Indian Patents
Title of Invention

RECOMBINANT SUPER COMPOUND INTERFERON PREPARATION AND USES THEREOF
Abstract This invention provides a method for producing interferon with changed spatial configuration and enhanced antiviral activity comprising steps of: (a) Introducing nucleic acid molecule which codes for said interferon with preferred codons for expression to an appropriate host; and (b) Placing the introduced host in conditions allowing expression of said interferon. This invention also provides the recombinant super-compound interferon or a functional equivalent thereof resulting from this method and various uses of said interferon.
Full Text FORM 2
THE PATENTS ACT, 1970
(39 of 1970)
COMPLETE SPECIFICATION
[See section 10]
"RECOMBINANT SUPER-COMPOUND INTERFERON PREPARATION AND USES THEREOF"







(a) SICHUAN BIOTECHNOLOGY RESEARCH CENTER
(b) Building A, Suite 902, No.8, Yusha Road, Chengdu, Sichuan, 610017, P.R.China.
(c) Chinese company incorporated under the Chinese Law
The following specification describes the nature of this invention and the manner in which it is to be performed:

5 MAR 2004







RECOMBINANT SUPER-COMPOUND INTERFERON PREPARATION AND USES
THEREOF
The application is a continuation-in-part application of 5 U.S. Serial No. 60/498,785 filed on August 28, 2003 and U.S. Serial No. 60/498,923 filed on August 28, 2003, the contents of which are incorporated by reference here into this application.
Throughout this application, various references are
referred to Disclosures of these publications in their
entireties are hereby incorporated by reference into this
application in order to more fully describe the state of
the art to which this invention pertains.

FIELD OF THE INVENTION
This invention is related to a method for producing
recombinant super-compound interferon (rSIFN-co) with
changed spatial configuration. One characteristic of rSIFN-
co in this invention is that it cannot only inhibit DNA
(deoxyribonucleic acid) duplication of the hepatitis B
virus but also the secretion of HBsAg and HBeAg.
I BACKGROUND OF THE INVENTION
rSIFN-co is a new interferon molecule constructed with the most popular conservative amino acid found;; an natural human a-IFN subtypes using genetic engineering methods. United States Patent Nos. 4,695,623 and 4,897,471 have described it. rSIFN-co had been proved to have broad-spectrum IFN
activity and virus- and tumor-inhibition and natural killer cell activity. United States Patent No. 5,372,808 by Amgen, Inc. addresses treatment rSIFN-co. Chinese Patent No. 97193506.8 by Amgen, Inc. addresses re-treatment of rSIFN-co on hepatitis C. Chinese Patent No. 98114663.5 by
Shenzhen Jiusheng Bio-engineering Ltd. addresses treatment of rSIFN-co on hepatitis B and hepatitis C.
The United States Food and Drug Administration (FDA)
2

authorized Amgen to produce rSIFN-co with E. Coli. for clinical hepatitis C treatment at the end of 1997.
Hepatitis B patients can be identified when detecting HBsAg and the HBeAg. a-IFN is commonly used in clinics to treat hepatitis B. IFN binds superficial cell membrane receptors, inhibiting DNA and RNA (ribonucleic acid) duplication, including inducing some enzymes to prevent duplication of the virus in hepatitis-infected cells. All IFNs can inhibit only the DNA duplication of viruses, not the e and s antigen.
An outbreak of atypical pneumonia, referred to as severe acute respiratory syndrome (SARS) and first identified in
Guangdong Province, China, has spread to several countries. Similar cases were detected in patients in Hong Kong, Vietnam, and Canada during February and March 2 003. The World Health Organization (WHO) issued a global alert for the illness. In mid-March 2003, SARS was recognized in
health care workers and household members who had cared for patients with severe respiratory illness in the far East. Many of these cases could be traced through multiple chains of transmission to a health care worker from Guangdong Province who visited Hong Kong, where he was hospitalized
with pneumonia and died. By late April 2003, over thousands of SARS cases and hundreds of SARS-related deaths were reported to WHO from over 25 countries around the world. Most of these cases occurred after exposure to SARS patients in household or health care settings.

Another recent epidemic scare in Asia is the avian influenza virus (H5N1). Avian influenza is an infectious disease of birds caused by type A strains of the influenza virus. There are 15 avian influenza virus subtypes; H5N1 is
of particular concern because it mutates rapidly infecting not just animal, but humans. The confirmed human death cases of avian influenza, as of February 4, 2004, stands at
5 '

. thirteen. Laboratories in the WHO global influenza network, . has been working to control the virus and prevent further human deaths. However, to fully understand the magnitude of H5N1 and its ways of distribution, more meticulous testing is need. Furthermore, antiviral drugs are only effective in treating or preventing influenza A virus strains against those who are of fair health. See http://www.who.int/csr/don/2004_01_15/en, January 15, 2004.
Researchers at St. Jude and other top influenza laboratories are racing to create a prototype human vaccine against H5N1. They hope that prototype vaccines can be ready in as little as three weeks. Nevertheless, until a vaccine is created, scientists are worried that H5N1 may
develop into a human superflu. See The Wall Street Journal, Scientists Rush to Create Vaccine for Bird Flu - Just in Case, January 28, 2004.
This disclosure describes recombinant super-compound 20 interferon, method to produce the same and uses thereof. Particularly, the super-compound interferon disclosed herein is capable of inhibiting, preventing and/or treating the hepatitis viruses, SARS virus, or virus induced upper respiratory diseases, and the avian influenza virus.
SUMMARY OF THE INVENTION
This invention provides a recombinant super-compound interferon or an equivalent thereof with changed spatial
configuration. An equivalent is a molecule which is similar in function to the super-compound interferon. The super-compound interferon possesses anti-viral or anti-tumor activity. This invention also provides an artificial gene codes for the super-compound interferon or its equivalent.

This invention provides a process for production of recombinant super-compound interferon comprising
4

introducing an artificial gene with selected codon preference into an appropriate host, culturing said introduced host in an appropriate condition permitting expression of said super-compound interferon and harvesting the expressed super-compound interferon.
This invention provides a composition comprising the recombinant super-compound interferon or its equivalent and a suitable carrier. This invention further provides a pharmaceutical composition comprising the recombinant super-compound interferon or its equivalent and a pharmaceutically acceptable carrier.
This invention provides a method for inhibiting, preventing or treating viral diseases or tumor in a subject comprising administering to the subject an effective amount of the super-compound interferon or its equivalent.
This invention provides the above-described method wherein 20 super-compound interferon, was administered via oral, vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal, mucosal administration, by inhalation via an inspirator.
This invention provides the method to prevent or treat viral diseases wherein the viral diseases is hepatitis A, hepatitis B, hepatitis C, other types of hepatitis, infections of viruses caused by Epstein-Barr virus, Cytomegalovirus, herpes simplex viruses, or other type of
herpes viruses, papovaviruses, poxviruses, picornaviruses, adenoviruses, rihnoviruses, human T cell leukaemia viruses I, or human T cell leukaemia viruses II, or human T cell leukemia virus III.
This invention provides a method for anti-hepatitis activities, it can inhibit HBV-DNA replication, HBsAg and
5

HBeAg production.
This invention provides a method to prevent or treat upper respiratory infection diseases.

