Title of Invention	"SYNTHETIC GENE ENCODING CRY1FA1 DELTA - ENDOTOXIN OF BACILLUS THURINGIENSIS"
Abstract	The present invention is about a synthetic crylFal gene for developing an insect resistant transgenic plant and which is modified for high level transcription, increased RNA stability and high level expression in higher plants. The modified gene is comprised of a synthetic DNA sequence SEQ.ID:2, coding for an insecticidal Bacillus thuiringiensis delta-endotoxin CrylFal protein.

Full Text

4. DESCRIPTION Field of the Invention This invention relates to the field of plant molecular biology, and in particular, to genetic engineering for the purpose of protecting plants from insect pests. More particularly, it concerns a synthetic gene encoding CrylFal δ-endotoxin of Bacillus thuringiensis. A method for using the synthetic chimeric S-endotoxin in the development of transgenic tobacco and brinjal plants, which express insecticidal activity against lepidopteran pests, is disclosed. Background of invention The insecticidal bacterium Bacillus thuringiensis (Bt) is the most commercially successful biological control agent of insect pests (Glare and O'Callaghan, 2000). Bt is a Gram-positive, aerobic, endospore-forming bacterium, recognized by its parasporal body (known as the crystal) that is proteinaceous in nature and possesses insecticidal properties, which are attributed to the presence of 5-endotoxins that are synthesized during the sporulation phase (Kumar et al., 1996). 5-endotoxin or crystal toxin is a multi-domain protein molecule comprising of three distinct domains To date, more than 140 different genes encoding crystal proteins have been cloned from various Bt strains (http://www.biols.susx.ac.uk/Home/Neil Crickmore/Bt/). The classification and nomenclature of Bt toxins have been recently described (Crickmore et al., 1998). Bt 5-endotoxins are comprised of three distinct domains. Domain I is made of seven α-helices, domain II comprises three antiparallel ß sheets, which are folded into loops and domain III is made of a ß sandwich of two antiparallel ß strands. Molecular studies on the structure and functional properties of different 5-endotoxins revealed that the domain I by virtue of its membrane spanning hydrophobic and amphipathic a-helices is capable of forming pores in the cell membranes of the larval midgut. Domain II being hyper variable in nature determines the insecticidal specificity of a toxin and domain III is involved in varied functions like structural stability, ion channel gating, binding to Brush Border Membrane Vesicles and insecticidal specificity. Recent studies on toxin aggregation and interaction revealed that the three domains interact closely to bring about the insecticidal activity of Bt (Saraswathy and Kumar, 2004). The most effective delivery system of Bt toxins for the management of insect pests is the transgenic plant. The first Bt-transgenic plants were made in 1987 (Kumar, 2003)). The plants expressed full-length or truncated Bt toxin genes (crylA) under the control of constitutive promoters. The expression of the toxin protein was very poor in the tobacco plants and the mortality of M sexta larvae was only 20%. Truncated crylA genes coding for the toxic N-terminal fragment provided better protection to the tobacco and tomato plants. When compared to the plants transformed with full-length genes, the plants expressing truncated genes were more resistant to the larvae, and the highest reported level of toxin protein expression was about 0.02% of total leaf-soluble protein. Despite these low levels of expression, many of the plants were shown to be insecticidal to the larvae of M. sexta. However, many of the noctuid lepidopterans, which constitute a very serious group of insect pests, need higher amounts of Bt toxins for effective control. Gene truncation as well as the use of different promoters, enhancer sequences, and fusion proteins resulted in only limited improvement in Bt gene expression (Vaeck et al., 1987). Significant advancement in the expression of Bt genes in plants was made in 1990 (Perlak et al., 1990). It was noticed that Bt genes were excessively AT rich in comparison with normal plant genes. This bias in nucleotide composition of the DNA could have a number of deleterious consequences to gene expression because AT-rich regions in plants are often found in introns or have a regulatory role in determining polyadenylation. There are also instances in other eukaryotic systems in which AT-rich regions can signal rapid degradation of specific mRNAs. In addition, plants have a tendency to use G