Indian Patents
Title of Invention

AN ISOLATED POLYNUCLEOTIDE ENCODING A POLYPEPTIDE
Abstract N/A
Full Text FORM 2
THE PATENTS ACT, 1970
[39 OF 1970]
&
THE PATENTS RULES, 2003
COMPLETE SPECIFICATION
[See Section 10; rule 13]
"AN ISOLATED POLYNUCLEOTIDE ENCODING A POLYPEPTIDE"
SHIRE BIOCHEM INC., of 275 Armand-Frappier Boulevard, Laval, Quebec, Canada H7V 4A7
The following specification particularly describes the nature of the invention and the manner in which it is to be performed:-
WO 00/39299 PCT/CA99/01218

NOVEL STREPTOCOCCUS ANTIGENS
FIELD OF THE INVENTION
5 The present invention is related to antigens, more particularly protein antigens o£_ streptococcus^. Pneumoniaepathogen witch are useful as vaccine components for therapy and/or prophylaxis.
10 BACKGROUND OF THE INVENTION
S. pneumoniae is an important agent of disease in man especially among infants, the elderly and immunocompromised persons. It is a bacterium frequently isolated from
15 patients with invasive diseases such as
bacteraemia/septicaemia, pneumonia, meningitis with high morbidity and mortality throughout the world. Even with appropriate antibiotic therapy, pneumococcal infections still result in many deaths. Although the advent of
20 antimicrobial drugs has reduced the overall mortality from pneumococcal disease, the presence of resistant pneumococcal organisms has become a major problem in the world today. Effective pneumococcal vaccines could have a major impact on the morbidity and mortality associated with s. pneumoniae
25 disease. Such vaccines would also potentially be useful to prevent otitis media in infants and young children.
Efforts to develop a pneumococcal vaccine have generally concentrated on generating immune responses to the
30 pneumococcal capsular polysaccharide. More than 80
pneumococcal capsular serotypes have been identified on the basis of antigenic differences. The currently available pneumococcal vaccine, comprising 23 capsular polysaccharides
1

WO 00/39299

PCT/CA99/01218


that most frequently caused disease, has significant shortcomings related primarily to the poor immunogenicity of some capsular polysaccharides, the diversity of the serotypes and the differences in the distribution of
5 serotypes over time, geographic areas and age groups. In particular, the failure of existing vaccines and capsular conjugate vaccines currently in development to protect young children against all serotypes spurres evaluation of other S. pneumoniae components. Although immunogenicity of
10 capsular polysaccharides can be improved, serotype
specificity will still represent a major limitation of polysaccharide-based vaccines. The use of a antigenically ^ conserved immunogenic pneumococcal protein antigen, either by itself or in combination with additional components,
15 offers the possibility of a protein-based pneumococcal vaccine.
PCT Publication number WO98/18930 published may 7 1998 entitled "Streptococcus Pneumoniae antigens and vaccines"
20 describes certain polypeptides which are claimed to be antigenic. However, no biological activity of these. polypeptides is reported.

Therefore their remains an unmet need for Streptococcus
25 antigens that may be used as vaccine components for the prophylaxis and/or therapy of Streptococcus infection.

30

SUMMARY OF THE INVENTION

According to one aspect, the present invention provides an
isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55


WO 00/39299

PCT/CA99/01218

to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
In other aspects, there are provided vectors comprising
5 polynucleotides of the invention operably linked to an expression control region, as well as host cells transfected with said vectors and methods of producing polypeptides comprising culturing said host cells under conditions suitable for expression.
10
In yet another aspect, there are provided novel polypeptides encoded by polynucleotides of the invention.
15 BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is the DNA sequence of BVH-3 gene; SEQ ID NO: 1.
Figure 2 is the amino acid sequence of BVH-3 protein; SEQ ID
20 NO: 2.
Figure 3 is the DNA sequence of BVH-11 gene; SEQ ID NO: 3.
Figure 4 is the amino acid sequence of BVH-11 protein; SEQ
25 ID NO: 4.
Figure 5 is the DNA sequence of BVH-28 gene; SEQ ID NOr* 5.
Figure 6 is the amino acid sequence of BVH-28 protein; SEQ
30 ID NO: 6.
Figure 7 is the DNA sequence of BVH-3A gene which
corresponds to the 5' terminal end of BVH-3; SEQ ID NO: 7
3

WO00/39299

PCT/CA99/0I218

Figure 8 is the amino acid sequence of BVH-3A protein; SEQ ID NO: 8.
Figure 9 is the DNA sequence of BVH-3B gene which
5 corresponds to the 3' terminal end of BVH-3; SEQ ID NO: 9.
Figure 10 is the amino acid sequence of BVH-3B protein; SEQ ID NO: 10.
10
Figure 11 depicts the comparison of the predicted amino
acid sequences of the BVH-3 open reading frames from WU2, RX1, JNR.7/87, SP64, P4241 and A66 S. pneumoniae strains by using the program Clustal W from MacVector sequence
15 analysis software (version 6.5). Underneath the alignment, there is a consensus' line where * and . characters indicate identical and similar amino acid residues, respectively.
Figure 12 depicts the comparison of the predicted amino
20 acid sequences of the BVH-11 open reading frames from WU2, Rxl, JNR.7/87, SP64, P4241, A66 and SP63 s. pneumoniae strains by using the program Clustal W from MacVector sequence analysis software (version 6.5). Underneath the alignment, there is a consensus line where * and .
25 characters indicate identical and similar amino acid residues, respectively.
Figure 13 depicts the comparison of the predicted amino acid sequences of the BVH-11 proteins from various S.
30 pneumoniae strains. The degrees of identity (I) and
similarity (S) were determined by using the program Clustal W from MacVector sequence analysis software (version 6.5).
Figure 14 is a DNA sequence containing the complete BVH-3
35 gene (open reading frame "ORF" at nucleotides 1777 to 4896); SEQ ID NO: 11.
4

WO 00/39299

PCT/CA99/01218

Figure 15 is a DNA sequence containing the complete BVH-11 gene (ORF at nucleotides 45 to 2567); SEQ ID NO: 12.
5 Figure 16 is a DNA sequence containing the complete BVH-11-2 gene (ORF at nucleotides 114 to 2630); SEQ ID NO: 13.
Figure 17 is the amino acid sequence of BVH-11-2 protein; SEQ ID NO: 14.
10
Figure 18 is the DNA sequence of SP63 BVH-3 gene; SEQ ID NO:15.
Figure 19 is the amino acid sequence of SP63 BVH-3 protein; 15 SEQ ID NO: 16.
Figure 20 is the amino acid sequence of BVH-3M protein; SEQ ID NO: 55.
20 Figure 21 is the amino acid sequence of BVH-3AD protein; SEQ ID NO: 56.
Figure 22 is the amino acid sequence of L-BVH-3-AD protein; SEQ ID NO: 57.
25
Figure 23 is the amino acid sequence of NEW12 protein; SEQ ID NO: 58.
Figure 24 is the amino acid sequence of BVH-3C protein; SEQ 30 ID NO: 59.
Figure 25 is the amino acid sequence of BVH-11M protein; SEQ ID NO: 60.
35 Figure 26 is the amino acid sequence of BVH-11A protein; SEQ ID NO: 61.
5

WO 00/39299

PCT/CA99/012I8

Figure 27 is the amino acid sequence of BVH-11B (also called Newl3) protein; SEQ ID NO: 62.
5 Figure 28 is the amino acid sequence of BVH-11C protein; SEQ ID NO: 63.
Figure 29 is the amino acid sequence of NEW1 protein; SEQ ID NO: 64.
10
Figure 30 is the amino acid sequence of NEW2 protein; SEQ ID NO: 65.
Figure 31 is the amino acid sequence of NEW3 protein; SEQ 15 ID NO: 66.
Figure 32 is the amino acid sequence of NEW4 protein; SEQ ID NO: 67.
20 Figure 33 is the amino acid sequence of NEW5 protein; SEQ ID NO: 68.
Figure 34 is the amino acid sequence of NEW6 protein; SEQ ID NO: 69.
25
Figure 35 is the amino acid sequence of NEW7 protein; SEQ ID NO: 70.
Figure 36 is the amino acid sequence of NEW8 protein; SEQ 30 ID NO: 71.
Figure 37 is the amino acid sequence of NEW9 protein; SEQ i
ID NO: 72.
35 Figure 38 is the amino acid sequence of BVH-11-2M protein; SEQ ID NO: 73.
6

WO00/39299

PCT/CA99/01218

Figure 39 is the amino acid sequence of NEW10 protein; SEQ ID NO: 74.
5 Figure 40 is the amino acid sequence of NEWll protein; SEQ ID NO: 75.
Figure 41 is the DNA sequence of NEW12 gene; SEQ ID NO: 76.
10 Figure 42 is the amino acid sequence of NEW14 protein; SEQ ID NO: 77.
Figure 43 is the amino acid sequence of NEW15 protein; SEQ ID NO: 78.
15
Figure 44 is the amino acid sequence of NEW16 protein; SEQ ID NO: 79.
Figure 45 is the DNA sequence of GBS BVH-71 gene; SEQ ID
20 NO: 80.
Figure 46 is the amino acid sequence of GBS BVH-71 protein; SEQ ID NO: 81.
25 Figure 47 is the DNA sequence of GAS BVH-71 gene; SEQ ID NO:82.
Figure 48 is the amino acid sequence of GAS BVH-71 protein; SEQ ID NO:83.
30
DETAILED DESCRIPTION OF THE INVENTION
According to one aspect, the present invention provides an
35 isolated polynucleotide encoding a polypeptide having at least 7 0% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55
7

WO 00/39299

PCT/CA99/01218

to 75, 77 to 79, 81, 83 or fragments, analogs or. derivatives thereof.
According to one aspect, the present invention provides an
5 isolated polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
10
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 8, 10, 14, 16, 55 to
15 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
According to one aspect; the present invention provides an isolated polynucleotide encoding a polypeptide having at
20 least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 10, i4, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
25 According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 8, 10, 14, 16, 55 to 75, 77 to 79 or fragments, analogs or derivatives thereof.
30
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 7 0% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 8, 10, 16, 55, 56, 57,
35 58, 59, 64, 65, 66, 78 or fragments, analogs or derivatives thereof.
8

WO 00/39299

PCT/CA99/01218

According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a
5 sequence chosen from SEQ ID NOs: 2, 8, 10, 16, 55, 56, 57, 59, 64, 65, 66, 78 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an
10 isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 4, 14, 58, 60, 61, 62, 63, 67, 68, 69, 70, 71, 72, 73, 74, 75, 77, 79 or fragments, analogs or derivatives thereof.
15
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a >second polypeptide comprising a sequence chosen from SEQ ID NOs: 4, 14, 60, 61, 62, 63, 67,
20 68, 69, 70, 71, 72, 73, 74, 75, 77, 79 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an
25 isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 10, 14, 16, 55 to 75, 77 to 79 or fragments, analogs or derivatives thereof.
30 According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least; 7 0% identity to a second polypeptide comprising sequence chosen from SEQ ID NOs: 10, 55 to 75, 77, 78, 79 or fragments, analogs or derivatives thereof.
35
According to one aspect, the present invention provides an
9

WO 00/39299

PCT/CA99/01218

isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence chosen from SEQ ID NOs: 55 to 75, 77, 78, 79 or fragments, analogs or derivatives thereof.
5
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10 or
10 fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at
15 least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 10, 14, 16 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an
20 isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising a sequence chosen from SEQ ID NOs: 2, 4, 14, 16 or fragments, analogs or derivatives thereof.
25 According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 2 or fragments, analogs or derivatives thereof.
30
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 4 or fragments, analogs or derivatives
35 thereof.
10

WO 00/39299

PCT/CA99/01218

According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 10 or fragments, analogs or derivatives
5 thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising
10 sequence SEQ ID NO: 14 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at
15 least 70% identity to a second polypeptide comprising
sequence SEQ ID NO: 16 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an
20 isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 58 or fragments, analogs or derivatives thereof.
25 According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 60 or fragments, analogs or derivatives thereof.
30
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 62 or fragments, analogs or derivatives
35 thereof.
11

WO 00/39299

PCT/CA99/01218

According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 64 or fragments, analogs or derivatives
5 thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising
10 sequence SEQ ID NO: 67 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at .
15 least 70% identity to a second polypeptide comprising
sequence SEQ ID NO: 68 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention provides an
20 isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 69 or fragments, analogs or derivatives thereof.
25 According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 72 or fragments, analogs or derivatives thereof.
30
According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 7 0% identity to a second polypeptide comprising sequence SEQ ID NO: 74 or fragments, analogs or derivatives
35 thereof.
12