This invention provides a method to prevent or treat tumor or cancers wherein the tumor is skin cancer, basal cell carcinoma and malignant melanoma, renal cell carcinoma, liver cancer, thyroid cancer, rhinopharyngeal cancer, solid
carcinoma, prostate cancer, tummy cancer, esophagus cancer, recta cancer, pancreas cancer and mammary cancer, ovarian cancer & superficial bladder cancer, hemangioma, epidermoid carcinoma, cervical cancer, non-small Cell lung cancer, small cell lung cancer, glioma, leucocythemia, acute
leucocythemia and chronic leucocythemia, chronica myelocytic leukemia, hairy cell leukemia, lymphadenoma, multiple myeloma, polycythemia vera or kaposi's sarcoma.
This invention provides a method for preventing or treating
Severe Acute Respiratory Syndrome (SARS) or virus induced upper respiratory diseases of a subject comprising administering to the subject an effective amount of recombinant super-compound interferon or a functional equivalent thereof.

The super-compound interferon may be administered via oral, vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal, mucosal administration, or by inhalation via an inspirator.

This invention provides a method for inhibiting the causative agent of Severe Acute Respiratory Syndrome, or virus induced upper respiratory diseases, comprising contacting the agent with an effective amount of super-
compound interferon or its equivalent.
This invention also provides a method for inhibiting Severe
4

Acute Respiratory Syndrome virus, Severe Acute Respiratory Syndrome virus-infected cells, or virus induced upper respiratory diseases, comprising contacting an effective amount of the super-compound interferon with said virus or cells. This contact could be direct or indirect.
This invention provides a composition comprising an effective amount of the super-compound interferon capable of inhibiting, preventing or treating Severe Acute Respiratory Syndrome virus, Severe Acute Respiratory Syndrome virus-infected cells, or virus induced upper respiratory diseases, and a suitable carrier.
This invention provides a pharmaceutical composition comprising an effective amount, of the recombinant super-compound interferon capable of inhibiting, preventing or treating Severe Acute Respiratory Syndrome, or virus induced upper respiratory diseases, in a subject and a pharmaceutically acceptable carrier.

DETAILED DESCRIPTION OF THE FIGURES
Figure 1. rSIFN-co cDNA sequence designed according to E. Coli. codon usage and deduced rSIFN-co amino acid sequence
Figure 2. Sequence of another super-compound interferon
Figure 3. Diagram of pLac T7 cloning vector plasmid
Figure 4. Diagram of pHY-4 expression vector plasmid
Figure 5. Construction process of expression plasmid pHY-5
Figure 6-A. Circular Dichroism spectrum of Infergen® 35 Spectrum range: 250nm - 190nm Sensitivity: 2 m°/cm
7

Light path: 0.20 cm
Equipment: Circular Dichroism J-500C
Samples: contains 30mg/ml IFN-conl, 5.9 mg/ml of NaCl and 3.8 mg/ml of Na2PO4, pH7 . 0 .
Infergen® (interferon alfacon-1), made by Amgen Inc., also known as consensus interferon, is marketed for the treatment of adults with chronic hepatitis C virus (HCV) infections. It is currently the only FDA approved, bio-
optimized interferon developed through rational drug design and the only interferon with data in the label specifically for non-responding or refractory patients. InterMune s sales force re-launched Infergen® in January 2002 with an active campaign to educate U.S. hepatologists about the
safe and appropriate use of Infergen®, which represents new hope for the more than 50 percent of HCV patients who fail other currently available therapies. See http://www.intermune.com/wt/itmn/infergen, 8/27/2003
Figure 6-B. Circular Dichroism spectrum of Infergen® From Reference [Journal of Interferon and Cytokine Research. 16:489-499(1996)]
Figure 6-C. Circular Dichroism spectrum of rSIFN-co Spectrum range: 320nm-250nm
Sensitivity: 2 m°/cm
Light path: 2cm
Equipment: Circular Dichroism J-500C
Samples: contains 0.5mg/ml rSIFN-co, 5.9 mg/ml of NaCl and 3.8 mg/ml of Na2PO4, pH7 . 0 .
Figure 6-D. Circular Dichroism spectrum of rSIFN-co Spectrum range: 250nm - 190nm Sensitivity: 2 m°/cm Light path: 0.20 cm
Equipment: Circular Dichroism J-500C
8

Samples: contains 30mg/ml rSIFN-co, 5.9 mg/ml of NaCl and 3.8 mg/ml of Na2PO4, pH7 . 0 .
Clearly, as evidenced by the above spectra, the secondary 5 or even tertiary structure of rSIFN-co is different from Infergen®.
Figure 7A-D. Recombinant.Super-Compound Interferon Spray Height: 90 mm 10 Width: 25mm (bottom), 6mm (top) Weight: 9g Volume delivery: 0.1 ml
DETAILED DESCRIPTION OF THE INVENTION
This invention provides a method for producing a
recombinant super-compound interferon with changed spatial
configuration and enhanced antiviral activity comprising
steps of:
(a) Introducing nucleic acid molecule which codes for said
interferon with preferred codons for expression to an
appropriate host; and
(b) Placing the introduced host in conditions allowing
expression of said interferon.
This invention provides the method for producing interferon, further comprising recovery of the expressed interferon.
This invention provides a recombinant super-compound 30 interferon or an equivalent thereof with changed spatial configuration. This invention reveals that protein with same primary sequence might have different biological activities. As illustrated in the following example, this invention disclosed two proteins with identical amino acid sequence but with different activities. This activity may sometimes become improved efficacy and sometimes, the protein with changed spatial configuration would reveal new
9

function.
An equivalent is a molecule which is similar in function to the compound interferon. An equivalent could be a deletion,
substitution, or replacement mutant of the original sequence. Alternatively, it is also the intention of this invention to cover mimics of the recombinant super-compound interferon. Mimics could be a peptide, polypeptide or a small chemical entity.