or C in the third base of redundant codons - A or T being rarer. Bt genes have the opposite tendency and because codon preference is thought to be linked to the abundance of the corresponding tRNAs, the overuse of rare codons would decrease the rate of synthesis of a Bt protein in plant cells. Based on the above considerations, a large number of modified and synthetic Bt genes have been generated for the management of insect pests in various plant species (Perlak et al., 1991; EP 0359472, 1990; EP 0385962, 1990; EP 0431829, 1991; USP 5,380,831, 1995). Summary of the invention: The objective of the present invention is to provide a means for plant protection against damage by insect pests. The invention disclosed herein comprises a chemically synthesized crylFal gene encoding an insecticidal protein (8-endotoxin). In designing synthetic Bt gene of this invention for enhanced expression of plants, the DNA sequences of the native Bt structural gene crylFal was modified in order to increase transcription by reducing nucleosome packaging and contain codons preferred by highly expressed plant genes, to attain an A+T content in nucleotide base composition substantially that found in plants, and to eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA and to avoid sequences that constitute RNA splice sites. In the synthetic gene codons used to specify a given amino acid were selected with regard to the distribution frequency of codon usage employed a highly expressed plant genes to specify that amino acid. Consideration was given to the percentage G+C content of the degenerate third base. In addition the synthetic crylFalgene designed in the present invention consist of only 1851 base pairs while native while native gene isolated from Bacillus thuringiensis is around 3600 base pair. The crylFal gene was designed in silico for enhanced expression in plants of the specific embodiment was synthesized in six fragments and the fragments were assembled within a DNA plasmid vector. The synthetic crylFal gene was then introduced into a tobacco and brinjal plant and expressed by employing Agrobacterium tumefaciens. The insecticidal protein produced upon expression of the synthetic crylFal gene in tobacco plants expreseed at higher level than the native crylFal exhibited higher toxicity to Tobacco caterpillar. Similarly in transgenic brinjal plants synthetic crylFal expressed at substantially higher level and provided more protection in comparison to native crylFal gene. Detailed Description of the Invention The S-endotoxins of Cryl class are specific to Lepidopteran pests (Schnepf et al., 1998). Many genes encoding Cryl class S-endotoxins are cloned and characterized (Table 1). Among the available 8-endotoxins, CrylAa and CrylAc are highly active against Lepidopteran pests such as Cotton bollworm (Helicoverpa armigera) and CrylFal is active against Tobacco caterpillar (Spodoptera litura) (Chakrabarti et al., 1998a). These two insect species are serious pests on cotton in India (Atwal, 1976). We observed an interesting synergism between CrylAc and CrylFal against H. armigera (Chakrabarti et al., 1998b). We envisaged construction of a gene that confers toxicity to Tobacco caterpillar (Spodoptera litura) and brinjal fruit and shoot borer {Leucinodes orbonalis). A synthetic gene encoding 8-endotoxin CrylFal was designed. The 5-endotoxin protein is 616 amino acids in length (Figure 1, SEQ IDNO.l). Table 1. List of Cryl class gene sequences (NCBI) available: (Table Removed) In the present invention synthetic DNA sequence of SEQ ID NO: 2, coding for insecticidal delta-endotoxin CrylFal protein of Bacillus thuringiensis having a nucleotide composition of A: 26.85%, C: 24.37%, G: 21.66% and T: 27.12%, while native crylFal used by Chakrabarti et al. (1998) and Lee et al. (1996) has a nucleotide composition of A: 31.7%, C: 16.72%, G: 20.89%, T: 30.68% (Figure 2) was designed. Alterations were made in the native crylFal sequence and the modifications in the base pair were such to bring about enhanced expression of protein in plant which in achieved by increased transcription, improved RNA stability, low nucleosome packaging all of which resulted in enhanced insecticidal protein production (Figure 2-3, Table 2). In designing synthetic Bt gene of this invention for enhanced expression in plants, the DNA sequences of the native Bt 8-endotoxin gene crylFal was modified in order to contain codons preferred by highly expressed plant genes to attain an A+T content in nucleotide base composition substantially as that found in plants, and to eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA and to avoid sequences that constitute RNA splice sites (Table 2). The synthetic crylFal gene developed in the present invention shows only 87 present sequence similarity with the native crylFal gene (Figure 3) and shows substantially low nucleosome packaging than the native crylFal gene (Figure 4). Table 2: Comparative analysis of native and synthetic crylFal genes sequences. The synthetic sequence was designed to remove polyA and splicing signals, and have reduced number of mRNA destabilizing sequences. (Table Removed) *Common poly A signal AATAAA and its less frequently used variants such as AATGAA, AATATT, GAT AAA, AATTAA and AATAAT, were analyzed. The synthetic gene (1851 bp long) encoding CrylFal 5-endotoxin was constructed and the nucleotide sequence of the gene is given in Figure 2 (SEQ ID NO. 2). The strategy followed for the construction of the synthetic gene was as follows: Six DNA fragments carrying convenient restriction sites at 5' end and 3' end were synthesized and used to assemble a gene of 1851 base pairs in length. The lengths of the respective DNA fragments are indicated in Table 3. The restriction sites, which were included at both the ends of the synthetic DNA fragments, are also given in Table 2. The DNA fragments were cut with respective restriction enzymes and ligated using T4 DNA ligase. The assembly of the gene was performed in the E. coli vector pET 29A(+) (Novagen). All the manipulations were carried out according to established procedures (Sambrook and Russel, 2001). After the assembly is complete the length of the nucleotide sequence is 1851 bp. Table 3. The lengths and restriction sites present at 5' and 3' ends of the synthetic DNA fragments. (Table Removed) The nucleotide sequences of the six synthetic DNA fragments are: SEQ ID NO: 3 XbaI TCTAGA ATG GAG AAC AAC ATC CAG AAT CAA TGC GTC CCT TAC AAC TGC TTA AAT AAC CCT GAA GTC GAA ATC TTG AAC GAA GAA AGA AGC ACC GGC AGG TTG CCG TTA GAT ATC TCC TTG TCG CTT ACC CGC TTC CTT TTG TCT GAG TTC GTT CCA GGA GTG GGA GTG GCG TTT GGC CTG TTC GAC TTG ATC TGG GGT TTC ATA ACG CCA TCT GAT TGG AGC CTG TTT CTC TTG CAG ATT GAA CAA CTG ATT GAG CAA AGA ATA GAA ACC TTG GAA AGG AAC CGC GCT ATT ACC ACT CTC CGG GGG CTA GC Nhel SEQ ID NO 4: Nhel GCTAGCA GAT TCC TAT GAG ATT TAT ATT GAG GCA CTT AGA GAG TGG GAA GCC AAT CCT AAC AAT GCA CAG CTA AGG GAA GAT GTG CGC ATT CGT TTT GCT AAT ACC GAT GAC GCT CTA ATA ACT GCC ATT AAC AAT TTT ACG CTT ACA AGC TTT GAG ATC CCA CTT TTG TCA GTC TAT GTT CAA GCT GCC AAT TTG CAT CTC TCA CTA CTT AGG GAC GCT GTG TCG TTT GGG CAG GGT TGG GGA CTG GAC ATA GCT ACT GTT AAC AAT CAC TAC AAT CGA T Clal SEQ ID NO 5:: Cla I ATCGATTA ATC AAC CTT ATT CAC AGA TAT ACG AAA CAC TGT TTG GAC ACA TAC AAT CAA GGC CTC GAG AAC TTA AGA GGT ACT AAT ACT CGA CAA TGG GCC AGA TTC AAT CAG TTT AGG AGA GAT CTC ACA CTC ACT GTA CTT GAT ATC GTG GCT CTT TTC CCG AAC TAC GAT GTT AGA ACC TAT CCA ATT CAA ACC TCA TCC CAA TTG ACC AGG GAG ATT TAC ACT AGT TCA GTC ATT GAG GAC TCC CCA GTG TCT GCT AAC ATA CCT AAT GGT TTC AAC AGG GCT GAA TTC Eco RI SEQ ID NO 6: Eco RI GAATTCGGA GTT CGA CCA CCC CAT CTT ATG GAC TTT ATG AAC TCT TTG TTC GTA ACT GCT GAG ACT GTG AGG TCT CAA ACT GTC TGG GGA GGA CAC CTA GTT AGC TCA CGT AAT ACC GCC GGT AAC CGT ATC AAC TTC CCT AGC TAC GGG GTG TTC AAT CCT GGT GGA GCC ATT TGG ATT GCA GAC GAA GAT CCA CGT CCT TTC TAT CGG ACA TTG TCA GAT CCA GTG TTT GTG CGT GGA GGA TTT GGC AAT CCT CAT TAT GTA CTG GGG CTT AGG GGA GTT GCC TTC CAA CAA ACT GGT ACC AAC CAC ACC CGT ACA TTC AGA AAC TCT GGG ACC ATA GAT TCT CTC GAT GAA ATT CCG CCT CAG GAT AAC AGT GGT GCC CCA TGG Nco I SEQ ID NO 7: Nco I CCATGG AAT GAC TAC AGT CAT GTG CTC AAT CAC GTT ACC TTT GTC CGC TGG CCA GGT GAG ATC TCC GGC AGT GAT TCA TGG CGA GCT CCA ATG TTT TCT TGG ACC CAC CGT AGT GCC ACC CCT ACA AAT ACA ATT GAT CCA GAG AGG ATT ACT CAA ATA CCA CTC GTC AAG GCA CAT ACA CTT CAG TCC GGT ACT ACT GTT GTT AGA GGA CCC GGA TTC ACG GGA GGA GAC ATT CTT CGT CGT ACA AGT GGA GGA CCC TTT GCT TAC ACT ATC GTT AAC ATC AAT GGC CAA CTC CCT CAA AGG TAC C Kpn I SEQ ID NO 8: Kpn I GGTACCGT GCA AGA ATA CGC TAT GCC TCA ACT ACA AAC CTA AGA ATT TAC GTT ACC GTT GCA GGT GAG AGG ATC TTC GCT GGT CAA TTT AAC AAA ACA ATG GAT ACC GGT GAT CCC TTA ACA TTC CAG TCT TTT AGC TAC GCA ACT ATC AAC ACA GCT TTC ACA TTC CCC ATG AGC CAG TCC AGC TTC ACC GTT GGT GCC GAT ACT TTT TCC TCT GGC AAT GAG GTT TAT ATT GAC AGA TTT GAA TTG ATC CCA GTT ACT GCA ACA TTC GAG GCA GAA TAC GAC TTA GAA AGA GCT CAG AAG GCG TAG GGATCC Bam HI The fragments were assembled in a plasmid vector pET 29A(+) and sequence-verified. Polyadenylation signals: The synthetic gene sequence does not carry