WO 00/39299

PCT/CA99/01218

According to one aspect, the present invention provides an isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising sequence SEQ ID NO: 77 or fragments, analogs or derivatives
5 thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10 or fragments,
10 analogs or derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75,
15 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
According to one aspect/ the present invention relates to polypeptides characterized by the amino acid sequence
20 chosen from SEQ ID NOs: 2, 4, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence
25 chosen from SEQ ID NOs: 2, 4 , 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence
30 chosen from SEQ ID NOs: 2, 4, 8, 10, 14, 16, 55 to 75, 77 to 79 or fragments, analogs or derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence
35 chosen from SEQ ID NOs: 2, 4, 10, 14, 16, 55 to 75, 77 to 79 or fragments, analogs or derivatives thereof.
13

WO 00/39299

PCT/CA99/01218

According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NOs: 2, 4, 10, 14, 16 or fragments,
5 analogs or derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 2 or fragments, analogs or
10 derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 4 or fragments, analogs or
15 derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 10 or fragments, analogs or
20 derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID. NO: 14 or fragments, analogs or
25 derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence** comprising sequence SEQ ID NO: 16 or fragments, analogs or
30 derivatives thereof.
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NOs: 10, 55 to 75, 77, 78, 79 or
35 fragments, analogs or derivatives thereof.
14

WO 00/39299

PCT/CA99/01218

According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NO: 10, 58, 60, 62, 64, 67, 68, 69, 72, 74, 77 or fragments, analogs or derivatives thereof.
5
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NO: 10, 58, 60, 62, 64, 67, 68, 69, 72, 74, 77 or fragments, analogs or derivatives thereof.
10
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NO: 10, 58, 60, 62, 64, 67, 68, 69, 72, 74, 77 or fragments, analogs or derivatives thereof.
15
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence chosen from SEQ ID NO: 10, 62, 64, 67, 68, 74, 77 or fragments, analogs or derivatives thereof.
20
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 58 or fragments, analogs or derivatives thereof.
25
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 62 or fragments, analogs or derivatives thereof.
30
According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 64 or fragments, analogs or derivatives thereof.
35
According to one aspect, the present invention relates to
15

WO00/39299

PCT/CA99/0I218

polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 61 or fragments, analogs or derivatives thereof.
5 According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 68 or fragments, analogs or derivatives thereof.
10 According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 74 or fragments, analogs or derivatives thereof.
15 According to one aspect, the present invention relates to polypeptides characterized by the amino acid sequence comprising sequence SEQ ID NO: 77 or fragments, analogs or derivatives thereof.
20 In a further embodiment, the present invention also relates to chimeric polypeptides which comprise one or more polypeptides or fragments, analogs or derivatives thereof as described in the present application.
25 In a further embodiment, the present invention also relates to chimeric polypeptides which comprise one or more polypeptides or fragments, analogs or derivatives thereof as defined in the figures of the present application.*.
30 In a further embodiment, the present application also
relates to chimeric polypeptides which comprise two or more
polypeptides chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14,
i
16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof ;provided that the polypeptides or
35 fragments, analogs or derivatives thereof are linked as to form a chimeric polypeptide.
16

WO 00/39299

PCT/CA99/01218

In a further embodiment, the chimeric polypeptide will comprise two or more polypeptides chosen from SEQ ID
NOs :10, 58, 60, 62, 64, 67, 68, 69, 72, 74, 77 or
5 fragments, analogs or derivatives thereof; provided that the polypeptides or fragments, analogs or derivatives thereof are linked as to form a chimeric polypeptide.
In a further embodiment, the chimeric polypeptide will
10 comprise two or more polypeptides chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68, 74, 77 or fragments, analogs or derivatives thereof; provided that the polypeptides or fragments, analogs or derivatives thereof are linked as to form a chimeric polypeptide.
15
In a further embodiment, the chimeric polypeptide will comprise two or more polypeptides chosen from SEQ ID NOs :10, 62, 64, 67, 68, 74, 77 or fragments, analogs or
derivatives thereof; provided that the polypeptides or
20 fragments, analogs or derivatives thereof are linked as to form a chimeric polypeptide.
In a further embodiment, the chimeric polypeptide will comprise between 2 and 5 polypeptides.
25
In a further embodiment, the chimeric polypeptide will comprise between 2 and 4 polypeptides.
In a further embodiment, the chimeric polypeptide will
30 comprise between 2 and 3 polypeptides.
In a further embodiment, the chimeric polypeptide will
comprise 2 polypeptides.
35
17

WO 00/39299

PCT/CA99/01218

In a further embodiment, there is provided a chimeric polypeptide of formula (I): A-(B)„-(C)n-D (I.)
5 Wherein;
m is 0 or 1,
n is 0 or 1,
A is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to
75, 77 to 79, 81, 83 or fragments, analogs or derivatives
10 thereof;
B is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to
75, 77 to 79, 81, 83 or fragments, analogs or derivatives
thereof;
C is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 15 75, 77 to 79, 81, 83 or fragments, analogs or derivatives
thereof; and
D is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to
75, 77 to 79, 81, 83 or fragments, analogs or derivatives
thereof. 20
In a further embodiment,
A is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68,
69, 72, 74, 77 or fragments, analogs or derivatives
thereof;
25 B is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68,
69, 72, 74, 77, or fragments, analogs or derivatives
thereof;
C is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68,
69, 72, 74, 77 or fragments, analogs or derivatives 30 thereof; and
D is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68, 69, 72, 74, 77 or fragments, analogs or derivatives thereof.
35 In a further embodiment,
18

WO 00/39299

PCT/CA99/01218

A is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68, 74, 77 or fragments, analogs or derivatives thereof; B is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68, 74, 77, or fragments, analogs or derivatives thereof;
5 C is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68, 74, 77 or fragments, analogs or derivatives thereof; and D is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68, 74, 77 or fragments, analogs or derivatives thereof.
10 In one embodiment, chimeric polypeptides of the present
invention comprise those wherein the following embodiments are present, either independently or in combination.
In a further embodiment, A is SEQ ID NOs :10, 58, 62, 64, 15 67, 68, 74, 77 or fragments, analogs or derivatives
thereof.
In a further embodiment, A is SEQ ID NO :10 or fragments,
analogs or derivatives thereof.
In a further embodiment, A is SEQ ID NO :58 or fragments, 20 analogs or derivatives thereof.
In a further embodiment, A is SEQ ID NO :62 or fragments,
analogs or derivatives thereof.
In a further embodiment, A is SEQ ID NO :64 or fragments,
analogs or derivatives thereof.
25 In a further embodiment, A is SEQ ID NO :67 or fragments,
analogs or derivatives thereof.
In a further embodiment, A is SEQ ID NO :68 or fragments,
analogs or derivatives thereof.
In a further embodiment, A is SEQ ID NO :74 or fragments,
30 analogs or derivatives thereof.
In a further embodiment, A is SEQ ID NO :77 or fragments,
analogs or derivatives thereof.
19

WO 00/39299

PCT/CA99/01218

In a further embodiment, B is SEQ ID NOs :10, 58, 62, 64,
67, 68, 74, 77 or fragments, analogs or derivatives
thereof.
In a further embodiment, B is SEQ ID NO :10 or fragments,'
5 analogs or derivatives thereof.
In a further embodiment, B is SEQ ID NO :58 or fragments,
analogs or derivatives thereof.
In a further embodiment, B is SEQ ID NO :64 or fragments,
analogs or derivatives thereof.
10 In a further embodiment, B is SEQ ID NO :64 or fragments,
analogs or derivatives thereof.
In a further embodiment, B is SEQ ID NO :67 or fragments,
analogs or derivatives thereof.
In a further embodiment, B is SEQ ID NO :68 or fragments,
15 analogs or derivatives thereof.
In a further embodiment, B is SEQ ID NO :74 or fragments,
analogs or derivatives thereof.
In a further embodiment, B is SEQ ID NO : 77 or fragments,
analogs or derivatives thereof.
20
In a further embodiment, C is SEQ ID NOs :10, 58, 62, 64, 67, 68, 74, 77 or fragments, analogs or derivatives
thereof.
In a further embodiment, C is SEQ ID NO :10 or fragments,
25 analogs or derivatives thereof.
In a further embodiment, C is SEQ ID NO :58 or fragments,
analogs or derivatives thereof.
In a further embodiment, C is SEQ ID NO : 62 or fragments,
analogs or derivatives thereof.
30 In a further embodiment, C is SEQ ID NO :64 or fragments, i
analogs or derivatives thereof.
In a further embodiment, C is SEQ ID NO : 67 or fragments, . analogs or derivatives thereof. In a further embodiment, C is SEQ ID NO : 68 or fragments,

WO 00/39299

PCT/CA99/01218

analogs or derivatives thereof.
In a further embodiment, C is SEQ ID NO : 74 or fragments,
analogs or derivatives thereof.
In a further embodiment, C is SEQ ID NO : 77 or fragments,
5 analogs or derivatives thereof.
In a further embodiment,. D is SEQ ID NO :10, 58, 62, 64,
67, 68, 74, 77 or fragments, analogs or derivatives
thereof.
10 In a further embodiment, D is SEQ ID NO :10 or fragments,
analogs or derivatives thereof.
In a further embodiment, D is SEQ ID NO :58 or fragments,
analogs or derivatives thereof.
In a further embodiment, D is SEQ ID NO :62 or fragments,
15 analogs or derivatives thereof.
In a further embodiment, D is SEQ ID NO :64 or fragments,
analogs or derivatives thereof.
In a further embodiment, D is SEQ ID NO :67 or fragments,
analogs or derivatives thereof.
20 In a further embodiment, D is SEQ ID NO :68 or fragments,
analogs or derivatives thereof.
In a further embodiment, D is SEQ ID NO :74 or fragments,
analogs or derivatives thereof.
In a further embodiment, D is SEQ ID NO :77 or fragments,
25 analogs or derivatives thereof.

30

In a further embodiment, m is 0. In a further embodiment, n is 0.
In a 'further embodiment, m and n are 0.
In a further embodiment, m and n are 0, A is SEQ ID NO:64 or fragments, analogs or derivatives thereof, B is SEQ ID

21

WO 00/39299

PCT/CA99/01218

NO:62 or fragments, analogs or derivatives thereof. In a further embodiment, m and n are 0, A is SEQ ID NO:62 or fragments, analogs or derivatives thereof, B is • SEQ ID NO:64 or fragments, analogs or derivatives thereof.
5
In accordance with the present invention, all nucleotides encoding polypeptides and chimeric polypeptides are within the scope of the present invention.
10 In a further embodiment, the polypeptides or chimeric
polypeptides in accordance with the present invention are antigenic.
In a further embodiment, the polypeptides or chimeric
15 polypeptides in accordance with the present invention can elicit an immune response in an individual.
In a further embodiments the present invention also relates to polypeptides which are able to raise antibodies having
20 binding specificity to the polypeptides or chimeric
polypeptides of the present invention as defined above.
An antibody that " has binding specificity" is an antibody that recognizes and binds the selected polypeptide but
25 which does not substantially recognize and bind other molecules in a sample, e.g., a biological sample, which naturally includes the selected peptide. Specific binding can be measured using an ELISA assay in which the selected polypeptide is used as an antigen.
30
Unless otherwise defined, all technical and scientific terms, used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent
35 applications, patents, and other references mentioned
herein are incorporated by reference in their entirety. In
22

WO 00/39299

PCT/CA99/01218

case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
5
As used herein, "fragments", "derivatives" or "analogs" of the polypeptides of the invention include those polypeptides in which one or more of the amino acid residues are substituted with a conserved or non-conserved
10 amino acid residue (preferably conserved) and which may be natural or unnatural. In one embodiment, derivatives and analogs of polypeptides of the invention will have about 70% identity with those sequences illustrated in the figures or fragments thereof. That is, 70% of the residues
15 are the same. In a further embodiment, polypeptides will have greater than 75% homology. In a further embodiment, polypeptides will have greater than 80% homology. In a further embodiment, polypeptides will have greater than 85% homology. In a further embodiment, polypeptides will have
20 greater than 90% homology. In a further embodiment,
polypeptides will have greater than 95% homology. In a further embodiment, polypeptides will have greater than 99% homology. In a further embodiment, derivatives and analogs of polypeptides of the invention will have fewer than about
25 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10. Preferred substitutions are those known in the art as conserved i.e the substituted residues share physical or chemical properties such as hydrophobicity, size, charge or
30 functional groups.
In accordance with the present invention, polypeptides of the invention include both polypeptides and chimeric polypeptides.
35
Also included are polypeptides which have fused thereto
23