The interferon described herein includes but is not limited to interferon a, (3, or co. In an embodiment, it is IFN-la, IFN-2b or other mutants.
In an embodiment, the super-compound interferon disclosed has higher efficacy than the interferon described in U.S. Patent Nos. 4,695,623 or 4,897,471. This super-compound interferon is believed to have unique secondary or tertiary structure. (See e.g. Figure 6)

The super-compound interferon described herein has spatial structure change(s) resulting from the changes of its production process.
The above-described super-compound interferon may be produced by a high efficiency expression system which uses a special promoter. In an embodiment, the promoter is PBAD-As it could be easily appreciated by other ordinary skilled artisan, other inducible promoters, such as heat shock
promoter or heavy metal inducible promoters, may be used in this invention.
The super-compound interferon may also be produced with its gene as artificially synthesized cDNA with adjustment of its sequence from the wild-type according to codon preference of E. Coli. Extensive discussion of said codon usage (preference) may be found in U.S. Patent No.
10

4,695,623. See e.g. column 6, line 41 - column 7, line 35
The above described super-compound interferon possesses anti-viral or anti-tumor activity and therefore useful in inhibiting, preventing and treating viral diseases, tumors or cancers.
As used herein, virus diseases include but are not limited to hepatitis A, hepatitis B, hepatitis C, other types of
hepatitis, infections caused by Epstein-Barr virus, Cytomegalovirus, herpes simplex viruses, other herpes viruses, papovaviruses, poxviruses, picornaviruses, adenoviruses, rihnoviruses, human T cell leukaemia viruses I, human T cell leukaemia viruses II, or human T cell
leukemia viruses III.
Viral upper respiratory infection, alternative names common cold, colds. It is a contagious viral infection of the upper respiratory tract characterized by inflammation of
the mucous membranes, sneezing, and sore throat. It is usually caused by over 200 different viruses, known as rhinoviruses. Colds are not caused by the same viruses responsible for influenza. Colds spread through droplets from the coughing or sneezing of others with a cold or by
hand contact with objects contaminated by someone with a cold. The incidence of colds is highest among children, and the incidence decreases with age because immunity to the virus causing the cold occurs after the illness. Gradually, immunity to a wide variety of viruses that cause colds is
developed in adults. Children may have 10 colds a year, and adults may have 3 colds a year.
The US Centers for Disease Control and Prevention has
estimated that the average annual incidence of upper
respiratory tract infections (URIs) in the United States is
429 million episodes, resulting in more than $2.5 billion
10

in direct and indirect healthcare costs.
The common cold is most often caused by one of several hundred rhinoviruses (52%), but coronaviruses (8%) or the respiratory syncytial virus (7%) may also lead to infection. Other viruses, such as influenza (6%), parainfluenza, and adenoviruses, may produce respiratory symptoms, but these are often associated with pneumonia, fever, or chills.
Colds occur in a seasonal pattern that usually begins in mid-September and concludes in late April to early May. The common cold is quite contagious and can be transmitted by either person-to-person contact or airborne droplets. Upper respiratory symptoms usually begin 1 to 2 days after
exposure and generally last 1 to 2 weeks, even though viral shedding and contagion can continue for 2 to 3 more weeks. Symptoms may persist with the occurrence of complications such as sinusitis or lower respiratory involvement such as bronchitis or pneumonia.
The common cold has a variety of overt symptoms, including malaise, nasal stuffiness, rhinorrhea, nonproductive cough, mild sore throat, and, in some cases, a low-grade fever. Because of the similarity of symptoms, a cold may be mistaken for perennial allergic rhinitis, but allergies can
usually be ruled out because of the differences in chronicity.
If a patient presents with a viral URI, the spectrum of remedies is extensive. Since most of these infections are
self-limiting, clinicians usually recommend rest and fluids, but other treatments include environmental and nutritional therapies, over-the-counter and prescription decongestant and antihistamine products, new antihistamine and anticholinergic nasal formulations, and antibiotics. Table
1 lists commonly used cough and cold medications and their
12
side effects.
Table 1. A Profile of Common Cough and Cold Medications and their side effects
5
Medication Purpose Side Effects and Special Considerations
Aerosolized beta2 agonists (eg, albuterol) Reversepostinflammatorybronchospasm Raises heart rate and may cause tremor
Alcohol-based liquid combination products Treat multiple symptoms Potential drowsiness and coordination problems
Alphal agonists (oral) (eg, pseudoephedrine, phenylpropanolamine) Decongestion May cause tachycardia, nervousness, transient stimulation, dizziness, drowsiness, elevation of blood pressure
Anticholinergic compounds:Ipratropium bromide(topical) Drying May cause nasal dryness and occasional epistaxis
Other anticholinergics(eg, methscopolamine,atropine, hyoscyamine) Drying May cause orthostasis, dysfunction of heat regulation, dry mouth, constipation
Antihistamines (oral) (eg, chlorpheniramine, diphenhydramine) Drying Drowsiness, dry mouth, orthostatic hypertension
Benzonatate capsules Cough suppression, local anesthesia Chewing can numb the mouth; can cause sedation, dizziness
Codeine, hydrocodone Cough suppression Drowsiness, constipation, nausea
Dextromethorphan Cough suppression Drowsiness possible, but side effects uncommon
Guaifenesin Promoteexpectoration(mucolysis) No side effects; must be taken with lots of water to improve efficacy
Topicaldecongestants (eg, oxymetazoline, phenylephrine) Decongestion Local burning; prolonged use may cause dependence
Zinc and vitamin C lozenges Possible reduction in symptom severity and duration Possible taste disturbance, increase of oxalate stones if susceptible
Abstract from
http://www.physsportsmed.com/issues/1998/02feb/swain.htm
13

The Usage of Super-compound Interferon to Prevent or Treat URI
Nearly 70~80% URI are caused by viruses such as respiratory Syncytical virus, adenovirus, rhinovirous, cox-sackie virus,
corona virus and its variant, influenza A virus and its variant, influenza B virus and its variant, parainfluenza virus and its variant, or enterovirus and its variant. A main cause of URI in adults is from rhinovirous. For children, respiratory syncytical virus and parainfluenza
virus are two leading causes of URI.
Super-compound interferon plays an important role in the fight against virus that causes URI. Super-compound interferon gains its anti-virus affects mainly via two mechanisms:
1. Attach to surface of sensitive cells and induce them
to product anti-virus protein, then blockup the
duplication and reproduce of virus in vivo.
2. Super-compound interferon can adjust immune response,
including T cell immune response, activity of NK cell,
the phagocytosis function of monokaryon, and even formation of some antibodies in vivo.
In treatment for URI, Super-compound interferon can be directly applied to the affected area via a spray inspiration. This method of treatment allows the interferon to reach the target cells first hand. Consequently, marketing the supply as a spray, rather than via oral or injection, it would be safer and more effective in administrating the interferon.
The Usage of Super-compound Interferon to Prevent or Treat SARS
With the consent of the Sichuan working group on SARS 35 prevention and control, we began the distribution of Super-compound interferon on May of 2003. Super-
14

compound interferon spray was allocated to doctors and nurses in hospitals, populated areas that where of high risk for SARS, and to the National research group on prevention and control of SARS. Among the 3000 users as of
December' 19, 2003, there were no reports of any side effects connected to the use of the spray. Furthermore, none of the doctors and nurses, the people of Sichuan province, or other organizations that have used the Super-compound interferon spray has been infected by SARS.

Therefore, this invention provides a method for inhibiting, preventing or treating virus replication or virus infected cells by contacting said virus or infected cells with an effective amount of the super-compound interferon or its
equivalent.
This super-compound interferon is useful in inhibiting, preventing or treating the following cancers or tumors:

Cancer Skin Cancer Basal Cell Carcinoma
Malignant Melanoma
Renal cell carcinoma
Liver Cancer
Thyroid Cancer
Rhinopharyngeal Cancer
Solid Carcinoma Prostate Cancer
Tummy Cancer
Esophagus Cancer
Recta Cancer
Pancreas Cancer
Mammary Cancer
15

Ovarian Cancer & Superficial Bladder Cancer
Hemangioma
Epidermoid Carcinoma Cervical Cancer
Non-small Cell Lung Cancer
Small Cell Lung Cancer
Glioma
Malignant Hemal Disease Leucocythemia Acute Leucocythemia
Chronic Leucocythemia
Chronic Myelocytic Leukemia
Hairy Cell Leukemia
Lymphadenoma
Multiple Myeloma
Polycythemia Vera
Others Kaposi's Sarcoma
Accordingly, this invention provides a method for inhibiting tumor or cancer cell growth by contacting the super-compound interferon or its equivalent with said tumor or cancer cells. In a further embodiment, the super-compound interferon inhibits the DNA duplication and secretion of HBsAg and HBeAg of Hepatitis B Virus.
This invention also provides an artificial gene codes for the super-compound interferon or its equivalent. It is
within the ordinary skill to design an artificial gene.
Many methods for generating nucleotide sequence and other
molecular biology techniques have been described previously.
See for example, Joseph Sambrook and David W. Russell, Molecular Cloning: A laboratory Manual, December 2000,
published by Cold Spring Harbor Laboratory Press.
16

This invention provides a vector comprising the gene which codes for the super-compound interferon or its equivalent.
This invention provides an expression system comprising the vector comprising the gene which codes for the super-compound interferon ' or its equivalent. The cells include but are not limited to prokaryotic or eukaryotic cells.
This invention also provides a host cell comprising the vector comprising the gene which codes for the super-compound interferon or its equivalent.
This invention provides a process for production of recombinant super-compound interferon comprising 15 introducing an artificial gene with selected codon preference into an appropriate host, culturing said introduced host in an appropriate condition for the expression of said compound interferon and harvesting the expressed compound interferon.

The process may comprise extraction of super-compound
interferon from fermentation broth, collection of inclusion
body, denaturation and renaturation of the harvested
protein.

The process may maintain the high efficacy even when the
super-compound interferon is used with an agent and in a
particular concentration. The process also comprises
separation and purification of the super-compound
interferon. The process further comprises lyophilization of
the purified super-compound interferon. The process
comprises production of liquid injection of super-compound
interferon.
This invention also provides the produced super-compound interferon by the above processes.
17-

This invention provides a composition comprising the recombinant super-compound interferon or its equivalent and a suitable carrier.
This invention provides a pharmaceutical composition comprising the recombinant super-compound interferon or its equivalent and a pharmaceutically acceptable carrier.
This invention provides a method for treating or preventing viral diseases or tumor in a subject comprising administering to the subject an effective amount of the super-compound interferon or its equivalent.
This invention provides the above-described method wherein the viral diseases include, but are not limited to, hepatitis A, hepatitis B, hepatitis C, other types of hepatitis, infections of viruses caused by Epstein-Barr virus, Cytomegalovirus, herpes simplex viruses, or other type of herpes viruses, papovaviruses, poxviruses, picornaviruses, adenoviruses, rihnoviruses, human T cell leukaemia viruses I, or human T cell leukaemia viruses II, or human T cell leukemia virus III.
This invention provides the above-described method wherein super-compound interferon was administered via oral, vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal, mucosal administration, by inhalation via an inspirator.

This invention provides the above-described method wherein
super-compound interferon was administered following the protocol of injection 9 ug or 15 ug every two days, 3 times a week, totally 24 weeks.
It was surprising to find that rSIFN-co, the spatial structure of which has been changed, is not only a
18

preparation to inhibit the DNA duplication of hepatitis B, but to inhibit the secretion of HBsAg and HBeAg on 2.2.15 cells.
One objective of this invention is to offer a preparation of rSIFN-co to directly inhibit the DNA duplication of hepatitis B viruses and the secretion of HBeAg and HBsAg of hepatitis B and decrease them to normal levels.
In one embodiment, rSIFN-co was produced with recombinant techniques. On the condition of fixed amino acid sequence, the IFN DNA was redesigned according to the E. Coli. codon usage and then the rSIFN-co gene was artificially synthesized. rSIFN-co cDNA was cloned into the high-
expression vector of E. Coli. by DNA recombinant techniques, and a high expression of rSIFN-co was gained by using of induce/activate-mechanism of L-arabinose to activate the transcription of PBAD promoter.
Compared with usual thermo-induction, pH induction and IPTG induction systems of genetic engineering, arabinose induction/activation system has some advantages: (1) Common systems relieve promoter function by creating a "derepression" pattern. Promoters then induce downstream
gene expression. So temperature and pH change and the addition of IPTG cannot activate promoters directly. In the system disclosed herein, L-arabinose not only deactivates and represses but also activates the transcription of PBAD promoter which induce a high expression of rSIFN-co.
Therefore, the arabinose induction/activation system is a more effective expression system. (2) The relation between Exogenous and L-arabinose dosage is linearity. This means the concentration of arabinose can be changed to adjust the expression level of the exogenous gene. Therefore, it is
easier to control the exogenous gene expression level in E. Coli. by arabinose than by changing temperature and pH value. This characteristic is significant for the formation
10

of inclusion bodies. (3) L- arabinose is resourceful cheap and safe, which, on the contrary, are the disadvantages of other inducers such as IPTG.
This embodiment creates an effective and resistant rSIFN-co-expressing E. Coli. engineering strain with an L-arabinose induction/activation system. The strain is cultivated and fermented under suitable conditions to harvest the bacterial bodies. Inclusion bodies are then
purified after destroying bacteria and washing repeatedly. The end result, mass of high-purity, spatial-configuration-changed rSIFN-co protein for this invention and for clinical treatment, was gained from denaturation and renaturation of inclusion bodies and a series of
purification steps.
The following are some rSIFN-co preparations: tablets,
capsules, oral liquids, pastes, injections, sprays,
suppositories, and solutions. Injections are recommended.
It is common to subcutaneously inject or vein-inject the
medicine. The medicine carrier could be any acceptance
medicine carrier, including carbohydrate, cellulosum,
adhesive, collapse, emollient, filling, add-dissolve agent,
amortization, preservative, add-thick agent, matching, etc.