polyadenylation signals such as AATAAA and AATAAT (major plant consensus sites) (Dean, 1996). Codon usage: Synthetic chimeric gene was designed for higher plant codon usage (Murray et al., 1989). Table 4.Codon Usage in Synthetic crylFal gene (Table Removed) Polymerase II termination sequence: The synthetic gene does not have the polymerase II termination sequence CAN7.9AGTNNAA. II. Constitution of recombinant vector containing the synthetic crylFal gene: The synthetic crylFal gene was restricted out of plasmid vector pET 29A(+) and cloned in a binary plant transformation vector pBinAR (Hofgen and Wilmitzer), a derivative of Bin 19 (Bevan 1984). The gene was cloned as Xba\-Sal\ insert downstream of Cauliflower mosaic virus 35 S (CaMV 35S) promoter and upstream of Octopine syttnthase (OCS) terminator sequences. The plasmid map of the recombinant binary vector is shown in Figure 5. The vector also caries neomycin phosphotransferase (npt II) gene (from E. coli transposon Tn5) under the control of Agrobacterium Nopaline synthase (NOS) promoter. The final size of the binary vector is 1380 bp. The vector is named as pBinBt9. The gene can also be inserted in other plant transformation vectors such as pBI121 (Chen et al., 2003), pZP (Hajdukiewicz et al., 1994) and pCAMBIA (www.cambia.org). III. Transformation: The recombinant binary vector pBinBt9 was transferred to Agrobacterium tumefaciens host strain LBA 4404 (Hoekema et al. 1983) by Freeze-Thaw technique of Hofgen and Wilmitzer (1988). The host strain carries helper plasmid pAL4404. The recombinant A tumefaciens is named as LBA 4404-Bt9. The vector can also be mobilized into other host strains of A. tumefaciens such as A 281, EH A 101, EHA 105, GV 3060 etc. The vector can also be mobilized into host strains by other methods such as triparental mating, electroporation etc., IV. Transformation of tobacco: Tobacco (Nicotiana tabacum var. Petit Havana SR-1) was transformed by Leaf disc method as described by Horsch et al., (1984). Tobacco leaf discs were infected and co-cultivated with A. tumefaciens LBA 4404-Bt9 for 24 hours and regenerated on selection medium (MS medium; Murashige and Skoog, 1962) containing Benzyladenine (2.0 mg/L), Naphthalene acetic acid (0.01 mg/L), Kanamycin (300 mg/L) and Cefotaxime (500 mg/L). The putative transformants were rooted on MS medium without hormones and containing Kanamycin (100 mg/L) and Cefotaxime (300 mg/L). Twenty transgenic plants were generated and grown in pots in a glass house. Transgenic plants were analyzed by polymerase chain reaction (PCR) technique (Nain et al., 2005). PCR was performed to detect the presence of npt 11 and crylFal gene in the transgenic plants. The sequences of the primers used are: Npt II: SEQ ID NO: 11: Forward: 5'- CCCCTCGGTATCCAATTAGAG-3' SEQ ID NO: 12: Reverse: 5'- CGGGGGTGGGCGAAGAACTCCAG-3' crylFal gene: SEQ ID NO: 13: Forward: 5'- GGAGTGGGAGTGGCGTTTGGCCTG -3' SEQ ID NO: 14: Reverse: 5' - CCAGTTTGTTGGAAGGCAACTCCC -3' PCR of genomic DNA from transgenic tobacco plants exhibited amplicon sizes of 693 bp for npt II and 1000 bp for crylFal gene. Full sequence of npt II and partial sequence of crylFal genes were amplified by PCR. Genetic transformation of tobacco can also be performed by alternate techniques such as particle bombardment, uptake of DNA by tobacco protoplasts, electroporation of protoplasts etc., Transgenic tobacco plants were further analyzed for gene integration and copy number by Southern hybridization technique (Sambrook and Russell, 2001). The crylFal gene insert (Xba I - BamHl) of 1851 bp was used as a probe after radiolabelling with α-32P-dCTP. Ten out of twenty transgenic plants exhibited single copy integrations. These plants were analyzed for the expression of crylFalgene at mRNA level by employing RT-PCR technique. The level of mRNA expression was high in comparison native crylFal in all the plants tested (Figure 6). The expression of CrylFal protein in the transgenic plants (Single copy) was carried out by Double antibody sandwich ELISA (Enzyme-linked immunosorbant assay) technique (Clark et al., 1986). High levels of 8-endotoxin protein expression were observed in the leaves of transgenic tobacco plants. The expression of 5-endotoxin ranged from 0.005 to 0.38 % of leaf soluble protein Table 5. V. Insect bioassays of transgenic tobacco plants: Five transgenic plants (Single copy) and a normal tobacco plant were selected for the study. Leaf discs (2 cm diameter) were punched from rapidly growing leaves and insect bioassays were performed in 6-well culture plates (Greiner) with neonate and I instar larvae of S. lititra. One larva per well was released. There were ten replicates (Wells) for each plant. Observations were recorded 4 days after the release of larvae. The results of insect bioassays are given in Table 6 and Figure 7. The high mortality (82-100%) of the larvae on transgenic tobacco leaves pointed towards the utility of the CrylFal 5-endotoxin to manage & litura in transgenic crops. Table 5: Quantification of CrylFal protein as a fraction of total soluble protein in leaf tissues of 35S:crylFal transgenic brinjal plants. (Table Removed) Table 6: Mortality of the larvae of S. litura on the leaves of transgenic tobacco expressing crylFal 5-endotoxin gene. (Table Removed) VI. Transformation of brinjal: Genetic transformation of brinjal (Solarium melongena cv. Pusa Purple Long) was carried out by A. tumefaciens (LBA 4404-Bt8) according to Kumar et al., (1998). High levels (0.012 to 0.32 % of total soluble protein) of CrylFal expression were observed in the leaves of transgenic brinjal that is substantially higher than the native crylFal (Table 7.) Table 7: Quantification of CrylFal protein as a fraction of total soluble protein in leaf tissues of 35S::crylFal transgenic tobacco plants. (Table Removed) VII. Insect bioassays of transgenic brinjal plants: Leaves from crylFal transgenic brinjal plants were tested for protection against BFSB larvae. Transgenic brinjal plants expressing synthetic crylFal showed total protection while native crylFal could provide only partial protection against BFSB larvae (Figure 8.) Fruits collected from transgenic brinjals were bioassayed by releasing ten neonate larvae of BSFB per fruit. Fruits were cut open after eight days. The transgenic brinjal fruits expressing CrylFal were free of insect damage (Figure 9). References: Atwal, A. S. 1976. Agricultural pests of India and South-East Asia. Kalyani Publishers, New Delhi. Chakrabarti, S K, Mandaokar A, Kumar P A and Sharma R P 1998a. Journal of Invertebrate Pathology 72: 336-337. Chakrabarti, S K, Mandaokar A, Kumar P A and Sharma R P 1998b. Current Science 75: 663-664. Crickmore, N., Zeigler, D.R., Feitelson, J., Schnepf, E., Van Rie, J., Lereclus, D., Baum, J., and Dean, D. H., 1998, Microbiology and Molecular Biology Reviews. 62: 807-813. De Maagd, R. A., Bravo, A., and Crickmore, N. 2001. Trends in Genetics. 17: 193-199. Dean, C. 1986. Nucleic Acids Research. 14: 2229. Glare, T. R. and O'Callaghan, M. 2000. Bacillus thuringiensis: Biology, Ecology and Safety. Wiley, Chichester. Hofgen R. and Wilmitzer L. 1990. Plant Science 66: 221-230. Knight, J. S., Broadwell, A. H., Grant, W. N. and Shoemaker, C. B. 2004. Journal of Economic Entomology. 97: 1805-1809. Kumar P A 2003. In: Advances in Microbial Control of Insect Pests (Ed. R K Upadhyay), pp. 71-82, Kluwer Academic, New York. Kumar, P. A., Malik, V. S. and Sharma, R. P. 1996. Advances in Applied Microbiology 42:1-43. Murray, E E., Lotzer, J. and Eberle, M. 1989. Codon usage in plant genes, Nucleic Acids Res., 17:477-498. Naimov, S., Dikiandjiev, S. and de Maagd, R. A. 2003. Plant Biotechnology Journal. 1:51- 57. Nain, V., Jaiswal, R., Dalai, M., Ramesh, B. and Kumar, P. A. 2005. Plant Molecular Biology Reporter. 23: 59-65. Perlak et al., 1990 Perlak, F. J., Deaton, R. W., Armstrong, T. A., Fuchs, R. L., Sims, S. R., Greenplate, J. T., and Fischhoff, D. A., 1990. Bio/Technology. 8: 939-943. Perlak F.J, Fuchs R. L, Dean D. A, McPherson S. and Fischhoff D. A. 1991. Proceedings of National Academy of Sciences, USA. 88: 3324-3328. Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler, D. R., and Dean, D. H., 1998. Microbiology and Molecular Biology Reviews. 62: 775-806. Saraswathy N and Kumar P.A. 2004. Electronic Journal of Biotechnology. Vol 7, Issue 2. Vaeck, M., Reynaerts, A., Hofte, H., Jansens, S., De Beukeleer, M., Dean, C, Zabeau, M., Van Montagu, M., and Leemans, J., 1987. Nature. 328:33-37 I/We claim 1. A synthetic DNA sequence SEQ ID NO: 2, coding for an insecticidal delta-endotoxin CrylFal protein of Bacillus thuringiensis, modified for high level expression in plant system, and a. comprising nucleotide composition of A: 26.85%, C: 24.37%, G: 21.66% and T: 27.12%. b. modified for reduced nucleosome packaging for increased transcription c. minimized RNA destabilizing sequences for increased RNA stability d. removed polyadenylation signals for increased RNA stability e. removed splicing sites for increased RNA stability and f. codon optimization for high level expression in higher plants. 2. The synthetic gene as claimed in claim 1 wherein said sequence is linked to a conventional CaMV 35S promoter.

Documents:

2049-DEL-2006-Abstract (13-01-2010).pdf

2049-DEL-2006-Abstract-(11-08-2010).pdf

2049-del-2006-abstract.pdf

2049-DEL-2006-Claims (13-01-2010).pdf

2049-DEL-2006-Claims-(11-08-2010).pdf

2049-del-2006-claims.pdf

2049-DEL-2006-Correspondence-Others (13-01-2010).pdf

2049-DEL-2006-Correspondence-Others-(11-08-2010).pdf

2049-DEL-2006-Correspondence-Others-(27-07-2010).pdf

2049-DEL-2006-Description (Complete) (13-01-2010).pdf

2049-DEL-2006-Description (Complete)-(11-08-2010).pdf

2049-del-2006-description (complete).pdf

2049-DEL-2006-Drawings (13-01-2010).pdf

2049-DEL-2006-Drawings-(11-08-2010).pdf

2049-DEL-2006-Form-1 (13-01-2010).pdf

2049-del-2006-form-1.pdf

2049-DEL-2006-Form-13-(11-08-2010).pdf

2049-del-2006-form-18.pdf

2049-DEL-2006-Form-2 (13-01-2010).pdf

2049-DEL-2006-Form-2-(11-08-2010).pdf

2049-del-2006-form-2.pdf