WO 00/39299

PCT/CA99/01218

other compounds which alter the polypeptides biological or pharmacological properties i.e. polyethylene glycol (PEG) to increase half-life; leader or secretory amino acid sequences for ease of purification; prepro- and pro-
5 sequences; and (poly)saccharides.
Furthermore, in those situations where amino acid regions are found to be polymorphic, it may be desirable to vary one or more particular amino acids to more effectively
10 mimic the different epitopes of the different streptococcus strains.
Moreover, the polypeptides of the present invention can be modified by terminal -NH2 acylation (eg. by acetylation, or
15 thioglycolic acid amidation, terminal carbosy amidation, e.g. with ammonia or methylamine) to provide stability, increased hydrophobicity for linking or binding to a support or other molecule.
20 Also contemplated are hetero and homo polypeptide multimers of the polypeptide fragments, analogues and derivatives. These polymeric forms include, for example, one or more polypeptides that have been cross-linked with cross-linkers such as avidin/biotin, gluteraldehyde or dimethyl-
25 superimidate. Such polymeric forms also include
polypeptides containing two or more tandem or inverted contiguous sequences, produced from multicistronic mRNAs generated by recombinant DNA technology. Preferably, a fragment, analog or derivative of a
30 polypeptide of the invention will comprise at least one antigenic region i.e. at least one epitope.
In order to achieve the formation of antigenic polymers (i.e. synthetic multimers), polypeptides may be utilized
35 having bishaloacetyl groups, nitroarylhalides, or the like, where the reagents being specific for thio groups.
24

WO 00/39299

PCT/CA99/01218

Therefore, the link between two mercapto groups of the different peptides may be a single bond or may be composed of a linking group of at least two, typically at least four, and not more than 16, but usually not more than about
5 14 carbon atoms.
In a particular embodiment, polypeptide fragments, analogs and derivatives of the invention do not contain a methionine (Met) starting residue. Preferably,
10 polypeptides will not incorporate a leader or secretory sequence (signal sequence). The signal portion of a polypeptide of the invention may be determined according to established molecular biological techniques. In general, the polypeptide of interest may be isolated from a
15 streptococcus culture and subsequently sequenced to
determine the initial residue of the mature protein and therefore the sequence of the mature polypeptide.
According to another aspect, there are provided vaccine
20 compositions comprising one or more streptococcus polypeptides of the invention in admixture with a pharmaceutically acceptable carrier diluent or adjuvant. Suitable adjuvants include oils i.e. Freund's complete or incomplete adjuvant; salts i.e. A1K(S04)2, AlNa(S04)2,
25 AlNH4(S04)2, silica, kaolin, carbon polynucleotides i.e.
poly IC and poly AU. Preferred adjuvants include QuilA and Alhydrogel. Vaccines of the invention may be administered parenterally by injection, rapid infusion, nasopharyngeal absorption, dermoabsorption, or bucal or oral.
30 Pharmaceutically acceptable carriers also include tetanus toxoid.
Vaccine compositions of the invention are used for the treatment or prophylaxis of streptococcus infection and/or
35 diseases and symptoms mediated by streptococcus infection as described in P.R. Murray (Ed, in chief),E.J. Baron, M.A.
25

WO 00/39299

PCT/CA99/0I218

Pfaller, F.C. Tenover and R.H. Yolken. Manual of Clinical Microbiology, ASM Press, Washington, D.C. sixth edition, 1995, 1482p which are herein incorporated by reference. In one embodiment, vaccine compositions of the present
5 invention are used for the treatment or prophylaxis of
meningitis, otitis media, bacteremia or pneumonia. In one embodiment, vaccine compositions of the invention are used for the treatment or prophylaxis of streptococcus infection and/or diseases and symptoms mediated by streptococcus
10 infection, in particular S.pneumoniae, group A
streptococcus {pyogenes), group B streptococcus (GBS or agalactiae), dysgalactiae, uberis, nocardia as well as Staphylococcus aureus. In a further embodiment, the streptococcus infection is S.pneumoniae.
15
In a particular embodiment, vaccines are administered to those individuals at risk of streptococcus infection such as infants, elderly and immunocompromised individuals.
20 As used in the present application, the term " individuals" include mammals. In a further embodiment, the mammal is human.
Vaccine compositions are preferably in unit dosage form of
25 about 0.001 to 100 µg/kg (antigen/body weight) and more preferably 0.01 to 10 µg/kg and most preferably 0.1 to 1 µg/kg 1 to 3 times with an interval of about 1 to 6 week intervals between immunizations.
30 According to another aspect, there are provided
polynucleotides encoding polypeptides characterized by the amino'acid sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
35
26

WO 00/39299

PCT/CA99/0I218

In one embodiment, polynucleotides are those illustrated in SEQ ID Nos: 1, 3, 5, 7, 9, 11, 12, 13, 15, 76, 80, 82
which may include the open reading frames (ORF), encoding polypeptides of the invention. It will be appreciated that
5 the polynucleotide sequences illustrated in the figures may be altered with degenerate codons yet still encode the polypeptides of the invention. Accordingly the present invention further provides polynucleotides which hybridize to the polynucleotide sequences herein above described (or
10 the complement sequences thereof) having 50% identity
between sequences. In one embodiment, at least 70% identity between sequences. In one embodiment, at least 75% identity between sequences. In one embodiment, at least 80% identity between sequences. In one embodiment, at least 85% identity
15 between sequences. In one embodiment, at least 90% identity between sequences. In a further embodiment, polynucleotides are hybridizable under stringent conditions i.e. having at least 95% identity. In a further embodiment, more than 97% identity.
20
In a further embodiment, polynucleotides are those illustrated in SEQ*ID NOs : 1, 3, 7, 9, 11, 12, 13, 15, 76, 80, 82 encoding polypeptides of the invention.
25 In a further embodiment, polynucleotides are those
illustrated in SEQ ID NOs : 1, 3, 9, 11, 12, 13, 15, 76, 80, 82 which may include the open reading frames (ORF), encoding polypeptides of the invention.
30 In a further embodiment, polynucleotides are those
illustrated in SEQ ID NOs : 1, 3, 9, 11, 12, 13, 15, 76
which may include the open reading frames (ORF), encoding polypeptides of the invention.
35 In a further embodiment, polynucleotides are those
27

WO 00/39299

PCT/CA99/01218

illustrated in SEQ ID NOs : 1, 3, 7, 9, 11, 12, 13, 15, 76
which may include the open reading frames (ORF), encoding polypeptides of the invention.
5 In a further embodiment, polynucleotides are those
illustrated in SEQ ID NOs : 1, 7, 9, 11, 15, 76 which may
include the open reading frames (ORF), encoding polypeptides of the invention.
10 In a .further embodiment, polynucleotides are those
illustrated in SEQ ID NOs : 1, 9, 11, 15, 76 which may include the open reading frames (ORF), encoding polypeptides of the invention.
15 In a further embodiment, polynucleotides are those
illustrated in SEQ ID NOs : 1, 7, 9, 11 which may include
the open reading frames (ORF), encoding polypeptides of the invention.
20 In a further embodiment, polynucleotides are those
illustrated in SEQ ID NO : 1, encoding polypeptides of the
invention.
In a further embodiment, polynucleotides are those
25 illustrated in SEQ ID NO :7, encoding polypeptides of the invention.
In a further embodiment, polynucleotides are those illustrated in SEQ ID NO :9, encoding polypeptides of the
30 invention.
In a further embodiment, polynucleotides are those illustrated in SEQ ID NO ill, .encoding polypeptides of the invention.
35
28

WO 00/39299

PCT/CA99/01218

±n a further embodiment, polynucleotides are those illustrated in SEQ ID NO :15, encoding polypeptides of the invention.
5 In a further embodiment, polynucleotides are those illustrated in SEQ ID NOs : 3, 12, 13, 76, encoding polypeptides of the invention.
In a further embodiment, polynucleotides are those
10 illustrated in SEQ ID NO :3, encoding polypeptides of the invention.
In a further embodiment, polynucleotides are those illustrated in SEQ ID NO :12, encoding polypeptides of the
15 invention.
In a further embodiment., polynucleotides are those illustrated in SEQ ID NO :13# encoding polypeptides of the invention.
20
In a further embodiment, polynucleotides are those illustrated in SEQ ID NO :76, encoding polypeptides of the invention.
25 As will be readily appreciated by one skilled in the art, polynucleotides include both DNA and RNA.
The present invention also includes polynucleotides complementary to the polynucleotides described in the
30 present application.
In a further aspect, polynucleotides encoding polypeptides of the invention, or fragments, analogs or derivatives thereof, may be used in a DNA immunization method. That
35 is, they can be incorporated into a vector which is
29

WO 00/39299

PCT/CA99/0I218

replicable and expressible upon injection thereby producing the antigenic polypeptide in vivo. For example polynucleotides may be incorporated into a plasmid vector under the control of the CMV promoter which is functional
5 in eukaryotic cells. Preferably the vector is injected intramuscularly.
According to another aspect, there is provided a process for producing polypeptides of the invention by recombinant
10 techniques by expressing a polynucleotide encoding said polypeptide in a host cell and recovering the expressed polypeptide product. Alternatively, the polypeptides can be produced according to established synthetic chemical techniques i.e. solution phase or solid phase synthesis of
15 oligopeptides which are ligated to produce the full polypeptide (block ligation).
General methods for obtention and evaluation of polynucleotides and polypeptides are described in the
20 following references: Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed, Cold Spring Harbor, N.Y., 1989; Current Protocols in Molecular Biology, Edited by Ausubel F.M. et al., John Wiley and Sons, Inc. New York; PCR Cloning Protocols, from Molecular Cloning to Genetic
25 Engineering, Edited by White B.A., Humana Press, Totowa, New Jersey, 1997, 490 pages; Protein Purification, Principles and Practices,. Scopes R.K., Springer-Verlag, New York, 3rd Edition, 1993, 380 pages; Current Protocols»-in Immunology, Edited by Coligan J.E. et al., John Wiley &
30 Sons Inc., New York which are herein incorporated by reference.
For recombinant production, host cells are transfected with vectors which encode the polypeptide, and then cultured in
35 a nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the genes.
30

WO 00/39299

PCT/CA99/01218

Suitable vectors are those that are viable and replicable in the chosen host and include chromosomal, non-chromosomal and synthetic DNA sequences e.g. bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from
5 combinations of plasmids and phage DNA. The polypeptide sequence may be incorporated in the vector at the appropriate site using restriction enzymes such that it is operably linked to an expression control region comprising a promoter, ribosome binding site (consensus region or
10 Shine-Dalgarno sequence), and optionally an operator
(control element). One can select individual components of the expression control region that are appropriate for a given host and vector according to established molecular biology principles(Sambrook et al, Molecular Cloning: A
15 Laboratory Manual, 2nd ed, Cold Spring Harbor, N.Y., 1989; Current Protocols in Molecular Biology, Edited by Ausubel F.M. et al., John Wiley and Sons, Inc. New York incorporated herein by reference). Suitable promoters include but are not limited to LTR or SV40 promoter, E.coli
20 lac, tac or trp promoters and the phage lambda PL promoter. Vectors will preferably incorporate an origin of replication as well as selection markers i.e. ampicilin resistance gene. Suitable bacterial vectors include pET, pQE7 0, pQE60, pQE-9, pbs, Pd10 phagescript, psiXl74,
25 pbluescript SK, pbsks, pNH8A, pNHl6a, pNH18A, pNH46A,
ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 and eukaryotic vectors pBlueBacIII, pWLNEO, pSV2CAT, pOG44, pXTl, pSG, pSVK3, pBPV, pMSG and pSVL. Host cells may be bacterial i.e. E.coli, Bacillus subtilis, Streptomvces; fungal i.e.
30 Aspergillus niger, Aspergillus nidulins; yeast i.e. Saccharomyces or eukaryotic i.e. CHO, COS.
Upon expression of the polypeptide in culture, cells are typically harvested by centrifugation then disrupted by
35 physical or chemical means (if the expressed polypeptide is not secreted into the media) and the resulting crude
31

WO 00/39299

PCT/CA99/01218

extract retained to isolate the polypeptide of interest. Purification of the polypeptide from culture media or lysate may be achieved by established techniques depending on the properties of the polypeptide i.e. using ammonium
5 sulfate or ethanol precipitation , acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography and lectin chromatography. Final purification may be achieved using HPLC.
10
The polypeptide may be expressed with or without a leader or secretion sequence. In the former case the leader may be removed using post-translational processing (see US 4,431,739; US 4,42 5,437; and US 4,338,397 incorporated
15 herein by reference) or be chemically removed subsequent to purifying the expressed polypeptide.
According to a further aspect, the streptococcus polypeptides of the invention may be used in a diagnostic
20 test for streptococcus infection, in particular S.
pneumoniae infection. Several diagnostic methods are possible, for example detecting streptococcus organism in a biological sample, the following procedure may be followed:
a) obtaining a biological sample from a patient;
25 b) incubating an antibody or fragment thereof reactive
with a streptococcus polypeptide of the invention with the biological sample to form a mixture; and
c) detecting specifically bound antibody or bound
fragment in the mixture which indicates the presence
30 of streptococcus.
Alternatively, a method for the detection' of antibody specific to a streptococcus antigen in a biological sample containing or suspected of containing said antibody may be
35 performed as follows:
a) obtaining a biological sample from a patient;
32