This invention also provides a pharmaceutical composition
comprising the above composition and a pharmaceutically
acceptable carrier.
For the purposes of this invention, "pharmaceutically acceptable carriers" means any of the standard pharmaceutical carriers. Examples of suitable carriers are well known in the art and may include, but are not limited to, any of the standard pharmaceutical carriers such as a
phosphate buffered saline solution and various wetting agents. Other carriers may include additives used in tablets, granules and capsules, etc. Typically such
20

carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gum, glycols or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Compositions comprising such carriers are formulated by well-known conventional methods.
This invention provides a method for preventing or treating Severe Acute Respiratory Syndrome, or virus induced upper respiratory diseases, of a subject comprising administering to the subject an effective amount of recombinant super-compound interferon or a functional equivalent thereof.
In an embodiment of the above method, the interferon is a, P, or Q.
The super-compound interferon may be administered via oral, vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal, mucosal administration, by inhalation via an inspirator.
In an embodiment, the interferon is delivered by a spray device.
In a specific embodiment, the device is described in Figures 7.
In one of the embodiments, the interferon is lyophilized.

This invention provides a method for inhibiting the causative agent of Severe Acute Respiratory Syndrome, or virus induced upper respiratory diseases, comprising contacting the agent with an effective amount of super-
compound interferon or its equivalent.
21

It is determined that the causative agent of SARS is a virus. See eg. Rota et al (2003), Characterization of a Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. Science 1085952 www.sciencexpress.org and Marra, 5 et al. (2003), The Genome Sequence of the SARS-Associated Coronavirus. Science 1085853 www.sciencexpress.org.
This invention also provides a method for inhibiting Severe Acute Respiratory Syndrome virus or Severe Acute
Respiratory Syndrome virus-infected cells, or virus induced upper respiratory diseases, or cells infected with viruses capable of inducing upper respiratory diseases, comprising contacting an effective amount of the super-compound interferon with said virus or cell. This contact could be
direct or indirect.
This invention provides a composition comprising an effective amount of the super-compound interferon capable of inhibiting Severe Acute Respiratory Syndrome virus or Severe Acute Respiratory Syndrome virus-infected cells, or virus induced upper respiratory diseases, or cells infected with viruses capable of inducing upper respiratory diseases, and a suitable carrier.
This invention provides a composition comprising an effective amount of the super-compound interferon capable of preventing or treating Severe Acute Respiratory Syndrome, or virus induced upper respiratory diseases, of a subject and a suitable carrier.

This invention provides a pharmaceutical composition comprising an effective amount of the recombinant super-compound interferon capable of inhibiting Severe Acute Respiratory Syndrome virus or Severe Acute Respiratory
Syndrome virus-infected cells, or virus induced upper respiratory diseases, and a pharmaceutically acceptable
21

carrier.
This invention provides a pharmaceutical composition comprising an effective amount of the recombinant super- compound interferon capable of preventing or treating Severe Acute Respiratory Syndrome, or virus induced upper respiratory diseases, in a subject and a pharmaceutically acceptable carrier.
This invention provides a device to deliver the above described pharmaceutical composition.
In a preferred embodiment, the subject is a human. As it can easily be appreciated, the super-compound interferon can be used in other animals or mammals.
This invention provides a method for preventing Severe Acute Respiratory Syndrome, or virus induced upper respiratory diseases, in human comprising application of the super-compound interferon three times a day via a spray which contains twenty microgram interferon, equal to ten million units of activity in three milliliter.
This invention will be better understood from the examples which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.
EXPERIMENTAL DETAILS
EXAMPLE 1
rSIFN-co is a new interferon molecule constructed according to conservative amino acid in human IFN-a subtype with 35 genetic engineering method. It has been proven that rSIFN-co has broad-spectrum IFN activity, such as high antivirus and tumor inhibition activity, especially for effectively
25

treating hepatitis C.
E. Coli. codon was used to redesign rSIFN-co cDNA and then artificially synthesize cDNA of rSIFN-co from published rSIFN-co DNA sequences and deduced amino acid sequences (Figure 1) .
In order to get pure rSIFN-co protein, rSIFN-co cDNA was cloned into E. Coli. high-expression vector, and L- arabinose, which can activate strong PBAD promoter in vectors, was used to induce high expression of rSIFN-co gene.
Synthesis of E. Coli. cDNA Sequence
Redesign of rSIFN-co cDNA sequence
rSIFN-co cDNA was redesigned according to the codon usage of E. Coli. to achieve high expression in E. Coli. Deduced amino acid sequence from the redesigned cDNA sequence of rSIFN-co is completely coincidental with primitive amino acid sequence of published rSIFN-co (Figure 1).
rSIFN-co cDNA sequence synthesis
rSIFN-co cDNA 5'-terminus and 3'- terminus semi-molecular synthesis
Two semi-moleculars can - be directly synthesized: rSIFN-co cDNA 5'- terminus 280bp (fragment I) and 3'- terminus 268bp(fragment II) by PCR. There are 41bp overlapping among fragment II and fragment I.
(1) Chemical synthesis oligodeoxynucleotide fragment:
Oligomer A: 30 5'ATGTGCGACCTGCCGCAGACCCACTCCCTGGGTAACCGTCGTGCTCTGATCCTGCTGGCTCA
GATGCGTCGTATCTCCCCGTTCTCCTGCCTGAAAGACCGTCACGAC3' Oligomer B: 5'CTGAAAGACCGTCACGACTTCGGTTTCCCGCAGGAGAGGTTCGACGGTAACCAGTTCCAGA
AGCTCAGGCTATCTCCGTTCTGCACGAAATGATCCAGCAGACCTTC3'
24



Oligomer C: 5'GCTGCTGGTACAGTTCGGTGTAGAATTTTTCCAGCAGGGATTCGTCCCAAGCAGCGGAGGAG
TCTTTGGTGGAGAACAGGTTGAAGGTCTGCTGGATCATTTC31
Oligomer D: 5'ATCCCTGCTGGAAAAATTCTACACCGAACTGTACCAGCAGCTGAACGACCTGGAAGCTTGCG
TTATCCAGGAAGTTGGTGTTGAAGAAACCCCGCTGATGAAC31
Oligomer E: 5'GAAGAAACCCCGCTGATGAACGTTGACTCCATCCTGGCTGTTAAAAAATACTTCCAGCGTAT
CACCCTGTACCTGACCGAAAAAAAATACTCCCCGTGCGCTTGGG3'
Oligomer F: 5'TTATTCTTTACGACGCAGACGTTCCTGCAGGTTGGTGGACAGGGAGAAGGAACGCATGATTT
CAGCACGAACAACTTCCCAAGCGCACGGGGAGTATTTTTTTTCGGTCAGG3'





PCR I for Fragment■ I: oligodeoxynucleotide B as template,
oligodeoxynucleotide A and C as primers, synthesized 280 bp
Fragment I.
PCR I mixture - (units: ul)






sterilized distilled water 39
10xPfu buffer ( Stratagen American Ltd. ) 5
dNTP mixture ( dNTP concentration 2.5 mmol/L ) 2
Oligomer A primer ( 25 mmol/L ) 1
Oligomer C primer ( 25 mmol/L ) 1
Oligomer B template ( 1 umol/L ) 1
Pfu DNA polymerase ( Stratagen American Ltd. ) ( 25 U/ul ) 1
Total volume
PCR cycle: 95 I
50ml
2m-(950C45s-65°C1m->72°C1m) x25 cycle-72°C10m-^°C

PCR II for Fragment II: oligodeoxynucleotide E as template, oligodeoxynucleotide D and F as primers, 25 synthesized 268bp Fragment II.
PCR II mixture (units: ul)
25

sterilized distilled water 39
10xPfu buffer ( Stratagen American Ltd. ) 5
dNTP mixture ( dNTP concentration 2.5mmol/L) 2
Oligomer D primer ( 25 umol/L ) 1
Oligomer F primer ( 25 umol/L ) 1
Oligomer E template ( 1 umol/L ) 1
Pfu DNA polymerase ( Stratagen American Ltd. ) ( 25U/ul ) 1
Total volume 50ml
PCR cycle: the same as PCR I
Assembling of rSIFN-co cDNA
Fragment I and II were assembled together to get the complete cDNA molecular sequence of rSIFN-co using the overlapping and extending PCR method. Restriction enzyme Nde I and Pst I were introduced to clone rSIFN-co cDNA sequence into plasmid.
(1) Chemical synthesis primers
Oligomer G : 5'ATCGGCCATATGTGCGACCTGCCGCAGACCC3’
Oligomer H : 5'ACTGCCAGGCTGCAGTTATTCTTTACGACGCAGACGTTCC3'
(2) Overlapping and extending PCR
PCR mixture (units: ml)
sterilized distilled water 38
10xPfu buffer ( Stratagen American Ltd. ) 5
dNTP mixture ( dNTP concentration 2.5mmol/L) 2
primer G ( 25 umol/L ) 1
primer H ( 25 umol/L ) 1
*fragment I preduction ( 1 mmol/L ) 1
26

*fragment II preduction( 1 umol/L )

1

Pfu DNA polymerase ( Stratagen American Ltd. ) (2.5U/ml) 1
Total volume 50u
*Separate and purify PCR production with StrataPrep PCR purification kit produced by Stratagen American Ltd. And dissolve into sterilized distilled water. PCR cycle: the same as PCR I
rSIFN-co gene clone and sequence analysis
pLac T7 plasmid as cloning vector. pLac T7 plasmid is reconstructed with pBluescript II KS(+) plasmid produced by Stratagen (Figure 3) .
Purified PCR production of rSIFN-co cDNA with StrataPrep PCR purification kit. Digest cDNA and pLac T7 plasmid with Ndel and Pstl. Run 1% agarose gel electrophoresis and
separate these double-digested DNA fragments. Recover 507bp long rSIFN-co DNA fragment and 2.9kb plasmid DNA fragment. Ligate these fragments by T4 DNA ligase to form a recombinant plasmid. Transform DH5acompetent cells (Gibco) with the recombinant plasmid, culture at 37°C overnight.
Identify the positive recombinant colony, named pHY-1.
Run DNA sequencing with SequiTherm™ Cycle Sequencing Kit produced by American Epicentre Technologies Ltd using Ll-COR Model 4000L. Primers are T7 and T3 common sequence primer, the DNA sequencing result matches theoretic design. Purify the rSIFN-co, sequence the N-terminus amino acids, the N-terminus amino acid sequence matches experimental design which is as follows:
N- Cys-Asp-Leu-Pro-Gln-Thr-His-Ser-Leu-Gly-Asn-Arg-Arg-Ala-Leu-
27

Construction, transformation, identification, and hereditary stability of expression vector
Construction and transformation of expression vector

Digested E. Coli. expression vector pHY-4(see Figure 3) with Nde I to linearize and, subsequently digest with Xba I. Run 1% agarose gel electrophoresis, and purify the 4.8kb pHY-4 Nde I -Xba I digest fragment with QIAEX II kit
produced by QIAGEN Germany Ltd.
At the same time, the pHY-4 plasmid is double digested with Nde I-Xba I. Run 1% agarose gel electrophoresis and purify the 715bp fragment. Ligate the rSIFN-co and pHY-4 fragments with T4 DNA ligase to construct the recombinant plasmid 15 (See Figure 4). Transform DH5acompetent cells with the recombinant plasmid. Spread the transformed cells on LB plate with Amp, 37° C culture overnight.
Positive cloning strain screening
Randomly choose E. Coli. colonies from above LB-plate, 20 screening the positive strains containing recombinant vector by endonuclease digesting and PCR analysis. Name one of the positive recombinant plasmid pHY-5, and name the strain containing pHY-5 plasmid PVIII. Amplify and store the positive strain with glycerol in -80°C. 25
High expression of rSIFN-co gene in E. Coli.
In pHY-5 plasmid, rSIFN-co gene is under control of strong promoter PBAD- This promoter is positively and negatively regulated by the product of the gene araC. AraC is a 30 transcriptional regulator that forms a complex with arabinose. In the absence of arabinose, the AraC dimer binds 02 and Ii forming a 210bp loop. This conformation
28

leads to a complete inhibition of transcription. In the presence of arabinose, the dimer is released from O2 and binds Ii and I2 leading to transcription. Arabinose binding deactivates, represses and even activates the transcription of PBAD promoter, which stimulates PBAD inducing high expression of rSIFN-co. rSIFN-co expression level in PVIII is more than 50% of the total E. Coli. protein.
Summary
RSIFN-CO is a new interferon molecule artificially built according to the conservative amino acid of human a interferons. It has been proven as a effective anti-hepatitis drug. In order to get enough pure rSIFN-co protein, a stable recombinant E. Coli. strain which high expresses rSIFN-co protein was constructed.
First, according to published rSIFN-co amino acid sequence, E. Coli. codon was used to synthesize whole cDNA of rSIFN-co. This DNA fragment was sequenced and proved that the 501bp codon sequence and TAA termination codon sequence are valid and identical with theocratic design. Subsequent analysis revealed that the N-terminus amino acid sequence and amino acid composed of rSIFN-co produced by the recombinant strain were both identical to the prediction.
The rSIFN-co cDNA was cloned into E. Coli. high-expression vector pHY-4 plasmid to construct the recombinant plasmid pHY-5. E. Coli. LMG194 strain was further transformed with pHY-4 plasmid to get stable rSIFN-co high-expression transformant. This transformant was cultured for 30
generations. The heredity of pHY-5 recombinant plasmid in E. Coli. LMG194 was normal and stable, and the expression of rSIFN-co was high and steady.
E. Coli. LMG194, which contains recombinant pHY-5 plasmid, is actually an ideal high-expression engineering strain.
29

References
1. Blatt LM, Davis JM, Klein SB. et al. The biologic
activity and molecular characterization of a novel
synthetic interferon-alpha species, consensus interferon.
Journal of Interferon and Cytokine Research, 1996;16{7):489-499.
2. Alton,K.et al: Production characterization and
biological effects of recombinant DNA derived human IFN-a
and IFN-y analogs. In: De Maeger E, Schellekens H. eds. The
Biology of Interferon System.2nd ed. Amsterdam: Elsevier Science Publishers, 1983: 119-128
3. Pfeffer LM. Biologic activity of natural and synthetic
type 1 interferons. Seminars in Oncology, 1997;24 (3 suppl
9) :S9-63 —S9-69.
4. Ozes ON, Reiter Z, Klein S, et al. A comparison of interferon-conl with natural recombinant interferons-(: antiviral, antiproliferative, and natural killer-inducing activities. J. Interferon Res., 1992; 12:55-59.
5. Heathcote EJL, Keeffe EB, Lee SS, et al. Re-treatment of
chronic hepatitis C with consensus interferon. Hepatology,
1998;27(4):1136-1143.
6. Klein ML, Bartley TD, Lai PH, et al. Structural
characterization of recombinant consensus interferon-alpha.
Journal of Chromatography, 1988; 454:205-215.
7. The Wisconsin Package, by Genetics Computer Group, Inc. Copyright 1992, Medison, Wisconsin, USA
8. Nishimura, A et al: A rapid and highly efficient method for preparation of competent E. coli cells. Nuclei. Acids Res. 1990, 18:6169
9. All molecular cloning techniques used are from: Sambrook, J., E. F. Fritsch and T. Maniatis. Molecular Cloning:A laboratory manual, 2nd ed. CSH Laboratory Press, Cold Spring Harbour, NY.1989. 10. Guzman, L. M et al: Tight regulation, modulation, and
high-level express-ion by vectors containing the arabinose
30

PBAD promoter. J. Bacteriol. 1995, 177: 4121- 4130.
rSIFN-co cDNA SEQUENCE DESIGNED ACCORDING TO E. COLI. CODON USAGE AND DEDUCED rSIFN-co AMINO ACID SEQUENCE

5' 11 21 31 41 51
+1 M C D LPQT HSL GNR RALIL L A
1 ATGTGCGACC TGCCGCAGAC CCACTCCCTG GGTAACCGTC GTGCTCTGAT CCTGCTGGCT TACACGCTGG ACGGCGTCTG GGTGAGGGAC CCATTGGCAG CACGAGACTA GGACGACCGA
5' 71 81 91 101 111
+1 Q M R RISP FSC LKD RHDF G F P
61 CAGATGCGTC GTATCTCCCC GTTCTCCTGC CTGAAAGACC GTCACGAC7T CGGTTTCCCG GTCTACGCAG CATAGAGGGG CAAGAGGACG GACTTTCTGG CAGTGCTGAA GCCAAAGGGC
5' 131 141 151 161 171
+1 QEE FDGN QFQ KAQ AISV LHE 121 CAGGAAGAAT TCGACGGTAA CCAGTTCCAG AAAGCTCAGG CTATCTCCGT TCTGCACGAA GTCCTTCTTA AGCTGCCATT GGTCAAGGTC TTTCGAGTCC GATAGAGGCA AGACGTGCTT 20
5' 191 201 211 221 231
+1 MIQ QTFN LFS TKD SSAA WDE
181 ATGATCCAGC AGACCTTCAA CCTGTTCTCC ACCAAAGACT CCTCCGCTGC TTGGGACGAA
TACTAGGTCG TCTGGAAGIT GGACAAGAGG TGGTTTCTGA GGAGGCGACG AACCCTGCTT
5' 251 261 271 281 291
+1 SLL EKFY TEL YQQ LNDL EAC
241 TCCCTGCTGG AAAAATTCTA CACCGAACTG TACCAGCAGC TGAACGACCT GGAAGCTTGC
AGGGACGACC TTTTrAAGAT GTGGCTTGAC ATGGTCGTCG ACTTGCTGGA CCTTCGAACG
5' 311 321 331 341 351
+ 1VIQ EVGV EETPLMN VDSILA
301 GTTATCCAGG AAGTTGGTGT TGAAGAAACC CCGCTGATGA ACGTTGACTC CATCCTGGCT
CAATAGGTCC TTCAACCACA ACTTCTTTGG GGCGACTACT TGCAACTGAG GTAGGACCGA
5' 371 381 391 401 411
+ 1VKKYFQRITLYLTEKKYSPC
361 GTTAAAAAAT ACTTCCAGCG TATCACCCTG TACCTGACCG AAAAAAAATA CTCCCCGTGC
31

CAATTTTTTA TGAAGGTCGC ATAGTGGGAC ATGGACTGGC 1T1T1T1TAT GAGGGGCACG
5' 431 441 451 461 471
+1AWEVVRAEIMRSFSLSTNLQ
421 GCTTGGGAAG TrGITCGTGC TGAAATCATG CGTTCCTTCT CCCTGTCCAC CAACCTGCAG CGAACCCTTC AACAAGCACG ACTTTAGTAC GCAAGGAAGA GGGACAGGTG GTTGGACGTC
5' 491 501
+1ERLRRKE#
481 GAACGTCTGC GTCGTAAAGA ATAA CTTGCAGACG CAGCATTTCT TATT
EXAMPLE 2
Separation and purification of rSIFN-co
1. Fermentation
Inoculate the recombinant strain in LB media, shaking (200 rpm) under 37°C overnight (approximate 18 h) , then add 30% glycerol to the fermentation broth to get final concentration of 15%, allotted to 1 ml tube and kept in -20°C as seed for production.
Add 1% of the seed to LB media, shaking (200 rpm) under 37 °C overnight to enlarge the scale of the seed, then add
to RM media with a ratio of 10%, culturing under 37°C. Add arabinose (20% solution) to 0.02% as an inductor when the OD600 reaches about 2.0. 4 hours after that, stop the culture process, collect the bacteria by centrifuge, resuspend the pellet with buffer A, and keep in -20 °C
overnight. Thaw and break the bacteria by homogenizer, then centrifuge. Wash the pellet with buffer B, buffer C, and distilled water to get a relatively pure inclusion body.
2. Denaturation and renaturation
Dissolve the inclusion body in Guanidine-HCl (or urea) of 6 mol/L. The solution will be a little cloudy. Centrifuge it at a speed of 10000 rpm. Determine the protein
32.

concentration of the supernatant. This supernatant is called "denaturation solution." Add the denaturation solution to renaturation buffer, and keep the final protein concentration under 0.3 mg/ml. It is better to add the 5 totally denaturation solution in three steps instead of one step. Keep the solution overnight under 4°C. Afterwards, dialyze 10 mol/L,5 mol/L PB buffer and distilled water, then adjust its pH by 2 mol/L HAc-NaAc. Let it stand, then filtrate. 10
3. Purification
POROS HS/M anion exchange chromatography: Equivalent column with 20 mmol/L HAc-NaAc(pH 5.0)

Load samples at a speed of 30 ml/min
Wash with 20 CV 20 mmol/L HAc-NaAc(pH^ 5.0)

5 CV of 0.15 mol/L NaCl+20 mmol/L HAc-NaAc(pH 5.0)wash

3 CV of 0.18 mol/L NaCl+20 mmol/L HAc-NaAc(pH 5.0)wash

0.25 mol/L NaCl + 20 mmol/L HAc-NaAc(pH 5.0)elute target
protein
Chelating sepharose™ fast flow: Add PB buffer of 0.2
mol/L(pH 6.6)and NaCl of 4 mol/L in the solution from HS to
adjust solution pH to pH 6.0 and NaCl concentration to 1
mol/L.
Column with buffer D

35

Loading at a rate of 1 ml/min

Wash with buffer E

Wash with buffer F

Elute with buffer G
Condense the eluted solution by POROS HS/M. Sometimes a purification by sephacryl S-100 step can be added to meet stricter purity requirements.
Note:
Buffer A: 100 mmol/L Tris-HCl,pH 7.5-10 mmol/L EDTA-100 mmol/L NaCl Buffer B: 50 mmol/L Tris-HCl,pH 7.5-1 mol/L Urea-10 mmol/L EDTA-0.5% Triton X-100
Buffer C: 50 mmol/L Tris-HCl,pH 7.5-2 mol/L Urea-10 mmol/L EDTA-0.5% Triton X-100
Buffer D: 1 mol/L NaCl 50 mmol/L Na2HPO4 (pH 5.5)
Buffer E: 1 mol/L NaCl 50 mmol/L Na2HPO4 (pH 5.0)
Buffer F: 1 mol/L NaCl 50 mmol/L Na2HPO4 (pH 4.0)
Buffer G: 1 mol/L NaCl 50 mmol/L Na2HPO4 (pH 3.6)
Renaturation buffer: 0.5 mol/L Arginine—150 mmol/L Tris-HCl, pH 7.5-0.2 mmol/L EDTA LB Media: 1 L
Tryptone 10 g
Yeast extracts 5 g
NaCl 10 g
RM Media: 1 L
Casein 20 g
MgCl 1 mmol/L (0.203 g)
34

Na2HPO4 4 g;
KH2P04 3 g,
NaCl 0.5 g
NH4CI 1 g

After purification, the buffer was changed to PBS (pH 7.0) along with the step of condensing by POROS HS/M. This is called the "Protein Stock Solution." It can directly used in the preparation of injections or sprays, or stored at 2-
8°C.
Lyophilized powder 34.5 ug/ml
10mmol/L 0.4mol/L
Formula for injection:
Solution
Solution of rSIFN- 34.5 ug/ml
CO
PB (pH7.0) 25mmol/L
Glycine
NaCl 0.lmol/L
0.01%
0.05%
l0mmol/L
1.26%
0.03%
0.5%
0.1%
10 mg/ml
For spray:
EDTA
Tween 8 0
Trisodium citrate
Glycerol
Sodium Chloride
Phenylmethanol
HSA
rSIFN-co
QUALITY CONTROL PROCESS
During purification tests for protein content, protein
purity, specific activity and pyrogen are conducted after
each step. When the stock solution is obtained, all the tests listed in the table are done one after the other.
The quality of the product is controlled according to
35

"Chinese Requirements for Biologics" 1. Original protein solution
Lowry

Item of Test Method
Protein Stock Solution:
Test for Protein Content Lowry
Test for Protein Purity Non-reductive SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis ) HPLC Analysis
Test for Molecular Weights Reductive SDS-PAGE
Test for Specific Activity According to Method in "Specific Activity Test of Interferon
Test for Leftover Exogenetic DNA Using DNA Labeling and Detection Kit
Test for Activity of Leftover Antibiotics According to Method in "Chemical and Other Test Methods for Biologies"
Test for Bacterial Endotoxin According to Method in "Requirements for Bacterial Endotoxin Test of Biologies"
Test for Isoelectronic Point Isoelectric Focusing Electrophoresis
Test for Identify Characteristics of the Protein UV spectrum (range of wavelength: 190-380nm)
Peptide Mapping (hydrolyzed by pancreatic enzyme, analyzed by C-18 column)
N-terminal Sequence Test
C-terminal Sequence Test
Circular Dichroism
Amino Acid Analysis

Semi-finished Product
Test for Bacterial Endotoxin According to Method in "Requirements for Bacterial Endotoxin Test of Biologies"

Product
Appearance Check
Chemical According to Method in "Chemical and Other Test Methods for Biologies"
Test for Specific Activity According to Method in "Specific Activity Test of Interferon
Sterility Test According to Method in "c"
Abnormal Toxicity Test Test on Mouse
Pyrogen Test According to Method in
36

"Requirements for Pyrogen Test of Biologies"
Test for Stability of Product

Note: "Chemical and Other Test Methods for Biologies", "Requirements for Pyrogen Test of Biologies" and "Requirements for Bacterial Endotoxin Test of Biologies"
all can be found in the "Chinese Requirements for Biologies." "Chinese Requirements for Biologies," PAN Zhengan, ZHANG Xinhui, DUAN Zhibing, et al. Chinese Biologies Standardization committee. Published by Chemical Industry Publishing Company, 2000.
EXAMPLE 3
Stability of lyophilized Powder of Recombinant Super-Compound Interferon Injection
The stability experiments were carried out with samples of lyophilized powder of recombinant super-compound interferon (rSIFN-co) injection in two specifications and three batches. The experiments started on April, 2000.
■engineering 05, 990102-
1. Sample Source
Samples were supplied by Sichuan Huiyang Life Ltd., Sichuan Province. Lot: 990101-03, 990101 03, 990102-05, 990103-03, 990103-05
2. