: CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for . expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, ara, tet, tip, IP\_, IPp^, 17, tac, and trc (useful for expression in Escherichia coli) as well as the amy, apr, npr promoters and various phage promoters useful for expression in Bacillus. Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary, however, it is most preferred if included. The vector containing the appropriate DNA sequence as described supra, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the peptide of the present invention. Cell-free translation systems can also be employed to produce such peptides using RNAs derived from the DNA constructs of the present invention. Optionally it may be desired to produce the instant gene product as a secretion product of the transformed host. Secretion of desired proteins into the growth media has the advantages of simplified and less costly purification procedures. It is well known in the art that secretion signal sequences are often useful in facilitating the active transport of expressible proteins across cell membranes. The creation of a transformed host capable of secretion may be accomplished by the incorporation of a DNA sequence that codes for a secretion signal which is functional in the production host. Methods for choosing appropriate signal sequences are well known in the art (see for example EP 546049 and WO 9324631). The secretion signal DNA or facilitator may be located between the expression-controlling DNA and the instant gene or gene fragment, and in the same reading frame with the latter. Peptide-Based Hair Conditioners The peptide-based'hair conditioners of the present invention are formed by coupling a hair-binding peptide (HBP) with a hair conditioning agent (HCA). The hair-binding peptide part of the conditioner binds strongly to the hair, thus keeping the conditioning agent attached to the hair for a long lasting conditioning effect. The hair-binding peptides include, but are not limited to, hair-binding peptides selected by the screening methods described above, including the hair-binding peptide sequences of the invention, given by SEQ ID NOs: 3-59, 64, 66, 69, and 70, most preferably the peptides given by SEQ ID NO:46 and SEQ ID NO:66, which bind strongly to hair, but not to skin. Additionally, any known hair-binding peptide may be used, including but not limited to SEQ ID NO:1, and SEQ ID NOs:76-98, described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976 and by Janssen et al. in WO 04048399, respectively, both of which are incorporated herein by reference. For bleached hair, the fingernail-binding peptide, given as SEQ ID NO:60, may also be used. Hair conditioning agents as herein defined are agents which improve the appearance, texture, and sheen of hair as well as increasing hair body or suppleness. Hair conditioning agents, include, but are not limited to, styling aids, hair straightening aids, hair strengthening aids, and volumizing agents, such as nanoparticles. In the peptide-based hair conditioners of the present invention, any known hair conditioning agent may be used. Hair conditioning agents are well known in the art, see for example Green et al. (WO 0107009), incorporated herein,by reference, and are available commercially from various sources. Suitable examples of hair conditioning agents include, but are not limited to, cationic polymers, such as cationized guar gum, diallyl quaternary ammonium salt/acrylamide copolymers, quaternized polyvinylpyrrolidone and derivatives thereof, and various polyquaternium-compounds; cationic surfactants, such as stearalkonium chloride, centrimonium chloride, and Sapamin hydrochloride; fatty alcohols, such as behenyl alcohol; fatty amines, such as stearyl amine; waxes; esters; nonionic polymers, such as polyvinylpyrrolidone, polyvinyl alcohol, and polyethylene glycol; silicones; siloxanes, such as decamethylcyclopentasiloxane; polymer emulsions, such as amodimethicone; and nanoparticles, such as silica nanoparticles and polymer nanoparticles. The preferred hair conditioning agents of the present invention contain amine or hydroxyl functional groups to facilitate coupling to the hair-binding peptides, as described below. Examples of preferred conditioning agents are octylamine (CAS No. 111-86-4), stearyl amine (CAS No. 124-30-1), behenyl alcohol (CAS No. 661-19-8, Cognis Corp., Cincinnati, OH), vinyl group terminated siloxanes, vinyl group terminated silicone (CAS No. 68083-19-2), vinyl group terminated methyl vinyl siloxanes, vinyl group terminated methyl vinyl silicone (CAS No. 68951-99-5), hydroxyl terminated siloxanes, hydroxyl terminated silicone (CAS No. 80801-30-5), amino-modified silicone derivatives, [(aminoethyl)amino]propyl hydroxyl dimethyl siloxanes, [(aminoethyl)amino]propyl hydroxyl dimethyl silicones, and alpha-tridecylomega- hydroxy-poly(oxy-1,2-ethanediyl) (CAS No. 24938-91-8). The peptide-based hair conditioners of the present invention are prepared by coupling a specific hair-binding peptide to a hair conditioning agent, either directly or via an optional spacer. The coupling interaction may be a covalent bond or a non-covalent interaction, such as hydrogen bonding, electrostatic interaction, hydrophobic interaction, or Van der Waals interaction. In the case of a non-covalent interaction, the peptidebased hair conditioner may be prepared by mixing the peptide with the conditioning agent and the optional spacer (if used) and allowing sufficient time for the interaction to occur. The unbound materials may be separated from the resulting peptide-based hair conditioner adduct using methods known in the art, for example, gel permeation chromatography. The peptide-based hair conditioners of the invention may also be prepared by covalently attaching a specific hair-binding peptide to a hair conditioning agent, either directly or through a spacer. Any known peptide or protein conjugation chemistry may be used to form the peptide-based hair conditioners of the present invention. Conjugation chemistries are well-known in the art (see for example, Hermanson, Bioconjugate Techniques, Academic Press, New York (1996)). Suitable coupling agents include, but are not limited to, carbodiimide coupling agents, diacid chlorides, diisocyanates and other difunctional coupling reagents that are reactive toward terminal amine and/or carboxylic acid terminal groups on the peptides and to amine, carboxylic acid, or alcohol groups on the hair conditioning agent. The preferred coupling agents are carbodiimide coupling agents, such as 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and N,N'-dicyclohexyl-carbodiimide (DCC), which may be used to activate carboxylic acid groups for coupling to alcohol, and amine groups. Additionally, it may be necessary to protect reactive amine or carboxylic > acid groups on the peptide to produce the desired structure for the peptide-based hair conditioner. The use of protecting groups for amino acids, such as t-butyloxycarbonyl (t-Boc), are well known in the art (see for example Stewart et al., supra; Bodanszky, supra; and Pennington et al.f supra). In some cases it may be necessary to introduce reactive groups, such as carboxylic acid, alcohol, amine, or aldehyde groups, on the hair conditioning ayent for coupling to the hair-binding peptide. These modifications may be done using routine chemistry such as oxidation, reduction and the like, which is well known in the art. It may also be desirable to couple the hair-binding peptide to the hair conditioning agent via a spacer. The spacer serves to separate the conditioning agent from the peptide to ensure that the agent does not interfere with the binding of the peptide to the hair. The spacer may be any of a variety of molecules, such as alkyl chains, phenyl compounds, ethylene glycol, amides, esters and the like. Preferred spacers are hydrophilic and have a chain length from 1 to about 100 atoms, more preferably, from 2 to about 30 atoms. Examples of preferred spacers include, but are not limited to ethanol amine, ethylene glycol, polyethylene with a chain length of 6 carbon atoms, polyethylene glycol with 3 to 6 repeating units, phenoxyethanol, propanolamide, butylene glycol, butyleneglycolamide, propyl phenyl chains, and ethyl, propyl, hexyl, steryl, cetyl, and palmitoyl alkyl chains. The spacer may be covalently attached to the peptide and the hair conditioning agent using any of the coupling chemistries described above. In order to facilitate incorporation of the spacer, a bifunctional cross-linking agent that contains a spacer and reactive groups at both ends for coupling to the peptide and the conditioning agent may be used. Suitable bifunctional cross-linking agents are well known in the art and include, but are not limited to diamines, such a as 1,6-diaminohexane; dialdehydes, such as glutaraldehyde; bis Nhydroxysuccinimide esters, such as ethylene glycol-bis(succinic acid Nhydroxysuccinimide ester), disuccinimidyl glutarate, disuccinimidyl suberate, and ethylene glycol-bis(succinimidylsuccinate); diisoqyantes, such as hexamethylenediisocyanate; bis oxiranes, such as 1,4 butanediyl diglycidyl ether; dicarboxylic acids, such as succinyldisalicylate; and the like. Heterobifunctional cross-linking agents, which contain a different reactive group at each end, may also be used. Examples of heterobifunctional cross-linking agents include, but are not limited to compounds having the following structure: where : RI is H or a substituent group such as -SOsNa, -NO2, or -Br; and R2 is a spacer such as -CH2CH2 (ethyl), -(CH2)s (propyl), or -(Ch^bCeHs (propyl phenyl). An example of such a heterobifunctional cross-linking agent is 3-maleimidopropionic acid N-hydroxysuccinimide ester. The Nhydroxysuccinimide ester group of these reagents reacts with amine or alcohol groups on the conditioner, while the maleimide group reacts with thiol groups present on the peptide. A thiol group may be incorporated into the peptide by adding a cysteine group to at least one end of the binding peptide sequence (i.e., the C-terminus or N-terminus). Several spacer amino acid residues, such as glycine, may be incorporated between the binding peptide sequence and the terminal cysteine to separate the reacting thiol group from the binding sequence. Additionally, the spacer may be a peptide composed of any amino acid and mixtures thereof. The preferred peptide spacers are composed of the amino acids glycine, alanine, and serine, and mixtures thereof. In addition, the peptide spacer may contain a specific enzyme cleavage site, such as the protease Caspase 3 site, given by SEQ ID NO:65, which allows for the enzymatic removal of the conditioning agent from the hair. The peptide spacer may be from 1 to about 50 amino acids, preferably from 1 to about 20 amino acids. These peptide spacers may be linked to the binding peptide sequence by any method known in the art. For example, the entire binding peptide-peptide spacer diblock may be prepared using the standard peptide synthesis methods described supra. In addition, the binding peptide and peptide spacer blocks may be combined using carbodiimide coupling agents (see for example, Hermanson, Bioconjugate Techniques, Academic Press, New York (1996)), diacid chlorides, diisocyanates and other difunctional coupling reagents that are reactive to terminal amine and/or carboxylic acid terminal groups on the peptides. Alternatively, the entire binding peptide-peptide spacer diblock may be prepared using the recombinant DMA and molecular cloning techniques described supra. The spacer may also be a combination of a peptide spacer and an organic spacer molecule, which may be prepared using the methods described above. It may also be desirable to have multiple hair-binding peptides coupled to the hair conditioning agent to enhance the interaction between the peptide-based hair conditioner and the hair. Either multiple copies of the same hair-binding peptide or a combination of different hair-binding peptides may be used. In the case of large conditioning particles (e.g., particle emulsions), a large number of hair-binding peptides, i.e., up to about 1,000, may be coupled to the conditioning agent. A smaller number of hair-binding peptides can be coupled to the smaller conditioner molecules, i.e., up to about 50. Therefore, in one embodiment of the present invention, the peptide-based hair conditioners are diblock compositions consisting of a hair-binding peptide (HBP) and a hair conditioning agent (HCA), having the general structure (HBP)n - HCA, where n ranges from 1 to about 1,000, preferably from 1 to about 50. In another embodiment, the peptide-based hair conditioners contain a spacer (S) separating the hair-binding peptide from the hair conditioning agent, as described above. Multiple copies of the hair-binding peptide may be coupled to a single spacer molecule. In this embodiment, the peptidebased hair conditioners are triblock compositions consisting of a hairbinding peptide, a spacer, and a hair conditioning agent, having the general structure [(HBP)m - S]n - HCA, where n ranges from 1 to about 1,000, preferably n is 1 to about 50, and m ranges from 1 to about 50, preferably m is 1 to about 10. It should be understood that as used herein, HBP is a generic designation and is not meant to refer to a single hair binding peptide sequence. Where n or m as used above, is greater than 1, it is well within the scope of the invention to provide for the situation where a series of hair binding peptides of different sequences may form a part of the composition. Additionally, it should be understood that these structures do not necessarily represent a covalent bond between the peptide, the hair conditioning agent, and the optional spacer. As described above, the coupling interaction between the peptide, the hair conditioning agent, and the optional spacer may be either covalent or non-covalent. The peptide-based hair conditioners of the present invention may be used in compositions for hair care. It should also be recognized that the hair-binding peptides themselves can serve as conditioning agents for the treatment of hair. Hair care compositions are herein defined as compositions for the treatment of hair, including but not limited to shampoos, conditioners, lotions, aerosols, gels, mousses, and hair dyes comprising an effective amount of a peptide-based hair conditioner or a mixture of different peptide-based hair conditioners in a cosmetically acceptable medium. An effective amount of a peptide-based hair conditioner or hair-binding peptide for use in a hair care composition is herein defined as a proportion of from about 0.01% to about 10%, preferably about 0.01% to about 5% by weight relative to the total weight of the composition. Components of a cosmetically acceptable medium for hair care compositions are described by Philippe et al. in U.S. Patent No. 6,280,747, and by Omura et al. in U.S. Patent No. 6,139,851 and Cannell et al. in U.S. Patent No. 6,013,250, all of which are incorporated herein by reference. For example, these hair care compositions can be aqueous, alcoholic or aqueous-alcoholic solutions, the alcohol preferably being ethanol or isopropanol, in a proportion of from about 1 to about 75% by weight relative to the total weight, for the aqueous-alcoholic solutions. Additionally, the hair care compositions may contain one or more conventional cosmetic or dermatological additives or adjuvants including but not limited to, antioxidants, preserving agents, fillers, surfactants, UVA and/or UVB sunscreens, fragrances, thickeners, wetting agents and anionic, nonionic or amphoteric polymers, and dyes or pigments. Peptide-Based Skin Conditioners The peptide-based skin conditioners of the present invention are formed by coupling a skin-binding peptide (SBP) with a skin conditioning agent (SCA). The skin-binding peptide part of the conditioner binds strongly to the skin, thus keeping the conditioning agent attached to the skin for a long lasting conditioning effect. The skin-binding peptides include, but are not limited to, skin-binding peptides selected by the screening methods described above, including the skin-binding peptide sequence of the invention, given as SEQ ID NO:61. Additionally, any known skin-binding peptide may be used, including but not limited to SEQ ID NO:2, and SEQ ID NOs:99-104, described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976 and by Janssen et al. in WO 04048399, respectively. Skin conditioning agents as herein defined include, but are not limited to astringents, which tighten skin; exfoliants, which remove dead skin cells; emollients, which help maintain a smooth, soft, pliable appearance; humectants, which increase the water content of the top layer of skin; occlusives, which retard evaporation of water from the skin's surface; and miscellaneous compounds that enhance the appearance of dry or damaged skin or reduce flaking and restore suppleness . In the peptide-based skin conditioners of the present invention, any known skin conditioning agent may be used. Skin conditioning agents are well known in the art, see for example Green et al. (WO 0107009), and are available commercially from various sources. Suitable examples of skin conditioning agents include, but are not limited to, alpha-hydroxy acids, beta-hydroxy acids, polyols, hyaluronic acid, D,L-panthenol, polysalicylates, vitamin A palmitate, vitamin E acetate, glycerin, sorbitol, silicones, silicone derivatives, lanolin, natural oils and triglyceride esters. The preferred skin conditioning agents of the present invention are polysalicylates, propylene glycol (CAS No. 57-55-6, Dow Chemical, Midland, Ml), glycerin (CAS No. 56-81-5, Proctor & Gamble Co., Cincinnati, OH), glycolic acid (CAS No. 79-14-1, DuPont Co., Wilmington, DE), lactic acid (CAS No. 50-21-5, Alfa Aesar, Ward Hill, MA), malic acid (CAS No. 617-48-1, Alfa Aesar), citric acid (CAS No. 77-92-9, Alfa Aesar), tartaric acid (CAS NO. 133-37-9, Alfa Aesar), glucaric acid (CAS No. 87- 73-0), galactaric acid (CAS No. 526-99-8), 3-hydroxyvaleric acid (CAS No. 10237-77-1), salicylic acid (CAS No. 69-72-7, Alfa Aesar), and 1,3 propanediol (CAS No. 504-63-2, DuPont Co., Wilmington, DE). Polysalicylates may be prepared by the method described by White et al. in U.S. Patent No. 4,855,483, incorporated herein by reference. Glucaric acid may be synthesized using the method described by Merbouh et al. (Carbohydr. Res. 336:75-78 (2001). The 3-hydroxyvaleric acid may be prepared as described by Bramucci in WO 02012530. The peptide-based skin conditioners of the present invention are prepared by coupling a specific skin-binding peptide to the skin conditioning agent, either directly or via a spacer. Any of the coupling methods described above may be used. It may be necessary to introduce reactive groups, such as carboxylic acid, alcohol, amine, or aldehyde groups, on the skin conditioning agent for coupling to the hair-binding peptide, as described above. It may also be desirable to have multiple skin-binding peptides coupled to the skin conditioning agent to enhance the interaction between the peptide-based skin conditioner and the skin. Either multiple copies of the same skin-binding peptide or a combination of different skin-binding peptides may be used. In the case of large conditioning particles, a large number of skin-binding peptides, i.e., up to about 1,000, may be coupled to the conditioning agent. A smaller number of skin-binding peptides can be attached to the smaller conditioner molecules, i.e., up to about 50. Therefore, in one embodiment of the present invention, the peptide-based skin conditioners are djblock compositions consisting of a skin-binding peptide (SBP) and a skin conditioning agent (SCA), having the general structure (SBP)n - SCA, where n ranges from 1 to about 1,000, preferably from 1 to about 50. , In another embodiment, the peptide-based skin conditioners contain a spacer (S) separating the skin-binding peptide from the skin conditioning agent, as described above. Multiple copies of the skin-binding peptide may be coupled to a single spacer molecule. In this embodiment, the peptide-based skin conditioners are triblock compositions consisting of a skin binding peptide, a spacer, and a skin conditioning agent, having the general structure [(SBP)m - S]n - SCA, where n ranges from 1 to about 1,000, preferably n is 1 to about 50, and m ranges from 1 to about 50, preferably m is 1 to about 10. It should be understood that as used herein, SBP is a generic designation and is not meant to refer to a single skin binding peptide sequence. Where n or m as used above, is greater than 1, it is well within the scope of the invention to provide for the situation where a series of skin binding peptides of different sequences may form a part of the composition. Additionally, it should be understood that these structures do not necessarily represent a covalent bond between the peptide, the skin conditioning agent, and the optional spacer. As described above, the coupling interaction between the peptide, the skin conditioning agent, and the optional spacer may be either covalent or non-covalent. The peptide-based skin conditioners of the present invention may be used in compositions for skin care. It should also be recognized that the skin-binding peptides themselves can serve as conditioning agents for skin. Skin care compositions are herein defined as compositions comprising an effective amount of a peptide-based skin conditioner or a mixture of different peptide-based skin conditioners in a cosmetically acceptable medium. The uses of these compositions include, but are not limited to, skin care, skin cleansing, make-up, and anti-wrinkle products. An effective amount of a peptide-based skin conditioner or skin-binding peptide for skin care compositions is herein defined as a proportion of from about 0.001% to about 10%, preferably about 0.01% to about 5% by weight relative to the total weight of the composition. This proportion may vary as a function of the type of skin care composition. Suitable compositions for a cosmetically acceptable medium are described by Philippe et al. supra. For example, the cosmetically acceptable medium may be an anhydrous composition containing a fatty substance in a proportion generally of from about 10 to about 90% by weight relative to the total weight of the composition, where the fatty phase containing at least one liquid, solid or semi-solid fatty substance. The fatty substance includes, but is not limited to, oils, waxes, gums, and so-called pasty fatty substances. Alternatively, the compositions may be in the form of a stable dispersion such as a water-in-oil or oil-in-water emulsion. Additionally, the compositions may contain one or more conventional cosmetic or dermatological additives or adjuvants, including but not limited to, antioxidants, preserving agents, fillers, surfactants, UVA and/or UVB sunscreens, fragrances, thickeners, wetting agents and anionic, nonionic or amphoteric polymers, and dyes or pigments. Peptide-Based Hair Colorants The peptide-based hair colorants of the present invention are formed by coupling a hair-binding peptide (HBP) with a coloring agent (C). The hair-binding peptide part of the peptide-based hair colorant binds strongly to the hair, thus keeping the coloring agent attached to the hair for a long lasting hair coloring effect. The hair-binding peptides include, but are not limited to, hair-binding peptides selected by the screening methods described above, including the hair-binding peptide sequences of the invention, given by SEQ ID NOs: 3-59, 64, 66, 69 and 70, most preferably the peptides given by SEQ ID NO:46 and SEQ ID NO:66, which bind strongly to hair, but not to skin. Additionally, any known hair-binding peptide may be used, including but not limited to SEQ ID NO:1, and SEQ ID NOs:76-98, described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976 and by Janssen et al. in WO 04048399, respectively. For bleached hair, the fingernail-binding peptide, given as SEQ ID NO:60, may also be used. Coloring agents as herein defined are any dye, pigment, and the like that may be used to change the color of hair, skin, or nails. In the peptide-based hair colorants of the present invention, any known coloring agent may be used. Hair coloring agents are well known in the art (see for example Green et al. supra, CFTA International Color Handbook, 2nd ed., Micelle Press, England (1992) and Cosmetic Handbook, US Food and Drug Administration, FDA/IAS Booklet (1992)), and are available commercially from various sources (for example Bayer, Pittsburgh, PA; Ciba-Geigy, Tarrytown, NY; ICI, Bridgewater, NJ; Sandoz, Vienna, Austria; BASF, Mount Olive, NJ; and Hoechst, Frankfurt, Germany). Suitable hair coloring agents include, but are not limited to dyes, such as 4- hydroxypropylamino-3-nitrophenol, 4-amino-3-nitrophenol, 2-amino-6- chloro-4-nitrophenol, 2-nitro-paraphenylenediamine, N,N-hydroxyethyl-2- nitro-phenylenediamine, 4-nitro-indole, Henna, HC Blue 1, HC Blue 2, HC Yellow 4, HC Red 3, HC Red 5, Disperse Violet 4, Disperse Black 9, HC Blue 7, HC Blue 12, HC Yellow 2, HC Yellow 6, HC Yellow 8, HC Yellow 12, HC Brown 2, D&C Yellow 1, D&C Yellow 3, D&C Blue 1, Disperse Blue 3, Disperse violet 1, eosin derivatives such as D&C Red No. 21 and halogenated fluorescein derivatives such as D&C Red No. 27, D&C Red Orange No. 5 in combination with D&C Red No. 21 and D&C Orange No. 10; and pigments, such as D&C Red No. 36 and D&C Orange No. 17, the calcium lakes of D&C Red Nos. 7,11, 31 and 34, the barium lake of D&C Red No. 12, the strontium lake of D&C Red No. 13, the aluminum lakes of FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27, of D&C Red No. 21, and of FD&C Blue No. 1, iron oxides, manganese violet, chromium oxide, titanium dioxide, titanium dioxide nanoparticles, zinc oxide, barium oxide, ultramarine blue, bismuth citrate, and carbon black particles. The preferred hair coloring agents of the present invention are D&C Yellow 1 and 3, HC Yellow 6 and 8, D&C Blue 1, HC Blue 1, HC Brown 2, HC Red 5, 2-nitro-paraphenylenediamine, N,N-hydroxyethyl-2- nitro-phenylenediamine, 4-nitro-indo!e, and carbon black. Metallic and semiconductor nanoparticles may also be used as hair coloring agents due to their strong emission of light (Vic et al. U.S. Patent Application Publication No. 2004/0010864). The metallic nanoparticles include, but are not limited to, particles of gold, silver, platinum, palladium, iridium, rhodium, osmium, iron, copper, cobalt, and alloys composed of these metals. An "alloy" is herein defined as a homogeneous mixture of two or more metals. The "semiconductor nanoparticles" include, but are not limited to, particles of cadmium selenide, cadmium sulfide, silver sulfide, cadmium sulfide, zinc oxide, zinc sulfide, zinc selenide, lead sulfide, gallium arsenide, silicon, tin oxide, iron oxide, and indium phosphide. The nanoparticles are stabilized and made water-soluble by the use of a suitable organic coating or monolayer. As used herein, monolayer-protected nanoparticles are one type of stabilized nanoparticle. Methods for the preparation of stabilized, water-soluble metal and semiconductor nanoparticles are known in the art, and are described by Huang et al. in copending U.S. Patent Application No. 10/622889, which is incorporated herein by reference. The color of the nanoparticles depends on the size of the particles. Therefore, by controlling the size of the nanoparticles, different colors may be obtained. For example, ZnS-coated CdSe nanoparticles cover the entire visible spectrum over a particle size range of 2 to 6 nm. Specifically, CdSe nanoparticles with a core size of 2.3, 4.2, 4.8 and 5.5 nm emit light at the wavelength centered around 485, 565, 590, and 625 nm, respectively. Water-soluble nanoparticles of different sizes may be obtained from a broad size distribution of nanoparticles using the size fractionation method described by Huang, supra. That method comprises the regulated addition of a water-miscible organic solvent to a solution of nanoparticles in the presence of an electrolyte. Increasing additions of the water-miscible organic solvent result in the precipitation of nanoparticles of decreasing size. The metallic and semiconductor nanoparticles may also serve as volumizing agents, as -scribed above. Of particular utility are titanium dioxide nanoparticles that not only serve as a colorant but additionally may serve to block harmful UV radiation. Suitable titanium dioxide nanoparticles are described in U.S. Patent Nos. 5,451,390; 5,672,330; and 5,762,914. Titanium dioxide P25 is an example of a suitable commercial product available from Degussa. Other commercial suppliers of titanium dioxide nanoparticles include Kemira, Sachtleben and Tayca. •» The titanium dioxide nanoparticles typically have an average particle size diameter of less than 100 nanometers (nm) as determined by dynamic light scattering which measures the particle size distribution of particles in liquid suspension. The particles are typically agglomerates which may range from about 3 nm to about 6000 nm. Any process known in the art can be used to prepare such particles. The process may involve vapor phase oxidation of titanium halides or solution precipitation from soluble titanium complexes, provided that titanium dioxide nanoparticles are produced. A preferred process to prepare titanium dioxide nanoparticles is by injecting oxygen and titanium halide, preferably titanium tetrachloride, into a high-temperature reaction zone, typically ranging from 400 to 2000 degrees centrigrade. Under the high temperature conditions present in the reaction zone, nanoparticles of titanium dioxide are formed having high surface area and a narrow size distribution. The energy source in the reactor may be any heating source such as a plasma torch. Additionally, the coloring agent may be a colored, polymeric microsphere. Exemplary polymeric microspheres include, but are not limited to, microspheres of polystyrene, polymethylmethacrylate, polyvinyltoluene, styrene/butadiene copolymer, and latex. For use in the invention, the microspheres have a diameter of about 10 nanometers to about 2 microns. The microspheres may be colored by coupling any suitable dye, such as those described above, to the microspheres. The dyes may be coupled to the surface of the microsphere or adsorbed within the porous structure of a porous microsphere. Suitable microspheres, including undyed and dyed microspheres that are functionalized to enable covalent attachment, are available from companies such as Bang Laboratories (Fishers, IN). The peptide-based hair colorants of the present invention are prepared by coupling a specific hair-binding peptide to a coloring agent, either directly or via a spacer. Any of the coupling methods described above may be used. It may be necessary to introduce reactive groups, such as carboxylic acid, alcohol, amine, or aldehyde groups, on the coloring agent for coupling to the hair-binding peptide. These modifications may be done using routine chemistry, which is well known in the art. For example, the surface of carbon black particles may be oxidized using nitric acid, a peroxide such as hydrogen peroxide, or an inorganic initiator such as ammonium persulfate, to generate functional groups. Preferably, the carbon black surface is oxidized using ammonium persulfate as described by Carrasco-Marin et al. (J. Chem. Soc., Faraday Trans. 93:2211-2215 (1997)). Amino functional groups may be introduced to the surface of carbon black using an organic initiator such as 2,2'- Azobis(2-methylpropionamide)-dihydrochloride. The inorganic pigments and the nanoparticles may be derivatized to introduce carboxylic acid or amino functional groups in a similar manner. Additionally, the hair-binding peptide may be coupled to a pigment using a pigment-binding peptide. Suitable pigment-binding peptide sequences are known in the art. For example, Nomoto et al. in EP1275728 describe peptides that bind to carbon black, copper phthalocyanine, titanium dioxide, and silicon dioxide. O'Brien et al. in copending and commonly owned U.S. Patent Application No. 10/935254 describe peptides that bind to carbon black, Cromophtal® Yellow, Sunfast® Magenta, and Sunfast® Blue. Additional pigment-binding peptides may be identified using the any of the screening methods described above. The pigment-binding peptide may be coupled to the hair-binding peptide either directly or through a spacer using any of the coupling methods described above. The hair-binding peptide-pigment binding peptide diblock or triblock (if a spacer is used) is contacted with the pigment to attach it to the pigment-binding peptide. It may also be desirable to have multiple hair-binding peptides coupled to the coloring agent to enhance the interaction between the peptide-based hair colorant and the hair. Either multiple copies of the same hair-binding peptide or a combination of different hair-binding peptides may be used. In the case of large pigment particles, a large number of hair-binding peptides, i.e., up to about 10,000, may be coupled to the pigment. A smaller number of hair-binding peptides can be coupled to the smaller dye molecules, i.e., up to about 50. Therefore, in one embodiment of the present invention, the peptide-based hair colorants are diblock compositions consisting of a hair-binding peptide (HBP) and a coloring agent (C), having the general structure (HBP)n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500. In another embodiment, the peptide-based hair colorants contain a spacer (S) separating the binding peptide from the hair coloring agent, as described above. Multiple copies of the hair-binding peptide may be coupled to a single spacer molecule. In this embodiment, the peptidebased hair colorants are triblock compositions consisting of a hair-binding peptide, a spacer, and a coloring agent, having the general structure [(HBP)m - S]n - C, where n ranges from 1 to about 10,000 , preferably n is 1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10. It should be understood that as used herein, HBP is a generic designation and is not meant to refer to a single hair binding peptide sequence. Where n or m as used above, is greater than 1, it is well within the scope of the invention to provide for the situation where a series of hair binding peptides of different sequences may form a part of the composition. Additionally, it should be understood that these structures do not necessarily represent a covalent bond between the peptide, the coloring agent, and the optional spacer. As described above, the coupling interaction between the peptide, the coloring agent, and the optional spacer may be either covalent or non-covalent. The peptide-based hair colorants of the present invention may be used in hair coloring compositions for dyeing hair. Hair coloring compositions are herein defined as compositions for the coloring, dyeing, or bleaching of hair, comprising an effective amount of peptide-based hair colorant or a mixture of different peptide-based hair colorants in a cosmetically acceptable medium. An effective amount of a peptide-based hair colorant for use in a hair coloring composition is herein defined as a proportion of from about 0.001 % to about 20% by weight relative to the total weight of the composition. Components of a cosmetically acceptable medium for hair coloring compositions are described by Dias et a!., in U.S. Patent No. 6,398,821 and by Deutz et al., in U.S. Patent No. 6,129,770, both of which are incorporated herein by reference. For example, hair coloring compositions may contain sequestrants, stabilizers, thickeners, buffers, carriers, surfactants, solvents, antioxidants, polymers, and conditioners. The conditioners may include the peptide-based hair conditioners and hair-binding peptides of the present invention in a proportion from about 0.01% to about 10%, preferably about 0.01% to about 5% by weight relative to the total weight of the hair coloring composition. The peptide-based hair colorants of the present invention may also be used as coloring agents in cosmetic compositions that are applied to the eyelashes or eyebrows including, but not limited to mascaras, and eyebrow pencils. These may be anhydrous make-up products comprising a cosmetically acceptable medium which contains a fatty substance in a proportion generally of from about 10 to about 90% by weight relative to the total weight of the composition, where the fatty phase containing at least one liquid, solid or semi-solid fatty substance, as described above. The fatty substance includes, but is not limited to, oils, waxes, gums, and so-called pasty fatty substances. Alternatively, these compositions may be in the form of a stable dispersion such as a water-in-oil or oil-in-water emulsion, as described above. In these compositions, the proportion of the peptide-based hair colorant is generally from about 0.001% to about 20% by weight relative to the total weight of the composition. Peptide-Based Nail Colorants The peptide-based nail colorants of the present invention are formed by coupling a nail-binding peptide (NBP) with a coloring agent (C). The nail-binding peptide part of the peptide-based nail colorant binds strongly to the fingernails or toenails, thus keeping the coloring agent attached to the nails for a long lasting coloring effect. The nail-binding peptides include, but are not limited to nail-binding peptides selected by the screening methods described above, including the nail-binding peptide sequences of the invention, given by SEQ ID NOs:53 and 60, most preferably the peptide given by SEQ ID NO:60. Additionally, the beached hair-binding peptides, given as SEQ ID NOs:7, 8,19-27 38, 39, 40, 43-45, 47, 57,58. and 59 may be used. The peptide-based nail colorants of the present invention are prepared by coupling a specific nail-binding peptide to a coloring agent, either directly or via a spacer, using any of the coupling methods described above. In the peptide-based nail colorants of the present invention, any of the coloring agents described above may be used. The preferred coloring agents for use in the peptide-based nail colorants of the present invention include D&C Red Nos. 8,10, 30 and 36, the barium lakes of D&C Red Nos. 6, 9 and 12, the calcium lakes of D&C Red Nos. 7, 11,31 and 34, the strontium lake of D&C Red No. 30 and D&C Orange No. 17 and D&C Blue No. 6. It may also be desirable to have multiple nail-binding peptides coupled to the coloring agent to enhance the interaction between the peptide-based nail colorant and the nails. Either multiple copies of the same nail-binding peptide or a combination of different nail-binding peptides may be used. In the case of large pigment particles, a large number of nail-binding peptides, i.e., up to about 10,000, may be coupled to the pigment. A smaller number of nail-binding peptides can be coupled to the smaller dye molecules, i.e., up to about 50. Therefore, in one embodiment of the present invention, the peptide-based nail colorants are diblock compositions consisting of a nail-binding peptide (NBP) and a coloring agent (C), having the general structure (NBP)n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500. In another embodiment, the peptide-based nail colorants contain a spacer (S) separating the binding peptide from the coloring agent, as described above. Multiple copies of the nail-binding peptide may be coupled to a single spacer molecule. In this embodiment, the peptidebased nail colorants are triblock compositions consisting of a nail-binding peptide, a spacer, and a coloring agent, having the genera! structure [(NBP)m - S]n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10. It should be understood that as used herein, NBP is a generic designation and is not meant to refer to a single nail binding peptide sequence. Where n or m as used above, is greater than 1, it is well within the scope of the invention to provide for the situation where a series of nail binding peptides of different sequences may form a part of the composition. Additionally, it should be understood that these structures do not necessarily represent a covalent bond between the peptide, the coloring agent, and the optional spacer. As described above, the coupling interaction between the peptide, the coloring agent, and the optional spacer may be either covalent or non-covalent. The peptide-based nail colorants of the present invention may be used in nail polish compositions for coloring fingernails and toenails. Nail polish compositions are herein defined as compositions for the treatment and coloring of nails, comprising an effective amount of a peptide-based nail colorant or a mixture of different peptide-based nail colorants in a cosmetically acceptable medium. An effective amount of a peptide-based nail colorant for use in a nail polish composition is herein defined as a proportion of from about 0.001% to about 20% by weight relative to the total weight of the composition. Components of a cosmetically acceptable medium for nail polishes are described by Philippe et al. supra. The nail polish composition typically contains a solvent and a film forming substance, such as cellulose derivatives, polyvinyl derivatives, acrylic polymers or copolymers, vinyl copolymers and polyester polymers. Additionally, the nail polish may contain a plasticizer, such as tricresyl phosphate, benzyl benzoate, tributyl phosphate, butyl acetyl ricinoleate, triethyl citrate, tributyl acetyl citrate, dibutyl phthalate or camphor. Peptide-Based Skin Colorants The peptide-based skin colorants of the present invention are formed by coupling a skin-binding peptide (SBP) with a coloring agent (C). The skin-binding peptide part of the peptide-based skin colorant binds strongly to the skin, thus keeping the coloring agent attached to the skin for a long lasting skin coloring effect. The skin-binding peptides include, but are not limited to, skin-binding peptides selected by the screening methods described above, including the skin-binding peptide sequence of the invention, given as SEQ ID NOs:61. Additionally, any known skinbinding peptide may be used, including but not limited to SEQ ID NO:2, and SEQ ID NOs:99-104, described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976 and by Janssen et al. in WO 04048399, respectively. The peptide-based skin colorants of the present invention are prepared by coupling a specific skin-binding peptide to a coloring agent, either directly or via a spacer, using any of the coupling methods described above. Any of the colorants described above may be used. The preferred coloring agents for use in the peptide-based skin colorants of the present invention include the following dyes: eosin derivatives such as D&C Red No. 21 and halogenated fluorescein derivatives such as D&C Red No. 27, D&C Red Orange No. 5 in combination with D&C Red No. 21 and D&C Orange No. 10, and the pigments: titanium dioxide, titanium dioxide nanoparticles, zinc oxide, D&C Red No. 36 and D&C Orange No. 17, the calcium lakes of D&C Red Nos. 7,11, 31 and 34, the barium lake of D&C Red No. 12, the strontium lake D&C Red No. 13, .the aluminum lakes of FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27, of D&C Red No. 21, of FD&C Blue No. 1, iron oxides, manganese violet, chromium oxide, ultramarine blue, and carbon black. The coloring agent may also be a sunless tanning agent, such as dihydroxyacetone, that produces a tanned appearance on the skin without exposure to the sun. It may also be desirable to have multiple skin-binding peptides coupled to the coloring agent to enhance the interaction between the peptide-based skin colorant and the skin. Either multiple copies of the same skin-binding peptide or a combination of different skin-binding peptides may be used. In the case of large pigment particles, a large number of skin-binding peptides, i.e., up to about 10,000, may be coupled to the pigment. A smaller number of skin-binding peptides can be coupled to the smaller dye molecules, i.e., up to about 50. Therefore, in one embodiment of the present invention, the peptide-based skin colorants are ; diblock compositions consisting of a skin-binding peptide (SBP) and a coloring agent (C), having the general structure (SBP)n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500. In another embodiment, the peptide-based skin colorants contain a spacer (S) separating the binding peptide from the coloring agent, as described above. Multiple copies of the skin-binding peptide may be coupled to a single spacer molecule. In this embodiment, the peptidebased skin colorants are triblock compositions consisting of a skin-binding peptide, a spacer, and a coloring agent, having the general structure [(SBP)m - S]n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10. It should be understood that as used herein, SBP is a generic designation and is not meant to refer to a single skin binding peptide sequence. Where n or m as used above, is greater than 1, it is well within the scope of the invention to provide for the situation where a series of skin binding peptides of different sequences may form a part of the composition. Additionally, It should be understood that these structures do not necessarily represent a covalent bond between the peptide, the coloring agent, and the optional spacer. As described above, the coupling interaction between the peptide, the coloring agent, and the optional spacer may be either covalent or non-covalent. The peptide-based skin colorants of the present invention may be used as coloring agents in cosmetic and make-up products, including but not limited to foundations, blushes, lipsticks, lip liners, lip glosses, eyeshadows and eyeliners. These may be anhydrous make-up products comprising a cosmetically acceptable medium which contains a fatty substance, or they may be in the form of a stable dispersion such as a water-in-oil or oil-in-water emulsion, as described above. In these compositions, the proportion of the peptide-based skin colorant is generally from about 0.001 % to about 40% by weight relative to the total weight of the composition. Peptide-Based Oral Care Reagents The peptide-based oral care reagents of the invention are formed by coupling an oral cavity surface-binding peptide (OBP) with an oral care benefit agent (OBA). Oral cavity surface-binding peptides include, but are not limited to, tooth-binding peptides (TBP), skin-binding peptides (SBP), gum, cheek, and tongue-binding peptides. The peptide part of the peptide-based oral care agent binds strongly to the teeth, gums, cheeks, tongue, or other surface in the oral cavity, thus keeping the benefit agent attached for a long lasting effect. The skin-binding peptides described above may be useful for attachment to gums, cheeks, or tongue. Preferably, a binding peptiae ror me specific oral cavity surface of interest is identified using the screening methods described above. . The peptide-based oral care reagents of the invention are prepared by coupling an oral cavity surface-binding peptide to an oral care benefit agent, either directly or via a spacer, using any of the coupling methods described above. Oral care benefit agents are well known in the art (see for example White etal., U.S. Patent No. 6,740,311; Lawleret al., U.S. Patent No. 6,706,256; and Fuglsang et al., U.S. Patent No. 6,264925; all of which are incorporated herein by reference). Exemplary oral benefit agents include, but are not limited to, white colorants, whitening agents, enzymes, anti-plaque agents, anti-staining agents, anti-microbial agents, anti-caries agents, flavoring agents, coolants, and salivating agents. Suitable white colorants which may be used in peptide-based teeth whiteners include, but are not limited to, white pigments such as titanium dioxide, titanium dioxide nanoparticles ; and white minerals such as hydroxyapatite, and Zircon (zirconium silicate). Suitable enzymes may be naturally occurring or recombinant enzymes including, but not limited to, oxidases, peroxidases, proteases, lipases, glycosidases, esterases, and polysaccharide hydrolases. Anti-plaque agents include, but are not limited to, fluoride ion sources and anti-microbial agents. Suitable anti-microbial agents include, but are not limited to, anti-microbial peptides such as those described by Haynie in U.S. Patent No. 5,847,047, magainins, and cecropins; microbiocides such as triclosan, chlorhexidine, quaternary ammonium compounds, chloroxyylenol, chloroxyethanol, phthalic acid and its salts, and thymol. Suitable flavoring agents include, but are not limited to, oil of wintergreen, oil of peppermint, oil of spearmint, menthol, methyl salicylate, eucalyptol, and vanillin. It may also be desirable to have multiple oral cavity surface-binding peptides coupled to the oral benefit agent to enhance the interaction between the peptide-based oral care agent and the oral cavity surface. Either multiple copies of the same oral cavity surface-binding peptide or a combination of different oral cavity surface-binding peptides may be used. In the case of large pigment particles, a large number of oral cavity surface-binding peptides, i.e., up to about 10,000, may be coupled to the pigment. A smaller number of oral cavity surface-binding peptides can be coupled to the smaller oral benefit agents molecules, i.e., up to about 50. Therefore, in one embodiment of the present invention, the peptide-based oral care reagents are diblock compositions consisting of an oral cavity surface-binding peptide (OBP) and an oral benefit agent (OBA), having the general structure (OBP)n - OBA, where n ranges from 1 to about 10,000, preferably n is 1 to about 500. In another embodiment, the peptide-based oral care reagents contain a spacer (S) separating the binding peptide from the oral benefit agent, as described above. Multiple copies of the oral cavity surfacebinding peptide may be coupled to a single spacer molecule. In this embodiment, the peptide-based oral care reagents are triblock compositions consisting of an oral cavity surface-binding peptide, a spacer, and an oral benefit agent, having the general structure [(OBP)m - S]n - OBA, where n ranges from 1 to about 10,000, preferably n is 1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10. It should be understood that as used herein, OBP is a generic designation and is not meant to refer to a single oral cavity surface-binding peptide sequence. Where n or m as used above, is greater than 1, it is well within the scope of the invention to provide for the situation where a series of oral cavity surface-binding peptides of different sequences may form a part of the composition. Additionally, it should be understood that these structures do not necessarily represent a covalent bond between the peptide, the oral benefit agent, and the optional spacer. As described above, the coupling interaction between the peptide, the oral benefit agent, and the optional spacer may be either covalent or non-covalent. The peptide-based oral care reagents of the invention may be used in oral care products, which may have any suitable physical form, such as powder, paste, gel, liquid, ointment, or tablet. Exemplary oral care products include, but are not limited to, toothpaste, dental cream, gel or tooth powder, mouth wash, breath freshener, and dental floss. The oral care products comprise an effective amount of the peptide-based oral care reagents of the invention in an orally acceptable carrier medium. An effective amount of a peptide-based oral care agent for use in an oral care product may vary depending on the type of product. Typically, the effective amount of the peptide-based oral care agent is a proportion from about 0.001% to about 90% by weight of the total product composition. The oral care product may contain one type of peptide-based oral care agent or a mixture of different peptide-based oral care reagents. Components of an orally acceptable carrier medium are described by White et al., Lawler et al., and Fuglsang et al., supra. For example, in addition to the peptide-based oral care reagents of the invention, the oral care products may contain one or more of the following: abrasives, surfactants, chelating agents, fluoride sources, thickening agents, buffering agents, solvents, humectants, carriers, bulking agents, and additional oral benefit agents, as given above. The oral care products of the invention may be prepared using standard techniques that are well known in the art. If the composition comprises more than one phase, typically, the different phases are prepared separately, with material of similar phase partitioning being' added in any order. The two phases are combined using vigorous mixing to form the multiphase system (e.g., an emulsion or dispersion). Methods for Treating Hair. Skin. Nails, and the Oral Cavity In another embodiment, methods are provided for treating hair, skin, and nails, with the peptide-based conditioners and colorants of the present invention. Specifically, the present invention also comprises a method for forming a protective film of peptide-based conditioner on skin, hair, or lips by applying one of the compositions described above comprising an effective amount of a peptide-based skin conditioner or peptide-based hair conditioner to the skin, hair, or lips and allowing the formation of the protective film. The compositions of the present invention may be applied to the skin, hair, or lips by various means, including, but not limited to spraying, brushing, and applying by hand. The peptidebased conditioner composition is left in contact with the skin, hair, or lips for a period of time sufficient to form the protective film, preferably for at least about 0.1 to 60 min. The present invention also provides a method for coloring hair by applying a hair coloring composition comprising an effective amount of a peptide-based hair colorant to the hair by means described above. The hair coloring composition is allowed to contact the hair for a period of time sufficient to cause coloration of the hair, preferably between about 5 seconds to about 50 minutes, and more preferably from about 5 seconds to about 60 seconds, and then the hair coloring composition may be rinsed from the hair. The present invention also provides a method for coloring skin or lips by applying a skin coloring composition comprising an effective amount of a peptide-based skin colorant to the skin or lips by means described above. The present invention also provides a method for coloring fingernails or toenails by applying a nail polish composition comprising an •» effective amount of a peptide-based nail colorant to the fingernails or toenails by means described above. The present invention also provides a method for coloring eyebrows and. eyelashes by applying a cosmetic composition comprising an effective amount of a peptide-based hair colorant to the eyebrows and eyelashes by means described above. The invention also provides a method for whitening teeth by applying an oral care product composition comprising a peptide-based whitener to the teeth for a sufficient time to allow the peptide-based whitener to bind to the teeth. The composition may then be rinsed from the teeth. The oral care product composition may be applied to the teeth using any suitable method including, but not limited to, brushing, rinsing, and using an applicator strip or dental floss coated with the composition. The invention also provides a method for freshening breath by applying to the oral cavity an oral care product comprising a peptide-based breath freshener. The oral care product may be applied as a rinse, a toothpaste, a spray, a gum, or a candy. The above methods of application of the binding reagents to body surfaces are characterized by the ability of the regent to bind to a surface in an aqueous environment and to bind rapidly, often within 5 to about 60 seconds from the time of first application. The reagents of the invention are multifaceted bio-adhesives with a multiplicity of applications but unified in their water fast nature and rapid and tight binding characteristics. EXAMPLES The present invention is further defined in the following Examples. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various uses and conditions. The meaning of abbreviations used is as follows: "min" means . minute(s), "sec" means second(s), "h" means hour(s), "uL" means microliter(s), "ml" means milliliter(s), "L" means liter(s), "nm" means nanometer(s), "mm" means millimeter(s), "cm" means centimeter(s), "jam" means micrometer(s), "mM" means millimolar, "M" means molar, "mmol" means millimole(s), "umole" means micromole(s), "g" means gram(s), "ug" means microgram(s), "mg" means milligram(s), "g" means the gravitation constant, "rpm" means revolutions per minute, "pfu" means plague forming unit, "BSA" means bovine serum albumin, "ELISA" means enzyme linked immunosorbent assay, "IPTG" means isopropyl p-Dthiogalactopyranoside, "A" means absorbance, 'Awo" means the absorbance measured at a wavelength of 450 nm, "TBS" means Trisbuffered saline, "TBST-X" means Tris-buffered saline containing Tween 20 where "X" is the weight percent of Tween® 20, "Xgal" means 5-bromo- 4-chloro-3-indolyl-beta-D-galactopyranoside, "SEM" means standard error of the mean, "ESCA" means electron spectroscopy for chemical analysis, "eV" means electron volt(s), "TGA" means thermogravimetric analysis, "GPC" means gel permeation chromatography, "MW" means molecular weight, "Mw" means weight-average molecular weight, "vol %" means volume percent, "NMR" means nuclear magnetic resonance spectroscopy, and "MALDI mass spectrometry" means matrix assisted, laser desorption ionization mass spectrometry. GENERAL METHODS: Standard recombinant DNA and molecular cloning techniques used in the Examples are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, by T. J. Silhavy, M. L Bennan, and L W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1984, and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-lnterscience, N.Y., 1987. Materials and methods suitable for the maintenance and growth of bacterial cultures are also well known in the art. Techniques suitable for use in the following Examples may be found in Manual of Methods for . General Bacteriology, Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds., American Society for Microbiology, Washington, DC., 1994, or by Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland, MA, 1989. All reagents, restriction enzymes and materials used for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals (Milwaukee, Wl), BD Diagnostic Systems (Sparks, MD), Life Technologies (Rockville, MD), or Sigma Chemical Company (St. Louis, MO), unless otherwise specified. EXAMPLE 1 Selection of Hair-Binding Phaqe Peptides Using Standard Biopanning The purpose of this Example was to identify hair-binding phage peptides that bind to normal hair and to bleached hair using standard phage display biopanning. Phage Display Peptide Libraries: The phage libraries used in the present invention, Ph.D.-12™ Phage Display Peptide Library Kit and Ph.D.-7™ Phage Display Library Kit, were purchased from New England BioLabs (Beverly, MA). These kits are based on a combinatorial library of random peptide 7 or 12-mers fused to a minor coat protein (pill) of M13 phage. The displayed peptide is expressed at the N-terminus of pill, such that after the signal peptide is cleaved, the first residue of the coat protein is the first residue of the displayed peptide. The Ph.D.-7 and Ph.D.-12 libraries consist of approximately 2.8 x 10 and 2.7 x 10 sequences, respectively. A volume of 10 pL contains about 55 copies of each peptide sequence. Each initial round of experiments was carried out using the original library provided by the manufacturer in order to avoid introducing any bias into the results. Preparation of Hair Samples: The samples used as normal hair were 6-inch medium brown human hairs obtained from International Hair Importers and Products , (Bellerose, NY). The hairs were placed in 90% isopropanol for 30 min at room temperature and then washed 5 times for 10 min each with deionized water. The hairs were air-dried overnight at room temperature. To prepare the bleached hair samples, the medium brown human hairs were placed in 6% H2O2, which was adjusted to pH 10.2 with ammonium hydroxide, for 10 min at room temperature and then washed 5 times for 10 min each with deionized water. The hairs were air-dried overnight at room temperature. The normal and bleached hair samples were cut into 0.5 to 1 cm lengths and about 5 to 10 mg of the hairs was placed into wells of a custom 24-well biopanning apparatus that had a pig skin bottom. An equal number of the pig skin bottom wells were left empty. The pig skin bottom apparatus was used as a subtractive procedure to remove phage-peptides that have an affinity for skin. This apparatus was created by modifying a dot blot apparatus (obtained from Schleicher & Schuell, Keene, NH) to fit the biopanning process. Specifically, the top 96-well block of the dot blot apparatus was replaced by a 24-well block. A 4 x 6 inch treated pig skin was placed under the 24-well block and panning wells with a pig skin bottom were formed by tightening the apparatus. The pig skin was purchased from a local supermarket and stored at -80 °C. Before use, the skin was placed in deionized water to thaw, and then blotted dry using a paper towel. The surface of the skin was wiped with 90% isopropanol, and then rinsed with deionized water. The 24-well apparatus was filled with blocking buffer consisting of 1 mg/mL BSA in TBST containing 0.5% Tween® 20 (TBST-0.5%) and incubated for 1 h at 4 °C. The wells and hairs were washed 5 times with TBST-0.5%. One milliliter of TBST-0.5% containing 1 mg/mL BSA was added to each well. Then, 10 uL of the original phage library (2 x 1011 pfu), either the 12-mer or 7-mer library, was added to the pig skin bottom wells that did not contain a hair sample and the phage library was incubated for 15 min at room temperature. The unbound phages were then transferred to pig skin bottom wells containing the hair samples and were incubated for 15 min at room temperature. The hair samples and the wells were washed 10 times with TBST-0.5%. ~Trje hairs were then transferred to clean, plastic bottom wells of a 24-well plate and 1 mL of a non-specific elution buffer consisting of 1 mg/mL BSA in 0.2 M glycine-HCI, pH 2.2, was added to each well and incubated for 10 min to elute the bound phages. Then, 160 uL of neutralization buffer consisting of 1 M Tris-HCI, pH 9.2, was added to each well. The eluted phages from each well were transferred to a new tube for titering and sequencing. To titer the bound phages, the eluted phage was diluted with SM buffer (100 mM NaCI, 12.3 mM MgS04-7 H2O, 50 mM Tris-HCI, pH 7.5, and 0.01 wt/vol % gelatin) to prepare 10-fold serial dilutions of 101 to 104. A 10 uL aliquot of each dilution was incubated with 200 uL of mid-log phase £ coli ER2738 (New England BioLabs), grown in LB medium for 20 min and then mixed with 3 mL of agarose top (LB medium with 5 mM MgCb, and 0.7% agarose) at 45 °C. This mixture was spread onto a SGal ™/LB agar plate (Sigma Chemical Co.) and incubated overnight at 37 °C. The S-Gal™/LB agar blend contained 5 g of tryptone, 2.5 g of yeast extract, 5 g of sodium chloride, 6 g of agar, 150 mg of 3,4- cyclohexenoesculetin-p-D-galactopyranoside (S-Gal™), 250 mg of ferric ammonium citrate and 15 mg of isopropyl p-D-thiogalactoside (IPTG) in 500 ml of distilled water. The plates were prepared by autoclaving the SGal ™ /LB for 15 to 20 min at 121-124 °C. The single black plaques were randomly picked for DNA isolation and sequence analysis. The remaining eluted phages were amplified by incubating with diluted Eco// ER2738, from an overnight culture diluted 1:100 in LB medium, at 37 °C for 4.5 h. After this time, the cell culture was centrifuged for 30 s and the upper 80% of the supernatant was transferred to a fresh tube, 1/6 volume of PEG/NaCI (20% polyethylene glyco-800, 2.5 M sodium chloride) was added, and the phage was allowed to precipitate overnight at 4 °C. The precipitate was collected by centrifugation at 10,000 x g at 4 °C and the resulting pellet was resuspended in 1 ml_ of TBS. This was the first round of amplified stock. The amplified first round phage stock was then titered according to the same method as described above. For the next round of biopanning, more than 2 x1011 pfu of phage stock from the first round was used. The biopanning process was repeated for 3 to 6 rounds depending on the experiments. The single plaque lysates were prepared following the manufacture's instructions (New England Biolabs) and the single stranded phage genomic DNA was purified using the QIAprep Spin M13 Kit (Qiagen, Valencia, CA) and sequenced at the DuPont Sequencing Facility using -96 gill sequencing primer (5'-CCCTCATAGTTAGCGTAACG-3')t given as SEQ ID NO:62. The displayed peptide is located immediately after the signal peptide of gene III. The amino acid sequences of the eluted normal hair-binding phage peptides from the 12-mer library isolated from the fifth round of biopanning are given in Table 1. The amino acid sequences of the eluted bleached hair-binding phage peptides from the 12-mer library isolated from the fifth round of biopanning are given in Table 2. Repeated amino acid sequences of the eluted normal hair-binding phage peptides from the 7- mer library from 95 randomly selected clones, isolated from the third round of biopanning, are given in Table 3. (Table Removed)There was a multiple DNA fragment intersion in these clones. EXAMPLE 2 Selection of High Affinity Hair-Binding Phaqe Peptides Using a Modified Method The purpose of this Example was to identify hair-binding phage peptides with a higher binding affinity. The hairs that were treated with the acidic elution buffer, as described in Example 1, were washed three more times with the elution buffer and then washed three times with TBST-0.5%. These hairs, which had acid resistant phage peptides still attached, were used to directly infect 500 uL of mid-log phase bacterial host cells, E. coli ER2738 (New England BioLabs), which were then grown in LB medium for 20 min and then mixed with 3 mL of agarose top (LB medium with 5 mM MgCI2, and 0.7% agarose) at 45 °C. This mixture was spread onto a LB medium/IPTG/ S-Gal™ plate (LB medium with 15 g/L agar, 0.05 g/L IPTG, and 0.04 g/L S-Gal™) and incubated overnight at 37 °C. The black plaques were counted to calculate the phage titer. The single black plaques were randomly picked for DNA isolation and sequencing analysis, as described in Example 1. This process was performed on the normal and bleached hair samples that were screened with the 7-mer and 12-mer phage display libraries, as described in Example 1. The amino acid sequences of these high affinity, hair-binding phage peptides are given in Selection of Hiqh Affinity Fingernail-Binding Phaqe Peptides The purpose of this Example was to identify phage peptides that have a high binding affinity to fingernails. The modified biopanning method described in Example 2 was used to identify high affinity, fingernail-binding phage-peptide clones. 67 Human fingernails were collected from test subjects. The fingernails were cleaned by brushing with soap solution, sinsed with deionized water, and allowed to air-dry at room temperature. The fingernails were then powdered under liquid N2, and 10 mg of the fingernails was added to each well of a 96-well filter plate. The fingernail samples were treated for 1 h with blocking buffer consisting of 1 mg/mL BSA in TBST-0.5%, and then washed with TBST-0.5%. The fingernail samples were incubated with phage library (Ph.D-12 Phage Display Peptide Library Kit), and washed 10 times using the same conditions described in Example 1. After the acidic elution step, described in Example 1, the fingernail samples were washed three more times with the elution buffer and then washed three times with TBST-0.5%. The acidtreated fingernails, which had acid resistant phage peptides still attached, were used to directly infect E. coli ER2738 cells as described in Example 2. This biopanning process was repeated three times. A total of 75 single black phage plaques were picked randomly for DNA isolation and - H sequencing analysis and two repeated clones were identified. The amino acid sequences of these phage peptides are listed in Table 8. These fingernail binding peptides were also found to bind well to bleached hair. (Table Removed)The frequency represents the number of identical sequences that occurred out of 75 sequenced clones. EXAMPLE 4 Selection of High Affinity Skin-Binding Phage Peptides The purpose of this Example was to identify phage peptides that have a high binding affinity to skin. The modified biopanning method described in Examples 2 and 4 was used to identify the high affinity, skinbinding phage-peptide clones. Pig skin served as a model for human skin in the process. The pig skin was prepared as described in Example 1. Three rounds of screenings were performed with the custom, pig skin bottom biopanning apparatus using the same procedure described in Example 4. A total of 28 single black phage plaques were picked randomly for DNA isolation and sequencing analysis and one repeated clone was identified. The amino acid sequence of this phage peptide, which appeared 9 times out of the 28 sequences, was TPFHSPENAPGS, given as SEQ ID NO:61. EXAMPLE 5 Quantitative Characterization of the Binding Affinity of Hair-Binding Phage Clones The purpose of this Example was to quantify the binding affinity of phage clones by titering and ELISA, Titering of Hair-Binding Phaqe Clones: Phage clones displaying specific peptides were used for comparing the binding characteristics of different peptide sequences. A titer-based assay was used to quantify the phage binding. This assay measures the output pfu retained by 10 mg of hair surfaces, having a signal to noise ratio of 103 to 104. The input for all the phage clones was 1014 pfu. It should be emphasized that this assay measures the peptide-expressing phage particle, rather than peptide binding. Normal hairs were cut into 0.5 cm lengths and 10 mg of the cut hair was placed in each well of a 96-well filter plate (Qiagen). Then, the wells were filled with blocking buffer containing 1mg/mL BSA in TBST-0.5% and incubated for 1 h at 4 °C. The hairs were washed 5 times with TBST- 0.5%. The wells were then filled with 1 ml_ of TBST-0.5% containing 1 mg/mL BSA and then purified phage clones (1014pfu) were added to each well. The hair samples were incubated for 15 min at room temperature and then washed 10 times with TBST-0.5%. The hairs were transferred to a clean well and 1.0 mL of a non-specific elution buffer, consisting of 1 mg/mL BSA in 0.2 M Glycine-HCI at pH 2.2, was added to each well. The samples were incubated for 10 min and then 160 uL of neutralization buffer (1 M Tris-HCI, pH 9.2) was added to each well. The eluted phages from each well were transferred to a new tube for titering and sequencing analysis. To titer the bound phages, the eluted phage was diluted with SM buffer to prepare 10-fold serial dilutions of 101 to 108. A 10 uL aliquot of each dilution was incubated with 200 \|jL of mid-log phase £. coli ER2738 (New England BioLabs), and grown in LB medium for 20 min and then mixed with 3 mL of agarose top (LB medium with 5 mM MgCfe, and 0,7% agarose) at 45 °C. This mixture was spread onto a LB medium/IPTG/Xgal plate (LB medium with 15 g/L agar, 0.05 g/L IPTG, and 0.04 g/L Xgal) and incubated overnight at 37 °C. The blue plaques were counted to calculate the phage titers, which are given in Table 9. Characterization of Hair-Binding Phaae Clones bv ELISA: Enzyme-linked immunosorbent assay (ELISA) was used to evaluate the hair-binding specificity of selected phage-peptide clones. Phagepeptide clones identified in Examples 1 and 2 along with a randomly chosen control G-F9, KHGPDLLRSAPR (given as SEQ ID NO:63) were amplified. More than 1014pfu phages were added to pre-blocked hair surfaces. The same amount of phages was also added to pre-blocked pig skin surfaces as a control to demonstrate the hair-binding specificity. A unique hair or pig skin-bottom 96-well apparatus was created by applying one layer of Parafilm® under the top 96-well block of a Minifold I Dot-Blot System (Schleicher & Schuell, Inc., Keene, NH), adding hair or a layer of hairless pig skin on top of the Parafilm® cover, and then tightening the apparatus. For each clone to be tested, the hair-covered well was incubated for 1 h at room temperature with 200 uL of blocking buffer, consisting of 2% non-fat dry milk (Schleicher & Schuell, Inc.) in TBS. A second Minifold system with pig skin at the bottom of the wells was treated with blocking buffer simultaneously to serve as a control. The blocking buffer was removed by inverting the systems and blotting them dry with paper towels. The systems were rinsed 6 times with wash buffer consisting of TBST-0.05%. The wells were filled with 200 uL of TBST- 0.5% containing 1 mg/mL BSA and then 10 uL (over 1012 copies) of purified phage stock was added to each well. The samples were incubated at 37 °C for 15 min with slow shaking. The non-binding phage was removed by washing the wells 10 to 20 times with TBST-0.5%. Then, 100 uL of horseradish peroxidase/anti-M13 antibody conjugate (Amersham USA, Piscataway, NJ), diluted 1:500 in the blocking buffer, was added to each well and incubated for 1 h at room temperature. The conjugate solution was removed and the wells were washed 6 times with TBST-0.05%. TMB substrate (200 uL), obtained from Pierce Biotechnology (Rockford, IL) was added to each well and the color was allowed to develop for between 5 to 30 min, typically for 10 min, at room temperature. Then, stop solution (200 uL of 2 M H2SO4) was added to each well and the solution was transferred to a 96-well plate and the AASQ was measured using a microplate spectrophotometer (Molecular Devices, Sunnyvale, CA). The resulting absorbance values, reported as the mean of at least three replicates, and the standard error of the mean (SEM) are (Table Removed)As can be seen from the data in Table 10, all the hair-binding clones had a significantly higher binding affinity for hair than the control. Moreover, the hair-binding clones exhibited various degrees of selectivity for hair compared to pig skin. Clone D21 had the highest selectivity for hair, having a very strong affinity for hair and a very low affinity for pig skin. EXAMPLE 6 Confirmation of Peptide Binding Specificity and Affinity The purpose of this Example was to test the peptide binding site specificity and affinity of the hair-binding peptide D21 using a competition ELISA. The ELISA assay only detects phage particles that remain bound to the hair surface. Therefore, if the synthetic peptide competes with the phage particle for the same binding site on hair surface, the addition of the synthetic peptide into the ELISA system will significantly reduce the ELISA results due to the peptide competition. The synthetic hair-binding peptide D21, given as SEQ ID NO:46, was synthesized by SynPep (Dublin, CA). As a control, an unrelated synthetic skin-binding peptide, given as SEQ ID NO:61, was added to the system. The experimental conditions were similar to those used in the ELISA method described in Example 5. Briefly, 100 uL of Binding Buffer (1xTBS with 0.1% Tween®20 and 1 mg/mL BSA) and 1011 pfu of the pure D21 phage particles were added to each well of the 96-weII filter plate, which contained a sample of normal hair. The synthetic peptide (100 ug ) was added to each well (corresponding to concentration of 0.8 mM). The reactions were carried out at room temperature for 1 h with gentle shaking, followed by five washes with TBST-0.5%. The remaining steps were identical to the those used in the ELISA method described in Example 5. The ELISA results, presented as the absorbance at 450 nm (A45o), are shown in Table 11. Each individual ELISA test was performed in triplicate; the values in Table 11 are the means of the triplicate determinations. These results demonstrated that the synthetic peptide D21 does compete with the phage clone D21 for the same binding sites on the hair surface. EXAMPLE 7 Selection of Shampoo-Resistant Hair-Binding Phaqe-Peptides Using Biopanning The purpose of this Example was to select shampoo-resistant hairbinding phage-peptides using biopanning with shampoo washes. In order to select shampoo-resistant hair-binding peptides, a biopanning experiment using 12-mer phage peptide libraries against normal and bleached hairs was performed, as described in Example 2, Instead of using normal TBST buffer to wash-off the unbounded phages, the phage-complexed hairs were washed with 10%, 30% and 50% shampoo solutions (Pantene Pro-V shampoo, Sheer Volume, Proctor & Gamble, Cincinnati, OH), for 5 min in separate tubes, followed by six TBS buffer washes. The washed hairs were directly used to infect host bacteria! cells as described in the modified biopanning method, described in Example 2. A potential problem with this method is the effect of the shampoo on the phage's ability to infect bacterial host cells. In a control experiment, a known amount of phage particles was added to a 10% shampoo solution for 5 min, and then a portion of the solution was used to infect bacterial cells. The titer of the shampoo-treated phage was 90% lower than that of the untreated phage. The 30% and 50% shampoo treatments gave eVen more severe damage to the phage's ability to infect host cells. Nevertheless, two shampoo-resistant hair-binding phage-peptides were identified, as shown in Table 12. Selection of Shampoo-Resistant Hair-Binding Phage-Peptides Using PCR The purpose of this Example was to select shampoo-resistant hairbinding phage-peptides using a PCR method to avoid the problem of shampoo induced damage to the phage. This principle of the PCR method is that DMA fragments inside the phage particle can be recovered using PCR, regardless of the phage's viability, and that the recovered DNA fragments, corresponding to the hair-binding peptide sequences, can then been cloned back into a phage vector and packaged into healthy phage particles. Biopanning experiments were performed using 7-mer and 12-mer phage-peptide libraries against normal and bleached hairs, as described in Example 1. After the final wash, the phage-treated hairs were subjected to 5 min of shampoo washes, followed by six TBS buffer washes. The shampoo-washed hairs were put into a new tube filled with 1 mL of water, and boiled for 15 min to release the DNA. This DNA-containing, boiled solution was used as a DNA template for PCR reactions. The primers used in the PCR reaction were primers: M13KE-1412 Forward 5'- CAAGCCTCAGCGACCGAATA -3', given as SEQ ID NO:67 and M13KE- 1794 Reverse 5'- CGTAACACTGAGTTTCGTCACCA -3', given SEQ ID NO:68. The PCR conditions were: 3 min denaturing at 96 °C, followed by 35 cycles of 94 °C for 30 sec, 50 °C for 30 sec and 60 °C for 2 min. The PCR products (~400 bp), and M13KE vector (New England BioLabs) were digested with restriction enzymes Eag I and Acc65 \. The ligation and transformation conditions, as described in the Ph.D.™ Peptide Display Cloning System (New England Biolabs), were used. The amino acid sequence of the resulting shampoo-resistant hair-binding phage-peptide is NTSQLST, given as SEQ ID N0:70. EXAMPLE 9 Determination of the Affinity of Hair-Binding and Skin-Binding Peptides The purpose of this Example was to determine the affinity of the hair-binding and skin-binding peptides for their respective substrates, measured as MBso values, using an ELISA assay. Hair-binding and skin-binding peptides were synthesized by SynPep Inc. (Dublin, CA). The peptides were biotinylated by adding a biotinylated lysine residue at the C-terminus of the amino acid binding sequences for detection purposes and an amidated cysteine was added to the C-terminus of the sequence. The amino acid sequences of the peptides tested are given as SEQ ID NOs:71-74, as shown in Table 13. For hair samples, the procedure used was as follows. The setup of the surface specific 96-well system used was the same as that described in Example 5. Briefly, the 96-wells with hair or pig skin surfaces were blocked with blocking buffer (SuperBlock™from Pierce Chemical Co., Rockford, IL) at room temperature for 1 h, followed by six washes with TBST-0.5%, 2 min each, at room temperature. Various concentrations of biotinylated, binding peptide were added to each well, incubated for 15 min at 37 °C, and washed six times with TBST-0.5%, 2 min each, at room temperature. Then, streptavidin-horseradish peroxidase (HRP) conjugate (Pierce Chemical Co.) was added to each well (1.0 ug per well), and incubated for 1 h at room temperature. After the incubation, the wells were washed six times with TBST-0.5%, 2 min each at room temperature. Finally, the color development and the measurement were performed as described in Example 5. For the measurement of MBso of the peptide-skin complexes, the following procedure was used. First, the pigskin was treated to block the endogenous biotin in the skin. This was done by adding streptavidin to the blocking buffer. After blocking the pigskin sample, the skin was treated with D-biotin to block the excess streptavidin binding sites. The remaining steps were identical to those used for the hair samples. The results were plotted as A4so versus the concentration of peptide using GraphPad Prism 4.0 (GraphPad Software, Inc., San Diego, CA). The MBso values were calculated from Scatchard plots and are summarized in Table 13. The results demonstrate that the binding affinity of the hair-binding peptides (D21, F35, and I-B5) and the skin binding peptide (SEQW ID NO:61) for their respective substrate was high, while the binding affinity of the hair-binding peptides (D-21 and I-B5) for skin was relatively low. 76 Table 13 Summary of MBnn Values for Hair and Skin-Binding Peptides The peptides tested were biotinylated at the C-terminus of the amino acid binding sequences and an amidated cysteine was added to the Cterminus of the binding sequence. EXAMPLE 10 Preparation of a Peptide-Based-Carbon Black Hair Colorant The purpose of this Example was to prepare a peptide-basedcarbon black hair colorant by covalently linking the hair-binding peptide D21, given as SEQ ID NO:46, to the surface of carbon black particles. The surface of the carbon black particles was functionalized by reaction with 2)2'-azobis(2methylpropionamide)-dihydrochloride to introduce free amino groups. The functionalized carbon black particles were then covalently linked to the specific hair-binding peptide. Functionalization of Carbon Black Surface: Carbon black (Nipex® 160-IQ from Degussa, Allendale, NJ), 2.0 g, and 1.0 g of 2,2'-Azobis(2-methylpropionamide)dihydrochloride (Aldrich, Milwaukee, Wl) were added to a 100 ml round-bottom flask and 30 ml of dioxane was added. The flask was purged with nitrogen for 5 min. Then, the flask was sealed with a rubber septum and the reaction mixture was stirred at 65 °C for 14 h. After this time, 50 mL of deionized water, prepared with a Nanopure water purification system (Barnstead/Thermolyne, Dubuque, IA), was added to the mixture. The diluted solution was centrifuged to collect the functionalized carbon black particles and to remove the organic solvent and unreacted reagents. The carbon black particles were washed with deionized water and centrifuged. This washing and centrifuging process was repeated 2 more times. The functionalized carbon black particles were then dried by lyophilization. Synthesis of t-Boc-Protected Hair-Binding Peptidefrom Phaqe Clone D21 The purpose of this reaction was to protect the ammo end group of the hair-binding peptide. The hair-binding peptide from phage clone D21 (0.25 g), given as SEQ ID NO:46 (95% purity, obtained from SynPep, Dublin, CA) was mixed with 2.5 ml of deionized water in a 25 ml roundbottom flask. Then, 20 mg of NaOH and 0.25 ml of t-butyl alcohol were added. After stirring the mixture for 2 min, 0.12 g of di-tert-butyl dicarbonate (t-Boc anhydride) (Aldrich) was added dropwise. The flask was sealed with a rubber septum and the reaction mixture was stirred overnight at room temperature. The reaction mixture was clear at the beginning of the reaction and became cloudy and then, precipitated after 1 •» h. Upon addition of water (10 ml), the reaction mixture formed a milky emulsion, which was then extracted three times with 5 ml portions of methylene chloride. The organic layer was washed twice with 5 ml portions of deionized water. The clear water layers were all combined and dried by lyophilization, yielding 0.20 g of a fluffy white powder (80% yield). The product was analyzed by liquid chromatography-mass spectrometry (LC-MS) and was found to have a molecular weight of 1323 g/mol, with a purity of 90% by weight. Coupling of Amino-Functionalized Carbon Black with t-Boc-D21 -Peptide: Amino-functionalized carbon black (87mg), t-Boc-D21-peptide (80mg) and dicyclohexyl carbodiimide (22mg) were added to 3 ml_ of tetrahydrofuran (THF). A solution of dimethyl aminopyridine (17 jaL) in several drops of THF was added dropwise to this mixture with stirring. The resulting dark suspension was heated to 40 °C for 6 h with stirring, followed by stirring overnight at room temperature. Trifluoroacetic acid (0.6 mL) was added to the product and the mixture was stirred for another 6 h. Then, 5 ml of deionized water was added to the reaction mixture. The mixture was centrifuged at 3,500 rpm for 2 min and the supernatant was decanted. The solid remaining in the centrifuge tube was washed with deionized water and centrifuged again. This washing was repeated until the pH of supernatant reached approximately 6.0. The dark residue was then dried using a lyophilizer for 2 days, yielding a dark powder. EXAMPLE 11 Hair Dyeing Using a Peptide-Based-Carbon Black Hair Colorant The purpose of this Example was to dye a sample of natural white hair using the peptide-based-carbon black hair colorant prepared in Example 10. A bundle of natural white hair (approximately 100 pieces) (from International Hair Importers and Products Inc., Bellerose, NY) was cleaned by mixing with 10 mL of 50% isopropanol for 30 min and then washed at least 5 times with distilled water. After drying in air, the cleaned hair was immersed for 30 min in a solution containing 50 mg of the hair-binding D21 peptide-carbon black hair colorant, described in Example 10, dissolved in 10 mL of distilled water. After dying, the hair was washed at least 5 times with distilled water. The original natural white hair became light black. The dyed hair was washed three times with a 30% shampoo solution 20 (Pantene Pro-V shampoo) by immersing the hair in the shampoo solution and stirring with a glass pipette. The hair was then rinsed at least 10 times with distilled water. The final color of the dyed, natural white hair was very light black. EXAMPLE 12 Preparation of a Peptide-Based Hair Conditioner The purpose of this Example was to prepare a peptide-based hair conditioner by covalently linking the hair-binding D21 peptide, given as SEQ ID NO:46, with behenyl alcohol using carbodiimide coupling. Behenyl alcohol (Aldrich), 81.7 mg, and 62.0 mg of dicyclohexyl carbodiimide (DCC) were dissolved in 2.0 ml of THF in a 25 ml roundbottom flask. A solution containing 0.25 g of the 9- fluorenylmethyloxycarbonyl (Fmoc) N-terminal protected form of SEQ ID N0:46 (95% purity, obtained from SynPep, Dublin, CA) in 2.0 ml dimethyformamide (DMF) was added to the above mixture. Then, 50 ^L of dimethylaminopyridine (DMAP) was added to the reaction mixture. With stirring, the reaction mixture was maintained at 40 °C for 3 h, and then at room temperature overnight. Then the solvent was evaporated under vacuum at room temperature for 4 h. After this time, the mixture was dissolved in 25 ml of ethyl acetate, and the unreacted peptide was extracted 3 times with water using 10 mL of deionized water for each extraction. The ethyl acetate phase was isolated and the ethyl acetate was removed using a rotary evaporator. The resulting solid product was dissolved in a solvent consisting of 2.5 mL of THF and 2.5 ml of DMF, and 1.5 mL of piperidine was added to deblock the amino group of the D21 peptide. This mixture was stirred for 2 h at room temperature and then the solvents were removed by rotary evaporation under vacuum. The final product was characterized by LC/MS. EXAMPLE 13 Preparation of a Peptide-Based Hair Conditioner The purpose of this Example was to prepare a peptide-based hair conditioner by covalently linking the hair-binding, cysteine-attached D21 peptide, given as SEQ ID NO:64, with octylamine using the heterobifunctional cross-linking agent 3-maleimidopropionic acid Nhydroxysuccinimide ester. Octylamine, obtained from Aid rich (Milwaukee, Wl) was diluted by adding 11.6 mg to 0.3 mL of DMF. This diluted solution was added to a stirred solution containing 25 mg of 3-maleimidopropionic acid Nhydroxysuccinimide ester (Aldrich) and 5 mg of diisopropylethylamine (Aldrich) in 0.2 mL of DMF in a 5 mL round bottom flask. The reaction mixture turned turbid immediately and then became clear several minutes later. The solution was stirred for another 4 h. The solution was then dried under high vacuum. The product, octylamine-attached maleimidopropionate, was purified by column chromatography using a Silica gel 60 (EMD Chemicals, formerly EM Science, Gibbstown, NJ) column and DMF/ether as the eluent. Approximately 12 mg of the above product was placed into a 5 mL round bottom flask and 50 mg of cysteine-attached D21 peptide (obtained from SynPep, Dublin, CA), given as SEQ ID NO:64, and 0.5 mL of 0.1 M phosphate buffer at pH 7.2 were added. The cysteine-attached D21 peptide has 3 glycine residues and a cysteine attached to the end of the peptide binding sequence of the hair-binding D21 peptide (SEQ ID NO:46). This mixture was stirred at room temperature for 6 h. The final product, the C8-D21 peptide hair conditioner, was purified by extraction with water/ether. EXAMPLE 14 Preparation of a Peptide-Based-Carbon Black Hair Colorant The purpose of this Example was to prepare a peptide-based carbon black hair colorant using carbon black that was functionalized with ethanol amine. The number of peptides attached to the carbon black surface was estimated from chemical analyses. Preparation of Acid Functionalized Carbon Black Particles: In a 1,000 mL beaker was added 25.5 g of carbon black (Nipex- 160-IQ from Degussa, 100 g of ammonium persulfate [(NH^SaOe] (98% from Aldrich), and 333 ml of 1.0 M H2SO4 (98%, GR grade from EMD Chemicals) aqueous solution. The mixture was stirred with a magnetic stir plate for 24 h at room temperature. After this time, the reaction mixture was transferred to a 500 mL plastic centrifuge tube and centrifuged at 8,500 rpm for 20 min. The supernatant became clear and was removed. The product was washed 6 times with deionized water using centrifugation to collect the product after each wash. The final product was neutral (pH = 6.0) and was dried by lyophilization for 24 h. The average size of the functionalized carbon black particles was 100 nm, as measured using a particle size analyzer (Microtrac Ultrafine Particle Analyzer, Microtrac Inc., Montgomeryville, PA). Preparation of Amino-Functionalized Carbon Black Using Ethanolamine: Two grams of the dried, acid functionalized carbon black, 25 mL of ethanolamine (99% from Aldrich) and 1 mL of concentrated H2S04 (98%, GR grade from EMD Chemicals) were mixed in a 100 mL round bottom flask. The mixture was stirred rapidly with a magnetic stirrer and refluxed for 6 h. After the mixture cooled to room temperature, a sufficient amount of ammonium hydroxide (28.0-30.0% of NH3 from EMD Chemicals) was added to neutralize the mixture. Then, the mixture was centrifuged and washed with water, as described in Example 6. The final product was neutral (pH = 6.0) and was dried by lyophilization for 24 h. The dried, amino functionalized carbon black was readily dispersed in water. The surface composition of the functionalized carbon black was analyzed by ESCA at the DuPont Corporate Center for Analytical Science. In ESCA, monoenergetic X-rays are focused onto the surface of a material to excite surface atoms. Core and valence shell electrons with energies characteristic of elements in the top 10 nm of the surface are ejected and their energy analyzed to obtain qualitative and quantitative information on surface composition. The kinetic energy of the electrons emitted provides information about the functional groups and oxidation states of the surface species. In this Example, the X-ray source used was a magnesium anode with an energy of 1253.6 eV. The samples were analyzed at a 45 degree exit angle (approximately 5 to 10 nm sampling depth). The ESCA analysis results are shown in Table 14. For ethanolamine-functionalized carbon black, the surface was mainly composed of unreacted -COOH groups and -C(=0)-OCH2CH2NH2 groups. To calculate the ratio of amine (y) to carboxylic acid groups (x), a simple equation was used, specifically, y/(x+y) = (N%/14)/(O%/32) for ethanolamine. The results are given in Coupling of Amino-Functionalized Carbon Black with t-Boc-D21 -Peptide: The amino-functionalized carbon black particles were then covalently linked to the specific hair-binding peptide D21, given as SEQ ID N0:46. The t-Boc protected D21 peptide was synthesized as described in Example 10. Then, amino-functionalized carbon black (87 mg), t-Boc- D21-peptide (80 mg) and dicyclohexyl carbodiimide (DCC) (22 mg) were added to 3 ml of tetrahydrofuran (THF). A solution of dimethylaminopyridine (DMAP) (17 \iL) in several drops of THF was added dropwise to this mixture with stirring. The resulting dark suspension was heated to 40 °C for 6 h with stirring, followed by stirring overnight at room temperature. To remove the t-Boc protecting group from the D21 peptide, trifluoroacetic acid (TFA) (0.6 ml_) was added to the product and the mixture was stirred for another 6 h. Then, 5 ml_ of deionized water was added to the reaction mixture. The mixture was centrifuged at 3,500 rpm for 2 min and the supernatant was decanted. The solid remaining in the centrifuge tube was washed with deionized water and centrifuged again. This washing was repeated until the pH of supernatant reached approximately 6.0. The dark residue was then dried using a lyophilizer for 2 days, yielding a dark powder. The amino-functionalized carbon black particles and the peptidelinked carbon black particles were analyzed by ESCA, elemental analysis, and TGA (thermogravimetric analysis). The analytical results showed that the organic layer on the carbon black modified with ethanolamine was approximately 12% of the total weight. After the D21 peptides were attached to the carbon black particles, the peptide weight percentage was in the range of 18 - 30%. Therefore, for a 100 nm carbon black particle, a total of 9.5 x 104 molecules were attached to the surface after reacting with ethanolamine, and a total of 7,700 D21 peptide molecules were attached to the carbon black surface after reaction with the peptide. A calculation of the peptide density on the carbon black surface, revealed that each D21 peptide occupied 4 nm2, which is comparable to the peptide density attached to the phage, approximately 12 nm2. 83 EXAMPLE 15 Specificity of the Peptide-Based-Carbon Black Hair Colorant The purpose of this Example was to demonstrate the specificity of the D21 peptide-carbon black hair colorant. The D21 peptide-based-carbon black colorant was prepared as described in Example 14. A piece of pig skin (10 cm x 10 cm), obtained from a local supermarket, was cleaned by mixing with 30 ml_ of 30% isopropanol for 10 min and then washed at least 5 times with distilled water. After drying in air, the cleaned pig skin was immersed in a plate holder with multiple wells containing a solution of 50 mg of the D21 peptide-carbon black colorant dissolved in 10 mL of distilled water. After applying the colorant for 15 min, the pig skin was washed three times with a 30% shampoo solution (Pantene Pro-V shampoo) by dropping the shampoo solution into the wells and decanting it. Then, the pig skin was rinsed 5 times with distilled water. A normal white hair sample, obtained from International Hair * Importers and Products (Bellerose, NY), was treated in the same manner as the pig skin. After washing, the pig skin showed negligible dark color, while the hair was very light black. These results demonstrate that the D21 peptidecarbon black colorant has specific binding to hair, but not to skin. EXAMPLE 16 Preparation of a Peptide-Polvsiloxane Hair Conditioner The purpose of this Example was to synthesize a D21 peptidepolysiloxane hair conditioner. The reactive side functional groups of the D21 peptide, given as SEQ ID N0:46, were fully protected so that the reaction with the polysiloxane proceeded only with the C-terminal group of the peptide. In addition, a tripeptide spacer, consisting of glycine residues, was added to the C-terminal end of the binding sequence. Fifty milligrams of the fully protected D21 peptide Fmoc- R(Pbf)T(tBu)N(Trt)AAD(OtBu)H(Trt)PAAVT(tBu)GGG (where Fmoc means fluorenylmethoxylcarbonyl; Pbf means 2,2,6,4,7- pentamethyldihydrobenzofuran-5-sulfonyl; tBu means t-butyl; Trt means trityl; and Otbu means t-butoxyl) (MW2522, 0.02 mmol, 95% purity from SynPep, Dublin, CA), given as SEQ ID NO:78 was dissolved in 1 mL of dimethyformamide (DMF, from E. Merck, Darmstadt, Germany) in a 5 ml round bottom flask. Polysiloxane fluid 2-8566 (77 mg) (N%=0.875%, 0.024 mmol of-NHa, from Dow Corning, Midland, Ml) was dissolved in 2 mL of THF (E. Merck) in a sample vial, then transferred into the round bottom flask containing the peptide solution. Then, 5 mg of dicyclohexyl carbodiimide (DCC, 0.024 mmol) and 5 jiL of dimethylaminopyridine (DMAP) were added to the flask. The flask was sealed with a rubber stopper and the reaction mixture was stirred at 50 °C for 5 h and then, at room temperature overnight. After the reaction was completed, the solvent was pumped out under vacuum. After drying, 122 mg of the solid product was obtained. The yield was about 90%. The solid product was dissolved in N, N-dimethylacetamide (DMAC, from EMD Chemicals) and 5 mg/mL of the product solution in DMAC was prepared for GPC (gel permeation chromatography) analysis with refractive index detection to determine the molecular weight. The original polysiloxane (Dow Corning 2-8566) was not soluble in DMAC and was not observed in the separation region of the chromatogram. The D21 peptide had a sharp, low molecular weight peak, and the product sample contained 2 peaks, one from the free D21 peptide and a broad peak, which was attributed to polysiloxane grafted with D21 peptide. The weight-average molecular weight (Mw) was calculated from polymethylmethacrylate (PMMA) standards. The Mw of D21 peptide and the peptide-polysiloxane conditioner were 4.7x103, and 4.4x104, respectively. A cleavage reagent (referred to as Reagent K) having the following composition: trifluoroaceticacid/H2O/thioanisole/ethanedithiol/phenoI (85:5:5:2.5:2.5, by volume) was used to cleave the protecting groups from the side functional groups of the D21 peptide. Reagent K (1 mL) was pre-cooled to -20 °C and then, added to 100 mg of the D21 peptide-polysiloxane conditioner. The mixture was stirred for 3-4 h at room temperature and then Reagent K was removed under high vacuum. Then, the Fmoc protecting group was removed from the N-terminus of the peptide by adding 61.2 mg of 20 vol % piperidine in DMF to the mixture and stirring for 30 min, followed by pumping under high vacuum. The final product was not completely soluble in THF, DMF, or DMAC. GPC analysis of the final product was not possible because of the low solubility. EXAMPLE.17 Effectiveness of Peptide-Based Hair Conditioner The purpose of this Example was to demonstrate the effectiveness of a peptide-based hair conditioner in reducing frictional forces in human hair fibers and to compare its performance against a commercial conditioning agent. Fiber friction is a significant contributor to combing behavior of hair fiber assemblies (i.e., multiple fibers). The single hair fiber characterization of frictional forces can be related to the combing behavior of the hair assembly. Interfiber friction studies illustrate the improvement to the hair surface from conditioner applications. The lower the interfiber friction, the smoother the hair looks and feels, and the easier it is to comb. The interfiber friction measurement method employed in this Example is one of a few hair fiber tests to give hard, quantitative data and is generally accepted in the industry. The peptide-based hair conditioner described in Example 12, which consists of the hair-binding peptide given as SEQ ID NO:46 covalently linked to behenyl alcohol, was used in a formulation consisting of a mixture of 0.25% by weight of the peptide-based conditioner and 1.5% by weight of Performix™ Lecithin (ADM Lecithin, Decatur. IL) in distilled water. The aqueous solution was mixed at 7000 rpm for 4 min using a Silverson L4RT-A High Shear Laboratory Mixer (Silverson Machines, Inc., East Longmeadow, MA) with a general purpose disintegrating head and a 0.95 cm mini-micro tubular frame. A 0.5% solution of Dow Corning 929 Cationic Emulsion (Dow Corning Corp., Midland, Ml), a commercial conditioning agent, in distilled water was prepared using identical mixing conditions. 86 European dark brown hair swatches (International Hair Importers and Products) were cleaned before testing by immersing in isopropanol for 30 min, then washing 10 times with distilled water. Single hair fibers from these swatches were sent to Textile Research Institute (TRI), Princeton, NJ, for friction testing. At TRI, the hair fibers were immersed in the conditioner solutions for 5 min at approximately 35 °C without agitation. Afterwards, they were rinsed for 1 min in lukewarm water and then dried overnight at 21 °C and 65% relative humidity. Frictional force measurements of treated hair fibers were measured by the Interfiber friction test using a single-fiber friction apparatus, as described by Kamath et al. (J. Appl. Polymer Sci., 85:394-414 (2002)). Hair fibers were evaluated at high normal forces (high load) (0.74 g) against a chromed steel wire, crosshead speed of 1 mm/min, using an Instron Tensile Testing machine. Low normal forces (low load) (8.5 mg) were measured against another single hair fiber using the TRI/Scan™ Surface Force Analyzer (Textile Research Institute). This apparatus" measures small forces with a Cahn® microbalance (mass resolution of 0.1 mg) and features a computer controlled stage. The results of these measurements are given in Table 15. The peptide-based conditioner had a lower average friction than the Dow Corning 929 Cationic Emulsion conditioner in both cases. Subsequently, a conditioning sample of 1.5% lecithin was tested for fiber friction (low load) and the average mean frictional force was 3.366 mg, indicating that the conditioning effects observed with the peptide-based conditioner was not due to the presence of the lecithin in the formulation. These results demonstrate the effectiveness of the peptide-based hair conditioner. EXAMPLE 18 Preparation of a Peptide-Based Hair Colorant The purpose of this Example was to prepare a peptide-based hair colorant by covalently attaching the D21 hair-binding peptide (SEQ ID NO:46) to Disperse Orange 3 dye. The dye was first functionalized with isocyanate and then reacted with the D21 peptide. Functionalization of Disperse Orange 3: In a dry box, 14.25 g of Disperse Orange 3 (Aldrich) was suspended in 400 ml of dry THF in an addition funnel. A 2-liter, four-neck reaction flask (Corning Inc., Corning, NY; part no. 1533-12), containing a magnetic stir bar, was charged with 200 ml of dry toluene. The flask was fitted with a cold finger condenser (Corning Inc., part no. 1209-04) and with a second cold finger condenser with an addition funnel, and was placed on an oil bath in a hood. Phosgene (25.4 ml_) was condensed into the reaction flask at room temperature. After phosgene addition was complete, the temperature of the oil bath was raised to 80 °C and the Disperse Orange 3 suspension was added to the reaction flask dropwise in 100 ml increments over 2 h, while monitoring the reaction temperature and gas discharge from the scrubber. The temperature was maintained at or below 64 °C throughout the addition. After addition was complete, the reactants were heated at 64 °C for 1 h and then allowed to cool to room temperature with stirring overnight. The reaction solvents were vacuum-distilled to dryness, while maintaining the contents at or below 40 °C, and vacuum was maintained for an additional hour. The reaction flask was transferred to a dry box; the product was collected and dried overnight (15.65 g). The desired product was confirmed by proton NMR. Coupling of Isocvanate Functionalized Dve with D21 Hair-Binding Peptide: Isocyanate functionalized Disperse Orange 3 [(2-(4- isocyantophenyl)-1-(4-nitrophenyl)diazene ](16mg), prepared as described above, was dissolved in 5 ml of DMF and added to a solution containing 75 mg of non-protected D21 peptide (SEQ ID N0:46), obtained from SynPep, dissolved in 10 mL of DMF. The solution was stirred at room temperature for 24 h. The solvent was evaporated yielding 91 mg of a purplish powder. The product was analyzed by MALDI mass spectrometry and was found to have a molecular weight of 1766 g/mol, consistent with covalent attachment of the dye molecule to the peptide. EXAMPLE 19 Selection of Tooth-Binding Peptides Using Biopanning The purpose of this prophetic Example is to describe how to identify phage peptides that bind to teeth with high affinity. Extracted human teeth, which may be obtained from a Dental Office, are cleaned by brushing with soap solution, rinsed with deionized water, and allowed to air-dry at room temperature. The teeth are placed in a 15 mL centrifuge tube (Corning Inc., Acton, MA), one tooth per tube. The teeth samples are treated for 1 h with blocking buffer consisting of 1 mg/mL BSA in TBST-0.5%, and then washed with TBST-0.5%. The teeth samples are incubated with the phage library (Ph.D-12 Phage Display Peptide Library Kit) and washed 10 times using the same conditions described in Example 1. After the acidic elution step, described in Example 1, the teeth samples are washed three more times with the elution buffer and then washed three times with TBST-0.5%. The acidtreated teeth, which have acid resistant phage peptides still attached, are used to directly infect E. coli ER2738 cells as described in Example 2. The amplified and isolated phages are contacted with a fresh tooth sample and the biopanning procedure is repeated two more times. After the third round of biopanning, the acid-treated teeth are used to directly infect E. coli ER2738 cells, and the cells are cultured as described in Example 1. Single black plaques are randomly picked for DNA isolation and sequence analysis. The single plaque lysates are prepared following the manufacture's instructions (New England Biolabs) and the single stranded phage genomic DNA is purified using the QIAprep Spin M13 Kit (Qiagen, Valencia, CA) and sequenced using -96 gill sequencing primer, as described in Example 1. The identified peptide sequences will have a binding affinity for teeth. The binding specificity and affinity of the identified tooth-binding peptides is determined as described in Example 6. EXAMPLE 20 Preparation of a Peptide-Based Tooth Whitener The purpose of this prophetic Example is to describe how to prepare a peptide-based tooth whitener by coupling a tooth-binding peptide to the white pigment, titanium dioxide. Dry titanium dioxide having an average particle size less than 2 urn (available from E.I. du Pont de Nemours and Co., Wilmington, DE) is treated with a solution of 3-aminopropyltriethoxysilane (available from Aldrich) in dry acetone to covalently attach amino groups to the surface of the titanium dioxide. The excess reagent is removed by decantation after centrifuging to settle out the particles. The resultant particles are then treated with sufficient glutaraldehyde (available from Sigma Chemical Co.) to react with the surface attached amino groups. A tooth binding peptide, identified using the method described in Example 19, is obtained from SynPep. The tooth-binding peptide sequence is terminated with 1-5 lysine residues at the C terminus. The tooth-binding peptide is then added to the glutaraldehyde-treated titanium dioxide particles and is covalently coupled to the pendant free aldehyde groups on glutaraldehyde through an amine group on the peptide. We claim: 1. A diblock, peptide-based hair colorant having the general structure (HBP)n - C, wherein a) HBP is a hair-binding peptide; b) C is a coloring agent; and c) n ranges from 1 to about 10,000. 2. A triblock, peptide-based hair colorant having the general structure [(HBP)m - S]n - C, wherein a) HBP is a hair-binding peptide; b) C is a coloring agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000. 3. A colorant according to any one of claims 1 or 2, wherein the hair binding peptide is from about 7 to about 25 amino acids and has a binding affinity for hair, measured as MB50, equal to or less than 10-5 M. 4. The peptide-based hair colorant of any of claims 1 or 2, wherein the hair-binding peptide has the amino acid sequence selected from the group consisting of SEQ ID NOs:l, 3-59, 64, 66, 69, 70, 76-97 and 98. 5. The peptide-based hair colorant of Claim 1 or 2, wherein the coloring agent is selected from the group consisting of 4-hydroxypropylamino-3-mtrophenol, 4-amino-3-nitrophenol, 2-amino-6-chloro-4-nitrophenol, 2-nitro-paraphenylenediamine, N,N-hydroxyethyl-2-nitro-phenylenediamine, 4-nitro-indole, Henna, HC Blue 1, HC Blue 2, HC Yellow 4, HC Red 3, HC Red 5, Disperse Violet 4, Disperse Black 9, HC Blue 7, HC Blue 12, HC Yellow 2, HC Yellow 6, HC Yellow 8, HC Yellow 12, HC Brown 2, D&C Yellow 1, D&C Yellow 3, D&C Blue 1, Disperse Blue 3, Disperse violet 1, eosin derivatives such as D&C Red No. 21 and halogenated fluorescein derivatives such as D&C Red No. 27, D&C Red Orange No. 5 in combination with D&C Red No. 21 and D&C Orange No. 10; and pigments, such as D&C Red No. 36 and D&C Orange No. 17, the calcium lakes of D&C Red Nos. 7, 11, 31 and 34, the barium lake of D&C Red No. 12, the strontium lake of D&C Red No. 13, the aluminum lakes of FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27, of D&C Red No. 21, and of FD&C Blue No. 1, iron oxides, manganese violet, chromium oxide, titanium dioxide, titanium dioxide nanoparticles, zinc oxide, barium oxide, ultramarine blue, bismuth citrate, and carbon black particles,metal nanoparticles, and semiconductor nanoparticles.

Full Text

This patent application is a continuation in part of United States Patent Application, 10/935642, filed September 7, 2004, which claims the benefit of United States Provisional Application 60/501498, filed September 8, 2003, now expired.
The invention relates to the field of personal care products. More specifically, the invention relates to skin conditioners, hair conditioners, hair colorants, nail colorants, and skin colorants based upon specific skin-binding, hair-binding, and nail-binding peptides.
BACKGROUND OF THE INVENTION
Film-forming substances are widely used in compositions for skin and hair care as conditioning agents and moisturizers, and to protect the skin and hair against environmental and chemical damage. These substances adsorb onto and/or absorb into the skin or hair, forming a protective coating. Commonly used film-forming substances include synthetic polymers, such as silicones, polyvinylpyrrolidone, acrylic acid polymers, and polysaccharides, and proteins, such as collagen, keratin, elastin, casein, silk, and soy proteins. Many proteins are known to be particularly effective film-forming agents. Because of their low solubility at the conditions used in skin and hair care products, proteins are commonly used In the form of peptides, formed by the hydrolysis of the proteins.
In hair care and hair coloring compositions, film-forming substances are used to form a protective film on the surface of the hair to protect it from damage due to grooming and styling, shampooingrand exposure to ultraviolet light and the reactive chemicals commonly used In permanent wave agents, hair coloring products, bleaches, and hair straighteners, which denature the hair keratin protein. Moreover, these film-forming substances improve the elasticity of the hair. Film-forming substances that have been used in hair care products include proteins, such as keratin, collagen, soy, and silk proteins and hydrolysates thereof, and polymeric materials, such as polyacrylates, long chain alkyl quaternized amines, and
siloxane polymers. For example, Cannell at al. in U.S. Patent No.
6,013,250 describe a hair care composition for treating hair against
chemical and ultraviolet light damage. That composition comprises
hydrolyzed protein, having an abundance of anionic amino acids,
particularly, sulfur-containing amino acids, and divalent cations. It is
proposed in that disclosure that the anionic components of the hydrolyzed
protein bind to the hair by means of cationic bridges. Amino acids and
their derivatives have also been used in hair care compositions to
condition and strengthen hair. For example, OToole et al. in WO 0051556
describe hair care compositions containing four or more amino acid
compounds selected from histidine, lysine, methionine, tyrosine,
tryptophan, and cysteine compounds.
Film-forming substances are also used in skin care compositions to
form a protective film on the skin. These films can serve to lubricate and
coat the skin to passively impede the evaporation of moisture and smooth
and soften the skin. Commonly used film-forming substances in skin care
compositions include hydrolyzed animal and vegetable proteins (Puchalski
et al., U.S. Patent No. 4,416,873, EI-Menshawy et al., U.S. Patent No.
4,482,537, and Kojima et al., JP 02311412) and silk proteins (Philippe et
al., U.S. Patent No. 6,280,747 and Fahnestock et al., copending U.S.
Patent Application No. 10/704337). Amino acids and derivatives have
also been used in skin care compositions as conditioning agents. For
example, Kojima et al. in JP 06065049 describe skin care compositions
containing amino acids and/or their derivatives and docosahexaenoic acid,
its salts or its esters.
Hair coloring agents may be divided into three categories,
specifically, permanent, semi-permanent or direct, and temporary. The
permanent hair dyes are generally oxidative dyes that provide hair color
that lasts about four to six weeks. These oxidative hair dyes consist of two
parts, one part contains the oxidative dyes in addition to other ingredients,
while the second part contains an oxidizing agent such as hydrogen
peroxide. The two components are mixed immediately prior to use. The
oxidizing agent oxidizes the dye precursors, which then combine to form
large color molecules within the hair shaft. Although the oxidative hair
dyes provide long-lasting color, the oxidizing agents they contain cause
hair damage. The semi-permanent or direct hair dyes are preformed dye
molecules that are applied to the hair and provide color for about six to
twelve shampoos. This type of hair dye is gentler to the hair because it
does not contain peroxides, but the hair color does not last as long. Some
improved durability is achieved by the use of nanoparticle hair coloring
materials with a particle size of 10 to 500 nm, as described by Hensen et
al. in WO 01045652. These nanoparticle hair coloring materials are
conventional direct hair dyes that are treated to obtain nanoscale
dimensions and exhibit increased absorption into the hair. Temporary hair
dyes are coloring agents that are applied to the hair surface and are
removed after one shampoo. It would be desirable to develop a hair
coloring agent that provides the durability of the permanent hair dyes
without the use of oxidizing agents that damage hair.
The major problem with the current skin care and hair care
compositions, non-oxidative hair dyes, as well as nail coloring agents is
that they lack the required durability required for long-lasting effects. For
this reason, there have been attempts to enhance the binding of the
cosmetic agent to the hair, skin or nails. For example, Richardson et al. in
U.S. Patent No. 5,490,980 and Green et al. in U.S. Patent No. 6,267,957
describe the covalent attachment of cosmetic agents, such as skin
conditioners, hair conditioners, coloring agents, sunscreens, and
perfumes, to hair, skin, and nails using the enzyme transglutaminase.
This enzyme crosslinks an amine moiety on the cosmetic agent to the
glutamine residues in skin, hair, and nails. Similarly, Green et al. in WO
0107009 describe the use of the enzyme lysine oxidase to covalently
attach cosmetic agents to hair, skin, and nails.
In another approach, cosmetic agents have been covalently
attached to proteins or protein hydrolysates. For example, Lang et al. in
U.S. Patent No. 5,192,332 describe temporary coloring compositions that
contain an animal or vegetable protein, or hydrolysate thereof, which
contain residues of dye molecules grafted onto the protein chain. In those
compositions, the protein serves as a conditioning agent and does not
enhance the binding of the cosmetic agent to hair, skin, or nails. Horikoshi
et al. in JP 08104614 and Igarashi et al. in U.S. Patent No. 5,597,386
describe hair coloring agents that consist of an anti-keratin antibody
covalently attached to a dye or pigment. The antibody binds to the hair,
thereby enhancing the binding of the hair coloring agent to the hair.
Similarly, Kizawa et al. in JP 09003100 describe an antibody that
recognizes the surface layer of hair and its use to treat hair. A hair
coloring agent consisting of that anti-hair antibody coupled to colored latex
particles is also described. The use of antibodies to enhance the binding
of dyes to the hair is effective in increasing the durability of the hair
coloring, but these antibodies are difficult and expensive to produce.
Terada et al. in JP 2002363026 describe the use of conjugates consisting
of single-chain antibodies, preferably anti-keratin, coupled to dyes,
ligands, and cosmetic agents for skin and hair care compositions. The
single-chain antibodies may be prepared using genetic engineering
techniques, but are still difficult and expensive to prepare because of their
large size. Findlay in WO 00048558 describes the use of calycin proteins,
such as p-lactoglobulin, which contain a binding domain for a cosmetic
agent and another binding domain that binds to at least a part of the
surface of a hair fiber or skin surface, for conditioners, dyes, and
perfumes. Again these proteins are large and difficult and expensive to
produce.
Linter in U.S. Patent No. 6,620,419 describes peptides grafted to a
fatty acid chain and their use in cosmetic and dermopharmaceutical
applications. The peptides described in that disclosure are chosen
because they stimulate the synthesis of collagen; they are not specific
binding peptides that enhance the durability of hair and skin conditioners,
and hair, nail, and skin colorants.
Since its introduction in 1985, phage display has been widely used
to discover a variety of ligands including peptides, proteins and small
molecules for drug targets (Dixit, J. ofSci. & Ind. Research, 57:173-183
(1998)). The applications have expanded to other areas such as studying
protein folding, novel catalytic activities, DNA-binding proteins with novel
specificities, and novel peptide-based biomaterial scaffolds for tissue
engineering (Hoess, Chem. Rev. 101:3205-3218 (2001) and Holmes,
Trends Biotechnol. 20:16-21 (2002)). Whaley et al. (Nature 405:665-668
(2000)) disclose the use of phage display screening to identify peptide
sequences that can bind specifically to different crystallographic forms of
inorganic semiconductor substrates.
A modified screening method that comprises contacting a peptide
library with an anti-target to remove peptides that bind to the anti-target,
then contacting the non-binding peptides with the target has been
described (Estell et al. WO 0179479, Murray et al. U.S. Patent Application
Publication No. 2002/0098524, and Janssen et al. U.S. Patent Application
Publication No. 2003/0152976). Using that method, a peptide sequence
that binds to hair and not to skin, given as SEQ ID NO:1, and a peptide
sequence that binds to skin and not hair, given as SEQ ID N0:2, were
identified. Using the same method, Janssen et al. (WO 04048399)
identified other skin-binding and hair-binding peptides, as well as several
binding motifs. Although the potential use of these peptides in personal
care applications is suggested in those disclosures, the coupling of these
peptides to coloring agents and conditioning agents to prepare high-affinity
hair conditioners, skin conditioners, hair colorants, nail colorants and skin
colorants is not described. A method for identifying high-affinity phagepeptide
clones is also described in those disclosures. The method
involves using PCR to identify peptides that remain bound to the target
after acid elution.
Reisch (Chem. Eng. News 80:16-21 (2002)) reports that a family of
peptides designed to target an ingredient of specific human tissue has
been developed for personal care applications. However, no description
of peptide-based conditioners or coloring agents are disclosed in that
publication.
One of the peptide binding sequences of the instant invention,
given as SEQ ID NO:3, has been reported for several other purposes. For
example, Hupp et al. in WO 02065134 disclose the peptide sequence
5
SEQ ID N0:3 as a peptide for use in modulating the binding of a p53
polypeptide to a p300 polypeptide, useful for regulating the mammalian
cell cycle or to induce or prevent cell death. Liu et al. in U.S. Patent No.
6,344,443 describe the use of that same peptide sequence to inhibit
binding of tumor necrosis factor alpha to its receptor for preventing or
reversing inflammatory changes in patients with arthritis and other
inflammatory diseases. Another peptide binding sequence of the instant
invention, given as SEQ ID NO:4, was reported by Jagota et al. in WO
03102020 as a carbon nanotube-binding peptide.
In view of the above, a need exists for hair and skin conditioners,
and hair, nail, and skin colorants that provide improved durability for long
lasting effects and are easy and inexpensive to prepare.
Applicants have met the stated needs by identifying peptide
sequences using phage display screening that specifically bind to body
surfaces, such as, hair, skin, nails, teeth, gums, cornea! tissue, and oral
cavity surfaces, with high affinity and using them to design peptide-based
body surface reagents, such as, hair conditioners, skin conditioners, hair
colorants, nail colorants, skin colorants, and oral care reagents.
SUMMARY OF THE INVENTION
The invention provides peptide sequences that bind with high
affinity to hair, skin and nails. The invention also provides' peptide-based
conditioners and colorants for hair, skin, and nails. In one embodiment,
the peptide-based conditioners and colorants are diblock compositions.
Accordingly the invention provides a hair-binding peptide selected
from the group consisting of SEQ ID N0s:5, 6,7, 8, 9, 10, 11,12, 13,14,
15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,45, 46, 47, 48, 49, 50, 51, 52,
53, 54, 55, 56, 57, 58, 59, 64, 66, 69, and 70.
Similarly the invention provides a nail-binding peptide as set forth in
SEQ ID NO:60.
In another embodiment the invention provides a skin-binding
peptide as set forth in SEQ ID NO:61.
In one embodiment the invention provides a diblock, peptide based
body surface reagent having the general structure (BSBP)n - BA, wherein
a) BSBP is a body surface binding peptide;
b) BA is a benefit agent; and
c) n ranges from 1 to about 10,000.
Alternatively the invention provides, a triblock, peptide based body
surface reagent having the general structure [(BSBP)m - S]n - BA, wherein
a) BSBP is a body surface binding peptide;
b) BA is a benefit agent;
c) S is a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 10,000.
In another embodiment the invention provides a diblock, peptidebased
hair conditioner having the general structure (HBP)n - HCA,
wherein
a) HBP is a hair-binding peptide;
b) HCA is a hair conditioning agent; and
c) n ranges from 1 to about 1000.
Similarly the invention provides a diblock, peptide-based skin
conditioner having the general structure (SBP)n - SCA, wherein
a) SBP is a skin-binding peptide;
b) SCA is a skin conditioning agent; and
c) n ranges from 1 to about 1000.
In an alternate embodiment the invention provides a diblock,
peptide-based hair colorant having the general structure (HBP)n- C,
wherein
a) HBP is a hair-binding peptide;
b) C is a coloring agent; and
c) n ranges from 1 to about 10,000.
In another embodiment the invention provides a diblock, peptidebased
nail colorant having the general structure (NBP)n - C, wherein
7
a) NBP is a nail-binding peptide;
b) C is a coloring agent; and
c) n ranges from 1 to about 10,000.
In another embodiment the invention provides a diblock, peptidebased
skin colorant having the general structure (SBP)n - C, wherein
a) SBP is a skin-binding peptide;
b) C is a coloring agent; and
c) n ranges from 1 to about 10,000.
In a similar embodiment the invention provides a triblock, peptidebased
hair conditioner having the general structure [(HBP)m - S]n - HCA,
wherein
a) HBP is a hair-binding peptide;
b) HCA is a hair conditioning agent;
c) S is a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 1000.
Alternatively the invention provides a triblock, peptide-based skin
conditioner having the general structure [(SBP)m - S]n - SCA, wherein
a) SBP is a hair-binding peptide;
b) SCA is a skin conditioning agent;
c) S is a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 1000.
Similarly the invention provides a triblock, peptide-based hair
colorant having the general structure [(HBP)m - S]n - C, wherein
a) HBP is a hair-binding peptide;
b) C is a coloring agent;
c) S is a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 10,000.
8
In another embodiment the invention provides a triblock, peptidebased
nail colorant having the general structure [(NBP)m - S]n - C,
wherein
a) NBP is a hair-binding peptide;
b) C is a coloring agent;
c) S is a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 10,000.
In another embodiment the invention provides a triblock, peptidebased
skin colorant having the general structure [(SBP)m - S]n - C,
wherein
a) SBP is a hair-binding peptide;
b) C is a coloring agent;
c) Sis a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 10,000.
In an alternate embodiment the invention provides a diblock,
peptide-based oral care reagent having the general structure (OBP)n -
OBA, wherein
a) OBP is an oral cavity surface-binding peptide;
b) OBA is an oral care benefit agent; and
c) n ranges from 1 to about 10,000.
Similarly the invention provides a triblock, peptide-based oral care
reagent having the general structure [(OBP)m - S]n - OBA, wherein
a) OBP is an oral cavity surface-binding peptide;
b) OBA is an oral care benefit agent;
c) S is a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 10,000.
Additionally the invention provides a method for generating a high
affinity body surface binding- peptide comprising:
a) providing a library of combinatorial generated phage-peptides;
b) contacting the library of (a) with a body surface sample to form a
reaction solution comprising:
(i) phage-peptide-body surface sample complexes;
(ii) unbound body surface sample, and
(iii) uncomplexed peptides;
c) isolating the phage-peptide-body surface sample complexes of
(b);
d) eluting the weakly-bound phage-peptides from the isolated
phage-peptide complex of (c);
e) infecting bacterial host cells directly with the phege-peptide-body
surface sample complexes remaining after step (d);
f) growing the infected cells of step (e) in a suitable growth
medium; and
g) isolating and identifying the phage-peptides from the grown cells
of step (f), wherein the phage-peptides have a high binding affinity
for a body surface.
In a preferred embodiment the invention provides methods for
forming a protective layer of a peptide-based conditioner on hair
comprising applying the composition of the invention to the hair and
allowing the formation of said protective layer.
Similarly the invention provides methods for forming a protective
layer of a peptide-based conditioner on skin or lips comprising applying the
composition of the invention to the skin or lips and allowing the formation
of said protective layer.
In one embodiment the invention provides a method for applying a
benefit agent to a body surface comprising contacting a body surface with
the peptide based body surface reagent of either of claims 4 or 5,
comprising a body surface binding peptide and a benefit agent, with a
body surface under conditions whereby the body surface binding peptide
adheres to the body surface.
In another embodiment the invention provides a method for coloring
hair, eyebrows, skin or nails comprising applying the hair, eyebrows, skin
or nail coloring composition of the invention to the hair, eyebrows, skin or
10
nails for a period of time sufficient to cause coloration of the hair,
eyebrows, skin or nails.
In a preferred embodiment the invention provides a method for
coloring hair, eyebrows or eyelashes comprising the steps of:
a) providing a hair coloring composition comprising a hair colorant
selected from the group consisting of:
i)(HBP)n-C;and
ii) [(HBP)m - S]k - C
wherein
1) HBP is a hair-binding peptide;
2) C is a coloring agent;
3) n ranges from 1 to about 10,000;
4) S is a spacer;
5) m ranges from 1 to about 50; and
6) k ranges from 1 to about 10,000;
and wherein the hair binding peptide is selected by a method
comprising the steps of:
A) providing a library of combinatorial generated phagepeptides;
B) contacting the library of (A) with a hair sample to form
a reaction solution comprising:
(i) phage-peptide-hair complex;
(ii) unbound hair, and
(iii) uncomplexed peptides;
C) isolating the phage-peptide-hair complex of (B);
D) eluting the weakly bound peptides from the isolated
peptide complex of (C);
E) identifying the remaining bound phage-peptides
either by using the polymerase chain reaction directly
with the phage-peptide-hair complex remaining after
step (D), or by infecting bacterial host cells directly
with the phage-peptide-hair complex remaining after
step (D), growing the infected cells in a suitable
growth medium, and isolating and identifying the
phage-peptides from the grown cells, wherein the
phage-peptides are from about 7 to about 25 amino
acids and have a binding affinity for hair, measured as
MBso, equal to or less than 10 M; and
b) applying the hair colorant of (a) to hair, eyebrows or eyelashes
for a time sufficient for the peptide-based colorant to bind to hair,
eyebrows or eyelashes.
In another embodiment the invention provides a method for forming
a protective layer of a peptide-based conditioner on hair comprising the
steps of:
a) providing a hair care composition comprising a hair conditioner
selected from the group consisting of:
i)(HBP)n-HCA;and
ii) [(HBP)m - S]k - HCA
wherein
1) HBP is a hair-binding peptide;
2) HCA is a hair conditioning agent;
3) n ranges from 1 to about 1,000;
4) S is a spacer;
5) m ranges from 1 to about 50; and
6) k ranges from 1 to about 1,000;
and wherein the hair binding peptide is selected by a method
comprising the steps of:
A) providing a library of combinatorial generated phagepeptides;
B) contacting the library of (A) with a hair sample to form
a reaction solution comprising:
(i) phage-peptide-hair complex;
(ii) unbound hair, and
(iii) uncomplexed peptides;
C) isolating the phage-peptide-hair complex of (B)
D) eluting the weakly bound peptides from the isolated
peptide complex of (C);
E) identifying the remaining bound phage-peptides
1 either by using the polymerase chain reaction directly
with the phage-peptide-hair complex remaining after
step (D), or by infecting bacterial host cells directly
with the phage-peptide-hair complex remaining after
step (D), growing the infected cells in a suitable
growth medium, and isolating and identifying the
phage-peptides from the grown cells, wherein the
phage-peptides are from about 7 to about 25 amino
acids and have a binding affinity for hair, measured as
MBso, equal to or less than 10" M; and
b) applying the hair conditioner of (a) to hair and allowing the
formation of
said protective layer.
Alternatively the invention provides a method for forming a protective layer
on skin or lips comprising the steps of:
a) providing a skin care composition comprising a skin conditioner
selected from the group consisting of:
i)(SBP)n-SCA;and
ii) I(SBP)m - S]k - SCA
wherein
1) SBP is a skin-binding peptide;
2) SCA is a skin conditioning agent;
3) n ranges from 1 to about 1,000;
4) S is a spacer;
5) m ranges from 1 to about 50; and
6) k ranges from 1 to about 1,000;
and wherein the skin binding peptide is selected by a method
comprising the steps of:
13
A) providing a library of combinatorial generated phagepeptides;
B) contacting the library of (A) with a skin sample to form
a reaction solution comprising:
(i) phage-peptide-skin complex;
(ii) unbound skin, and
(iii) uncomplexed peptides;
C) isolating the phage-peptide-skin complex of (B);
D) eluting the weakly bound peptides from the isolated
peptide complex of (C);
E) identifying the remaining bound phage-peptides
either by using the polymerase chain reaction directly
with the phage-peptide-skin complex remaining after
step (D), or by infecting bacterial host cells directly
with the phage-peptide-skin complex remaining after
step (D), growing the infected cells in a suitablegrowth medium, and isolating and identifying the
phage-peptides from the grown cells, wherein the
phage-peptides are from about 7 to about 25 amino
acids and have a binding affinity for skin, measured as
MBso, equal to or less than 10" M; and
b) applying the skin conditioner of (a) to skin or lips and allowing
the formation of said protective layer.
In another embodiment the invention provides a method for coloring
skin or lips comprising the steps of:
a) providing a cosmetic composition comprising a skin colorant
selected from the group consisting of:
i)(SBP)n-C;and
ii)[(SBP)m-S]k-C
wherein
1) SBP is a skin-binding peptide;
2) C is a coloring agent;
3) n ranges from 1 to about 10,000;
4) S is a spacer;
5) m ranges from 1 to about 50; and
6) k ranges from 1 to about 10,000;
and wherein the skin binding peptide is selected by a method
comprising the steps of:
A) providing a library of combinatorial generated phagepeptides;
B) contacting the library of (A) with a skin sample to form
a reaction solution comprising:
(i) phage-peptide-skin complex;
(ii) unbound skin, and
(iii) uncomplexed peptides;
C) isolating the phage-peptide-skin complex of (B);
D) eluting the weakly bound peptides from the isolated
peptide complex of (C);
E) identifying the remaining bound phage-peptides either
by using the polymerase chain reaction directly with
the phage-peptide-skin complex remaining after step
(D), or by infecting bacterial host cells directly with the
phage-peptide-skin complex remaining after step (D),
growing the infected cells in a suitable growth
medium, and isolating and identifying the phagepeptides
from the grown cells, wherein the phagepeptides
are from about 7 to about 25 amino acids
and have a binding affinity for skin, measured as
MBso, equal to or less thanIO M; and
b) applying the skin colorant of (a) to the skin or lips.
Alternatively the invention provides a method for coloring nails
comprising the steps of:
a) providing a nail polish composition comprising a nail colorant
selected from the group consisting of:
i)(NBP)n-C;and
ii) [(NBP)m - S]k - C
wherein
1) NBP is a nail-binding peptide;
2) C is a coloring agent;
3) n ranges from 1 to about 10,000;
4) S is a spacer;
5) m ranges from 1 to about 50; and
6) k ranges from 1 to about 10,000;
and wherein the nail binding peptide is selected by a method
comprising the steps of:
A) providing a library of combinatorial generated phagepeptides;
B) contacting the library of (A) with a nail sample to form
a reaction solution comprising:
(i) phage-peptide-nail complex;
(ii) unbound nail, and
(iii) uncomplexed peptides;
C) isolating the phage-peptide-nail complex of (B);
D) eluting the weakly bound peptides from the isolated
peptide complex of (C);
E) identifying the remaining bound phage-peptides either
by using the polymerase chain reaction directly with
the phage-peptide-nail complex remaining after step
(D), or by infecting bacterial host cells directly with the
phage-peptide-nail complex remaining after step (D),
growing the infected cells in a suitable growth
medium, and isolating and identifying the phagepeptides
from the grown cells, wherein the phagepeptides
are from about 7 to about 25 amino acids
and have a binding affinity for nails, measured as
, equal to or less thanl0" M; and
b) applying the nail colorant of (a) to the nails.
In another embodiment the invention provides a method for applying an
oral care benefit reagent to an oral cavity surface comprising the steps of:
a) providing an oral care reagent selected from the group consisting
of:
i) (OBP)n - OBA; and
ii) l(OBP)m - S]k - OBA wherein
1) OBP is an oral cavity surface-binding peptide;
2) OBA is an oral care benefit agent;
3) n ranges from 1 to about 10,000;
4) S is a spacer;
5) m ranges from 1 to about 50; and
6) k ranges from 1 to about 10,000;
and wherein the oral cavity surface-binding peptide is selected by a
method comprising the steps of:
A) providing a library of combinatorial generated phagepeptides;
B) contacting the library of (A) with an oral cavity surface
sample to form a reaction solution comprising:
(i) phage-peptide-oral cavity surface sample complex;
(ii) unbound oral cavity surface sample, and
(iii) uncomplexed peptides;
C) isolating the phage-peptide- oral cavity surface
sample complex of (B);
D) eluting the weakly bound peptides from the isolated
peptide complex of (C);
E) identifying the remaining bound phage-peptides
either by using the polymerase chain reaction directly
with the phage-peptide- oral cavity surface sample
complex remaining after step (D), or by infecting
bacterial host cells directly with the phage-peptideoral
cavity surface sample complex remaining after
step (D), growing the infected cells in a suitable
growth medium, and isolating and identifying the
phage-peptides from the grown cells, wherein the
phage-peptides are from about 7 to about 25 amino
acids and have a binding affinity for oral cavity surface
sample, measured as MBsn, equal to or less than 10"
M; and
b) applying the oral care benefit agent of (a) to an oral cavity
surface for a time sufficient for the peptide-based oral care agent to
bind to an oral cavity surface.
BRIEF DESCRIPTION OF SEQUENCE DESCRIPTIONS
The invention can be more fully understood from the following
detailed description and the accompanying sequence descriptions, which
form a part of this application.
The following sequences conform with 37 C.F.R. 1.821-1.825
("Requirements for Patent Applications Containing Nucleotide Sequences
and/or Amino Acid Sequence Disclosures - the Sequence Rules") and
consistent with World Intellectual Property Organization (WIPO) Standard
ST.25 (1998) and the sequence listing requirements of the EPO and PCT
(Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the
Administrative Instructions). The symbols and format used for nucleotide
and amino acid sequence data comply with the rules set forth in
37 C.F.R. §1.822.
SEQ ID NO:1 is the amino acid sequence of a hair-binding peptide.
SEQ ID NO:2 is the amino acid sequence of a skin-binding peptide.
SEQ ID NOs:3-52, 54-59 are the amino acid sequences of hairbinding
peptides of the present invention
SEQ ID N0:53 is the amino acid sequence of a hair-binding and
nail-binding peptide of the present invention.
SEQ ID NO:60 is the amino acid sequence of a nail-binding peptide
of the present invention.
SEQ ID NO:61 is the amino acid sequence of a skin-binding peptide
of the present invention.
SEQ ID NO:62 is the oligonucleotide primer used to sequence
phage DNA.
SEQ ID NO:63 is the amino acid sequence of a peptide used as a
control in the EL1SA binding assay.
SEQ ID NO:64 is the amino acid sequence of a cysteine-attached
hair-binding peptide.
SEQ ID NO:65 is the amino acid sequence of the Caspase 3
cleavage site.
SEQ ID NOs:66, 69, and 70 are the amino acid sequence of
shampoo-resistant hair-binding peptides.
SEQ ID NOs:67 and 68 are the nucleotide sequences of the
primers used to amplify shampoo-resistant, hair-binding phage peptides,
as described in Example 8.
SEQ ID NOs:71-74 are the amino acid sequences of the
biotinylated hair-binding and skin-binding peptides used Example 9.
SEQ ID NO:75 is the amino acid sequence of the fully protected
D21 peptide used in Example 16.
SEQ ID NOs:76-98 are the amino acid sequences of hair-binding
peptides.
SEQ ID NOs:99-104 are the amino acid sequences of skin-binding
peptides.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides peptide sequences that specifically
bind to human body surfaces such as hair, skin, nails, teeth, gums, and
the like with high affinity. Additionally, the present invention provides
peptide based body surface reagents that are comprised of body surface
binding peptides coupled with various benefit agents that convey a benefit
to the body surface. Typical of the compositions of the invention are
peptide-based hair and skin conditioners, and hair, nail, and skin colorants
with improved durability.
The peptide based body surface reagents of the invention provide
benefits and an advance over the art in the development of personal care
products. Because the reagents are peptide based they are able to bind
strongly to surfaces from an aqueous environment, thus in many cases
being both water soluble and water fast. Additionally, because of the
aqueous nature of the reagents they may be removed from body surfaces
without of the use of odor producing chemicals. The reagents of the
invention bind almost immediately to the target body surface, eliminating
the need for long drying times, typical of most personal care applications.
Additionally the reagents of the invention are specific in their affinity for
body surfaces, making the need to isolate their application to a specific
surface unnecessary. Thus a regent that binds hair for coloring will not
bind skin and visa versa. Most importantly, the peptide nature of the
reagents makes them virtually non-toxic and non-irritating to exposed
body surfaces such as the skin and the membranes of the eyes and
mouth.
The following definitions are used herein and should be referred to
for interpretation of the claims and the specification.
"HBP" means hair-binding peptide.
^
"SBP" means skin-binding peptide.
"NBP" means nail-binding peptide.
"OBP" means oral cavity surface-binding peptide.
"TBP" means tooth-binding peptide.
"HCA" means hair conditioning agent.
"SCA" means skin conditioning agent.
"C" means coloring agent for hair, skin, or nails.
"OBA" means oral benefit agent.
"S" means spacer.
"BSBP" means body surface binding peptide.
"BA" means benefit agent.
The term "peptide" refers to two or more amino acids joined to each
other by peptide bonds or modified peptide bonds.
The term "body surface" will mean any surface of the human body
that may serve as a substrate for the binding of a peptide carrying a
benefit agent. Typical body surfaces include but are not limited to hair,
skin, nails, teeth, gums, and corneal tissue.
The term "benefit agent' is a general term applying to a compound
or substance that may be coupled with a binding peptide for application to
a body surface. Benefit agents typically include conditioners, colorants,
fragrances, whiteners and the like along with other substances commonly
used in the personal care industry.
The term "hair" as used herein refers to human hair, eyebrows, and
eyelashes.
The term "skin" as used herein refers to human skin, or pig skin,
Vitro-Skin and EpiDerm™ which are substitutes for human skin. Skin as
used herein as a body surface will generally comprise a layer of epithelial
cells and may additionally comprise a layer of endothelial cells.
The term "nails" as used herein refers to human fingernails and
toenails.
The terms "coupling" and "coupled" as used herein refer to any
chemical association and includes both covalent and non-covalent
interactions.
The term "stringency" as it is applied to the selection of the hairbinding,
skin-binding, and nail-binding peptides of the present invention,
refers to the concentration of the eluting agent (usually detergent) used to
elute peptides from the hair, skin, or nails. Higher concentrations of the
eluting agent provide more stringent conditions.
The term "peptide-body surface sample complex" means structure
comprising a peptide bound to a sample of a body surface via a binding
site on the peptide.
The term "peptide-hair complex" means structure comprising a
peptide bound to a hair fiber via a binding site on the peptide.
The term "peptide-skin complex" means structure comprising a
peptide bound to the skin via a binding site on the peptide.
The term "peptide-nail complex" means structure comprising a
peptide bound to fingernails or toenails via a binding site on the peptide.
The term "peptide-substrate complex" refers to either peptide-hair,
peptide-skin, or peptide-nail complexes.
The term "MBso" refers to the concentration of the binding peptide
that gives a signal that is 50% of the maximum signal obtained in an
ELISA-based binding assay, as described in Example 9. The MBso
provides an indication of the strength of the binding interaction or affinity of
the components of the complex. The lower the value of MBso, the
stronger the interaction of the peptide with its corresponding substrate.
The term "binding affinity" refers to the strength of the interaction of
a binding peptide with its respective substrate. The binding affinity is
defined herein in terms of the MBso value, determined in an ELISA-based
binding assay.
The term "nanoparticles" are herein defined as particles with an
average particle diameter of between 1 and 100 nm. Preferably, the
average particle diameter of the particles is between about 1 and 40 nm.
As used herein, "particle size" and "particle diameter" have the same
meaning. Nanoparticles include, but are not limited to, metallic,
semiconductor, polymer, or silica particles.
The term "amino acid" refers to the basic chemical structural unit of
a protein or polypeptide. The following abbreviations are used herein to
identify specific amino acids:
Three-Letter One-Letter
Amino Acid Abbreviation Abbreviation
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic acid Asp D
Cysteine Cys C
Glutamine Gin Q
(Table Removed)
"Gene" refers to a nucleic acid fragment that expresses a specific
protein, including regulatory sequences preceding (51 non-coding
sequences) and following (3' non-coding sequences) the coding
sequence. "Native gene" refers to a gene as found in nature with its own
regulatory sequences "Chimeric gene" refers to any gene that is not a
native gene, comprising regulatory and coding sequences that are not
found together in nature. Accordingly, a chimeric gene may comprise
regulatory sequences and coding sequences that are derived from
different sources, or regulatory sequences and coding sequences derived
from the same source, but arranged in a manner different than that found
in nature. A "foreign" gene refers to a gene not normally found in the host
organism, but that is introduced into the host organism by gene transfer.
Foreign genes can comprise native genes inserted into a non-native
organism, or chimeric genes.
"Synthetic genes" can be assembled from oligonucleotide building
blocks that are chemically synthesized using procedures known to those
skilled in the art. These building blocks are ligated and annealed to form
gene segments which are then enzymatically assembled to construct the
entire gene. "Chemically synthesized", as related to a sequence of DMA,
means that the component nucleotides were assembled in vitro. Manual
chemical synthesis of DMA may be accomplished using well-established
procedures, or automated chemical synthesis can be performed using one
of a number of commercially available machines. Accordingly, the genes
can be tailored for optimal gene expression based on optimization of
nucleotide sequence to reflect the codon bias of the host cell. The skilled
artisan appreciates the likelihood of successful gene expression if codon
usage is biased towards those codons favored by the host. Determination
of preferred codons can be based on a survey of genes derived from the
host cell where sequence information is available.
"Coding sequence" refers to a DMA sequence that codes for a
specific amino acid sequence. "Suitable regulatory sequences" refer to
nucleotide sequences located upstream (51 non-coding sequences), within,
or downstream (3' non-coding sequences) of a coding sequence, and
which influence the transcription, RNA processing or stability, or
translation of the associated coding sequence. Regulatory sequences
may include promoters, translation leader sequences, introns,
polyadenylation recognition sequences, RNA processing site, effector
binding site and stem-loop structure.
i "Promoter" refers to a DNA sequence capable of controlling the
expression of a coding sequence or functional RNA. In general, a coxiing
sequence is located 3' to a promoter sequence. Promoters may be
derived in their entirety from a native gene, or be composed of different
elements derived from different promoters found in nature, or even
20 comprise synthetic DNA segments. It is understood by those skilled in the
art that different promoters may direct the expression of a gene in different
tissues or cell types, or at different stages of development, or in response
to different environmental or physiological conditions. Promoters which
cause a gene to be expressed in most cell types at most times are
commonly referred to as "constitutive promoters". It is further recognized
that since in most cases the exact boundaries of regulatory sequences
have not been completely defined, DNA fragments of different lengths may
have identical promoter activity.
The term "expression", as used herein, refers to the transcription
and stable accumulation of sense (mRNA) or antisense RNA derived from
the nucleic acid fragment of the invention. Expression may also refer to
translation of mRNA into a polypeptide.
The term "transformation" refers to the transfer of a nucleic acid
fragment into the genome of a host organism, resulting in genetically
stable inheritance. Host organisms containing the transformed nucleic
acid fragments are referred to as "transgenic" or "recombinant" or
"transformed" organisms.
The term "host cell" refers to cell which has been transformed or
transfected, or is capable of transformation or transfection by an
exogenous polynucleotide sequence.
The terms "plasmid", "vector" and "cassette" refer to an extra
chromosomal element often carrying genes which are not part of the
central metabolism of the cell, and usually in the form of circular doublestranded
DMA molecules. Such elements may be autonomously
replicating sequences, genome integrating sequences, phage or
nucleotide sequences, linear or circular, of a single- or double-stranded
DMA or RNA, derived from any source, in which a number of nucleotide
sequences have been joined or recombined into a unique construction
which is capable of introducing a promoter fragment and DNA sequence
for a selected gene product along with appropriate 3' untranslated
sequence into a cell. "Transformation cassette" refers to a specific vector
containing a foreign gene and having elements in addition to the foreign
gene that facilitate transformation of a particular host cell. "Expression
cassette" refers to a specific vector containing a foreign gene and having
elements in addition to the foreign gene that allow for enhanced
expression of that gene in a foreign host.
The term "phage" or "bacteriophage" refers to a virus that infects
bacteria. Altered forms may be used for the purpose of the present
invention. The preferred bacteriophage is derived from the "wild" phage,
called M13. The M13 system can grow inside a bacterium, so that it does
not destroy the cell it infects but causes it to make new phages
continuously. It is a single-stranded DNA phage.
The term "phage display" refers to the display of functional foreign
peptides or small proteins on the surface of bacteriophage or phagemid
particles. Genetically engineered phage may be used to present peptides
as segments of their native surface proteins. Peptide libraries may be
produced by populations of phage with different gene sequences.
"PCR" or "polymerase chain reaction" is a technique used for the
amplification of specific DNA segments (U.S. Patent Nos. 4,683,195 and
4,800,159).
Standard recombinant DNA and molecular cloning techniques used
herein are well known in the art and are described by Sambrook, J.,
Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual,
Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY (1989) (hereinafter "Maniatis"); and by Silhavy, T. J., Bennan,
M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring
Harbor Laboratory Cold Press Spring Harbor, NY (1984); and by Ausubel,
F. M. et al., Current Protocols in Molecular Biology, published by Greene
Publishing Assoc. and Wiley-lnterscience (1987).
The present invention comprises specific hair-binding, skin-binding,
and nail-binding peptides and their use in conditioners and coloring agents
for the hair, skin, and nails.
Body Surfaces
Body surfaces of the invention are any surface on the human body
that will serve as a substrate for a binding peptide. Typical body surfaces
include, but are not limited to hair, skin, nails, teeth, gums, corneal tissue
and the tissues of the oral cavity. In many cases the body surfaces of the
invention will be exposed to air, however in some instances, the oral cavity
for example, the surfaces will be internal. Accordingly body surfaces may
include layers of both epithelial and well as endothelial cells.
Samples of body surfaces are available from a variety of sources.
For example, human hair samples are available commercially, for example
from International Hair Importers and Products (Bellerose, NY), in different
colors, such as brown, black, red, and blond, and in various types, such as
African-American, Caucasian, and Asian. Additionally, the hair samples
may be treated for example using hydrogen peroxide to obtain bleached
hair. Pig skin, available from butcher shops and supermarkets, Vitro-
Skin®, available from IMS Inc. (Milford, CT), and EpiDerm™, available
from MatTek Corp. (Ashland, MA), are good substitutes for human skin.
Human fingernails and toenails may be obtained from volunteers.
Extracted human teeth and false teeth may be obtained from Dental
offices. Additionally, hydroxyapatite, available in many forms for example
from Berkeley Advanced Biomaterials, Inc. (San Leandro, CA) may be
used as a model for human teeth.
Body Surface-Binding Peptides
Body surface-binding peptides as defined herein are peptide
sequences that specifically bind with high affinity to specific body surfaces,
including, but not limited to hair, skin, nails, teeth, tongue, cheeks, lips,
gums, corneal tissue and the tissues of the oral cavity, for example. Body
surface-binding peptides of the present invention are from about 7 amino
acids to about 45 amino acids, more preferably, from about 7 amino acids
to about 20 amino acids. The binding peptides of the invention have a
binding affinity for their respective substrate, as measured
values, of less than or equal to about 10~2 M, less than or equal to about
10~3 M, less than or equal to about 10~4 M, less than or equal to about 10~5
M, preferably less than or equal to about 10~6 M, and more preferably less
than or equal to about 10~7 M.
Suitable body surface-binding peptide sequences may be selected
using methods that are well known in the art. The peptides of the present
invention are generated randomly and then selected against a specific
body surface, for example, hair, skin, nail ,or oral cavity surface sample,
based upon their binding affinity for the surface of interest. The generation
of random libraries of peptides is well known and may be accomplished by
a variety of techniques including, bacterial display (Kemp, D.J.; Proc. Natl.
Acad. Sci. USA 78(7):4520-4524 (1981), and Helfman et al., Proc. Natl.
Acad. Sci. USA 80(1):31-35, (1983)), yeast display (Chien et al., Proc Natl
Acad Sci USA 88(21 ):9578-82 (1991)), combinatorial solid phase peptide
synthesis (U.S. Patent No. 5,449,754, U.S. Patent No. 5,480,971, U.S.
Patent No. 5,585,275, U.S. Patent No.5,639,603), and phage display
technology (U.S. Patent No. 5,223,409, U.S. Patent No. 5,403,484, U.S.
Patent No. 5,571,698, U.S. Patent No. 5,837,500). Techniques to
generate such biological peptide libraries are described in Dani, M, J. of
Receptor & Signal Transduction Res., 21(4):447-468 (2001).
A preferred method to randomly generate peptides.is by phage
display. Phage display Is an in vitro selection technique in which a peptide
or protein is genetically fused to a coat protein of a bacteriophage,
resulting in display of fused peptide on the exterior of the phage virion,
while the DNA encoding the fusion resides within the virion. This physical
linkage between the displayed peptide and the DNA encoding it allows
screening of vast numbers of variants of peptides, each linked to a
corresponding DNA sequence, by a simple in vitro selection procedure
called "biopanning". In its simplest form, biopanning is carried out by
incubating the pool of phage-displayed variants with a target of interest
that has been immobilized on a plate or bead, washing away unbound
phage, and eluting specifically bound phage by disrupting the binding
interactions between the phage and the target. The eluted phage is then
amplified in vivo and the process is repeated, resulting in a stepwise
enrichment of the phage pool in favor of the tightest binding sequences.
After 3 or more rounds of selection/amplification, individual clones are
characterized by DNA sequencing.
After a suitable library of peptides has been generated, they are
then contacted with an appropriate amount of the test substrate,
specifically a body surface sample. The library of peptides is dissolved in a
suitable solution for contacting the sample. The body surface sample may
be suspended in the solution or may be immobilized on a plate or bead. A
preferred solution is a buffered aqueous saline solution containing a
surfactant. A suitable solution is Tris-buffered saline (TBS) with 0.5%
Tween® 20. The solution may additionally be agitated by any means in
order to increase the mass transfer rate of the peptides to body surface
sample, thereby shortening the time required to attain maximum binding.
Upon contact, a number of the randomly generated peptides will
bind to the body surface sample to form a peptide-body-surface complex,
for example a peptide-hair, peptide-skin, peptide-nail, or peptide-oral
cavity surface complex. Unbound peptide may be removed by washing.
After all unbound material is removed, peptides having varying degrees of
binding affinities for the test surface may be fractionated by selected
washings in buffers having varying stringencies. Increasing the stringency
of the buffer used increases the required strength of the bond between the
peptide and body surface in the peptide-body surface complex.
A number of substances may be used to vary the stringency of the
buffer solution in peptide selection including, but not limited to, acidic pH
(1.5-3.0); basic pH (10-12.5); high salt concentrations such as MgCfe (3-5
M) and LiCI (5-10 M); water; ethylene glycol (25-50%); dioxane (5-20%);
thiocyanate (1-5 M); guanidine (2-5 M); urea (2-8 M); and various
concentrations of different surfactants such as SDS (sodium dodecyl
sulfate), DOC (sodium deoxycholate), Nonidet P-40, Triton X-100, Tween®
20, wherein Tween® 20 is preferred. These substances may be prepared
in buffer solutions including, but not limited to, Tris-HCI, Tris-buffered
saline, Tris-borate, Tris-acetic acid, triethylamine, phosphate buffer, and
glycine-HCl, wherein Tris-buffered saline solution is preferred.
It will be appreciated that peptides having increasing binding
affinities for body surface substrates may be eluted by repeating the
selection process using buffers with increasing stringencies.
The eluted peptides can be identified and sequenced by any means
known in the art.
Thus, the following method for generating the body surface-binding
peptides, for example, hair-binding peptides, skin-binding peptides, nailbinding
peptides, or oral cavity surface-binding peptides, of the present
invention was used. A library of combinatorial generated phage-peptides
is contacted with the body surface of interest, to form phage peptide-body
surface complexes. The phage-peptide-body-surface complex is
separated from uncomplexed peptides and unbound substrate, and the
bound phage-peptides from the phage-peptide-body surface complexes is
eluted from the complex, preferably by acid treatment. Then, the eluted
peptides are identified and sequenced. To identify peptide sequences that
bind to one substrate but not to another, for example peptides that bind to
hair, but not to skin or peptides that bind to skin, but not to hair, a
subtractive panning step is added. Specifically, the library of combinatorial
generated phage-peptides is first contacted with the non-target to remove
phage-peptides that bind to it. Then, the non-binding phage-peptides are
contacted with the desired substrate and the above process is followed.
Alternatively, the library of combinatorial generated phage-peptides may
be contacted with the non-target and the desired substrate simultaneously.
Then, the phage-peptide-body surface complexes are separated from the
phage-peptide-non-target complexes and the method described above is
followed for the desired phage-peptide-body surface complexes.
One embodiment of the present invention provides a modified
phage display screening method for isolating peptides with a higher affinity
for body surfaces. In the modified method, the phage-peptide-body
surface complexes are formed as described above. Then, these
complexes are treated with an elution buffer. Any of the elution buffers
described above may be used. Preferably, the elution buffer is an acidic
solution. Then, the remaining, elution-resistant phage-peptide-body
surface complexes are used to directly infect a bacterial host cell, such as
£. co// ER2738. The infected host cells are grown in an appropriate
growth medium, such as LB (Luria-Bertani) medium, and this culture is
spread onto agar, containing a suitable growth medium, such as LB
medium with IPTG (isopropyl p-D-thiogalactopyranoside) and S-Gal™.
After growth, the plaques are picked for DNA isolation and sequencing to
identify the peptide sequences with a high binding affinity for the body
surface of interest.
In another embodiment, PCR may be used to identify the elutionresistant
phage-peptides from the modified phage display screening
method, described above, by directly carrying out PCR on the phagepeptide-
body surface complexes using the appropriate primers, as
described by Janssen et al. in U.S. Patent Application Publication No.
2003/0152976, which is incorporated herein by reference.
Hair-binding, skin-binding, and nail-binding peptides have been
identified using the above methods. Specifically, binding peptides were
isolated that have a high affinity for normal brown hair, given as SEQ ID
N0s:3-18, 28-38, 40-56, and 64; shampoo resistant, normal brown hair,
given as SEQ ID NO:66, 69 and 70; bleached hair, given as SEQ ID
NOs:7, 8, 19-27, 38-40, 43, 44, 47, 57, 58, and 59, fingernail, given as
SEQ ID NOs:53 and 60; and skin, given as SEQ ID NO:61. Additionally,
the fingernail-binding peptides were found to bind to bleached hair and
may be used in the peptide-based hair conditioners and hair colorants of
the invention. The bleached hair-binding peptides will bind to fingernails
and may be used in the peptide-based nail colorants of the invention.
Production of Binding Peptides
The binding peptides of the present invention may be prepared
using standard peptide synthesis methods, which are well known in the art
(see for example Stewart et al., Solid Phase Peptide Synthesis, Pierce
Chemical Co., Rockford, IL, 1984; Bodanszky, Principles of Peptide
Synthesis, Springer-Verlag, New York, 1984; and Pennington etal.,
Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994).
Additionally, many companies offer custom peptide synthesis services.
Alternatively, the peptides of the present invention may be prepared
using recombinant DMA and molecular cloning techniques. Genes
encoding the hair-binding, skin-binding or nail-binding peptides may be
produced in heterologous host cells, particularly In the cells of microbial
hosts.
Preferred heterologous host cells for expression of the binding
peptides of the present invention are microbial hosts that can be found
broadly within the fungal or bacterial families and which grow over a wide
range of temperature, pH values, and solvent tolerances. Because
transcription, translation, and the protein biosynthetic apparatus are the
same irrespective of the cellular feedstock, functional genes are expressed
irrespective of carbon feedstock used to generate cellular biomass.
Examples of host strains include, but are not limited to, fungal or yeast
species such as Aspergillus, Trichoderma, Saccharomyces, Pichia,
Candida, Hansenula, or bacterial species such as Salmonella, Bacillus,
Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Pseudomonas,
Methylomonas, Methylobacter, Alcaligenes, Synechocystis, Anabaena,
Thiobacillus, Methanobacterium and Klebsiella.
A variety of expression systems can be used to produce the
peptides of the present invention. Such vectors include, but are not limited
to, chromosomal, episomal and virus-derived vectors, e.g., vectors derived
from bacterial plasmids, from bacteriophage, from transposons, from
insertion elements, from yeast episoms, from viruses such as
baculoviruses, retroviruses and vectors derived from combinations thereof
such as those derived from piasmid and bacteriophage genetic elements,
such as cosmids and phagemids. The expression system constructs may
contain regulatory regions that regulate as well as engender expression.
In general, any system or vector suitable to maintain, propagate or
express polynucleotide or polypeptide in a host cell may be used for
expression in this regard. Microbial expression systems and expression•»
vectors contain regulatory sequences that direct high level expression of
foreign proteins relative to the growth of the host cell. Regulatory
sequences are well known to those skilled in the art and examples include,
but are not limited to, those which cause the expression of a gene to be
turned on or off in response to a chemical or physical stimulus, including
the presence of regulatory elements in the vector, for example, enhancer
sequences. Any of these could be used to construct chimeric genes for
production of the any of the binding peptides of the present invention.
These chimeric genes could then be introduced into appropriate
microorganisms via transformation to provide high level expression of the
peptides.
Vectors or cassettes useful for the transformation of suitable host
cells are well known in the art. Typically the vector or cassette contains
sequences directing transcription and translation of the relevant gene, one
or more selectable markers, and sequences allowing autonomous
replication or chromosomal integration. Suitable vectors comprise a
region 5' of the gene, which harbors transcriptional initiation controls and a
region 3' of the DMA fragment which controls transcriptiona! termination. It
is most preferred when both control regions are derived from genes
homologous to the transformed host cell, although it is to be understood
that such control regions need not be derived from the genes native to the
specific species chosen as a production host. Selectable marker genes
provide a phenotypic trait for selection of the transformed host cells such
as tetracycline or ampicillin resistance in E, coll.
Initiation control regions or promoters which are useful to drive
expression of the chimeric gene in the desired host cell are numerous and
familiar to those skilled in the art. Virtually any promoter capable of driving
the gene is suitable for producing the binding peptides of the present
invention including, but not limited to: CYC1, HIS3, GAL1, GAL10, ADH1,
PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for .
expression in Saccharomyces); AOX1 (useful for expression in Pichia);
and lac, ara, tet, tip, IP\_, IPp^, 17, tac, and trc (useful for expression in
Escherichia coli) as well as the amy, apr, npr promoters and various phage
promoters useful for expression in Bacillus.
Termination control regions may also be derived from various
genes native to the preferred hosts. Optionally, a termination site may be
unnecessary, however, it is most preferred if included.
The vector containing the appropriate DNA sequence as described
supra, as well as an appropriate promoter or control sequence, may be
employed to transform an appropriate host to permit the host to express
the peptide of the present invention. Cell-free translation systems can also
be employed to produce such peptides using RNAs derived from the DNA
constructs of the present invention. Optionally it may be desired to
produce the instant gene product as a secretion product of the
transformed host. Secretion of desired proteins into the growth media has
the advantages of simplified and less costly purification procedures. It is
well known in the art that secretion signal sequences are often useful in
facilitating the active transport of expressible proteins across cell
membranes. The creation of a transformed host capable of secretion may
be accomplished by the incorporation of a DNA sequence that codes for a
secretion signal which is functional in the production host. Methods for
choosing appropriate signal sequences are well known in the art (see for
example EP 546049 and WO 9324631). The secretion signal DNA or
facilitator may be located between the expression-controlling DNA and the
instant gene or gene fragment, and in the same reading frame with the
latter.
Peptide-Based Hair Conditioners
The peptide-based'hair conditioners of the present invention are
formed by coupling a hair-binding peptide (HBP) with a hair conditioning
agent (HCA). The hair-binding peptide part of the conditioner binds
strongly to the hair, thus keeping the conditioning agent attached to the
hair for a long lasting conditioning effect. The hair-binding peptides
include, but are not limited to, hair-binding peptides selected by the
screening methods described above, including the hair-binding peptide
sequences of the invention, given by SEQ ID NOs: 3-59, 64, 66, 69, and
70, most preferably the peptides given by SEQ ID NO:46 and SEQ ID
NO:66, which bind strongly to hair, but not to skin. Additionally, any known
hair-binding peptide may be used, including but not limited to SEQ ID
NO:1, and SEQ ID NOs:76-98, described by Janssen et al. in U.S. Patent
Application Publication No. 2003/0152976 and by Janssen et al. in WO
04048399, respectively, both of which are incorporated herein by
reference. For bleached hair, the fingernail-binding peptide, given as SEQ
ID NO:60, may also be used.
Hair conditioning agents as herein defined are agents which
improve the appearance, texture, and sheen of hair as well as increasing
hair body or suppleness. Hair conditioning agents, include, but are not
limited to, styling aids, hair straightening aids, hair strengthening aids, and
volumizing agents, such as nanoparticles. In the peptide-based hair
conditioners of the present invention, any known hair conditioning agent
may be used. Hair conditioning agents are well known in the art, see for
example Green et al. (WO 0107009), incorporated herein,by reference,
and are available commercially from various sources. Suitable examples
of hair conditioning agents include, but are not limited to, cationic
polymers, such as cationized guar gum, diallyl quaternary ammonium
salt/acrylamide copolymers, quaternized polyvinylpyrrolidone and
derivatives thereof, and various polyquaternium-compounds; cationic
surfactants, such as stearalkonium chloride, centrimonium chloride, and
Sapamin hydrochloride; fatty alcohols, such as behenyl alcohol; fatty
amines, such as stearyl amine; waxes; esters; nonionic polymers, such as
polyvinylpyrrolidone, polyvinyl alcohol, and polyethylene glycol; silicones;
siloxanes, such as decamethylcyclopentasiloxane; polymer emulsions,
such as amodimethicone; and nanoparticles, such as silica nanoparticles
and polymer nanoparticles. The preferred hair conditioning agents of the
present invention contain amine or hydroxyl functional groups to facilitate
coupling to the hair-binding peptides, as described below. Examples of
preferred conditioning agents are octylamine (CAS No. 111-86-4), stearyl
amine (CAS No. 124-30-1), behenyl alcohol (CAS No. 661-19-8, Cognis
Corp., Cincinnati, OH), vinyl group terminated siloxanes, vinyl group
terminated silicone (CAS No. 68083-19-2), vinyl group terminated methyl
vinyl siloxanes, vinyl group terminated methyl vinyl silicone (CAS No.
68951-99-5), hydroxyl terminated siloxanes, hydroxyl terminated silicone
(CAS No. 80801-30-5), amino-modified silicone derivatives,
[(aminoethyl)amino]propyl hydroxyl dimethyl siloxanes,
[(aminoethyl)amino]propyl hydroxyl dimethyl silicones, and alpha-tridecylomega-
hydroxy-poly(oxy-1,2-ethanediyl) (CAS No. 24938-91-8).
The peptide-based hair conditioners of the present invention are
prepared by coupling a specific hair-binding peptide to a hair conditioning
agent, either directly or via an optional spacer. The coupling interaction
may be a covalent bond or a non-covalent interaction, such as hydrogen
bonding, electrostatic interaction, hydrophobic interaction, or Van der
Waals interaction. In the case of a non-covalent interaction, the peptidebased
hair conditioner may be prepared by mixing the peptide with the
conditioning agent and the optional spacer (if used) and allowing sufficient
time for the interaction to occur. The unbound materials may be separated
from the resulting peptide-based hair conditioner adduct using methods
known in the art, for example, gel permeation chromatography.
The peptide-based hair conditioners of the invention may also be
prepared by covalently attaching a specific hair-binding peptide to a hair
conditioning agent, either directly or through a spacer. Any known peptide
or protein conjugation chemistry may be used to form the peptide-based
hair conditioners of the present invention. Conjugation chemistries are
well-known in the art (see for example, Hermanson, Bioconjugate
Techniques, Academic Press, New York (1996)). Suitable coupling agents
include, but are not limited to, carbodiimide coupling agents, diacid
chlorides, diisocyanates and other difunctional coupling reagents that are
reactive toward terminal amine and/or carboxylic acid terminal groups on
the peptides and to amine, carboxylic acid, or alcohol groups on the hair
conditioning agent. The preferred coupling agents are carbodiimide
coupling agents, such as 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide
(EDC) and N,N'-dicyclohexyl-carbodiimide (DCC), which may be used to
activate carboxylic acid groups for coupling to alcohol, and amine groups.
Additionally, it may be necessary to protect reactive amine or carboxylic
>
acid groups on the peptide to produce the desired structure for the
peptide-based hair conditioner. The use of protecting groups for amino
acids, such as t-butyloxycarbonyl (t-Boc), are well known in the art (see for
example Stewart et al., supra; Bodanszky, supra; and Pennington et al.f
supra). In some cases it may be necessary to introduce reactive groups,
such as carboxylic acid, alcohol, amine, or aldehyde groups, on the hair
conditioning ayent for coupling to the hair-binding peptide. These
modifications may be done using routine chemistry such as oxidation,
reduction and the like, which is well known in the art.
It may also be desirable to couple the hair-binding peptide to the
hair conditioning agent via a spacer. The spacer serves to separate the
conditioning agent from the peptide to ensure that the agent does not
interfere with the binding of the peptide to the hair. The spacer may be
any of a variety of molecules, such as alkyl chains, phenyl compounds,
ethylene glycol, amides, esters and the like. Preferred spacers are
hydrophilic and have a chain length from 1 to about 100 atoms, more
preferably, from 2 to about 30 atoms. Examples of preferred spacers
include, but are not limited to ethanol amine, ethylene glycol, polyethylene
with a chain length of 6 carbon atoms, polyethylene glycol with 3 to 6
repeating units, phenoxyethanol, propanolamide, butylene glycol,
butyleneglycolamide, propyl phenyl chains, and ethyl, propyl, hexyl, steryl,
cetyl, and palmitoyl alkyl chains. The spacer may be covalently attached to
the peptide and the hair conditioning agent using any of the coupling
chemistries described above. In order to facilitate incorporation of the
spacer, a bifunctional cross-linking agent that contains a spacer and
reactive groups at both ends for coupling to the peptide and the
conditioning agent may be used. Suitable bifunctional cross-linking agents
are well known in the art and include, but are not limited to diamines, such
a as 1,6-diaminohexane; dialdehydes, such as glutaraldehyde; bis Nhydroxysuccinimide
esters, such as ethylene glycol-bis(succinic acid Nhydroxysuccinimide
ester), disuccinimidyl glutarate, disuccinimidyl
suberate, and ethylene glycol-bis(succinimidylsuccinate); diisoqyantes,
such as hexamethylenediisocyanate; bis oxiranes, such as 1,4 butanediyl
diglycidyl ether; dicarboxylic acids, such as succinyldisalicylate; and the
like. Heterobifunctional cross-linking agents, which contain a different
reactive group at each end, may also be used. Examples of
heterobifunctional cross-linking agents include, but are not limited to
compounds having the following structure:
where : RI is H or a substituent group such as -SOsNa, -NO2, or -Br; and
R2 is a spacer such as -CH2CH2 (ethyl), -(CH2)s (propyl), or -(Ch^bCeHs
(propyl phenyl). An example of such a heterobifunctional cross-linking
agent is 3-maleimidopropionic acid N-hydroxysuccinimide ester. The Nhydroxysuccinimide
ester group of these reagents reacts with amine or
alcohol groups on the conditioner, while the maleimide group reacts with
thiol groups present on the peptide. A thiol group may be incorporated
into the peptide by adding a cysteine group to at least one end of the
binding peptide sequence (i.e., the C-terminus or N-terminus). Several
spacer amino acid residues, such as glycine, may be incorporated
between the binding peptide sequence and the terminal cysteine to
separate the reacting thiol group from the binding sequence.
Additionally, the spacer may be a peptide composed of any amino
acid and mixtures thereof. The preferred peptide spacers are composed
of the amino acids glycine, alanine, and serine, and mixtures thereof. In
addition, the peptide spacer may contain a specific enzyme cleavage site,
such as the protease Caspase 3 site, given by SEQ ID NO:65, which
allows for the enzymatic removal of the conditioning agent from the hair.
The peptide spacer may be from 1 to about 50 amino acids, preferably
from 1 to about 20 amino acids. These peptide spacers may be linked to
the binding peptide sequence by any method known in the art. For
example, the entire binding peptide-peptide spacer diblock may be
prepared using the standard peptide synthesis methods described supra.
In addition, the binding peptide and peptide spacer blocks may be
combined using carbodiimide coupling agents (see for example,
Hermanson, Bioconjugate Techniques, Academic Press, New York
(1996)), diacid chlorides, diisocyanates and other difunctional coupling
reagents that are reactive to terminal amine and/or carboxylic acid terminal
groups on the peptides. Alternatively, the entire binding peptide-peptide
spacer diblock may be prepared using the recombinant DMA and
molecular cloning techniques described supra. The spacer may also be a
combination of a peptide spacer and an organic spacer molecule, which
may be prepared using the methods described above.
It may also be desirable to have multiple hair-binding peptides
coupled to the hair conditioning agent to enhance the interaction between
the peptide-based hair conditioner and the hair. Either multiple copies of
the same hair-binding peptide or a combination of different hair-binding
peptides may be used. In the case of large conditioning particles (e.g.,
particle emulsions), a large number of hair-binding peptides, i.e., up to
about 1,000, may be coupled to the conditioning agent. A smaller number
of hair-binding peptides can be coupled to the smaller conditioner
molecules, i.e., up to about 50. Therefore, in one embodiment of the
present invention, the peptide-based hair conditioners are diblock
compositions consisting of a hair-binding peptide (HBP) and a hair
conditioning agent (HCA), having the general structure (HBP)n - HCA,
where n ranges from 1 to about 1,000, preferably from 1 to about 50. In
another embodiment, the peptide-based hair conditioners contain a spacer
(S) separating the hair-binding peptide from the hair conditioning agent, as
described above. Multiple copies of the hair-binding peptide may be
coupled to a single spacer molecule. In this embodiment, the peptidebased
hair conditioners are triblock compositions consisting of a hairbinding
peptide, a spacer, and a hair conditioning agent, having the
general structure [(HBP)m - S]n - HCA, where n ranges from 1 to about
1,000, preferably n is 1 to about 50, and m ranges from 1 to about 50,
preferably m is 1 to about 10.
It should be understood that as used herein, HBP is a generic
designation and is not meant to refer to a single hair binding peptide
sequence. Where n or m as used above, is greater than 1, it is well within
the scope of the invention to provide for the situation where a series of hair
binding peptides of different sequences may form a part of the
composition. Additionally, it should be understood that these structures do
not necessarily represent a covalent bond between the peptide, the hair
conditioning agent, and the optional spacer. As described above, the
coupling interaction between the peptide, the hair conditioning agent, and
the optional spacer may be either covalent or non-covalent.
The peptide-based hair conditioners of the present invention may
be used in compositions for hair care. It should also be recognized that
the hair-binding peptides themselves can serve as conditioning agents for
the treatment of hair. Hair care compositions are herein defined as
compositions for the treatment of hair, including but not limited to
shampoos, conditioners, lotions, aerosols, gels, mousses, and hair dyes
comprising an effective amount of a peptide-based hair conditioner or a
mixture of different peptide-based hair conditioners in a cosmetically
acceptable medium. An effective amount of a peptide-based hair
conditioner or hair-binding peptide for use in a hair care composition is
herein defined as a proportion of from about 0.01% to about 10%,
preferably about 0.01% to about 5% by weight relative to the total weight
of the composition. Components of a cosmetically acceptable medium for
hair care compositions are described by Philippe et al. in U.S. Patent No.
6,280,747, and by Omura et al. in U.S. Patent No. 6,139,851 and Cannell
et al. in U.S. Patent No. 6,013,250, all of which are incorporated herein by
reference. For example, these hair care compositions can be aqueous,
alcoholic or aqueous-alcoholic solutions, the alcohol preferably being
ethanol or isopropanol, in a proportion of from about 1 to about 75% by
weight relative to the total weight, for the aqueous-alcoholic solutions.
Additionally, the hair care compositions may contain one or more
conventional cosmetic or dermatological additives or adjuvants including
but not limited to, antioxidants, preserving agents, fillers, surfactants, UVA
and/or UVB sunscreens, fragrances, thickeners, wetting agents and
anionic, nonionic or amphoteric polymers, and dyes or pigments.
Peptide-Based Skin Conditioners
The peptide-based skin conditioners of the present invention are
formed by coupling a skin-binding peptide (SBP) with a skin conditioning
agent (SCA). The skin-binding peptide part of the conditioner binds
strongly to the skin, thus keeping the conditioning agent attached to the
skin for a long lasting conditioning effect. The skin-binding peptides
include, but are not limited to, skin-binding peptides selected by the
screening methods described above, including the skin-binding peptide
sequence of the invention, given as SEQ ID NO:61. Additionally, any
known skin-binding peptide may be used, including but not limited to SEQ
ID NO:2, and SEQ ID NOs:99-104, described by Janssen et al. in U.S.
Patent Application Publication No. 2003/0152976 and by Janssen et al. in
WO 04048399, respectively.
Skin conditioning agents as herein defined include, but are not
limited to astringents, which tighten skin; exfoliants, which remove dead
skin cells; emollients, which help maintain a smooth, soft, pliable
appearance; humectants, which increase the water content of the top layer
of skin; occlusives, which retard evaporation of water from the skin's
surface; and miscellaneous compounds that enhance the appearance of
dry or damaged skin or reduce flaking and restore suppleness . In the
peptide-based skin conditioners of the present invention, any known skin
conditioning agent may be used. Skin conditioning agents are well known
in the art, see for example Green et al. (WO 0107009), and are available
commercially from various sources. Suitable examples of skin
conditioning agents include, but are not limited to, alpha-hydroxy acids,
beta-hydroxy acids, polyols, hyaluronic acid, D,L-panthenol,
polysalicylates, vitamin A palmitate, vitamin E acetate, glycerin, sorbitol,
silicones, silicone derivatives, lanolin, natural oils and triglyceride esters.
The preferred skin conditioning agents of the present invention are
polysalicylates, propylene glycol (CAS No. 57-55-6, Dow Chemical,
Midland, Ml), glycerin (CAS No. 56-81-5, Proctor & Gamble Co.,
Cincinnati, OH), glycolic acid (CAS No. 79-14-1, DuPont Co., Wilmington,
DE), lactic acid (CAS No. 50-21-5, Alfa Aesar, Ward Hill, MA), malic acid
(CAS No. 617-48-1, Alfa Aesar), citric acid (CAS No. 77-92-9, Alfa Aesar),
tartaric acid (CAS NO. 133-37-9, Alfa Aesar), glucaric acid (CAS No. 87-
73-0), galactaric acid (CAS No. 526-99-8), 3-hydroxyvaleric acid (CAS No.
10237-77-1), salicylic acid (CAS No. 69-72-7, Alfa Aesar), and 1,3
propanediol (CAS No. 504-63-2, DuPont Co., Wilmington, DE).
Polysalicylates may be prepared by the method described by White et al.
in U.S. Patent No. 4,855,483, incorporated herein by reference. Glucaric
acid may be synthesized using the method described by Merbouh et al.
(Carbohydr. Res. 336:75-78 (2001). The 3-hydroxyvaleric acid may be
prepared as described by Bramucci in WO 02012530.
The peptide-based skin conditioners of the present invention are
prepared by coupling a specific skin-binding peptide to the skin
conditioning agent, either directly or via a spacer. Any of the coupling
methods described above may be used. It may be necessary to introduce
reactive groups, such as carboxylic acid, alcohol, amine, or aldehyde
groups, on the skin conditioning agent for coupling to the hair-binding
peptide, as described above. It may also be desirable to have multiple
skin-binding peptides coupled to the skin conditioning agent to enhance
the interaction between the peptide-based skin conditioner and the skin.
Either multiple copies of the same skin-binding peptide or a combination of
different skin-binding peptides may be used. In the case of large
conditioning particles, a large number of skin-binding peptides, i.e., up to
about 1,000, may be coupled to the conditioning agent. A smaller number
of skin-binding peptides can be attached to the smaller conditioner
molecules, i.e., up to about 50. Therefore, in one embodiment of the
present invention, the peptide-based skin conditioners are djblock
compositions consisting of a skin-binding peptide (SBP) and a skin
conditioning agent (SCA), having the general structure (SBP)n - SCA,
where n ranges from 1 to about 1,000, preferably from 1 to about 50. ,
In another embodiment, the peptide-based skin conditioners contain
a spacer (S) separating the skin-binding peptide from the skin conditioning
agent, as described above. Multiple copies of the skin-binding peptide
may be coupled to a single spacer molecule. In this embodiment, the
peptide-based skin conditioners are triblock compositions consisting of a
skin binding peptide, a spacer, and a skin conditioning agent, having the
general structure [(SBP)m - S]n - SCA, where n ranges from 1 to about
1,000, preferably n is 1 to about 50, and m ranges from 1 to about 50,
preferably m is 1 to about 10.
It should be understood that as used herein, SBP is a generic
designation and is not meant to refer to a single skin binding peptide
sequence. Where n or m as used above, is greater than 1, it is well within
the scope of the invention to provide for the situation where a series of
skin binding peptides of different sequences may form a part of the
composition. Additionally, it should be understood that these structures do
not necessarily represent a covalent bond between the peptide, the skin
conditioning agent, and the optional spacer. As described above, the
coupling interaction between the peptide, the skin conditioning agent, and
the optional spacer may be either covalent or non-covalent.
The peptide-based skin conditioners of the present invention may
be used in compositions for skin care. It should also be recognized that
the skin-binding peptides themselves can serve as conditioning agents for
skin. Skin care compositions are herein defined as compositions
comprising an effective amount of a peptide-based skin conditioner or a
mixture of different peptide-based skin conditioners in a cosmetically
acceptable medium. The uses of these compositions include, but are not
limited to, skin care, skin cleansing, make-up, and anti-wrinkle products.
An effective amount of a peptide-based skin conditioner or skin-binding
peptide for skin care compositions is herein defined as a proportion of from
about 0.001% to about 10%, preferably about 0.01% to about 5% by
weight relative to the total weight of the composition. This proportion may
vary as a function of the type of skin care composition. Suitable
compositions for a cosmetically acceptable medium are described by
Philippe et al. supra. For example, the cosmetically acceptable medium
may be an anhydrous composition containing a fatty substance in a
proportion generally of from about 10 to about 90% by weight relative to
the total weight of the composition, where the fatty phase containing at
least one liquid, solid or semi-solid fatty substance. The fatty substance
includes, but is not limited to, oils, waxes, gums, and so-called pasty fatty
substances. Alternatively, the compositions may be in the form of a stable
dispersion such as a water-in-oil or oil-in-water emulsion. Additionally, the
compositions may contain one or more conventional cosmetic or
dermatological additives or adjuvants, including but not limited to,
antioxidants, preserving agents, fillers, surfactants, UVA and/or UVB
sunscreens, fragrances, thickeners, wetting agents and anionic, nonionic
or amphoteric polymers, and dyes or pigments.
Peptide-Based Hair Colorants
The peptide-based hair colorants of the present invention are
formed by coupling a hair-binding peptide (HBP) with a coloring agent (C).
The hair-binding peptide part of the peptide-based hair colorant binds
strongly to the hair, thus keeping the coloring agent attached to the hair for
a long lasting hair coloring effect. The hair-binding peptides include, but
are not limited to, hair-binding peptides selected by the screening methods
described above, including the hair-binding peptide sequences of the
invention, given by SEQ ID NOs: 3-59, 64, 66, 69 and 70, most preferably
the peptides given by SEQ ID NO:46 and SEQ ID NO:66, which bind
strongly to hair, but not to skin. Additionally, any known hair-binding
peptide may be used, including but not limited to SEQ ID NO:1, and SEQ
ID NOs:76-98, described by Janssen et al. in U.S. Patent Application
Publication No. 2003/0152976 and by Janssen et al. in WO 04048399,
respectively. For bleached hair, the fingernail-binding peptide, given as
SEQ ID NO:60, may also be used.
Coloring agents as herein defined are any dye, pigment, and the
like that may be used to change the color of hair, skin, or nails. In the
peptide-based hair colorants of the present invention, any known coloring
agent may be used. Hair coloring agents are well known in the art (see for
example Green et al. supra, CFTA International Color Handbook, 2nd ed.,
Micelle Press, England (1992) and Cosmetic Handbook, US Food and
Drug Administration, FDA/IAS Booklet (1992)), and are available
commercially from various sources (for example Bayer, Pittsburgh, PA;
Ciba-Geigy, Tarrytown, NY; ICI, Bridgewater, NJ; Sandoz, Vienna, Austria;
BASF, Mount Olive, NJ; and Hoechst, Frankfurt, Germany). Suitable hair
coloring agents include, but are not limited to dyes, such as 4-
hydroxypropylamino-3-nitrophenol, 4-amino-3-nitrophenol, 2-amino-6-
chloro-4-nitrophenol, 2-nitro-paraphenylenediamine, N,N-hydroxyethyl-2-
nitro-phenylenediamine, 4-nitro-indole, Henna, HC Blue 1, HC Blue 2, HC
Yellow 4, HC Red 3, HC Red 5, Disperse Violet 4, Disperse Black 9, HC
Blue 7, HC Blue 12, HC Yellow 2, HC Yellow 6, HC Yellow 8, HC Yellow
12, HC Brown 2, D&C Yellow 1, D&C Yellow 3, D&C Blue 1, Disperse Blue
3, Disperse violet 1, eosin derivatives such as D&C Red No. 21 and
halogenated fluorescein derivatives such as D&C Red No. 27, D&C Red
Orange No. 5 in combination with D&C Red No. 21 and D&C Orange No.
10; and pigments, such as D&C Red No. 36 and D&C Orange No. 17, the
calcium lakes of D&C Red Nos. 7,11, 31 and 34, the barium lake of D&C
Red No. 12, the strontium lake of D&C Red No. 13, the aluminum lakes of
FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27, of D&C
Red No. 21, and of FD&C Blue No. 1, iron oxides, manganese violet,
chromium oxide, titanium dioxide, titanium dioxide nanoparticles, zinc
oxide, barium oxide, ultramarine blue, bismuth citrate, and carbon black
particles. The preferred hair coloring agents of the present invention are
D&C Yellow 1 and 3, HC Yellow 6 and 8, D&C Blue 1, HC Blue 1, HC
Brown 2, HC Red 5, 2-nitro-paraphenylenediamine, N,N-hydroxyethyl-2-
nitro-phenylenediamine, 4-nitro-indo!e, and carbon black.
Metallic and semiconductor nanoparticles may also be used as hair
coloring agents due to their strong emission of light (Vic et al. U.S. Patent
Application Publication No. 2004/0010864). The metallic nanoparticles
include, but are not limited to, particles of gold, silver, platinum, palladium,
iridium, rhodium, osmium, iron, copper, cobalt, and alloys composed of
these metals. An "alloy" is herein defined as a homogeneous mixture of
two or more metals. The "semiconductor nanoparticles" include, but are
not limited to, particles of cadmium selenide, cadmium sulfide, silver
sulfide, cadmium sulfide, zinc oxide, zinc sulfide, zinc selenide, lead
sulfide, gallium arsenide, silicon, tin oxide, iron oxide, and indium
phosphide. The nanoparticles are stabilized and made water-soluble by
the use of a suitable organic coating or monolayer. As used herein,
monolayer-protected nanoparticles are one type of stabilized nanoparticle.
Methods for the preparation of stabilized, water-soluble metal and
semiconductor nanoparticles are known in the art, and are described by
Huang et al. in copending U.S. Patent Application No. 10/622889, which is
incorporated herein by reference. The color of the nanoparticles depends
on the size of the particles. Therefore, by controlling the size of the
nanoparticles, different colors may be obtained. For example, ZnS-coated
CdSe nanoparticles cover the entire visible spectrum over a particle size
range of 2 to 6 nm. Specifically, CdSe nanoparticles with a core size of
2.3, 4.2, 4.8 and 5.5 nm emit light at the wavelength centered around 485,
565, 590, and 625 nm, respectively. Water-soluble nanoparticles of
different sizes may be obtained from a broad size distribution of
nanoparticles using the size fractionation method described by Huang,
supra. That method comprises the regulated addition of a water-miscible
organic solvent to a solution of nanoparticles in the presence of an
electrolyte. Increasing additions of the water-miscible organic solvent
result in the precipitation of nanoparticles of decreasing size. The metallic
and semiconductor nanoparticles may also serve as volumizing agents, as
-scribed above.
Of particular utility are titanium dioxide nanoparticles that not only
serve as a colorant but additionally may serve to block harmful UV
radiation. Suitable titanium dioxide nanoparticles are described in U.S.
Patent Nos. 5,451,390; 5,672,330; and 5,762,914. Titanium dioxide P25
is an example of a suitable commercial product available from Degussa.
Other commercial suppliers of titanium dioxide nanoparticles include
Kemira, Sachtleben and Tayca. •»
The titanium dioxide nanoparticles typically have an average
particle size diameter of less than 100 nanometers (nm) as determined by
dynamic light scattering which measures the particle size distribution of
particles in liquid suspension. The particles are typically agglomerates
which may range from about 3 nm to about 6000 nm. Any process known
in the art can be used to prepare such particles. The process may involve
vapor phase oxidation of titanium halides or solution precipitation from
soluble titanium complexes, provided that titanium dioxide nanoparticles
are produced.
A preferred process to prepare titanium dioxide nanoparticles is by
injecting oxygen and titanium halide, preferably titanium tetrachloride, into
a high-temperature reaction zone, typically ranging from 400 to 2000
degrees centrigrade. Under the high temperature conditions present in
the reaction zone, nanoparticles of titanium dioxide are formed having high
surface area and a narrow size distribution. The energy source in the
reactor may be any heating source such as a plasma torch.
Additionally, the coloring agent may be a colored, polymeric
microsphere. Exemplary polymeric microspheres include, but are not
limited to, microspheres of polystyrene, polymethylmethacrylate,
polyvinyltoluene, styrene/butadiene copolymer, and latex. For use in the
invention, the microspheres have a diameter of about 10 nanometers to
about 2 microns. The microspheres may be colored by coupling any
suitable dye, such as those described above, to the microspheres. The
dyes may be coupled to the surface of the microsphere or adsorbed within
the porous structure of a porous microsphere. Suitable microspheres,
including undyed and dyed microspheres that are functionalized to enable
covalent attachment, are available from companies such as Bang
Laboratories (Fishers, IN).
The peptide-based hair colorants of the present invention are
prepared by coupling a specific hair-binding peptide to a coloring agent,
either directly or via a spacer. Any of the coupling methods described
above may be used. It may be necessary to introduce reactive groups,
such as carboxylic acid, alcohol, amine, or aldehyde groups, on the
coloring agent for coupling to the hair-binding peptide. These
modifications may be done using routine chemistry, which is well known in
the art. For example, the surface of carbon black particles may be
oxidized using nitric acid, a peroxide such as hydrogen peroxide, or an
inorganic initiator such as ammonium persulfate, to generate functional
groups. Preferably, the carbon black surface is oxidized using ammonium
persulfate as described by Carrasco-Marin et al. (J. Chem. Soc., Faraday
Trans. 93:2211-2215 (1997)). Amino functional groups may be introduced
to the surface of carbon black using an organic initiator such as 2,2'-
Azobis(2-methylpropionamide)-dihydrochloride. The inorganic pigments
and the nanoparticles may be derivatized to introduce carboxylic acid or
amino functional groups in a similar manner.
Additionally, the hair-binding peptide may be coupled to a pigment
using a pigment-binding peptide. Suitable pigment-binding peptide
sequences are known in the art. For example, Nomoto et al. in
EP1275728 describe peptides that bind to carbon black, copper
phthalocyanine, titanium dioxide, and silicon dioxide. O'Brien et al. in
copending and commonly owned U.S. Patent Application No. 10/935254
describe peptides that bind to carbon black, Cromophtal® Yellow,
Sunfast® Magenta, and Sunfast® Blue. Additional pigment-binding
peptides may be identified using the any of the screening methods
described above. The pigment-binding peptide may be coupled to the
hair-binding peptide either directly or through a spacer using any of the
coupling methods described above. The hair-binding peptide-pigment
binding peptide diblock or triblock (if a spacer is used) is contacted with
the pigment to attach it to the pigment-binding peptide.
It may also be desirable to have multiple hair-binding peptides
coupled to the coloring agent to enhance the interaction between the
peptide-based hair colorant and the hair. Either multiple copies of the
same hair-binding peptide or a combination of different hair-binding
peptides may be used. In the case of large pigment particles, a large
number of hair-binding peptides, i.e., up to about 10,000, may be coupled
to the pigment. A smaller number of hair-binding peptides can be coupled
to the smaller dye molecules, i.e., up to about 50. Therefore, in one
embodiment of the present invention, the peptide-based hair colorants are
diblock compositions consisting of a hair-binding peptide (HBP) and a
coloring agent (C), having the general structure (HBP)n - C, where n
ranges from 1 to about 10,000, preferably n is 1 to about 500.
In another embodiment, the peptide-based hair colorants contain a
spacer (S) separating the binding peptide from the hair coloring agent, as
described above. Multiple copies of the hair-binding peptide may be
coupled to a single spacer molecule. In this embodiment, the peptidebased
hair colorants are triblock compositions consisting of a hair-binding
peptide, a spacer, and a coloring agent, having the general structure
[(HBP)m - S]n - C, where n ranges from 1 to about 10,000 , preferably n is
1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to
about 10.
It should be understood that as used herein, HBP is a generic
designation and is not meant to refer to a single hair binding peptide
sequence. Where n or m as used above, is greater than 1, it is well within
the scope of the invention to provide for the situation where a series of hair
binding peptides of different sequences may form a part of the
composition. Additionally, it should be understood that these structures do
not necessarily represent a covalent bond between the peptide, the
coloring agent, and the optional spacer. As described above, the coupling
interaction between the peptide, the coloring agent, and the optional
spacer may be either covalent or non-covalent.
The peptide-based hair colorants of the present invention may be
used in hair coloring compositions for dyeing hair. Hair coloring
compositions are herein defined as compositions for the coloring, dyeing,
or bleaching of hair, comprising an effective amount of peptide-based hair
colorant or a mixture of different peptide-based hair colorants in a
cosmetically acceptable medium. An effective amount of a peptide-based
hair colorant for use in a hair coloring composition is herein defined as a
proportion of from about 0.001 % to about 20% by weight relative to the
total weight of the composition. Components of a cosmetically acceptable
medium for hair coloring compositions are described by Dias et a!., in U.S.
Patent No. 6,398,821 and by Deutz et al., in U.S. Patent No. 6,129,770,
both of which are incorporated herein by reference. For example, hair
coloring compositions may contain sequestrants, stabilizers, thickeners,
buffers, carriers, surfactants, solvents, antioxidants, polymers, and
conditioners. The conditioners may include the peptide-based hair
conditioners and hair-binding peptides of the present invention in a
proportion from about 0.01% to about 10%, preferably about 0.01% to
about 5% by weight relative to the total weight of the hair coloring
composition.
The peptide-based hair colorants of the present invention may also
be used as coloring agents in cosmetic compositions that are applied to
the eyelashes or eyebrows including, but not limited to mascaras, and
eyebrow pencils. These may be anhydrous make-up products comprising
a cosmetically acceptable medium which contains a fatty substance in a
proportion generally of from about 10 to about 90% by weight relative to
the total weight of the composition, where the fatty phase containing at
least one liquid, solid or semi-solid fatty substance, as described above.
The fatty substance includes, but is not limited to, oils, waxes, gums, and
so-called pasty fatty substances. Alternatively, these compositions may
be in the form of a stable dispersion such as a water-in-oil or oil-in-water
emulsion, as described above. In these compositions, the proportion of
the peptide-based hair colorant is generally from about 0.001% to about
20% by weight relative to the total weight of the composition.
Peptide-Based Nail Colorants
The peptide-based nail colorants of the present invention are
formed by coupling a nail-binding peptide (NBP) with a coloring agent (C).
The nail-binding peptide part of the peptide-based nail colorant binds
strongly to the fingernails or toenails, thus keeping the coloring agent
attached to the nails for a long lasting coloring effect. The nail-binding
peptides include, but are not limited to nail-binding peptides selected by
the screening methods described above, including the nail-binding peptide
sequences of the invention, given by SEQ ID NOs:53 and 60, most
preferably the peptide given by SEQ ID NO:60. Additionally, the beached
hair-binding peptides, given as SEQ ID NOs:7, 8,19-27 38, 39, 40, 43-45,
47, 57,58. and 59 may be used.
The peptide-based nail colorants of the present invention are
prepared by coupling a specific nail-binding peptide to a coloring agent,
either directly or via a spacer, using any of the coupling methods
described above. In the peptide-based nail colorants of the present
invention, any of the coloring agents described above may be used. The
preferred coloring agents for use in the peptide-based nail colorants of the
present invention include D&C Red Nos. 8,10, 30 and 36, the barium
lakes of D&C Red Nos. 6, 9 and 12, the calcium lakes of D&C Red Nos. 7,
11,31 and 34, the strontium lake of D&C Red No. 30 and D&C Orange
No. 17 and D&C Blue No. 6.
It may also be desirable to have multiple nail-binding peptides
coupled to the coloring agent to enhance the interaction between the
peptide-based nail colorant and the nails. Either multiple copies of the
same nail-binding peptide or a combination of different nail-binding
peptides may be used. In the case of large pigment particles, a large
number of nail-binding peptides, i.e., up to about 10,000, may be coupled
to the pigment. A smaller number of nail-binding peptides can be coupled
to the smaller dye molecules, i.e., up to about 50. Therefore, in one
embodiment of the present invention, the peptide-based nail colorants are
diblock compositions consisting of a nail-binding peptide (NBP) and a
coloring agent (C), having the general structure (NBP)n - C, where n
ranges from 1 to about 10,000, preferably n is 1 to about 500.
In another embodiment, the peptide-based nail colorants contain a
spacer (S) separating the binding peptide from the coloring agent, as
described above. Multiple copies of the nail-binding peptide may be
coupled to a single spacer molecule. In this embodiment, the peptidebased
nail colorants are triblock compositions consisting of a nail-binding
peptide, a spacer, and a coloring agent, having the genera! structure
[(NBP)m - S]n - C, where n ranges from 1 to about 10,000, preferably n is
1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to
about 10.
It should be understood that as used herein, NBP is a generic
designation and is not meant to refer to a single nail binding peptide
sequence. Where n or m as used above, is greater than 1, it is well within
the scope of the invention to provide for the situation where a series of nail
binding peptides of different sequences may form a part of the
composition. Additionally, it should be understood that these structures do
not necessarily represent a covalent bond between the peptide, the
coloring agent, and the optional spacer. As described above, the coupling
interaction between the peptide, the coloring agent, and the optional
spacer may be either covalent or non-covalent.
The peptide-based nail colorants of the present invention may be
used in nail polish compositions for coloring fingernails and toenails.
Nail polish compositions are herein defined as compositions for the
treatment and coloring of nails, comprising an effective amount of a
peptide-based nail colorant or a mixture of different peptide-based nail
colorants in a cosmetically acceptable medium. An effective amount of a
peptide-based nail colorant for use in a nail polish composition is herein
defined as a proportion of from about 0.001% to about 20% by weight
relative to the total weight of the composition. Components of a
cosmetically acceptable medium for nail polishes are described by
Philippe et al. supra. The nail polish composition typically contains a
solvent and a film forming substance, such as cellulose derivatives,
polyvinyl derivatives, acrylic polymers or copolymers, vinyl copolymers and
polyester polymers. Additionally, the nail polish may contain a plasticizer,
such as tricresyl phosphate, benzyl benzoate, tributyl phosphate, butyl
acetyl ricinoleate, triethyl citrate, tributyl acetyl citrate, dibutyl phthalate or
camphor.
Peptide-Based Skin Colorants
The peptide-based skin colorants of the present invention are
formed by coupling a skin-binding peptide (SBP) with a coloring agent (C).
The skin-binding peptide part of the peptide-based skin colorant binds
strongly to the skin, thus keeping the coloring agent attached to the skin
for a long lasting skin coloring effect. The skin-binding peptides include,
but are not limited to, skin-binding peptides selected by the screening
methods described above, including the skin-binding peptide sequence of
the invention, given as SEQ ID NOs:61. Additionally, any known skinbinding
peptide may be used, including but not limited to SEQ ID NO:2,
and SEQ ID NOs:99-104, described by Janssen et al. in U.S. Patent
Application Publication No. 2003/0152976 and by Janssen et al. in WO
04048399, respectively.
The peptide-based skin colorants of the present invention are
prepared by coupling a specific skin-binding peptide to a coloring agent,
either directly or via a spacer, using any of the coupling methods
described above. Any of the colorants described above may be used.
The preferred coloring agents for use in the peptide-based skin colorants
of the present invention include the following dyes: eosin derivatives such
as D&C Red No. 21 and halogenated fluorescein derivatives such as D&C
Red No. 27, D&C Red Orange No. 5 in combination with D&C Red No. 21
and D&C Orange No. 10, and the pigments: titanium dioxide, titanium
dioxide nanoparticles, zinc oxide, D&C Red No. 36 and D&C Orange No.
17, the calcium lakes of D&C Red Nos. 7,11, 31 and 34, the barium lake
of D&C Red No. 12, the strontium lake D&C Red No. 13, .the aluminum
lakes of FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27,
of D&C Red No. 21, of FD&C Blue No. 1, iron oxides, manganese violet,
chromium oxide, ultramarine blue, and carbon black. The coloring agent
may also be a sunless tanning agent, such as dihydroxyacetone, that
produces a tanned appearance on the skin without exposure to the sun.
It may also be desirable to have multiple skin-binding peptides
coupled to the coloring agent to enhance the interaction between the
peptide-based skin colorant and the skin. Either multiple copies of the
same skin-binding peptide or a combination of different skin-binding
peptides may be used. In the case of large pigment particles, a large
number of skin-binding peptides, i.e., up to about 10,000, may be coupled
to the pigment. A smaller number of skin-binding peptides can be coupled
to the smaller dye molecules, i.e., up to about 50. Therefore, in one
embodiment of the present invention, the peptide-based skin colorants are
;
diblock compositions consisting of a skin-binding peptide (SBP) and a
coloring agent (C), having the general structure (SBP)n - C, where n
ranges from 1 to about 10,000, preferably n is 1 to about 500.
In another embodiment, the peptide-based skin colorants contain a
spacer (S) separating the binding peptide from the coloring agent, as
described above. Multiple copies of the skin-binding peptide may be
coupled to a single spacer molecule. In this embodiment, the peptidebased
skin colorants are triblock compositions consisting of a skin-binding
peptide, a spacer, and a coloring agent, having the general structure
[(SBP)m - S]n - C, where n ranges from 1 to about 10,000, preferably n is
1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to
about 10.
It should be understood that as used herein, SBP is a generic
designation and is not meant to refer to a single skin binding peptide
sequence. Where n or m as used above, is greater than 1, it is well within
the scope of the invention to provide for the situation where a series of
skin binding peptides of different sequences may form a part of the
composition. Additionally, It should be understood that these structures do
not necessarily represent a covalent bond between the peptide, the
coloring agent, and the optional spacer. As described above, the coupling
interaction between the peptide, the coloring agent, and the optional
spacer may be either covalent or non-covalent.
The peptide-based skin colorants of the present invention may be
used as coloring agents in cosmetic and make-up products, including but
not limited to foundations, blushes, lipsticks, lip liners, lip glosses,
eyeshadows and eyeliners. These may be anhydrous make-up products
comprising a cosmetically acceptable medium which contains a fatty
substance, or they may be in the form of a stable dispersion such as a
water-in-oil or oil-in-water emulsion, as described above. In these
compositions, the proportion of the peptide-based skin colorant is
generally from about 0.001 % to about 40% by weight relative to the total
weight of the composition.
Peptide-Based Oral Care Reagents
The peptide-based oral care reagents of the invention are formed
by coupling an oral cavity surface-binding peptide (OBP) with an oral care
benefit agent (OBA). Oral cavity surface-binding peptides include, but are
not limited to, tooth-binding peptides (TBP), skin-binding peptides (SBP),
gum, cheek, and tongue-binding peptides. The peptide part of the
peptide-based oral care agent binds strongly to the teeth, gums, cheeks,
tongue, or other surface in the oral cavity, thus keeping the benefit agent
attached for a long lasting effect. The skin-binding peptides described
above may be useful for attachment to gums, cheeks, or tongue.
Preferably, a binding peptiae ror me specific oral cavity surface of interest
is identified using the screening methods described above. .
The peptide-based oral care reagents of the invention are prepared
by coupling an oral cavity surface-binding peptide to an oral care benefit
agent, either directly or via a spacer, using any of the coupling methods
described above. Oral care benefit agents are well known in the art (see
for example White etal., U.S. Patent No. 6,740,311; Lawleret al., U.S.
Patent No. 6,706,256; and Fuglsang et al., U.S. Patent No. 6,264925; all
of which are incorporated herein by reference). Exemplary oral benefit
agents include, but are not limited to, white colorants, whitening agents,
enzymes, anti-plaque agents, anti-staining agents, anti-microbial agents,
anti-caries agents, flavoring agents, coolants, and salivating agents.
Suitable white colorants which may be used in peptide-based teeth
whiteners include, but are not limited to, white pigments such as titanium
dioxide, titanium dioxide nanoparticles ; and white minerals such as
hydroxyapatite, and Zircon (zirconium silicate). Suitable enzymes may be
naturally occurring or recombinant enzymes including, but not limited to,
oxidases, peroxidases, proteases, lipases, glycosidases, esterases, and
polysaccharide hydrolases. Anti-plaque agents include, but are not limited
to, fluoride ion sources and anti-microbial agents. Suitable anti-microbial
agents include, but are not limited to, anti-microbial peptides such as those
described by Haynie in U.S. Patent No. 5,847,047, magainins, and
cecropins; microbiocides such as triclosan, chlorhexidine, quaternary
ammonium compounds, chloroxyylenol, chloroxyethanol, phthalic acid and
its salts, and thymol. Suitable flavoring agents include, but are not limited
to, oil of wintergreen, oil of peppermint, oil of spearmint, menthol, methyl
salicylate, eucalyptol, and vanillin.
It may also be desirable to have multiple oral cavity surface-binding
peptides coupled to the oral benefit agent to enhance the interaction
between the peptide-based oral care agent and the oral cavity surface.
Either multiple copies of the same oral cavity surface-binding peptide or a
combination of different oral cavity surface-binding peptides may be used.
In the case of large pigment particles, a large number of oral cavity
surface-binding peptides, i.e., up to about 10,000, may be coupled to the
pigment. A smaller number of oral cavity surface-binding peptides can be
coupled to the smaller oral benefit agents molecules, i.e., up to about 50.
Therefore, in one embodiment of the present invention, the peptide-based
oral care reagents are diblock compositions consisting of an oral cavity
surface-binding peptide (OBP) and an oral benefit agent (OBA), having the
general structure (OBP)n - OBA, where n ranges from 1 to about 10,000,
preferably n is 1 to about 500.
In another embodiment, the peptide-based oral care reagents
contain a spacer (S) separating the binding peptide from the oral benefit
agent, as described above. Multiple copies of the oral cavity surfacebinding
peptide may be coupled to a single spacer molecule. In this
embodiment, the peptide-based oral care reagents are triblock
compositions consisting of an oral cavity surface-binding peptide, a
spacer, and an oral benefit agent, having the general structure [(OBP)m -
S]n - OBA, where n ranges from 1 to about 10,000, preferably n is 1 to
about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10.
It should be understood that as used herein, OBP is a generic
designation and is not meant to refer to a single oral cavity surface-binding
peptide sequence. Where n or m as used above, is greater than 1, it is
well within the scope of the invention to provide for the situation where a
series of oral cavity surface-binding peptides of different sequences may
form a part of the composition. Additionally, it should be understood that
these structures do not necessarily represent a covalent bond between the
peptide, the oral benefit agent, and the optional spacer. As described
above, the coupling interaction between the peptide, the oral benefit
agent, and the optional spacer may be either covalent or non-covalent.
The peptide-based oral care reagents of the invention may be used
in oral care products, which may have any suitable physical form, such as
powder, paste, gel, liquid, ointment, or tablet. Exemplary oral care
products include, but are not limited to, toothpaste, dental cream, gel or
tooth powder, mouth wash, breath freshener, and dental floss. The oral
care products comprise an effective amount of the peptide-based oral care
reagents of the invention in an orally acceptable carrier medium. An
effective amount of a peptide-based oral care agent for use in an oral care
product may vary depending on the type of product. Typically, the
effective amount of the peptide-based oral care agent is a proportion from
about 0.001% to about 90% by weight of the total product composition.
The oral care product may contain one type of peptide-based oral care
agent or a mixture of different peptide-based oral care reagents.
Components of an orally acceptable carrier medium are described
by White et al., Lawler et al., and Fuglsang et al., supra. For example, in
addition to the peptide-based oral care reagents of the invention, the oral
care products may contain one or more of the following: abrasives,
surfactants, chelating agents, fluoride sources, thickening agents,
buffering agents, solvents, humectants, carriers, bulking agents, and
additional oral benefit agents, as given above.
The oral care products of the invention may be prepared using
standard techniques that are well known in the art. If the composition
comprises more than one phase, typically, the different phases are
prepared separately, with material of similar phase partitioning being'
added in any order. The two phases are combined using vigorous mixing
to form the multiphase system (e.g., an emulsion or dispersion).
Methods for Treating Hair. Skin. Nails, and the Oral Cavity
In another embodiment, methods are provided for treating hair,
skin, and nails, with the peptide-based conditioners and colorants of the
present invention. Specifically, the present invention also comprises a
method for forming a protective film of peptide-based conditioner on skin,
hair, or lips by applying one of the compositions described above
comprising an effective amount of a peptide-based skin conditioner or
peptide-based hair conditioner to the skin, hair, or lips and allowing the
formation of the protective film. The compositions of the present invention
may be applied to the skin, hair, or lips by various means, including, but
not limited to spraying, brushing, and applying by hand. The peptidebased
conditioner composition is left in contact with the skin, hair, or lips
for a period of time sufficient to form the protective film, preferably for at
least about 0.1 to 60 min.
The present invention also provides a method for coloring hair by
applying a hair coloring composition comprising an effective amount of a
peptide-based hair colorant to the hair by means described above. The
hair coloring composition is allowed to contact the hair for a period of time
sufficient to cause coloration of the hair, preferably between about 5
seconds to about 50 minutes, and more preferably from about 5 seconds
to about 60 seconds, and then the hair coloring composition may be rinsed
from the hair.
The present invention also provides a method for coloring skin or
lips by applying a skin coloring composition comprising an effective
amount of a peptide-based skin colorant to the skin or lips by means
described above.
The present invention also provides a method for coloring
fingernails or toenails by applying a nail polish composition comprising an
•»
effective amount of a peptide-based nail colorant to the fingernails or
toenails by means described above.
The present invention also provides a method for coloring eyebrows
and. eyelashes by applying a cosmetic composition comprising an effective
amount of a peptide-based hair colorant to the eyebrows and eyelashes
by means described above.
The invention also provides a method for whitening teeth by
applying an oral care product composition comprising a peptide-based
whitener to the teeth for a sufficient time to allow the peptide-based
whitener to bind to the teeth. The composition may then be rinsed from
the teeth. The oral care product composition may be applied to the teeth
using any suitable method including, but not limited to, brushing, rinsing,
and using an applicator strip or dental floss coated with the composition.
The invention also provides a method for freshening breath by
applying to the oral cavity an oral care product comprising a peptide-based
breath freshener. The oral care product may be applied as a rinse, a
toothpaste, a spray, a gum, or a candy.
The above methods of application of the binding reagents to body
surfaces are characterized by the ability of the regent to bind to a surface
in an aqueous environment and to bind rapidly, often within 5 to about 60
seconds from the time of first application. The reagents of the invention
are multifaceted bio-adhesives with a multiplicity of applications but unified
in their water fast nature and rapid and tight binding characteristics.
EXAMPLES
The present invention is further defined in the following Examples.
It should be understood that these Examples, while indicating preferred
embodiments of the invention, are given by way of illustration only. From
the above discussion and these Examples, one skilled in the art can
ascertain the essential characteristics of this invention, and without
departing from the spirit and scope thereof, can make various changes
and modifications of the invention to adapt it to various uses and
conditions.
The meaning of abbreviations used is as follows: "min" means .
minute(s), "sec" means second(s), "h" means hour(s), "uL" means
microliter(s), "ml" means milliliter(s), "L" means liter(s), "nm" means
nanometer(s), "mm" means millimeter(s), "cm" means centimeter(s), "jam"
means micrometer(s), "mM" means millimolar, "M" means molar, "mmol"
means millimole(s), "umole" means micromole(s), "g" means gram(s), "ug"
means microgram(s), "mg" means milligram(s), "g" means the gravitation
constant, "rpm" means revolutions per minute, "pfu" means plague forming
unit, "BSA" means bovine serum albumin, "ELISA" means enzyme linked
immunosorbent assay, "IPTG" means isopropyl p-Dthiogalactopyranoside,
"A" means absorbance, 'Awo" means the
absorbance measured at a wavelength of 450 nm, "TBS" means Trisbuffered
saline, "TBST-X" means Tris-buffered saline containing Tween
20 where "X" is the weight percent of Tween® 20, "Xgal" means 5-bromo-
4-chloro-3-indolyl-beta-D-galactopyranoside, "SEM" means standard error
of the mean, "ESCA" means electron spectroscopy for chemical analysis,
"eV" means electron volt(s), "TGA" means thermogravimetric analysis,
"GPC" means gel permeation chromatography, "MW" means molecular
weight, "Mw" means weight-average molecular weight, "vol %" means
volume percent, "NMR" means nuclear magnetic resonance spectroscopy,
and "MALDI mass spectrometry" means matrix assisted, laser desorption
ionization mass spectrometry.
GENERAL METHODS:
Standard recombinant DNA and molecular cloning techniques used
in the Examples are well known in the art and are described by Sambrook,
J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,
1989, by T. J. Silhavy, M. L Bennan, and L W. Enquist, Experiments with
Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.,
1984, and by Ausubel, F. M. et al., Current Protocols in Molecular Biology,
Greene Publishing Assoc. and Wiley-lnterscience, N.Y., 1987.
Materials and methods suitable for the maintenance and growth of
bacterial cultures are also well known in the art. Techniques suitable for
use in the following Examples may be found in Manual of Methods for .
General Bacteriology, Phillipp Gerhardt, R. G. E. Murray, Ralph N.
Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs
Phillips, eds., American Society for Microbiology, Washington, DC., 1994,
or by Thomas D. Brock in Biotechnology: A Textbook of Industrial
Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland, MA,
1989. All reagents, restriction enzymes and materials used for the growth
and maintenance of bacterial cells were obtained from Aldrich Chemicals
(Milwaukee, Wl), BD Diagnostic Systems (Sparks, MD), Life Technologies
(Rockville, MD), or Sigma Chemical Company (St. Louis, MO), unless
otherwise specified.
EXAMPLE 1
Selection of Hair-Binding Phaqe Peptides Using Standard Biopanning
The purpose of this Example was to identify hair-binding phage
peptides that bind to normal hair and to bleached hair using standard
phage display biopanning.
Phage Display Peptide Libraries:
The phage libraries used in the present invention, Ph.D.-12™
Phage Display Peptide Library Kit and Ph.D.-7™ Phage Display Library
Kit, were purchased from New England BioLabs (Beverly, MA). These kits
are based on a combinatorial library of random peptide 7 or 12-mers fused
to a minor coat protein (pill) of M13 phage. The displayed peptide is
expressed at the N-terminus of pill, such that after the signal peptide is
cleaved, the first residue of the coat protein is the first residue of the
displayed peptide. The Ph.D.-7 and Ph.D.-12 libraries consist of
approximately 2.8 x 10 and 2.7 x 10 sequences, respectively. A volume
of 10 pL contains about 55 copies of each peptide sequence. Each initial
round of experiments was carried out using the original library provided by
the manufacturer in order to avoid introducing any bias into the results.
Preparation of Hair Samples:
The samples used as normal hair were 6-inch medium brown
human hairs obtained from International Hair Importers and Products ,
(Bellerose, NY). The hairs were placed in 90% isopropanol for 30 min at
room temperature and then washed 5 times for 10 min each with
deionized water. The hairs were air-dried overnight at room temperature.
To prepare the bleached hair samples, the medium brown human
hairs were placed in 6% H2O2, which was adjusted to pH 10.2 with
ammonium hydroxide, for 10 min at room temperature and then washed 5
times for 10 min each with deionized water. The hairs were air-dried
overnight at room temperature.
The normal and bleached hair samples were cut into 0.5 to 1 cm
lengths and about 5 to 10 mg of the hairs was placed into wells of a
custom 24-well biopanning apparatus that had a pig skin bottom. An equal
number of the pig skin bottom wells were left empty. The pig skin bottom
apparatus was used as a subtractive procedure to remove phage-peptides
that have an affinity for skin. This apparatus was created by modifying a
dot blot apparatus (obtained from Schleicher & Schuell, Keene, NH) to fit
the biopanning process. Specifically, the top 96-well block of the dot blot
apparatus was replaced by a 24-well block. A 4 x 6 inch treated pig skin
was placed under the 24-well block and panning wells with a pig skin
bottom were formed by tightening the apparatus. The pig skin was
purchased from a local supermarket and stored at -80 °C. Before use, the
skin was placed in deionized water to thaw, and then blotted dry using a
paper towel. The surface of the skin was wiped with 90% isopropanol, and
then rinsed with deionized water. The 24-well apparatus was filled with
blocking buffer consisting of 1 mg/mL BSA in TBST containing 0.5%
Tween® 20 (TBST-0.5%) and incubated for 1 h at 4 °C. The wells and
hairs were washed 5 times with TBST-0.5%. One milliliter of TBST-0.5%
containing 1 mg/mL BSA was added to each well. Then, 10 uL of the
original phage library (2 x 1011 pfu), either the 12-mer or 7-mer library, was
added to the pig skin bottom wells that did not contain a hair sample and
the phage library was incubated for 15 min at room temperature. The
unbound phages were then transferred to pig skin bottom wells containing
the hair samples and were incubated for 15 min at room temperature. The
hair samples and the wells were washed 10 times with TBST-0.5%. ~Trje
hairs were then transferred to clean, plastic bottom wells of a 24-well plate
and 1 mL of a non-specific elution buffer consisting of 1 mg/mL BSA in 0.2
M glycine-HCI, pH 2.2, was added to each well and incubated for 10 min to
elute the bound phages. Then, 160 uL of neutralization buffer consisting
of 1 M Tris-HCI, pH 9.2, was added to each well. The eluted phages from
each well were transferred to a new tube for titering and sequencing.
To titer the bound phages, the eluted phage was diluted with SM
buffer (100 mM NaCI, 12.3 mM MgS04-7 H2O, 50 mM Tris-HCI, pH 7.5,
and 0.01 wt/vol % gelatin) to prepare 10-fold serial dilutions of 101 to 104.
A 10 uL aliquot of each dilution was incubated with 200 uL of mid-log
phase £ coli ER2738 (New England BioLabs), grown in LB medium for 20
min and then mixed with 3 mL of agarose top (LB medium with 5 mM
MgCb, and 0.7% agarose) at 45 °C. This mixture was spread onto a SGal
™/LB agar plate (Sigma Chemical Co.) and incubated overnight at 37
°C. The S-Gal™/LB agar blend contained 5 g of tryptone, 2.5 g of yeast
extract, 5 g of sodium chloride, 6 g of agar, 150 mg of 3,4-
cyclohexenoesculetin-p-D-galactopyranoside (S-Gal™), 250 mg of ferric
ammonium citrate and 15 mg of isopropyl p-D-thiogalactoside (IPTG) in
500 ml of distilled water. The plates were prepared by autoclaving the SGal
™ /LB for 15 to 20 min at 121-124 °C. The single black plaques were
randomly picked for DNA isolation and sequence analysis.
The remaining eluted phages were amplified by incubating with
diluted Eco// ER2738, from an overnight culture diluted 1:100 in LB
medium, at 37 °C for 4.5 h. After this time, the cell culture was centrifuged
for 30 s and the upper 80% of the supernatant was transferred to a fresh
tube, 1/6 volume of PEG/NaCI (20% polyethylene glyco-800, 2.5 M sodium
chloride) was added, and the phage was allowed to precipitate overnight
at 4 °C. The precipitate was collected by centrifugation at 10,000 x g at 4
°C and the resulting pellet was resuspended in 1 ml_ of TBS. This was the
first round of amplified stock. The amplified first round phage stock was
then titered according to the same method as described above. For the
next round of biopanning, more than 2 x1011 pfu of phage stock from the
first round was used. The biopanning process was repeated for 3 to 6
rounds depending on the experiments.
The single plaque lysates were prepared following the
manufacture's instructions (New England Biolabs) and the single stranded
phage genomic DNA was purified using the QIAprep Spin M13 Kit
(Qiagen, Valencia, CA) and sequenced at the DuPont Sequencing Facility
using -96 gill sequencing primer (5'-CCCTCATAGTTAGCGTAACG-3')t
given as SEQ ID NO:62. The displayed peptide is located immediately
after the signal peptide of gene III.
The amino acid sequences of the eluted normal hair-binding phage
peptides from the 12-mer library isolated from the fifth round of biopanning
are given in Table 1. The amino acid sequences of the eluted bleached
hair-binding phage peptides from the 12-mer library isolated from the fifth
round of biopanning are given in Table 2. Repeated amino acid
sequences of the eluted normal hair-binding phage peptides from the 7-
mer library from 95 randomly selected clones, isolated from the third round
of biopanning, are given in Table 3.
(Table Removed)There was a multiple DNA fragment intersion in these clones.
EXAMPLE 2
Selection of High Affinity Hair-Binding Phaqe Peptides
Using a Modified Method
The purpose of this Example was to identify hair-binding phage
peptides with a higher binding affinity.
The hairs that were treated with the acidic elution buffer, as
described in Example 1, were washed three more times with the elution
buffer and then washed three times with TBST-0.5%. These hairs, which
had acid resistant phage peptides still attached, were used to directly
infect 500 uL of mid-log phase bacterial host cells, E. coli ER2738 (New
England BioLabs), which were then grown in LB medium for 20 min and
then mixed with 3 mL of agarose top (LB medium with 5 mM MgCI2, and
0.7% agarose) at 45 °C. This mixture was spread onto a LB
medium/IPTG/ S-Gal™ plate (LB medium with 15 g/L agar, 0.05 g/L IPTG,
and 0.04 g/L S-Gal™) and incubated overnight at 37 °C. The black
plaques were counted to calculate the phage titer. The single black
plaques were randomly picked for DNA isolation and sequencing analysis,
as described in Example 1. This process was performed on the normal
and bleached hair samples that were screened with the 7-mer and 12-mer
phage display libraries, as described in Example 1. The amino acid
sequences of these high affinity, hair-binding phage peptides are given in
Selection of Hiqh Affinity Fingernail-Binding Phaqe Peptides
The purpose of this Example was to identify phage peptides that
have a high binding affinity to fingernails. The modified biopanning
method described in Example 2 was used to identify high affinity,
fingernail-binding phage-peptide clones.
67
Human fingernails were collected from test subjects. The
fingernails were cleaned by brushing with soap solution, sinsed with
deionized water, and allowed to air-dry at room temperature. The
fingernails were then powdered under liquid N2, and 10 mg of the
fingernails was added to each well of a 96-well filter plate. The fingernail
samples were treated for 1 h with blocking buffer consisting of 1 mg/mL
BSA in TBST-0.5%, and then washed with TBST-0.5%. The fingernail
samples were incubated with phage library (Ph.D-12 Phage Display
Peptide Library Kit), and washed 10 times using the same conditions
described in Example 1. After the acidic elution step, described in
Example 1, the fingernail samples were washed three more times with the
elution buffer and then washed three times with TBST-0.5%. The acidtreated
fingernails, which had acid resistant phage peptides still attached,
were used to directly infect E. coli ER2738 cells as described in Example
2. This biopanning process was repeated three times. A total of 75 single
black phage plaques were picked randomly for DNA isolation and -
H
sequencing analysis and two repeated clones were identified. The amino
acid sequences of these phage peptides are listed in Table 8. These
fingernail binding peptides were also found to bind well to bleached hair.
(Table Removed)The frequency represents the number of identical sequences that
occurred out of 75 sequenced clones.
EXAMPLE 4
Selection of High Affinity Skin-Binding Phage Peptides
The purpose of this Example was to identify phage peptides that
have a high binding affinity to skin. The modified biopanning method
described in Examples 2 and 4 was used to identify the high affinity, skinbinding
phage-peptide clones. Pig skin served as a model for human skin
in the process.
The pig skin was prepared as described in Example 1. Three
rounds of screenings were performed with the custom, pig skin bottom
biopanning apparatus using the same procedure described in Example 4.
A total of 28 single black phage plaques were picked randomly for DNA
isolation and sequencing analysis and one repeated clone was identified.
The amino acid sequence of this phage peptide, which appeared 9 times
out of the 28 sequences, was TPFHSPENAPGS, given as SEQ ID NO:61.
EXAMPLE 5
Quantitative Characterization of the Binding Affinity of
Hair-Binding Phage Clones
The purpose of this Example was to quantify the binding affinity of
phage clones by titering and ELISA,
Titering of Hair-Binding Phaqe Clones:
Phage clones displaying specific peptides were used for comparing
the binding characteristics of different peptide sequences. A titer-based
assay was used to quantify the phage binding. This assay measures the
output pfu retained by 10 mg of hair surfaces, having a signal to noise
ratio of 103 to 104. The input for all the phage clones was 1014 pfu. It
should be emphasized that this assay measures the peptide-expressing
phage particle, rather than peptide binding.
Normal hairs were cut into 0.5 cm lengths and 10 mg of the cut hair
was placed in each well of a 96-well filter plate (Qiagen). Then, the wells
were filled with blocking buffer containing 1mg/mL BSA in TBST-0.5% and
incubated for 1 h at 4 °C. The hairs were washed 5 times with TBST-
0.5%. The wells were then filled with 1 ml_ of TBST-0.5% containing 1
mg/mL BSA and then purified phage clones (1014pfu) were added to each
well. The hair samples were incubated for 15 min at room temperature
and then washed 10 times with TBST-0.5%. The hairs were transferred to
a clean well and 1.0 mL of a non-specific elution buffer, consisting of 1
mg/mL BSA in 0.2 M Glycine-HCI at pH 2.2, was added to each well. The
samples were incubated for 10 min and then 160 uL of neutralization
buffer (1 M Tris-HCI, pH 9.2) was added to each well. The eluted phages
from each well were transferred to a new tube for titering and sequencing
analysis.
To titer the bound phages, the eluted phage was diluted with SM
buffer to prepare 10-fold serial dilutions of 101 to 108. A 10 uL aliquot of
each dilution was incubated with 200 |jL of mid-log phase £. coli ER2738
(New England BioLabs), and grown in LB medium for 20 min and then
mixed with 3 mL of agarose top (LB medium with 5 mM MgCfe, and 0,7%
agarose) at 45 °C. This mixture was spread onto a LB medium/IPTG/Xgal
plate (LB medium with 15 g/L agar, 0.05 g/L IPTG, and 0.04 g/L Xgal) and
incubated overnight at 37 °C. The blue plaques were counted to calculate
the phage titers, which are given in Table 9.
Characterization of Hair-Binding Phaae Clones bv ELISA:
Enzyme-linked immunosorbent assay (ELISA) was used to evaluate
the hair-binding specificity of selected phage-peptide clones. Phagepeptide
clones identified in Examples 1 and 2 along with a randomly
chosen control G-F9, KHGPDLLRSAPR (given as SEQ ID NO:63) were
amplified. More than 1014pfu phages were added to pre-blocked hair
surfaces. The same amount of phages was also added to pre-blocked pig
skin surfaces as a control to demonstrate the hair-binding specificity.
A unique hair or pig skin-bottom 96-well apparatus was created by
applying one layer of Parafilm® under the top 96-well block of a Minifold I
Dot-Blot System (Schleicher & Schuell, Inc., Keene, NH), adding hair or a
layer of hairless pig skin on top of the Parafilm® cover, and then tightening
the apparatus. For each clone to be tested, the hair-covered well was
incubated for 1 h at room temperature with 200 uL of blocking buffer,
consisting of 2% non-fat dry milk (Schleicher & Schuell, Inc.) in TBS. A
second Minifold system with pig skin at the bottom of the wells was treated
with blocking buffer simultaneously to serve as a control. The blocking
buffer was removed by inverting the systems and blotting them dry with
paper towels. The systems were rinsed 6 times with wash buffer
consisting of TBST-0.05%. The wells were filled with 200 uL of TBST-
0.5% containing 1 mg/mL BSA and then 10 uL (over 1012 copies) of
purified phage stock was added to each well. The samples were
incubated at 37 °C for 15 min with slow shaking. The non-binding phage
was removed by washing the wells 10 to 20 times with TBST-0.5%. Then,
100 uL of horseradish peroxidase/anti-M13 antibody conjugate
(Amersham USA, Piscataway, NJ), diluted 1:500 in the blocking buffer,
was added to each well and incubated for 1 h at room temperature. The
conjugate solution was removed and the wells were washed 6 times with
TBST-0.05%. TMB substrate (200 uL), obtained from Pierce
Biotechnology (Rockford, IL) was added to each well and the color was
allowed to develop for between 5 to 30 min, typically for 10 min, at room
temperature. Then, stop solution (200 uL of 2 M H2SO4) was added to
each well and the solution was transferred to a 96-well plate and the AASQ
was measured using a microplate spectrophotometer (Molecular Devices,
Sunnyvale, CA). The resulting absorbance values, reported as the mean
of at least three replicates, and the standard error of the mean (SEM) are
(Table Removed)As can be seen from the data in Table 10, all the hair-binding
clones had a significantly higher binding affinity for hair than the control.
Moreover, the hair-binding clones exhibited various degrees of selectivity
for hair compared to pig skin. Clone D21 had the highest selectivity for
hair, having a very strong affinity for hair and a very low affinity for pig skin.
EXAMPLE 6
Confirmation of Peptide Binding Specificity and Affinity
The purpose of this Example was to test the peptide binding site
specificity and affinity of the hair-binding peptide D21 using a competition
ELISA. The ELISA assay only detects phage particles that remain bound
to the hair surface. Therefore, if the synthetic peptide competes with the
phage particle for the same binding site on hair surface, the addition of the
synthetic peptide into the ELISA system will significantly reduce the ELISA
results due to the peptide competition.
The synthetic hair-binding peptide D21, given as SEQ ID NO:46,
was synthesized by SynPep (Dublin, CA). As a control, an unrelated
synthetic skin-binding peptide, given as SEQ ID NO:61, was added to the
system. The experimental conditions were similar to those used in the
ELISA method described in Example 5. Briefly, 100 uL of Binding Buffer
(1xTBS with 0.1% Tween®20 and 1 mg/mL BSA) and 1011 pfu of the pure
D21 phage particles were added to each well of the 96-weII filter plate,
which contained a sample of normal hair. The synthetic peptide (100 ug )
was added to each well (corresponding to concentration of 0.8 mM). The
reactions were carried out at room temperature for 1 h with gentle shaking,
followed by five washes with TBST-0.5%. The remaining steps were
identical to the those used in the ELISA method described in Example 5.
The ELISA results, presented as the absorbance at 450 nm (A45o), are
shown in Table 11. Each individual ELISA test was performed in
triplicate; the values in Table 11 are the means of the triplicate
determinations.
These results demonstrated that the synthetic peptide D21 does
compete with the phage clone D21 for the same binding sites on the hair
surface.
EXAMPLE 7
Selection of Shampoo-Resistant Hair-Binding Phaqe-Peptides
Using Biopanning
The purpose of this Example was to select shampoo-resistant hairbinding
phage-peptides using biopanning with shampoo washes.
In order to select shampoo-resistant hair-binding peptides, a
biopanning experiment using 12-mer phage peptide libraries against
normal and bleached hairs was performed, as described in Example 2,
Instead of using normal TBST buffer to wash-off the unbounded phages,
the phage-complexed hairs were washed with 10%, 30% and 50%
shampoo solutions (Pantene Pro-V shampoo, Sheer Volume, Proctor &
Gamble, Cincinnati, OH), for 5 min in separate tubes, followed by six TBS
buffer washes. The washed hairs were directly used to infect host
bacteria! cells as described in the modified biopanning method, described
in Example 2.
A potential problem with this method is the effect of the shampoo
on the phage's ability to infect bacterial host cells. In a control experiment,
a known amount of phage particles was added to a 10% shampoo solution
for 5 min, and then a portion of the solution was used to infect bacterial
cells. The titer of the shampoo-treated phage was 90% lower than that of
the untreated phage. The 30% and 50% shampoo treatments gave eVen
more severe damage to the phage's ability to infect host cells.
Nevertheless, two shampoo-resistant hair-binding phage-peptides were
identified, as shown in Table 12.
Selection of Shampoo-Resistant Hair-Binding Phage-Peptides
Using PCR
The purpose of this Example was to select shampoo-resistant hairbinding
phage-peptides using a PCR method to avoid the problem of
shampoo induced damage to the phage. This principle of the PCR
method is that DMA fragments inside the phage particle can be recovered
using PCR, regardless of the phage's viability, and that the recovered DNA
fragments, corresponding to the hair-binding peptide sequences, can then
been cloned back into a phage vector and packaged into healthy phage
particles.
Biopanning experiments were performed using 7-mer and 12-mer
phage-peptide libraries against normal and bleached hairs, as described in
Example 1. After the final wash, the phage-treated hairs were subjected to
5 min of shampoo washes, followed by six TBS buffer washes. The
shampoo-washed hairs were put into a new tube filled with 1 mL of water,
and boiled for 15 min to release the DNA. This DNA-containing, boiled
solution was used as a DNA template for PCR reactions. The primers
used in the PCR reaction were primers: M13KE-1412 Forward 5'-
CAAGCCTCAGCGACCGAATA -3', given as SEQ ID NO:67 and M13KE-
1794 Reverse 5'- CGTAACACTGAGTTTCGTCACCA -3', given SEQ ID
NO:68. The PCR conditions were: 3 min denaturing at 96 °C, followed by
35 cycles of 94 °C for 30 sec, 50 °C for 30 sec and 60 °C for 2 min. The
PCR products (~400 bp), and M13KE vector (New England BioLabs) were
digested with restriction enzymes Eag I and Acc65 \. The ligation and
transformation conditions, as described in the Ph.D.™ Peptide Display
Cloning System (New England Biolabs), were used. The amino acid
sequence of the resulting shampoo-resistant hair-binding phage-peptide is
NTSQLST, given as SEQ ID N0:70.
EXAMPLE 9
Determination of the Affinity of Hair-Binding and Skin-Binding Peptides
The purpose of this Example was to determine the affinity of the
hair-binding and skin-binding peptides for their respective substrates,
measured as MBso values, using an ELISA assay.
Hair-binding and skin-binding peptides were synthesized by
SynPep Inc. (Dublin, CA). The peptides were biotinylated by adding a
biotinylated lysine residue at the C-terminus of the amino acid binding
sequences for detection purposes and an amidated cysteine was added to
the C-terminus of the sequence. The amino acid sequences of the
peptides tested are given as SEQ ID NOs:71-74, as shown in Table 13.
For hair samples, the procedure used was as follows. The setup of
the surface specific 96-well system used was the same as that described
in Example 5. Briefly, the 96-wells with hair or pig skin surfaces were
blocked with blocking buffer (SuperBlock™from Pierce Chemical Co.,
Rockford, IL) at room temperature for 1 h, followed by six washes with
TBST-0.5%, 2 min each, at room temperature. Various concentrations of
biotinylated, binding peptide were added to each well, incubated for 15
min at 37 °C, and washed six times with TBST-0.5%, 2 min each, at room
temperature. Then, streptavidin-horseradish peroxidase (HRP) conjugate
(Pierce Chemical Co.) was added to each well (1.0 ug per well), and
incubated for 1 h at room temperature. After the incubation, the wells
were washed six times with TBST-0.5%, 2 min each at room temperature.
Finally, the color development and the measurement were performed as
described in Example 5.
For the measurement of MBso of the peptide-skin complexes, the
following procedure was used. First, the pigskin was treated to block the
endogenous biotin in the skin. This was done by adding streptavidin to the
blocking buffer. After blocking the pigskin sample, the skin was treated
with D-biotin to block the excess streptavidin binding sites. The remaining
steps were identical to those used for the hair samples.
The results were plotted as A4so versus the concentration of
peptide using GraphPad Prism 4.0 (GraphPad Software, Inc., San Diego,
CA). The MBso values were calculated from Scatchard plots and are
summarized in Table 13. The results demonstrate that the binding affinity
of the hair-binding peptides (D21, F35, and I-B5) and the skin binding
peptide (SEQW ID NO:61) for their respective substrate was high, while
the binding affinity of the hair-binding peptides (D-21 and I-B5) for skin
was relatively low.
76
Table 13
Summary of MBnn Values for Hair and Skin-Binding Peptides
The peptides tested were biotinylated at the C-terminus of the amino acid
binding sequences and an amidated cysteine was added to the Cterminus
of the binding sequence.
EXAMPLE 10
Preparation of a Peptide-Based-Carbon Black Hair Colorant
The purpose of this Example was to prepare a peptide-basedcarbon
black hair colorant by covalently linking the hair-binding peptide
D21, given as SEQ ID NO:46, to the surface of carbon black particles.
The surface of the carbon black particles was functionalized by reaction
with 2)2'-azobis(2methylpropionamide)-dihydrochloride to introduce free
amino groups. The functionalized carbon black particles were then
covalently linked to the specific hair-binding peptide.
Functionalization of Carbon Black Surface:
Carbon black (Nipex® 160-IQ from Degussa, Allendale, NJ), 2.0 g,
and 1.0 g of 2,2'-Azobis(2-methylpropionamide)dihydrochloride (Aldrich,
Milwaukee, Wl) were added to a 100 ml round-bottom flask and 30 ml of
dioxane was added. The flask was purged with nitrogen for 5 min. Then,
the flask was sealed with a rubber septum and the reaction mixture was
stirred at 65 °C for 14 h. After this time, 50 mL of deionized water,
prepared with a Nanopure water purification system
(Barnstead/Thermolyne, Dubuque, IA), was added to the mixture. The
diluted solution was centrifuged to collect the functionalized carbon black
particles and to remove the organic solvent and unreacted reagents. The
carbon black particles were washed with deionized water and centrifuged.
This washing and centrifuging process was repeated 2 more times. The
functionalized carbon black particles were then dried by lyophilization.
Synthesis of t-Boc-Protected Hair-Binding Peptidefrom Phaqe Clone D21
The purpose of this reaction was to protect the ammo end group of
the hair-binding peptide. The hair-binding peptide from phage clone D21
(0.25 g), given as SEQ ID NO:46 (95% purity, obtained from SynPep,
Dublin, CA) was mixed with 2.5 ml of deionized water in a 25 ml roundbottom
flask. Then, 20 mg of NaOH and 0.25 ml of t-butyl alcohol were
added. After stirring the mixture for 2 min, 0.12 g of di-tert-butyl
dicarbonate (t-Boc anhydride) (Aldrich) was added dropwise. The flask
was sealed with a rubber septum and the reaction mixture was stirred
overnight at room temperature. The reaction mixture was clear at the
beginning of the reaction and became cloudy and then, precipitated after 1
•»
h. Upon addition of water (10 ml), the reaction mixture formed a milky
emulsion, which was then extracted three times with 5 ml portions of
methylene chloride. The organic layer was washed twice with 5 ml
portions of deionized water. The clear water layers were all combined and
dried by lyophilization, yielding 0.20 g of a fluffy white powder (80% yield).
The product was analyzed by liquid chromatography-mass spectrometry
(LC-MS) and was found to have a molecular weight of 1323 g/mol, with a
purity of 90% by weight.
Coupling of Amino-Functionalized Carbon Black with t-Boc-D21 -Peptide:
Amino-functionalized carbon black (87mg), t-Boc-D21-peptide
(80mg) and dicyclohexyl carbodiimide (22mg) were added to 3 ml_ of
tetrahydrofuran (THF). A solution of dimethyl aminopyridine (17 jaL) in
several drops of THF was added dropwise to this mixture with stirring.
The resulting dark suspension was heated to 40 °C for 6 h with stirring,
followed by stirring overnight at room temperature. Trifluoroacetic acid
(0.6 mL) was added to the product and the mixture was stirred for another
6 h. Then, 5 ml of deionized water was added to the reaction mixture.
The mixture was centrifuged at 3,500 rpm for 2 min and the supernatant
was decanted. The solid remaining in the centrifuge tube was washed
with deionized water and centrifuged again. This washing was repeated
until the pH of supernatant reached approximately 6.0. The dark residue
was then dried using a lyophilizer for 2 days, yielding a dark powder.
EXAMPLE 11
Hair Dyeing Using a Peptide-Based-Carbon Black Hair Colorant
The purpose of this Example was to dye a sample of natural white
hair using the peptide-based-carbon black hair colorant prepared in
Example 10.
A bundle of natural white hair (approximately 100 pieces) (from
International Hair Importers and Products Inc., Bellerose, NY) was cleaned
by mixing with 10 mL of 50% isopropanol for 30 min and then washed at
least 5 times with distilled water. After drying in air, the cleaned hair was
immersed for 30 min in a solution containing 50 mg of the hair-binding D21
peptide-carbon black hair colorant, described in Example 10, dissolved in
10 mL of distilled water. After dying, the hair was washed at least 5 times
with distilled water. The original natural white hair became light black.
The dyed hair was washed three times with a 30% shampoo solution
20 (Pantene Pro-V shampoo) by immersing the hair in the shampoo solution
and stirring with a glass pipette. The hair was then rinsed at least 10 times
with distilled water. The final color of the dyed, natural white hair was very
light black.
EXAMPLE 12
Preparation of a Peptide-Based Hair Conditioner
The purpose of this Example was to prepare a peptide-based hair
conditioner by covalently linking the hair-binding D21 peptide, given as
SEQ ID NO:46, with behenyl alcohol using carbodiimide coupling.
Behenyl alcohol (Aldrich), 81.7 mg, and 62.0 mg of dicyclohexyl
carbodiimide (DCC) were dissolved in 2.0 ml of THF in a 25 ml roundbottom
flask. A solution containing 0.25 g of the 9-
fluorenylmethyloxycarbonyl (Fmoc) N-terminal protected form of SEQ ID
N0:46 (95% purity, obtained from SynPep, Dublin, CA) in 2.0 ml
dimethyformamide (DMF) was added to the above mixture. Then, 50 ^L
of dimethylaminopyridine (DMAP) was added to the reaction mixture. With
stirring, the reaction mixture was maintained at 40 °C for 3 h, and then at
room temperature overnight. Then the solvent was evaporated under
vacuum at room temperature for 4 h. After this time, the mixture was
dissolved in 25 ml of ethyl acetate, and the unreacted peptide was
extracted 3 times with water using 10 mL of deionized water for each
extraction. The ethyl acetate phase was isolated and the ethyl acetate
was removed using a rotary evaporator. The resulting solid product was
dissolved in a solvent consisting of 2.5 mL of THF and 2.5 ml of DMF, and
1.5 mL of piperidine was added to deblock the amino group of the D21
peptide. This mixture was stirred for 2 h at room temperature and then the
solvents were removed by rotary evaporation under vacuum. The final
product was characterized by LC/MS.
EXAMPLE 13
Preparation of a Peptide-Based Hair Conditioner
The purpose of this Example was to prepare a peptide-based hair
conditioner by covalently linking the hair-binding, cysteine-attached D21
peptide, given as SEQ ID NO:64, with octylamine using the
heterobifunctional cross-linking agent 3-maleimidopropionic acid Nhydroxysuccinimide
ester.
Octylamine, obtained from Aid rich (Milwaukee, Wl) was diluted by
adding 11.6 mg to 0.3 mL of DMF. This diluted solution was added to a
stirred solution containing 25 mg of 3-maleimidopropionic acid Nhydroxysuccinimide
ester (Aldrich) and 5 mg of diisopropylethylamine
(Aldrich) in 0.2 mL of DMF in a 5 mL round bottom flask. The reaction
mixture turned turbid immediately and then became clear several minutes
later. The solution was stirred for another 4 h. The solution was then
dried under high vacuum. The product, octylamine-attached
maleimidopropionate, was purified by column chromatography using a
Silica gel 60 (EMD Chemicals, formerly EM Science, Gibbstown, NJ)
column and DMF/ether as the eluent.
Approximately 12 mg of the above product was placed into a 5 mL
round bottom flask and 50 mg of cysteine-attached D21 peptide (obtained
from SynPep, Dublin, CA), given as SEQ ID NO:64, and 0.5 mL of 0.1 M
phosphate buffer at pH 7.2 were added. The cysteine-attached D21
peptide has 3 glycine residues and a cysteine attached to the end of the
peptide binding sequence of the hair-binding D21 peptide (SEQ ID
NO:46). This mixture was stirred at room temperature for 6 h. The final
product, the C8-D21 peptide hair conditioner, was purified by extraction
with water/ether.
EXAMPLE 14
Preparation of a Peptide-Based-Carbon Black Hair Colorant
The purpose of this Example was to prepare a peptide-based
carbon black hair colorant using carbon black that was functionalized with
ethanol amine. The number of peptides attached to the carbon black
surface was estimated from chemical analyses.
Preparation of Acid Functionalized Carbon Black Particles:
In a 1,000 mL beaker was added 25.5 g of carbon black (Nipex-
160-IQ from Degussa, 100 g of ammonium persulfate [(NH^SaOe] (98%
from Aldrich), and 333 ml of 1.0 M H2SO4 (98%, GR grade from EMD
Chemicals) aqueous solution. The mixture was stirred with a magnetic stir
plate for 24 h at room temperature. After this time, the reaction mixture
was transferred to a 500 mL plastic centrifuge tube and centrifuged at
8,500 rpm for 20 min. The supernatant became clear and was removed.
The product was washed 6 times with deionized water using centrifugation
to collect the product after each wash. The final product was neutral (pH =
6.0) and was dried by lyophilization for 24 h. The average size of the
functionalized carbon black particles was 100 nm, as measured using a
particle size analyzer (Microtrac Ultrafine Particle Analyzer, Microtrac Inc.,
Montgomeryville, PA).
Preparation of Amino-Functionalized Carbon Black Using Ethanolamine:
Two grams of the dried, acid functionalized carbon black, 25 mL of
ethanolamine (99% from Aldrich) and 1 mL of concentrated H2S04 (98%,
GR grade from EMD Chemicals) were mixed in a 100 mL round bottom
flask. The mixture was stirred rapidly with a magnetic stirrer and refluxed
for 6 h. After the mixture cooled to room temperature, a sufficient amount
of ammonium hydroxide (28.0-30.0% of NH3 from EMD Chemicals) was
added to neutralize the mixture. Then, the mixture was centrifuged and
washed with water, as described in Example 6. The final product was
neutral (pH = 6.0) and was dried by lyophilization for 24 h. The dried,
amino functionalized carbon black was readily dispersed in water.
The surface composition of the functionalized carbon black was
analyzed by ESCA at the DuPont Corporate Center for Analytical Science.
In ESCA, monoenergetic X-rays are focused onto the surface of a material
to excite surface atoms. Core and valence shell electrons with energies
characteristic of elements in the top 10 nm of the surface are ejected and
their energy analyzed to obtain qualitative and quantitative information on
surface composition. The kinetic energy of the electrons emitted provides
information about the functional groups and oxidation states of the surface
species. In this Example, the X-ray source used was a magnesium anode
with an energy of 1253.6 eV. The samples were analyzed at a 45 degree
exit angle (approximately 5 to 10 nm sampling depth). The ESCA analysis
results are shown in Table 14. For ethanolamine-functionalized carbon
black, the surface was mainly composed of unreacted -COOH groups and
-C(=0)-OCH2CH2NH2 groups. To calculate the ratio of amine (y) to
carboxylic acid groups (x), a simple equation was used, specifically,
y/(x+y) = (N%/14)/(O%/32) for ethanolamine. The results are given in
Coupling of Amino-Functionalized Carbon Black with t-Boc-D21 -Peptide:
The amino-functionalized carbon black particles were then
covalently linked to the specific hair-binding peptide D21, given as SEQ ID
N0:46. The t-Boc protected D21 peptide was synthesized as described in
Example 10. Then, amino-functionalized carbon black (87 mg), t-Boc-
D21-peptide (80 mg) and dicyclohexyl carbodiimide (DCC) (22 mg) were
added to 3 ml of tetrahydrofuran (THF). A solution of
dimethylaminopyridine (DMAP) (17 \iL) in several drops of THF was
added dropwise to this mixture with stirring. The resulting dark
suspension was heated to 40 °C for 6 h with stirring, followed by stirring
overnight at room temperature. To remove the t-Boc protecting group
from the D21 peptide, trifluoroacetic acid (TFA) (0.6 ml_) was added to the
product and the mixture was stirred for another 6 h. Then, 5 ml_ of
deionized water was added to the reaction mixture. The mixture was
centrifuged at 3,500 rpm for 2 min and the supernatant was decanted.
The solid remaining in the centrifuge tube was washed with deionized
water and centrifuged again. This washing was repeated until the pH of
supernatant reached approximately 6.0. The dark residue was then dried
using a lyophilizer for 2 days, yielding a dark powder.
The amino-functionalized carbon black particles and the peptidelinked
carbon black particles were analyzed by ESCA, elemental analysis,
and TGA (thermogravimetric analysis). The analytical results showed that
the organic layer on the carbon black modified with ethanolamine was
approximately 12% of the total weight. After the D21 peptides were
attached to the carbon black particles, the peptide weight percentage was
in the range of 18 - 30%. Therefore, for a 100 nm carbon black particle, a
total of 9.5 x 104 molecules were attached to the surface after reacting
with ethanolamine, and a total of 7,700 D21 peptide molecules were
attached to the carbon black surface after reaction with the peptide. A
calculation of the peptide density on the carbon black surface, revealed
that each D21 peptide occupied 4 nm2, which is comparable to the peptide
density attached to the phage, approximately 12 nm2.
83
EXAMPLE 15
Specificity of the Peptide-Based-Carbon Black Hair Colorant
The purpose of this Example was to demonstrate the specificity of
the D21 peptide-carbon black hair colorant.
The D21 peptide-based-carbon black colorant was prepared as
described in Example 14.
A piece of pig skin (10 cm x 10 cm), obtained from a local
supermarket, was cleaned by mixing with 30 ml_ of 30% isopropanol for 10
min and then washed at least 5 times with distilled water. After drying in
air, the cleaned pig skin was immersed in a plate holder with multiple wells
containing a solution of 50 mg of the D21 peptide-carbon black colorant
dissolved in 10 mL of distilled water. After applying the colorant for 15
min, the pig skin was washed three times with a 30% shampoo solution
(Pantene Pro-V shampoo) by dropping the shampoo solution into the wells
and decanting it. Then, the pig skin was rinsed 5 times with distilled water.
A normal white hair sample, obtained from International Hair *
Importers and Products (Bellerose, NY), was treated in the same manner
as the pig skin.
After washing, the pig skin showed negligible dark color, while the
hair was very light black. These results demonstrate that the D21 peptidecarbon
black colorant has specific binding to hair, but not to skin.
EXAMPLE 16
Preparation of a Peptide-Polvsiloxane Hair Conditioner
The purpose of this Example was to synthesize a D21 peptidepolysiloxane
hair conditioner. The reactive side functional groups of the
D21 peptide, given as SEQ ID N0:46, were fully protected so that the
reaction with the polysiloxane proceeded only with the C-terminal group of
the peptide. In addition, a tripeptide spacer, consisting of glycine
residues, was added to the C-terminal end of the binding sequence.
Fifty milligrams of the fully protected D21 peptide Fmoc-
R(Pbf)T(tBu)N(Trt)AAD(OtBu)H(Trt)PAAVT(tBu)GGG (where Fmoc means
fluorenylmethoxylcarbonyl; Pbf means 2,2,6,4,7-
pentamethyldihydrobenzofuran-5-sulfonyl; tBu means t-butyl; Trt means
trityl; and Otbu means t-butoxyl) (MW2522, 0.02 mmol, 95% purity from
SynPep, Dublin, CA), given as SEQ ID NO:78 was dissolved in 1 mL of
dimethyformamide (DMF, from E. Merck, Darmstadt, Germany) in a 5 ml
round bottom flask. Polysiloxane fluid 2-8566 (77 mg) (N%=0.875%,
0.024 mmol of-NHa, from Dow Corning, Midland, Ml) was dissolved in 2
mL of THF (E. Merck) in a sample vial, then transferred into the round
bottom flask containing the peptide solution. Then, 5 mg of dicyclohexyl
carbodiimide (DCC, 0.024 mmol) and 5 jiL of dimethylaminopyridine
(DMAP) were added to the flask. The flask was sealed with a rubber
stopper and the reaction mixture was stirred at 50 °C for 5 h and then, at
room temperature overnight. After the reaction was completed, the
solvent was pumped out under vacuum. After drying, 122 mg of the solid
product was obtained. The yield was about 90%.
The solid product was dissolved in N, N-dimethylacetamide (DMAC,
from EMD Chemicals) and 5 mg/mL of the product solution in DMAC was
prepared for GPC (gel permeation chromatography) analysis with
refractive index detection to determine the molecular weight. The original
polysiloxane (Dow Corning 2-8566) was not soluble in DMAC and was not
observed in the separation region of the chromatogram. The D21 peptide
had a sharp, low molecular weight peak, and the product sample
contained 2 peaks, one from the free D21 peptide and a broad peak,
which was attributed to polysiloxane grafted with D21 peptide. The
weight-average molecular weight (Mw) was calculated from
polymethylmethacrylate (PMMA) standards. The Mw of D21 peptide and
the peptide-polysiloxane conditioner were 4.7x103, and 4.4x104,
respectively.
A cleavage reagent (referred to as Reagent K) having the following
composition:
trifluoroaceticacid/H2O/thioanisole/ethanedithiol/phenoI (85:5:5:2.5:2.5,
by volume) was used to cleave the protecting groups from the side
functional groups of the D21 peptide. Reagent K (1 mL) was pre-cooled to
-20 °C and then, added to 100 mg of the D21 peptide-polysiloxane
conditioner. The mixture was stirred for 3-4 h at room temperature and
then Reagent K was removed under high vacuum. Then, the Fmoc
protecting group was removed from the N-terminus of the peptide by
adding 61.2 mg of 20 vol % piperidine in DMF to the mixture and stirring
for 30 min, followed by pumping under high vacuum. The final product
was not completely soluble in THF, DMF, or DMAC. GPC analysis of the
final product was not possible because of the low solubility.
EXAMPLE.17
Effectiveness of Peptide-Based Hair Conditioner
The purpose of this Example was to demonstrate the effectiveness
of a peptide-based hair conditioner in reducing frictional forces in human
hair fibers and to compare its performance against a commercial
conditioning agent. Fiber friction is a significant contributor to combing
behavior of hair fiber assemblies (i.e., multiple fibers). The single hair fiber
characterization of frictional forces can be related to the combing behavior
of the hair assembly. Interfiber friction studies illustrate the improvement
to the hair surface from conditioner applications. The lower the interfiber
friction, the smoother the hair looks and feels, and the easier it is to comb.
The interfiber friction measurement method employed in this Example is
one of a few hair fiber tests to give hard, quantitative data and is generally
accepted in the industry.
The peptide-based hair conditioner described in Example 12, which
consists of the hair-binding peptide given as SEQ ID NO:46 covalently
linked to behenyl alcohol, was used in a formulation consisting of a mixture
of 0.25% by weight of the peptide-based conditioner and 1.5% by weight
of Performix™ Lecithin (ADM Lecithin, Decatur. IL) in distilled water. The
aqueous solution was mixed at 7000 rpm for 4 min using a Silverson
L4RT-A High Shear Laboratory Mixer (Silverson Machines, Inc., East
Longmeadow, MA) with a general purpose disintegrating head and a 0.95
cm mini-micro tubular frame. A 0.5% solution of Dow Corning 929
Cationic Emulsion (Dow Corning Corp., Midland, Ml), a commercial
conditioning agent, in distilled water was prepared using identical mixing
conditions.
86
European dark brown hair swatches (International Hair Importers
and Products) were cleaned before testing by immersing in isopropanol for
30 min, then washing 10 times with distilled water. Single hair fibers from
these swatches were sent to Textile Research Institute (TRI), Princeton,
NJ, for friction testing. At TRI, the hair fibers were immersed in the
conditioner solutions for 5 min at approximately 35 °C without agitation.
Afterwards, they were rinsed for 1 min in lukewarm water and then dried
overnight at 21 °C and 65% relative humidity.
Frictional force measurements of treated hair fibers were measured
by the Interfiber friction test using a single-fiber friction apparatus, as
described by Kamath et al. (J. Appl. Polymer Sci., 85:394-414 (2002)).
Hair fibers were evaluated at high normal forces (high load) (0.74 g)
against a chromed steel wire, crosshead speed of 1 mm/min, using an
Instron Tensile Testing machine. Low normal forces (low load) (8.5 mg)
were measured against another single hair fiber using the TRI/Scan™
Surface Force Analyzer (Textile Research Institute). This apparatus"
measures small forces with a Cahn® microbalance (mass resolution of 0.1
mg) and features a computer controlled stage. The results of these
measurements are given in Table 15.
The peptide-based conditioner had a lower average friction than the
Dow Corning 929 Cationic Emulsion conditioner in both cases.
Subsequently, a conditioning sample of 1.5% lecithin was tested for fiber
friction (low load) and the average mean frictional force was 3.366 mg,
indicating that the conditioning effects observed with the peptide-based
conditioner was not due to the presence of the lecithin in the formulation.
These results demonstrate the effectiveness of the peptide-based hair
conditioner.
EXAMPLE 18
Preparation of a Peptide-Based Hair Colorant
The purpose of this Example was to prepare a peptide-based hair
colorant by covalently attaching the D21 hair-binding peptide (SEQ ID
NO:46) to Disperse Orange 3 dye. The dye was first functionalized with
isocyanate and then reacted with the D21 peptide.
Functionalization of Disperse Orange 3:
In a dry box, 14.25 g of Disperse Orange 3 (Aldrich) was
suspended in 400 ml of dry THF in an addition funnel. A 2-liter, four-neck
reaction flask (Corning Inc., Corning, NY; part no. 1533-12), containing a
magnetic stir bar, was charged with 200 ml of dry toluene. The flask was
fitted with a cold finger condenser (Corning Inc., part no. 1209-04) and
with a second cold finger condenser with an addition funnel, and was
placed on an oil bath in a hood.
Phosgene (25.4 ml_) was condensed into the reaction flask at room
temperature. After phosgene addition was complete, the temperature of
the oil bath was raised to 80 °C and the Disperse Orange 3 suspension
was added to the reaction flask dropwise in 100 ml increments over 2 h,
while monitoring the reaction temperature and gas discharge from the
scrubber. The temperature was maintained at or below 64 °C throughout
the addition. After addition was complete, the reactants were heated at 64
°C for 1 h and then allowed to cool to room temperature with stirring
overnight.
The reaction solvents were vacuum-distilled to dryness, while
maintaining the contents at or below 40 °C, and vacuum was maintained
for an additional hour. The reaction flask was transferred to a dry box; the
product was collected and dried overnight (15.65 g). The desired product
was confirmed by proton NMR.
Coupling of Isocvanate Functionalized Dve with D21 Hair-Binding Peptide:
Isocyanate functionalized Disperse Orange 3 [(2-(4-
isocyantophenyl)-1-(4-nitrophenyl)diazene ](16mg), prepared as described
above, was dissolved in 5 ml of DMF and added to a solution containing
75 mg of non-protected D21 peptide (SEQ ID N0:46), obtained from
SynPep, dissolved in 10 mL of DMF. The solution was stirred at room
temperature for 24 h. The solvent was evaporated yielding 91 mg of a
purplish powder. The product was analyzed by MALDI mass spectrometry
and was found to have a molecular weight of 1766 g/mol, consistent with
covalent attachment of the dye molecule to the peptide.
EXAMPLE 19
Selection of Tooth-Binding Peptides Using Biopanning
The purpose of this prophetic Example is to describe how to identify
phage peptides that bind to teeth with high affinity.
Extracted human teeth, which may be obtained from a Dental
Office, are cleaned by brushing with soap solution, rinsed with deionized
water, and allowed to air-dry at room temperature. The teeth are placed in
a 15 mL centrifuge tube (Corning Inc., Acton, MA), one tooth per tube.
The teeth samples are treated for 1 h with blocking buffer consisting of 1
mg/mL BSA in TBST-0.5%, and then washed with TBST-0.5%. The teeth
samples are incubated with the phage library (Ph.D-12 Phage Display
Peptide Library Kit) and washed 10 times using the same conditions
described in Example 1. After the acidic elution step, described in
Example 1, the teeth samples are washed three more times with the
elution buffer and then washed three times with TBST-0.5%. The acidtreated
teeth, which have acid resistant phage peptides still attached, are
used to directly infect E. coli ER2738 cells as described in Example 2. The
amplified and isolated phages are contacted with a fresh tooth sample and
the biopanning procedure is repeated two more times. After the third
round of biopanning, the acid-treated teeth are used to directly infect E.
coli ER2738 cells, and the cells are cultured as described in Example 1.
Single black plaques are randomly picked for DNA isolation and sequence
analysis. The single plaque lysates are prepared following the
manufacture's instructions (New England Biolabs) and the single stranded
phage genomic DNA is purified using the QIAprep Spin M13 Kit (Qiagen,
Valencia, CA) and sequenced using -96 gill sequencing primer, as
described in Example 1.
The identified peptide sequences will have a binding affinity for
teeth. The binding specificity and affinity of the identified tooth-binding
peptides is determined as described in Example 6.
EXAMPLE 20
Preparation of a Peptide-Based Tooth Whitener
The purpose of this prophetic Example is to describe how to
prepare a peptide-based tooth whitener by coupling a tooth-binding
peptide to the white pigment, titanium dioxide.
Dry titanium dioxide having an average particle size less than 2 urn
(available from E.I. du Pont de Nemours and Co., Wilmington, DE) is
treated with a solution of 3-aminopropyltriethoxysilane (available from
Aldrich) in dry acetone to covalently attach amino groups to the surface of
the titanium dioxide. The excess reagent is removed by decantation after
centrifuging to settle out the particles. The resultant particles are then
treated with sufficient glutaraldehyde (available from Sigma Chemical Co.)
to react with the surface attached amino groups.
A tooth binding peptide, identified using the method described in
Example 19, is obtained from SynPep. The tooth-binding peptide
sequence is terminated with 1-5 lysine residues at the C terminus. The
tooth-binding peptide is then added to the glutaraldehyde-treated titanium
dioxide particles and is covalently coupled to the pendant free aldehyde
groups on glutaraldehyde through an amine group on the peptide.

We claim:
1. A diblock, peptide-based hair colorant having the general structure (HBP)n - C,
wherein
a) HBP is a hair-binding peptide;
b) C is a coloring agent; and
c) n ranges from 1 to about 10,000.
2. A triblock, peptide-based hair colorant having the general structure [(HBP)m - S]n - C,
wherein
a) HBP is a hair-binding peptide;
b) C is a coloring agent;
c) S is a spacer;
d) m ranges from 1 to about 50; and
e) n ranges from 1 to about 10,000.

3. A colorant according to any one of claims 1 or 2, wherein the hair binding peptide is from about 7 to about 25 amino acids and has a binding affinity for hair, measured as MB50, equal to or less than 10-5 M.
4. The peptide-based hair colorant of any of claims 1 or 2, wherein the hair-binding peptide has the amino acid sequence selected from the group consisting of SEQ ID NOs:l, 3-59, 64, 66, 69, 70, 76-97 and 98.
5. The peptide-based hair colorant of Claim 1 or 2, wherein the coloring agent is selected from the group consisting of 4-hydroxypropylamino-3-mtrophenol, 4-amino-3-nitrophenol, 2-amino-6-chloro-4-nitrophenol, 2-nitro-paraphenylenediamine, N,N-hydroxyethyl-2-nitro-phenylenediamine, 4-nitro-indole, Henna, HC Blue 1, HC Blue 2, HC Yellow 4, HC Red 3, HC Red 5, Disperse Violet 4, Disperse Black 9, HC Blue 7, HC Blue 12, HC Yellow 2, HC Yellow 6, HC Yellow 8, HC Yellow 12, HC Brown 2, D&C Yellow 1, D&C Yellow 3, D&C Blue 1, Disperse Blue 3, Disperse violet 1, eosin derivatives such as D&C Red No. 21 and halogenated fluorescein derivatives such as D&C Red No. 27, D&C Red Orange No. 5 in combination with D&C Red No. 21 and D&C Orange No. 10; and pigments, such as D&C Red No. 36 and D&C Orange No. 17, the calcium lakes of D&C Red Nos. 7, 11, 31 and 34, the barium lake of D&C Red No. 12, the strontium lake of D&C Red No. 13, the aluminum lakes of FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27, of D&C Red No. 21, and of FD&C Blue No. 1, iron oxides, manganese violet, chromium oxide, titanium dioxide,

titanium dioxide nanoparticles, zinc oxide, barium oxide, ultramarine blue, bismuth citrate, and carbon black particles,metal nanoparticles, and semiconductor nanoparticles.

Documents:

1297-DELNP-2007-Abstract-(15-06-2011).pdf

1297-DELNP-2007-Abstract-(28-02-2012).pdf

1297-delnp-2007-abstract.pdf

1297-delnp-2007-assignment.pdf

1297-DELNP-2007-Claims-(15-06-2011).pdf

1297-DELNP-2007-Claims-(28-02-2012).pdf

1297-delnp-2007-claims.pdf

1297-DELNP-2007-Correspondence Others-(15-06-2011).pdf

1297-DELNP-2007-Correspondence Others-(28-02-2012).pdf

1297-delnp-2007-correspondence-others 1.pdf

1297-DELNP-2007-Correspondence-Others.pdf

1297-DELNP-2007-Description (Complete)-(15-06-2011).pdf

1297-delnp-2007-description (complete).pdf

1297-DELNP-2007-Form-1-(15-06-2011).pdf

1297-delnp-2007-form-1.pdf

1297-delnp-2007-form-18.pdf

1297-DELNP-2007-Form-2-(15-06-2011).pdf

1297-delnp-2007-form-2.pdf

1297-DELNP-2007-Form-3-(15-06-2011).pdf

1297-DELNP-2007-Form-3-(28-02-2012).pdf

1297-DELNP-2007-Form-3.pdf

1297-delnp-2007-form-5.pdf

1297-DELNP-2007-GPA-(15-06-2011).pdf

1297-DELNP-2007-GPA.pdf

1297-delnp-2007-pct-101.pdf

1297-delnp-2007-pct-210.pdf

1297-delnp-2007-pct-220.pdf

1297-DELNP-2007-PCT-237.pdf

1297-delnp-2007-pct-326.pdf

1297-delnp-2007-pct-373.pdf

1297-delnp-2007-pct-notification.pdf

1297-DELNP-2007-Petition-137-(15-06-2011).pdf

« Previous Patent

Next Patent »

Patent Number

251696

Indian Patent Application Number

1297/DELNP/2007

PG Journal Number

13/2012

Publication Date

30-Mar-2012

Grant Date

28-Mar-2012

Date of Filing

19-Feb-2007

Name of Patentee

E.I.DU PONT DE NEMOURS AND COMPANY

Applicant Address

1007 MARKET STREET, WILMINGTON, DELAWARE 19898, USA

Inventors:

#	Inventor's Name	Inventor's Address
1	XUEYING HUANG	204 CHERRY BLOSSOM PLACE, HOCKESSIN, DELAWARE 19707, USA
2	JOHN P.O'BRIEN	971 SAGINAW ROAD, OXFORD, PENNSYLVANIA 19363, USA
3	HONG WANG	605 KAZIO COURT, KENNETT SQUARE, PENNSYLVANIA 19348, USA
4	YING WU	717 SCOTT LANE, WALLINGFORD PENNSYLVANIA 19806, USA

PCT International Classification Number

A61K 6/00

PCT International Application Number

PCT/US2005/007928

PCT International Filing date

2005-03-08

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1	10/935,642	2004-09-07	U.S.A.