WO 00/39299

PCT/CA99/01218

b) incubating one or more streptococcus polypeptides of
the invention or fragments thereof with the biological
sample to form a mixture; and
c) detecting specifically bound antigen or bound fragment
5 in the mixture which indicates the presence of
antibody specific to streptococcus.
One of skill in the art will recognize that this diagnostic test may take several forms, including an immunological
10 test such as an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay or a latex agglutination assay, essentially to determine whether antibodies specific for the protein are present in an organism.
15 The DNA sequences encoding polypeptides of the invention may also be used to design DNA probes for use in detecting the presence of streptococcus in a biological sample suspected of containing such bacteria. The detection method of this invention comprises:
20 a) obtaining the biological sample from a patient;
b) incubating one or more DNA probes having a DNA
sequence encoding a polypeptide of the invention or fragments thereof with the biological sample to form a mixture; and
25 c) detecting specifically bound DNA probe in the mixture which indicates the presence of streptococcus
bacteria.
The DNA probes of this invention may also be used for
30 detecting circulating streptococcus i.e.
S.pneumoniaenucleic acids in a sample, for example using a polymerase chain reaction, as a method of diagnosing streptococcus infections. The probe may be synthesized using conventional techniques and may be immobilized on a
35 solid phase, or may be labelled with a detectable label. A preferred DNA probe for this application is an oligomer
33

WO 00/39299

PCT/CA99/01218

having a sequence complementary to at least about 6 contiguous nucleotides of the streptococcus pneumoniae -polypeptides of the invention.
5 Another diagnostic method for the detection of streptococcus in a patient comprises:
a) labelling an antibody reactive with a polypeptide of the invention or fragment thereof with a detectable label;
10 b) administering the labelled antibody or labelled fragment to the patient; and
c) detecting specifically bound labelled antibody or
labelled fragment in the patient which indicates the presence of streptococcus.
15
A further aspect of the invention is the use of the streptococcus polypeptides of the invention as immunogens for the production of specific antibodies for the diagnosis and in particular the treatment of streptococcus infection.
20 Suitable antibodies may be determined using appropriate
screening methods, for example by measuring the ability of a particular antibody to passively protect against streptococcus infection in a test model. One example of an animal model is the mouse model described in the examples
25 herein. The antibody may be a whole antibody or an
antigen-binding fragment thereof and may belong to any immunoglobulin class. The antibody or fragment may be of animal origin, specifically of mammalian origin and more specifically of murine, rat or human origin. It may be a
30 natural antibody or a fragment thereof, or if desired, a recombinant antibody or antibody fragment. The term recombinant antibody or antibody fragment means antibody or antibody fragment which was produced using molecular biology techniques. The antibody or antibody fragments may
35 be polyclonal, or preferably monoclonal. It may be specific for a number of epitopes associated with the
34

WO 00/39299 PCT/CA99/01218
streptococcus pneumoniae polypeptides but is preferably specific for one.
Without limiting its scope, the present invention also
5 relates to new antigens designated BVH-3, BVH-11, BVH-11-2, BVH-28 and BVH-71. The present invention also relates to truncated polypeptides comprising fragments of the new antigens designated BVH-3, BVH-11, BVH-11-2, BVH-28 and BVH-71. The present invention also relates to chimeric
10 polypeptides comprising fragments of the new antigens
designated BVH-3, BVH-11, BVH-11-2, BVH-28 and BVH-71. The following is a reference table summarizing the relation between the antigens of the present invention:

Family Nucleotide SEQ ID NO Polypeptide SEQ NO ID
BVH-3
BVH-3 1, 11 2
BVH-3A 7 8
BVH-3B 9 10
BVH-3 SP63 15 16
BVH-3M 55
BVH-3AD 56
L-BVH-3AD 57
Newl2 76 58
BVH-3C 59
Newl 64
New2 65
New3 66
Newl 5 78
BVH-11 **
BVH-11 3, 12 4
BVH-11-2 13 14
BVH-11M 60
BVH-11A 61
BVH-11B also referred to as NEW13 62
BVH-11C 63
New4 67
New5 68
35

WO 00/39299

PCT/CA99/01218


Family Nucleotide SEQ ID NO Polypeptide SEQ ID NO
New6 69
New7 70
New8 71
New9 72
BVH-11-2M 73
NewlO 74
Newll 75
Newl2 76 58
Newl4 77
Newl6 79
BVH-28
BVH-28 5 6
BVH-71
GBS 80 81
GAS 82 83
EXAMPLE 1
5 This example illustrates the cloning of S. pneumoniae genes.
The coding region of S^ pneumoniae gene BVH-3 (SEQ ID NO: 1) and the coding region of S^_ pneumoniae gene BVH-28 (SEQ ID NO: 5) were amplified by PCR (DNA Thermal Cycler GeneAmp
10 PCR system 2400 Perkin Elmer, San Jose, CA) from genomic DNA of serogroup 6 S. pneumoniae strain SP64 using the oligos that contained base extensions for the addition of restriction sites Bglll (AGATCT) and Xbal (TCTAGA). PCR products were purified from agarose gel using a QIAquick gel
15 extraction kit from QIAgen (Chatsworth, CA), digested Bglll-Xbal (Pharmacia Canada Inc, Baie d'Urfe, Canada), extracted with phenol : chloroform and precipitated with ethanol. The Superlinker vector pSL301 (Invitrogen, San Diego, CA) was digested with Bglll and Xbal and purified from agarose gel
20 using a QIAquick gel extraction kit from QIAgen (Chatsworth, CA). The Bglll-Xbal genomic DNA fragments were ligated to
36

WO 00/39299

PCT/CA99/01218

the Bglll-Xbal pSL301 vector. The ligated products were transformed into E. coli strain DH5a [f80 lacZ DM15 endAl recAl hsdRll (r-mK+) supE44 thi-11" gyrA96 relAl D(lacZYA-argF)U169] (Gibco BRL, Gaithersburg, MD) according to the
5 method of Simanis (Hanahan, D. DNA Cloning, 1985, D.M. Glover (ed), pp. 109-135). Recombinant pSL301 plasmids (rpSL301) containing either BVH-3 or BVH-28 gene were purified using a QIAgen kit (Chatsworth, CA) and DNA inserts were confirmed by nucleotide sequence analysis (Taq Dye
10 Deoxy Terminator Cycle Sequencing kit, ABI, Foster City, CA). Recombinant rpSL301 (rpSL301) were digested with the restriction enzymes Bglll (AGATCT) and Xhol (CTCGAG). DNA fragments Bglll-Xhol were purified using the QIAquick gel extraction kit from QIAgen (Chatsworth, CA). pET-32c(+)
15 expression vector (Novagen, Madison, WI) containing the thioredoxin-His-Tag sequence was digested with BamHI (GGATCC) and Xhol and- gel extracted using the QIAquick gel extraction kit from QIAgen (Chatsworth, CA). The Bglll-Xhol DNA fragments were ligated to the BamHI-XhoI pET-32c(+)
20 vector to create the coding sequence for thioredoxin-
His-Tag-BVH-3 or thioredoxin-His-Tag-BVH-28 fusion protein. The ligated products were transformed into E. coli strain DH5a [f80 lacZ DM15 endAl recAl hsdR17 (rK"mK+) supE44 thi-11" gyrA96 relAl D(lacZYA-argF)U169] (Gibco BRL, Gaithersburg,
25 MD) according to the method of Simanis (Hanahan, D. DNA
Cloning, 1985, D.M. Glover (ed), pp. 109-135). Recombinant pET-32c(+) plasmids were purified using a QIAgen kit (Chatsworth, CA) and the nucleotide sequences at the fusion sites of thioredoxin-His-Tag and DNA insert were verified by
30 DNA sequencing (Taq Dye Deoxy Terminator Cycle Sequencing kit, ABI, Foster City, CA).
37

rci/CA99/012I8
EXAMPLE 2
This example illustrates the cloning of S. pneumoniae 5 protein genes in CMV plasmid pCMV-GH.
The DNA coding region of a S. pneumoniae protein was inserted in phase downstream of a human growth hormone (hGH) gene which was under the transcriptional control of the
10 cytomegalavirus (CMV) promotor in the plasmid vector pCMV-GH (Tang et al., Nature, 1992, 356 :152). The CMV promotor is non functional plasmid in E. coli cells but active upon administration of the plasmid in eukaryotic cells. The vector also incorporated the ampicillin resistance gene.
15
The coding region of BVH-3 gene (SEQ ID NO: 1) and BVH-28 gene (SEQ ID NO: 5) were obtained from rpSL301 (see example 1) using restriction enzymes Bglll (AGATCT) and Xbal (TCTAGA). The digested products were purified from agarose
20 gel using the QIAquick gel extraction kit from QIAgen
(Chatsworth, CA). The pCMV-GH vector (Laboratory of Dr. Stephen A. Johnston, Department of Biochemistry, The University of Texas, Dallas, Texas) containing the human growth hormone to create fusion proteins was digested with
25 Bglll and Xbal and purified from agarose gel using the
QIAquick gel extraction kit from QIAgen (Chatsworth, CA). The Bglll-Xbal DNA fragments were ligated to the Bglll-Xbal pCMV-GH vector to create the hGH-BVH-3 or hGH-BVH-28 fusion protein under the control of the CMV promoter. The ligated
30 products were transformed into E. coli strain DH5a[f80 lacZ DM15 endAl recAl ftsdR17 ("K"^) supE44 thi-11" gyrA96 relAl D(2acZYA-argF)U169] (Gibco BRL, Gaithersburg, MD) according
38

WO 00/39299

PCT/CA99/01218

to the method of Simanis (Hanahan, D. DNA Cloning, 1985, D.M. Glover (ed), pp. 109-135). The recombinant pCMV plasmids were purified using a QIAgen kit (QIAgen, Chatsworth, CA).
5
The coding region of BVH-11 gene (SEQ ID NO: 3) was amplified by PCR (DNA Thermal Cycler GeneAmp PCR system 2400 Perkin Elmer, San Jose, CA) from genomic DNA of serogroup 6 S. pneumoniae strain SP64 using the oligos that contained
10 base extensions for the addition of restriction sites Bglll (AGATCT) and HindIII (AAGCTT). The PCR product was purified from agarose gel using a QIAquick gel extraction kit from QIAgen (Chatsworth, CA), digested with restriction enzymes (Pharmacia Canada Inc, Baie d'Urfe, Canada), extracted with
15 phenol : chloroform and precipitated with ethanol. The pCMV-GH vector (Laboratory of Dr. Stephen A. Johnston, Department of Biochemistry, The University of Texas, Dallas, Texas) was digested with Bglll and HindiII and purified from agarose gel using the QIAquick gel extraction kit from
20 QIAgen (Chatsworth, CA) . The Bglll- HindIII DNA fragment was ligated to the Bglll- HindIII pCMV-GH vector to create the hGH-BVH-11 fusion protein under the control of the CMV promoter. The ligated products were transformed into E. coli strain DH5a[f80 lacZ DM15 endAl recAl hsdRll (rK"mK+) supE44
25 thi-11" gyrA96 relAl D(lacZYA-argF)U169] (Gibco BRL, Gaithersburg, MD) according to the method of Simanis (Hanahan, D. DNA Cloning, 1985, D.M. Glover (ed), pp. 109-135). The recombinant pCMV plasmid was purified using a QIAgen kit (Chatsworth, CA) and the nucleotide sequence of
30 the DNA insert was verified by DNA sequencing.
39

WO 00/39299

PCT/CA99/01218

EXAMPLE 3
This example illustrates the use of DNA to elicit an immune response to S. pneumoniae antigens.
5
A group of 8 female BALB/c mice (Charles River, St-Constant, Quebec, Canada) were immunized by intramuscular injection of 50 µl three times at two- or three-week intervals with 100 fig of recombinant pCMV-GH encoding the BVH-3, BVH-11 or the
10 BVH-2 8 gene in presence of 50 µg of granulocyte-macrophage colony-stimulating factor (GM-CSF)- expressing plasmid pCMV-GH-GM-CSF (Laboratory of Dr. Stephen A. Johnston, Department of Biochemistry, The University of Texas, Dallas, Texas). As control, a group of mice were injected with 100 µg of
15 pCMV-GH in presence of 50µg of pCMV-GH-GM-CSF. Blood samples were collected from the orbital prior to each immunization and seven days following the third injection and serum antibody responses were determined by ELISA using thioredoxin-His•Tag-S. pneumoniae fusion protein as coating
20 antigen. DNA immunization with recombinant plasmid pCMV-GH encoding the BVH-3, BVH-11 or the BVH-28 S. pneumoniae protein induced antibody reactive against the respective recombinant protein. The reciprocal antibody titers, defined as the highest serum dilution at which the absorbance values
25 were 0.1 above the background values, were above 4xl03.
EXAMPLE 4
30 This example illustrates the production and purification of recombinant S. pneumoniae proteins.
40

WO 00/39299

PCT/CA99/01218

The recombinant pET plasmids containing the BVH-3, BVH-11 or the BVH-28 gene corresponding to the SEQ ID NO: 1 , SEQ ID NO: 3 or the SEQ ID NO: 5 respectively were transformed by
5 electroporation (Gene Pulser II apparatus, BIO-RAD Labs, Mississauga, Canada) into E. coli strain AD494 (DE3) (Dara" 2eu7697 DlacX74 DphoA PVUII phoR DmalF3 F'[2ac+(laclq) pro] trxB::Kan) (Novagen, Madison, WI). In this strain of E. coli, the T7 promotor controlling expression of the fusion
10 protein is specifically recognized by the T7 RNA polymerase (present on the 1DE3 prophage) whose gene is under the control of the lac promotor which is inducible by isopropyl-S-d-thio-galactopyranoside (IPTG). The transformant AD494 (DE3)/rpET was grown at 37°C with agitation at 250 rpm
15 in LB broth (peptone lOg/L, yeast extract 5g/L, NaCl lOg/L) containing 100µg of ampicillin (Sigma-Aldrich Canada Ltd., Oakville, Canada) per ml until the A600 reached a value of 0.6. In order to induce the production of the thioredoxin-His-Tag-BVH-3, thioredoxin-His-Tag-BVH-11 or thioredoxin-
20 His-Tag-BVH-28 fusion protein, the cells were incubated for 2 additional hours in the presence of IPTG at a final concentration of 1 mM. Induced cells from a 100 ml culture were pelleted by centrifugation and frozen at -70°C.
25 The purification of the fusion proteins from the soluble cytoplasmic fraction of IPTG-induced AD494(DE3)/rpET was done by affinity chromatography based on the properties of the His-Tag sequence (6 consecutive histidine residues) to bind to divalent cations (Ni2+) immobilized on the His-Bind
30 metal chelation resin. Briefly, the pelleted cells obtained from a 100mL culture induced with IPTG were resuspended in .
41

WO 00/39299

PCT/CA99/01218

phosphate-buffered (PBS):500mM NaCl pH7.1, sonicated and spun at 20,000 X g for 20 min to remove debris. The supernatant was filtered (0.22µm pore size membrane) and deposited on a HiTrap® 1mL chelating pre-packed ready-to-use
5 column (Pharmacia Biotech, Baie d'Urfe, Canada). The
thioredoxin-His•Tag-S. pneumoniae fusion protein was eluted with 1M imidazole-500mM NaCl-PBS pH7.1. The removal of the salt and imidazole from the sample was done by dialysis .against PBS at 4°C. The quantities of fusion protein
10 obtained from the soluble fraction of E. coli was estimated by MicroBCA (Pierce, Rockford, Illinois).
EXAMPLE 5
15
This example illustrates the protection of mice against fatal pneumococcal infection by immunization.
Groups of 8 female BALB/c mice (Charles River) were
20 immunized subcutaneously three times at three-week intervals with either 25 µg of affinity purified thioredoxin-His-Tag-BVH-3 fusion protein in presence of 15 µg of QuilA adjuvant (Cedarlane Laboratories Ltd, Hornby, Canada) or, as control, with QuilA adjuvant alone in PBS. Blood samples were
25 collected from the orbital sinus on day 1, 22 and 43 prior to each immunization and seven days (day 50) following the third injection. One week later the mice were challenged with approximately 106 CFU of the type 3 S. pneumoniae strain WU2. Samples of the S. pneumoniae challenge inoculum
30 were plated on chocolate agar plates to determine the CFU
and to verify the challenge dose. Deaths were recorded for
42

WO 00/39299

PCT/CA99/01218

a period of 14 days and on day 14 post-challenge, the surviving mice were sacrificied and blood samples tested for the presence of S. pneumoniae organisms. The survival data are shown in table 1.
5
Prechallenge sera were analyzed for the presence of antibodies reactive with S. pneumoniae by standard immunoassays. Elisa and immunoblot analyses indicated that immunization with recombinant S. pneumoniae protein produced
10 in E. coli elicited antibodies reactive with both, recombinant and native pneumococcal protein.
Table 1. Protection mediated by recombinant BVH-3 protein

Immunogen No. of mice alive : no. of micedead14 days post-challenge Median day of death
BVH-3 8 : 0 >14
none 0 : 8 1
15
All mice immunized with BVH-3 recombinant protein survived to infection while none of the control mice given adjuvant alone survived. There was a significant difference in survival between the two groups of mice (P 20 test for nonparametric analysis of survival curves; P=0.0002, Fisher's exact test). All hemocultures from surviving mice were negative at day 14 post-challenge.
25
EXAMPLE 6
43

WO 00/39299

PCT/CA99/01218

This example describes the cloning of BVH-3 and BVH-11 genes from a variety of S^_ pneumoniae strains and the molecular conservation of these genes.
5 Molecular analysis of chromosomal DNA from various S. pneumoniae isolates with DNA probes spanning different regions of BVH-3 or BVH-11 revealed the presence of one BVH-3 gene copy and two BVH-11 gene copies. The two BVH-11 gene copies are not identical and the genes were
10 arbitrarily designated BVH-11 (SEQ ID NO:12; ORF at
nucleotides 45 to 2567) and BVH-11-2 (SEQ ID NO:13; ORF at nucleotides 114 to 2630).
The first amino acids of the BVH-3 and BVH-11 coding
15 regions have the characteristics of leader sequences also known as signal peptides. The consensus signal peptidase cleavage site L-X-X-C of lipoprotein
modification/processing sites was present in the sequences. Mature BVH-3, BVH-11 and BVH-11-2 proteins from S.
20 pneumoniae SP64 have 1019, 821 and 819 amino acids,
respectively. The regions of S. pneumoniae genes coding for mature BVH-3, termed BVH-3M, (nucleotides 1837 - 4896; SEQ. ID. NO: 11), BVH-11M (nucleotides 102-2567; SEQ. ID. NO: 12) and BVH-11-2M (nucleotides 171-2630; SEQ. ID. NO:
25 13), were amplified by PCR(DNA Thermal Cycler GeneAmp PCR system 2400 Perkin Elmer, San Jose, CA) from genomic DNA of 6 or 7 S. pneumoniae strains. Serogroup 6 S. pneumoniae SP64 and serogroup 9 SP63 clinical isolates were provided by the laboratoire de la sante publique du Quebec, Sainte-
30 Anne-de-Bellevue; serotype 4 strain JNR.7/87 was provided by Andrew Camilli, Tufts University School of Medicine, Boston; Rxl strain, a nonencapsulated derivative of the type 2 strain D39 and the type 3 strains A66 and WU2 were provided by David E. Briles from University of Alabama,
35 Birmingham and the type 3 clinical isolate P4241 was
provided by the centre de recherche en infectiologie du
44

WO 00/39299

PCT/CA99/01218

centre hospitalier de l'universite Laval, Sainte-Foy. The sets of oligonucleotide primers OCRR479-OCRR480; HAMJ160-OCRR488 and HAMJ160-HAMJ186, that contained base extensions for the addition of restriction sites were used for the
5 amplification of BVH-3, BVH-11 and BVH-11-2 gene,
respectively, with the exception of BVH-11 gene from SP64 strain which was amplified using the set of primers consisting of HAMJ487 and OCRR488. Primer sequences are listed below (Table 2). PCR products were purified from
10 agarose gel using a QIAquick gel extraction kit from QIAgen (Chatsworth, CA) and digested Bglll-Xbal or BglII-HindIII (Pharmacia Canada Inc, Baie d'Urfe, Canada). Digestions were cleaned using a QIAquick PCR purification kit from QIAgen (Chatsworth, CA). The PCR products were ligated to
15 the BglII-Xbal or Bglll-HindIII pSL301 vector. The ligated products were transformed into E. coli strain DH5α [θ80 lacZ ∆MI5 endAl recAl hsdRll (K'”K*) supE44 thi-lλ gyrA96 relAl ∆(2acZYA-argF)U169] (Gibco BRL, Gaithersburg, MD) according to the method of Simanis (Hanahan, D. DNA
20 Cloning, 1985, D.M. Glover (ed), pp. 109-135). Recombinant pSL301 plasmids (rpSL301) containing BVH-3, BVH-11 or BVH11-2 were purified using a QIAgen kit (Chatsworth, CA) and DNA inserts were sequenced (Taq Dye Deoxy Terminator Cycle Sequencing kit, ABI, Foster City, CA). The figures 11
25 and 12 depict the consensus sequence established from the BVH-3, and BVH-11 deduced amino acid sequences, respectively. Comparison of BVH-3 protein sequences ,. revealed 99 to 100% identity of sequences for all strains with the exception that BVH-3 from serogroup 9 SP63 strain
30 (SEQ. ID. NO: 15 and SEQ. ID. NO: 16) misses a stretch of 177 amino acids corresponding to residues 244 to 420 on BVH-3'protein sequence of S. pneumoniae SP64. Analysis of sequences of additional serogroup 9 strains revealed BVH-3 molecule having the same deletion in 3 out of 4 strains
45

WO 00/39299

PCT/CA99/01218

thus suggesting that the 3 strains are members of a S. pneumoniae serogroup 9 clone.
Comparison of 13 BVH-11 nucleotide sequences obtained from 5 7 S. pneumoniae strains, revealed that the nucleotide
sequences are very similar. Computer analysis (MacVector, Clustal W 1.4) using multiple alignment of the predicted BVH-11 protein sequences revealed that these sequences were 75% identical and 82 % homologous on a length of 834 amino
10 acids. Pairwise alignment revealed 80 to 100% identity (Figure 13). The sequences showed great similarity in overall organization. Variability in the primary sequence* of these proteins is almost restricted to the last 125 amino acids in the C-terminal portion of the proteins. This
15 region constitutes a domain. Close examination of this domain revealed two groups of sequences. The first 9 sequences from the figure 13 belong to one group while the last 4 sequences belong to another group. A 39% identity value is obtained when the domain sequences of the 13
20 proteins are compared (MacVector, Clustal W 1.4). The identity value increased to more than 92% when sequences belonging to a same group are compared.
25 EXAMPLE 7
This example illustrates the homology of portions of BVH-3 and BVH-11 genes.
30 Molecular analysis with DNA probes derived from BVH-3 and BVH-11 genes indicated that BVH-3 and BVH-11 were related. In dot blot hybridization studies, DNA probe consisting of either, BVH-3 or BVH-11, gene sequence hybridized to both, BVH-3 and BVH-11 genes thus indicating that BVH-3 and BVH-
35 11 genes shared homologous sequences. Comparison of
sequences revealed that the ORFs and the proteins were 43
46

PCT/CA99/0I218
and 33% identical, respectively. Closer examination revealed that the region corresponding to amino acids 1 to 225 in BVH-3 and 1 to 228 in BVH-11 were 73 and 75% identical at the DNA and protein level, respectively. In
5 contrast, the 3' regions corresponding to amino acids 226 to 1039 from BVH-3 and amino acids 229-840 from BVH-11 were only 34 and 22% identical at the DNA and protein level, respectively. Thus the 5' termini of BVH-3 and BVH-11 genes appear to contain highly conserved sequences while
10 the remaining parts of the genes are highly divergent. These results suggest that BVH-3 and BVH-11 might share similar functions mediated by sequences present in the conserved region whereas BVH-3- and BVH-11-specific functions might be mediated by sequences in the divergent
15 region.
EXAMPLE 8
20 This example describes the cloning of truncated BVH-3, BVH-11 and BVH-11-2 genes by polymerase chain reaction (PCR) and the expression of truncated BVH-3 and BVH-11 molecules.
Gene fragments were amplified by PCR using pairs of
25 oligonucleotide engineered to amplify fragments spanning
the BVH-3 (SEQ ID NO: 1 and SEQ ID NO: 11), BVH-11 (SEQ ID NO: 3 and SEQ ID NO: 12) or BVH-11-2 (SEQ ID NO: 13) gene from £^_ pneumoniae strain SP64. Each of the primers had a restriction endonuclease site at the 5' end, thereby
30 allowing directional in-frame cloning of the amplified
product into the digested plasmid vector (Tables 2 and 3). PCR-amplified products were digested with restriction endonucleases and ligated to either linearized plasmid pSL301 (see example 1), pCMV-GH (see example 2) or pET
35 (Novagen, Madison, WI) expression vector digested likewise or digested with enzymes that produce compatible cohesive
47

WO 00/39299

PCT/CA99/01218

ends. Recombinant pSL301 and recombinant pCMV-GH plasmids were digested with restriction enzymes for the in-frame cloning in pET expression vector. Clones were first
stabilized in E. coli DH5a before introduction into E. coli
5 BL21(λDE3) or AD494 (λDE3) for expression of truncated BVH-3 or BVH-11 molecules. Each of the resultant plasmid constructs was confirmed by nucleotide sequence analysis. The recombinant proteins were expressed as N-terminal fusions with the thioredoxin and His-tag or as C-terminal
10 fusions with an His-tag. The expressed recombinant
proteins were purified from supernatant fractions obtained from centrifugation of sonicated IPTG-induced E. coli cultures using a His-Bind metal chelation resin (QIAgen, Chatsworth, CA). The gene products generated are listed in
15 the table 3. The gene products corresponding to the N-terminal region including the signal sequence are designated as Lapidated-proteins or lipoproteins (L-proteins). The gene products corresponding to the N-terminal region lacking the signal sequence are identified
20 as protein without signal sequence (w/o ss).
Table 2. List of PCR oligonucleotide primers 25
Primer SEQ. ID. Sequence 5' - 3' Nucleotide position Restriction sites
OCRR 479 17 cagtagatctgtgcctatgcactaaac SEQ ID 1:61-78 BgiII
OCRR 480 18 gatctctagactactgctattccttacgctatg SEQID 11 :4909-4887 Xbal
OCRR 497I 19 atcactcgagcattacctggataatcctgt SEQID 1 :1525-1506 Xhol
OCRR 498 20 ctgctaagcttatgaaagatttagat SEQID 1:1534-1548 Hindffl
48

WO 00/39299

PCT/CA99/0121I


OCRR 499 21 gatactcgagctgctattccttac SEQID 11 :4906-4893 Xhol
HAMJ172 22 gaatctcgagttaagctgctgctaattc SEQ ID 1 : 675-661 Xhol
HAMJ247 23 gacgctcgagcgctatgaaatcagataaattc SEQ ID1:3117-3096 Xhol
HAMJ248 24 gacgctcgagggcattacctggataatcctgttcatg SEQ ED1 :1527-1501 Xhol
HAMJ249 25 cagtagatctcttcatcatttattgaaaagagg SEQ ID 11: 1749-1771 Bglll
HAMJ278 26 ttatttcttccatatggacttgacagaagagcaaattaag SEQ ID1 .-1414-1437 Ndel
HAMJ279 27 cgccaagcttcgctatgaaatcagataaattc SEQ ID1 :3117-3096 HindIII
HAMJ280 28 cgccaagcttttccacaatataagtcgattgatt SEQ ID1 :2400-2377 HindIII
HAMJ281 29 ttatttcttccatatggaagtacctatcttggaaaaagaa SEQ ID1 :2398-2421 Ndel
HAMJ300 30 ttatttcttccatatggtgcctatgcactaaaccagc SEQ ID 1:62-82 Ndel
HAMJ313 31 ataagaatgcggccgcttccacaatataagtcgattgatt> SEQ ID1 =2400-2377 NotI
OCRR 487 32 cagtagatctgtgcttatgaactaggtttgc SEQ ID 3 :58-79 BglII
OCRR 488 33 gatcaagcttgctgctacctttacttactctc SEQ ID12 :2577-2556 HindIII
HAMJ171 34 ctgagatatccgttatcgttcaaacc SEQ ID 3:1060-1075 EcoRV
HAM J 251 35 ctgcaagcttttaaaggggaataatacg SEQ ID3:1059-1045 HindIII
HAMJ264 36 cagtagatctgcagaagccttcctatctg SEQ ID 3 :682-700 BgiII
HAMJ282 37 tcgccaagcttcgttatcgttcaaaccattggg SEQ ID 3:1060-1081 HindIII
HAMJ283 38 ataagaatgcggccgccttactctcctttaataaagccaat agtt SEQ ID3 :2520-2492 Ndelf
HAMJ284 39 catgccatggacattgatagtctcttgaaacagc SEQ ID 3 :856-880 Ncol
HAMJ285 40 cgccaagcttcttactetcctttaataaagccaatag SEQ ID3 :2520-2494 Hindffl
HAMJ286 41 cgacaagcttaacatggtcgctagcgttacc SEQ ID 3:2139-2119 HindIII
HAMJ287 42 cataccatgggcctttatgaggcacctaag SEQ ID3:2014-2034 Ncol
HAMJ288 43 cgacaagcttaagtaaatcttcagcctctctcag SEQ ID3 :2376-2353 HindIII
49

WO 00/39299

PCT/CA99/01218


HAMJ289 44 gataccatggctagcgaccatgttcaaagaa SEQ ID3 :2125-2146 Ncol
HAMJ290 45 cgccaagcttatcatccactaacttgactttatcac SEQ ID 3:1533-1508 Hindffl
HAMJ291 46 cataccatggatattcttgccttcttagctccg SEQ ID3:1531-1554 Ncol
HAMJ301 47 catgccatggtgcttatgaactaggtttgc SEQ ID 3 :59-79 Ncol
HAMJ302 48 cgccaagctttagcgttaccaaaaccattatc SEQ ID3 :2128-2107 HindIII
HAMJ160 49 gtattagatctgttcctatgaacttggtcgtcacca SEQ ID 13 : 172-196 BgiII
HAMJ186 50 cgcctctagactactgtataggagccgg SEQ ID 13: 2460-2443 Xbal
HAMJ292 51 catgccatggaaaacatttcaagccttttacgtg SEQ ID 11: 754-778 Ncol
HAMJ293 52- cgacaagcttctgtataggagccggttgactttc SEQ ID 11:2457-2434 HindIII
HAMJ294 53 catgccatggttcgtaaaaataaggcagaccaag SEQ ID 11 : 2038-2062 Ncol
HAMJ297 54 catgccatggaagcctattggaatgggaag SEQ ID 11 : 622-642 Ncol
50

Table 3. Lists of truncated BVH-3 and BVH-11 gene products generated from S^ pneumoniae SP64




PCR-primer sets Protein designation Identification (encoded amino acids) SEQ. ID.NO. Cloning vector
OCRR479-OCRR480 BVH-3M BVH-3 w/o ss (21-1039) 55 PSL301
OCRR479-OCRR497 BVH-3AD BVH-3 N' end w/o ss (21-509) 56 pSL301
HAMJ2 4 8-HAMJ2 4 9 L-BVH-3AD BVH-3 N' end (1-509) 57 pET-21(+)
OCRR498-OCRR499 BVH-3B BVH-3 C' end (512-1039) 10 pSL301
OCRR479-HAMJ172 BVH-3C BVH-3 N' end w/o ss (21-225) 59 pET-32 c(+)
OCRR487-OCRR488 BVH-11M BVH-11 w/o s§ (20-840) 60 pCMV-GH
HAMJ251-OCRR4 87 BVH-11A BVH-11 N' end w/o ss (20-353) 61 pET-32 c (+)
HAMJ171-OCRR488 BVH-11B BVH-11 C' end (354-840) 62 pET-32 a(+)
HAMJ264-OCRR488 BVH-11C BVH-11 C' end (228-840) 63 pET-32 a(+)
HAMJ278-HAMJ279 NEW1 BVH-3 C' end (472-1039) 64 pET-21b(+)
HAMJ278-HAMJ2 80 NEW2 BVH-3 C' end (472-800) 65 pET-21b(+)
HAMJ281-HAMJ279 NEW3 BVH-3 C' end (800-1039) 66 pET-21b(+)
HAMJ284-HAMJ285 NEW4 BVH-11 C' end (286-840) 67 pET-21d(+)
HAMJ2 84-HAMJ286 NEW5 BVH-11 internal (286-713) 68 pET-21d(+)
HAMJ287-HAMJ2 88 NEW 6 BVH-11 internal (672-792) 6 9 pET-21d(+)
HAMJ2 85-HAMJ2 89 NEW7 BVH-11 internal (709-840) 70 pET-21d(+)
HAMJ2 84-HAMJ290 NEW8 BVH-11 internal (286-511) 71 pET-21d(+)

HAMJ286-HAMJ291 NEW9 BVH-11 internal (511-713) 72 pET-21d(+)
HAMJ160-HAMJ186 BVH-11-2M BVH-11-2 w/o ss (20-838) 73 pSL30l
HAMJ292-HAMJ2 93 NEW10 BVH-11-2 C' end (271-838) 74 pET-21d(+)
HAMJ293-HAMJ294 NEW11 BVH-11-2 C' end (699-838) 75 pET-21d(+)
HAMJ282-HAMJ2 83 BVH-11B BVH-11 C' end (354-840) 62 pET-21b(+)
HAMJ286-HAMJ297 NEW14 BVH-11-2 internal (227-699) 77 pET-21d(+)
HAMJ300-HAMJ313 NEW15 BVH-3 N' end w/o ss (21-800) 78 pET-21b(+)
HAMJ301-HAMJ302 NEW16 BVH-11 N' end w/o ss (20-709) 79 pET-21d(+)

WO 00/39299

PCT/CA99/012I8

EXAMPLE 9
This example describes the isolation of monoclonal antibodies (Mabs) and the use of Mabs to characterize BVH-
5 3, BVH-11 and BVH-11-2 protein epitopes.
Female BALB/c mice (Charles River) were immunized subcutaneously with BVH-3, BVH-11 or BVH-11-2 gene products from S. pneumoniae strain SP64 in presence of 15 /µg of
10 QuilA adjuvant (Cedarlane Laboratories Ltd, Hornby, Canada). One set of mice (fusion experiment 1) were immunized on day 1 and 14 with 25 µg of affinity purified
thioredoxin-His·Tag-BVH-3M fusion protein. A second group of mice (fusion experiment 2) were immunized three times at
15 three-week intervals with 25 µg of affinity purified
thioredoxin-His«Tag-BVH-HM. A third group of mice (fusion experiment 3) were immunized on day 1 and day 15 with 25 µg of affinity purified thioredoxin-His«Tag-BVH-ll-2M fusion protein. A fourth group of mice (fusion experiment 4) were
20 immunized on day 1 with 25 µg of affinity purified
thioredoxin-His»BVH-11B fusion protein and boosted by
intravenous injection on day 16 and on day 37 with recombinant BVH-11B in PBS. Three to four days before fusion, mice were injected intravenously with 25 µg of the
25 respective antigen suspended in PBS alone. Hybridomas were produced by fusion of spleen cells with nonsecreting SP2/0 myeloma cells as previously described by J. Hamel et al. [J. Med. Microbiol., 23, ppl63-170 (1987)]. Culture supernatants of hybridomas were initially screened by
30 enzyme-linked-immunoassay according to the procedure
described by Hamel et al. (Supra) using plates coated with preparations of purified recombinant proteins or suspensions of heat-killed s. pneumoniae cells. Positive hybridomas selected on the basis of ELISA reactivity with a
53

WO 00/39299

PCT/CA99/01218

variety of antigens were then cloned by limiting dilutions, expanded and frozen.
Hybridomas were tested by ELISA or Western immunoblotting
5 against BVH-3 and BVH-11 gene products in order to
characterize the epitopes recognized by the Mabs. BVH-3 and BVH-11 shared common epitopes with 6 Mabs (H3-1-F9, H3-1-D4, H3-1-H12, H11-1-E7, H11-1-H10 and H11-1.1-G11) showing reactivities with both proteins (Table 4). BVH-11
10 and BVH-11-2 molecules from S. pneumoniae SP64 shared
common epitopes not present on BVH-3 with Mabs (3A1, 13C11, 10H10, 1D8, 10G9, 10A2, 3E8, 10D7, 2H7 and 6H7) reactive with both, BVH-11 and BVH-11-2, recombinant proteins (Table 5) .
15
Table 4. Reactivity of BVH-3-immunoreactive Mabs with a
panel of BVH-3 and BVH-11 gene products

MAbs a. Immunoreactivity with
BVH-3M 21-1039 BVH-3A 21-509 BVH-3B 512-1039 BVH-3C 21-225 NEW2 472-800 NEW3 800-1039 BVH-11M 20-840
H3-1-F9 + + - + - - +
H3-1-D4 + + - + - - +
H3-1-H12 + + - + - - +
H3-2-G2 + + - - - - -
H3-3-A1 + + - - - - -
H3-4-D3 + - + - - + -
H11-1-E7 + + - + - - +
Hll-1-H10 + + + +
Hll-1.1-G11 + + + + +
54

WO 00/39299

PCT/CA99/01218

Table 5. Reactivity of Mabs raised against BVH-11-2 protein from S. pneumoniae strain SP64 with a panel of BVH-
11 gene products

Mabs" b.Immunoreactivity with
c.BVH-11 products d.BVH-11-2 products
BVH-11M 20-840 NEW8 286-511 NEW9 511-713 BVH-11B 354-840 BVH-11-2 20-838 NEW10 271-838 NEW11 699-838 NEW14 227-699
3A1 + + - + + + - +
13C1 + + + + + + - +
10H10 + + + + + + - +
1D8 + + - + +. + - +
10G9 + - - + + + - +
10A2 + - - + + + - +
3E8 + - - + + + - +
10D7 + - - + + + - +
2H7 + - - -. + - - -
6H7 + - - - + - - -
3A4 - - - - + + + -
14H6 - - - - + + + -
7G2 - - - -> + + - +
13H10 - - - - + - - +
7E8 - - - - + - - -
7H6 - - - - + - - -
· Mabs listed in this table were not reactive with recombinant BVH-3 molecule 5
The results obtained from the immunoreactivity studies of the Mabs (Table 4 and Table 5) are in agreement with the protein sequences derived from the respective gene sequences. Indeed the Mabs cross-reactive with BVH-3 and
10 BVH-11 molecules recognized BVH-3C protein corresponding to the conserved region, and BVH-11 and BVH-11-2 specific Mabs were reactive with epitopes located on variable parts of these molecules. BVH-3 and BVH-11, and BVH-11 and BVH-11-2 can be distinguished by their reactivity with Mabs.
15
EXAMPLE 10
55

WO 00/39299

PCT/CA99/01218

This example illustrates the simultaneous expression of BVH-3 and BVH-11 gene products by S. pneumoniae.
A standard Western blot technique was used to investigate
5 whether BVH-3 and BVH-11 genes were expressed in S.
pneumoniae. S. pneumoniae strain SP64 and SP63 were grown overnight at 37°C in 5% C02 on chocolate agar plates, bacteria were suspended in PBS and heat-killed at 56°C for 20 min. For the preparation of antigens, suspensions of S^
10 pneumoniae were treated with sample buffer containing SDS and 2-mercaptoethanol for 5 min at 100°C. Pneumococcal protein antigens were resolved by SDS-PAGE electrophoresis according to the method of Laemmli [Nature, 227, pp. 680-685 (1970)]. After SDS-PAGE, the proteins were transferred
15 electrophoretically from the gel to nitrocellulose paper by the method of Towbin [Proc. Natl. Acad. Sci. USA, 76, pp. 4350-4354 (1979)] and probed with mouse antiserum or monoclonal antibodies. The detection of antigens reactive with the antibodies was performed by indirect enzyme-
20 immunoassay using conjugated-anti-mouse immunoglobulins and a colour substrate. When antiserum raised to recombinant BVH-3 was tested against S. pneumoniae SP64 antigens, two reactive bands having apparent molecular masses of 127 kDa and 99 kDa were detected. Bands having the same apparent
25 molecular masses were also detected when Mabs H3-1-F9, H3-1-D4, H3-1-H12, H11-1-E7, H11-1-H10 and H11-1.1-G11 were used individually as immunological probes. In contrast, Mabs specific for the BVH-3 molecule detected the 127 kDa
it-*
band only and Mabs specific for BVH-11 detected the 99 kDa
30 band only thus confirming the identity of the 127 and 99 kDa bands as BVH-3 and BVH-11, respectively. These studies provide evidence that BVH-3 and BVH-11 proteins are simultaneously present on S. pneumoniae. Moreover, the results are consistent with our previous observations that
35 BVH-3 and BVH-11 possess epitopes that are common to both proteins and epitopes that are exclusive to either protein.
56

WO 00/39299

PCT/CA99/012I8

In S. pneumoniae SP64, mature BVH-3, BVH-11 and BVH-11-2 are proteins of 1019, 821 and 819 amino acids with predicted molecular mass of 112.5 kDa, 92.4 kDa, and 91.7
5 kDa, respectively. Although there is a discrepancy between the molecular mass predicted from the sequence and the molecular mass calculated on SDS-PAGE, BVH-3 can be distinguished from BVH-11 by its higher molecular mass. Moreover, BVH-3 molecules from S. pneumoniae strain SP63
10 have an apparent molecular mass of 112 kDa in SDS-PAGE
compared to 127 kDa for BVH-3 of SP64 strain. This data is consistent with the deletion of a stretch of 177 amino acid residues in BVH-3 of S. pneumoniae strain SP63 .
15
EXAMPLE 11
This example describes the protection conferred in experimental infection of mice vaccinated with recombinant
20 BVH-3 or BVH-11 gene products.
Groups of 7 or 8 female BALB/c mice (Charles River) were immunized subcutaneously three times at three-week intervals with either affinity purified thioredoxin-
25 His·Tag-BVH-3M fusion protein, affinity purified
thioredoxin-His·Tag-BVH-11M fusion protein or, as control, with QuilA adjuvant alone in PBS. Twelve to 14 days following the third immunization, the mice were challenged . intravenously with S. pneumoniae WU2 strain or intranasally
30 with P4241 strain. Samples of the S. pneumoniae challenge inoculum were plated on chocolate agar plates to determine the CFU and to verify the challenge dose. The challenge dose was approximately 106 CFU. Deaths were recorded for a period of 14 days and on day 14 post-challenge, the
35 surviving mice were sacrificed and blood samples tested for
57

WO 00/39299

PCT/CA99/01218

the presence of S. pneumoniae organisms. The survival data are shown in Tables 6 and 7.
5
Table 6. Protection mediated by recombinant BVH-3M and BVH-11M proteins in experimental infection with virulent S. pneumoniae WU2

Experiment Immunogen Alive : dead" Median days alive
1 BVH-3M none 8 : 0 0 : 8 >141
2 BVH-11M none 8 : 0 0 : 8 >14 1
10 * The number of mice alive : the number of mice dead on day 14 post-challenge.
Table 7. Protection mediated by recombinant BVH-3M and BVH-11M proteins in experimental pneumonia with virulent S.
15 pneumoniae P4241

Experiment Immunogen Alive : dead" Median day alive
1 BVH-3M none 6 : 1 1 : 7 >14 4.5
2 BVH-3MBVH-11Mnone 8 : 08 : 00 : 8 >14>14 4
"The number of mice alive : the number of mice dead on day 14 post-challenge.
All mice immunized with recombinant BVH-3M or BVH-11M
20 protein survived to infection with WU2 while none of the
control mice given adjuvant alone survived. All except one mice immunized with recombinant BVH-3M or BVH-11M protein survived to infection with P4241 while only one control mice given adjuvant alone survived. All hemocultures from

WO 00/39299

PCT/CA99/01218

surviving mice were negative at day 14 post-challenge. These results clearly indicate that both, BVH-3M and BVH-11M, elicit protective anti-pneumococcal immune responses in mice. The fact that these proteins are highly conserved
5 among S. pneumoniae isolates emphasize the potential of BVH-3 and BVH-11 as universal vaccine candidates. Indeed, the BVH-3 and BVH-11 proteins from serogroup 6 S. pneumoniae strain SP64 elicited protection against pneumococcal infections with strains of different capsular
10 serotypes.
Ideally, a vaccine that could protect against pneumococcal disease, could protect against meningitis, otitis media, bacteremia and pneumonia. BVH-3 and BVH-11 were protective
15 against lethal systemic- and pneumonia-infection models
thus suggesting that, in humans, BVH-3- and BVH11-protein-based vaccines could reduce the incidence of a wide spectrum of disease caused by virtually all S. pneumoniae independently of the capsular serotype.
20
Data from Tables 6 and 7 clearly demonstrate that BVH-3 and BVH-11 were, both, protection-eliciting molecules of S. pneumoniae. It was not known, however, whether protection can be mediated by specific sequences that were not shared
25 oh BVH-3 and BVH-11 molecules. Groups of female BALB/c mice (Charles River) were immunized subcutaneously three times at three-week intervals with either affinity purified thioredoxin-His·Tag- BVH-3AD, -BVH-3B or -BVH-3C fusion protein in presence of 15 µg of QuilA adjuvant (Cedarlane
30 Laboratories Ltd, Hornby, Canada). Control mice were immunized with QuilA adjuvant alone in PBS or affinity purified thioredoxin-His«Tag or thioredoxin-His»Tag-fusion protein (His-Thio) in presence of QuilA.
35 To determine the protective ability of a set of truncated proteins, termed NEW4, NEW5, NEW6, NEW7, NEW8, NEW9, NEW10,
59

WO 00/39299

PCT/CA99/01218

NEW11, NEW14 and BVH-11B, groups of female BALB/c mice (Charles River) were immunized subcutaneously two times at three-week intervals with 25 µg of either affinity purified
His·Tag-fusion protein in presence of 15 µg of QuilA
5 adjuvant. Ten to 14 days following the last immunization, the mice were challenged with virulent S. pneumoniae. Our results indicate that, BVH-3B, a truncated BVH-3 molecule consisting of amino acids 512-1039, elicited protection against the mouse-virulent strains WU2 and P4241.
10 Similarly, BVH-11B, NEW4 and NEW5 molecules, three
truncated BVH-11 molecules consisting of amino acids 354-840, amino acids. 286-840 and amino acids 286-713, respectively, elicited protection against experiment intravenous challenge with WU2 and intranasal challenge
15 with P4241. Moreover, vaccination with NEW10 and NEW14, consisting of amino acids 272-838 and amino acids 227-699 from BVH-11-2 molecule also resulted in protection against death with the pneumococcal strains. These results indicate that the region comprising 428 amino acids
20 extending from amino acids 286-713 and amino acids 272-699 on S. pneumoniae SP64 BVH-11 and BVH-11-2 protein sequences, respectively, contains protective epitopes. This region is highly conserved with a global 91% identity and 94% homology among thirteen BVH-11 protein sequences.
25
60

WO00/39299

PCT/CA99/01218

Table 8. Evaluation of protection elicited by vaccination of mice with BVH-3 and BVH-11 gene products



























61

WO 00/39299

PCT/CA99/01218

EXAMPLE 12
This example described the cloning and expression of a
5 chimeric gene encoding for a chimeric polypeptide
corresponding to the carboxy-terminal region of BVH-3 in fusion at the C end to the carboxy-terminal region of BVH-11 and the additive protection observed after vaccination with a chimeric polypeptide.
10
It is clear from the studies described above that BVH-3 and BVH-11 are serologically distinct molecules simultaneously present on S. pneumoniae. The results of immunological studies of mice indicate that both proteins are good
15 vaccine candidates. These proteins have the potential to provide protection against all pneumococci, regardless of serotype. Even though the two proteins share epitopes and sequences, they have different characteristics and may serve different biological functions. Thus, immunization
20 against the two proteins may provide a higher level of protection than that imparted by each individually. To examine this, several avenues where full-length or truncated BVH-3 and BVH-11 are administered in combination or in conjugation can be explored. Here we describe the
25 genetic engineering of a BVH-3-BVH-11 fusion gene and protein, termed NEW12 (SEQ ID NO:76 and SEQ ID NO:58, respectively), and the potential use of NEW12 protein as a vaccine.
30 BVH-3 and BVH-11 gene fragments corresponding to the 3'end of the genes were amplified by PCR using pairs of oligonucleotides engineered to amplify fragments spanning nucleotides 1414 to 3117(SEQ ID NO: 1) and nucleotides 1060 to 2520 (SEQ ID NO: 3) from S. pneumoniae strain SP64 BVH-3
35 and BVH-11 genes, respectively. The primers used, HAMJ27 8 and HAMJ279; HAMJ282 and HAMJ283 had a restriction
62

WO 00/39299

PCT/CA99/01218

endonuclease site at the 5' end, thereby allowing directional in-frame cloning of the amplified product into the digested pET21b(+) plasmid vector (Table 2). PCR-amplified products were digested with restriction
5 endonucleases and ligated to linearized plasmid pET21b(+) vector digested likewise. The resultant plasmid constructs were confirmed by nucleotide sequence analysis. The recombinant pET21b(+) plasmid containing the Ndel-HindIII BVH-3 PCR product was linearized by digestion with the
10 restriction enzymes HindIII and NotI for the in-frame
cloning of the HindIII-NotI DNA fragment obtained from the recombinant pET21(+) vector containing the BVH-11 gene fragment. Clones were first stabilized in E^ coli DH5CC before introduction into E. coli BL21(λDE3) for expression
15 of a chimeric pneumococcal protein molecule. The
recombinant chimeric polypeptide, termed NEW 12, was expressed as C-terminal fusion with an His-tag. The expressed recombinant NEW 12 protein was purified from supernatant fractions obtained from centrifugation of
20 sonicated IPTG-induced E. coli cultures using a His-Bind metal chelation resin (QIAgen, Chatsworth, CA).
According to the same procedure described above, it is possible to construct other chimeric polypeptides, as a
25 result of a simultaneous expression of New 1 and New 4, New 1 and New 5, New 1 and New 10, or New 1 and New 14. The construction can be with New 1 upstream or downstream of New 4, New 5, New 10, BVH-11B or New 14. It is also ** possible to construct other chimeric polypeptides as a
30 result of a simultaneous expression of more than two
fragments of either genes of BVH-3, BVH-11 or BVH-11-2.
Groups of 8 female BALB/c mice (Charles River) were immunized subcutaneously two times at three-week intervals
35 with 25 µg of either affinity purified His»Tag-fusion NEWl,
63

WO 00/39299

PCT/CA99/01218

BVH-11B or NEW12 protein in presence of 15 µg of QuilA adjuvant. Ten to 14 days following the last immunization, the mice were challenged with virulent S. pneumoniae. As demonstrated before, NEWl and BVH-11B molecules comprising
5 amino acids 472 to 1039 from BVH-3 protein and amino acids 354-840 from BVH-11 protein, respectively, correspond to portions of the proteins capable of eliciting a protective immune response. To determine if a chimeric polypeptide would significantly improve the protection compared with
10 those seen for the individual counterparts, the challenge dose was adjusted in a manner that protection was not expected with NEWl and BVH-11B molecules. Interestingly, the chimeric NEW12 protein, elicited protection against the mouse-virulent strains WU2 and P4241. Seven out of 8 mice
15 immunized with NEW12 were still alive 10 days after the
challenge while 28 out of 32 mice immunized with NEWl, BVH-11B, BVH-3M or adjuvant alone were dead by five days post-challenge. Thus, vaccination of mice with NEW12 provided the highest degree of protection against WU2 challenge.
20 These results indicate that immunization with a chimeric polypeptide and possibly a combination of BVH-3 and BVH-11 gene products can provide additional protection to that obtained by administration of BVH-3 or BVH-11 antigens alone.
25
Table 9. Evaluation of protection elicited by vaccination of mice with the chimeric NEW12 molecule





64

WO 00/39299

PCT/CA99/01218

EXAMPLE 13 5
This example illustrates the identification of additional BVH-3 and BVH-11 related sequences in Streptococcus species other than S. pneumoniae.
10 It was previously shown that BVH-3, BVH-11 and BVH-11-2 are a family of related proteins sharing common sequences. Homology searches were performed with the nucleotide sequence from the conserved region of these genes and compared with GenBank and EMBL sequences using FASTA. The
15 most significant homology was observed with a 2.469-kb gene coding for a calculated 92-kDa protein (SEQ ID NO: 81) of unknown function in S. agalactiae also called group B streptococcus or GBS. The gene was designated BVH-71. A protein demonstrating 99.2% identity and 99.5% similarity
20 with that of GBS was also identified in S. pyogenes also
called group A streptococcus or GAS (SEQ ID NO: 83). The 5' region of the BVH-71 sequences (SEQ ID NO: 80 and SEQ ID NO: 82), spanning nucleotides 1 to 717, demonstrated 58 and 60% identity with the conserved regions of BVH-3
25 (nucleotides 1 to 675) and BVH-11 (nucleotides 1 to 684) genes respectively. The first 239 amino acids of the translated sequences of the GBS and GAS BVH-71 open reading frames are 51 and 54% identical to the first 225 and 228 amino acids of BVH-3 and BVH-11, respectively. In addition
30 to structural similarities, streptococcal BVH-3, BVH-11 and BVH-71 proteins also share antigenic epitopes. A 97-kDa band Was revealed on Western blots of GAS or GBS whole cells, using Mab Hll-1.1-G11 reactive with the BVH-3 and BVH-11 conserved regions. Similarly, GAS and GBS
65

WO 00/39299

PCT/CA99/01218

recombinant BVH-71 proteins were detected in Western immunoblot analysis.
These results indicate that BVH-71, BVH-3 and BVH-11 proteins might share similar functions. Our results also
5 suggest that BVH-71 proteins can be used as protein vaccine components of anti-streptococcus. In a further embodiment BVH-71 proteins can be used as protein vaccine components of anti-GAS or anti-GBS vaccines.
66

WO 00/39299

PCT/CA99/01218

What is claimed is:

1. An isolated polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide having a sequence chosen from: SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.

2. A polynucleotide according to claim 1, wherein said
polynucleotide encodes a polypeptide having at least 95%
identity to the second polypeptide.
3. An isolated polynucleotide encoding a polypeptide capable
of generating antibodies having binding specificity for a
polypeptide having a sequence chosen from: SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments,, analogs or derivatives thereof.
4. An isolated polynucleotide that is complementary to the y polynucleotide of claim 1.
5. An isolated polynucleotide that is complementary to the J polynucleotide of claim 3.
6. The polynucleotide of claim 1, wherein said polynucleotide is DNA.
7. The polynucleotide of claim 3, wherein said polynucleotide is DNA.
8. The polynucleotide of claim 1, wherein said polynucleotide is RNA.
9. The polynucleotide of claim 3, wherein said polynucleotide is RNA.
67

WO 00/39299

PCT/CA99/01218

10. A vector comprising the polynucleotide of claim 1, / wherein said DNA is operably linked to an expression control region.

11. A vector comprising the polynucleotide of claim 3,
wherein said DNA is operably linked to an expression control region.

12. A host cell transfected with the vector of claim 10.

13. A host cell transfected with the vector of claim 11.
14. A process for producing a polypeptide comprising culturing a host cell according to claim 12 under
conditions suitable for expression of said polypeptide.
15. A process for producing a polypeptide comprising
culturing a host cell according to claim 13 under
condition suitable for expression of said polypeptide.
16. An isolated polypeptide having at least 70% identity to a
second polypeptide having an amino acid sequence chosen
from: SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
17. An isolated polypeptide capable of generating antibodies having binding specificity for a second polypeptide ,. having a sequence chosen from: SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
18. An isolated polypeptide having an amino acid sequence chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75,
77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
68

WO 00/39299

PCT/CA99/01218

19. An isolated polypeptide according to claim 18, wherein the
N-terminal Met residue is deleted.
20. An isolated polypeptide according to claim 18, wherein the
secretory amino acid sequence is deleted.
21. A chimeric polypeptide comprising two or more
polypeptides chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55 to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof; provided that the polypeptides or fragments, analogs or derivatives thereof are linked as to form a chimeric polypeptide.
22. A chimeric polypeptide comprising two or more polypeptides
chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68, 69,
72, 74, 77 or fragments, analogs or derivatives thereof; provided that the polypeptides or fragments, analogs or derivatives thereof are linked as to form a chimeric polypeptide.
23. A chimeric polypeptide of formula (I):
A-(B)B-(C)n-D (I)
Wherein;
m is 0 or 1,
n is 0 or 1,
A is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55
to 75, 77 to 79, 81, 83 or fragments, analogs or
derivatives thereof;
B is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55
to 75, 77 to 79, 81, 83 or fragments, analogs or
derivatives thereof;
C is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55
to 75, 77 to 79, 81, 83 or fragments, analogs or
derivatives thereof; and
D is chosen from SEQ ID NOs: 2, 4, 6, 8, 10, 14, 16, 55
69

WO 00/39299

PCT/CA99/012I8

to 75, 77 to 79, 81, 83 or fragments, analogs or derivatives thereof.
24. A chimeric polypeptide of formula (I):
A-(B),-(C),-D (I)
Wherein; m is 0 or 1, n is 0 or 1, A is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68,
69, 72, 74, 77 or fragments, analogs or derivatives
thereof;
B is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68,
69, 72, 74, 77, or fragments, analogs or derivatives
thereof;
C is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68,
69, 72, 74, 77 or fragments, analogs or derivatives
thereof; and *
D is chosen from SEQ ID NOs :10, 58, 60, 62, 64, 67, 68,
69, 72, 74, 77 or fragments, analogs or derivatives
thereof.
25. A vaccine composition comprising a polypeptide according
to any one of claims 16 to 24 and a pharmaceutically
acceptable carrier, diluent or adjuvant.
26. A method for therapeutic or prophylactic treatment of
meningitis, otitis media, bacteremia or pneumonia
infection in an individual susceptible to meningitis,
otitis media, bacteremia or pneumonia infection comprising
administering to said individual a therapeutic or
prophylactic amount of a composition according to claim
25.
27. A method for therapeutic or prophylactic treatment of
streptococcal bacterial infection in an individual
70

WO 00/39299

PCT/CA99/01218

susceptible to streptococcal infection comprising administering to said individual a therapeutic or prophylactic amount of a composition according to claim 25.
28. A method according to claim 26, wherein said individual is
a mammal.
29. A method according to claim 27, wherein said individual is
a human.
30. A method according to claim 22, wherein said bacterial
infection is S.pneumoniae, group A streptococcus [pyogenes), group B streptococcus (GBS or agalactiae), dysgalactiae, uberis, nocardia or Staphylococcus aureus.
31. A method according to claim 26, wherein said bacterial
infection is S.pneumoniae.

32. Use of a vaccine composition according to claim 25 for
the prophylactic or therapeutic treatment of Streptococcal infection in an animal susceptible to or infected with streptococcal infection comprising administering to said animal a prophylactic or therapeutic amount of the composition.
71

33. An isolated polynucleotide encoding a polypeptide substantially as herein described with reference to the foregoing examples.
34. A method for therapeutic or prophylactic treatment substantially as herein described with reference to the foregoing examples.
Dated this 11th Day of May, 2005
ATTORNEYS FOR THE APPLICANTS
(RANJNA MEHTA-DUTT) OF REMFRY & SAGAR

Documents:

410-mumnp-2005-claims.doc

410-mumnp-2005-claims.pdf

410-MUMNP-2005-CORRESPONDENCE 4-8-2008.pdf

410-MUMNP-2005-CORRESPONDENCE(16-12-2008).pdf

410-MUMNP-2005-CORRESPONDENCE(26-5-2009).pdf

410-mumnp-2005-correspondence-received-ver-070207.pdf

410-mumnp-2005-correspondence-received-ver-101105.pdf

410-mumnp-2005-correspondence-received-ver-110505.pdf

410-mumnp-2005-correspondence-received-ver-140207.pdf

410-mumnp-2005-correspondence-received-ver-231105.pdf

410-mumnp-2005-correspondence-received-ver-290107.pdf

410-mumnp-2005-correspondence-received.pdf

410-mumnp-2005-description (complete).pdf

410-mumnp-2005-drawings.pdf

410-MUMNP-2005-FORM 1(16-12-2008).pdf

410-mumnp-2005-form 13(16-12-2008).pdf

410-mumnp-2005-form 13(26-5-2009).pdf

410-MUMNP-2005-FORM 16(10-6-2011).pdf

410-MUMNP-2005-FORM 2(TITLE PAGE)-(16-12-2008).pdf

410-MUMNP-2005-FORM 24 4-8-2008.pdf

410-mumnp-2005-form 6(16-12-2008).pdf

410-mumnp-2005-form-1.pdf

410-mumnp-2005-form-18.pdf

410-mumnp-2005-form-2.pdf

410-mumnp-2005-form-3-ver-070207.pdf

410-mumnp-2005-form-3.pdf

410-mumnp-2005-form-5.pdf

410-mumnp-2005-form-pct-ipea-401.pdf

410-mumnp-2005-form-pct-ipea-409.pdf

410-mumnp-2005-form-pct-ipea-416.pdf

410-mumnp-2005-form-pct-isa-206.pdf

410-mumnp-2005-form-pct-separate sheet-409.pdf

410-MUMNP-2005-OTHER DOCUMENTS 4-8-2008.pdf

410-mumnp-2005-pct-correspondence-others.pdf

410-mumnp-2005-pct-search report.pdf

410-MUMNP-2005-POWER OF AUTHORITY(16-12-2008).pdf

abstract1.jpg

Seq Lst 83 seqs 438IN1.TXT


« Previous Patent
Next Patent »
Patent Number 237235
Indian Patent Application Number 410/MUMNP/2005
PG Journal Number 51/2009
Publication Date 18-Dec-2009
Grant Date 10-Dec-2009
Date of Filing 12-May-2005
Name of Patentee ID BIOMEDICAL CORPORATION
Applicant Address 525 CARTIER BOULEVARD WEST, LAVAL, QUEBEC H7V 3S8
Inventors:
# Inventor's Name Inventor's Address
1 JOSEE HAMEL 2401 MARITAIN, SILLERY, QUEBEC, CANADA G1T 1N6
2 BERNARD R. BRODEUER 2401 MARITAIN, SILLERY, QUEBEC, CANADA G1T 1N6
3 CLEMENT RIOUS 12 CROISSANT BARABE, I1E BIZARD, QUEBEC, CANADA H9E 1J1
4 ISABELLE PINEAU 3035 RUE DES CHATELETS, APT. 201, STE-FOY, QUEBEC, CANADA G1V 3Y7
5 DENIS MARTIN 4728-G GANBOURY, ST. AUGUSTIN-DE-DESMAURES, QUEBEC, CANADA G3A 1E9
6 NATHALIE CHARLAND 4340 RUE DU RAPIDE, APP. 8, CHARNY, QUEBEC, CANADA G6X 3N6
PCT International Classification Number C12N15/31
PCT International Application Number PCT/CA99/01218
PCT International Filing date 1999-12-20
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 60/113,800 1998-10-23 U.S.A.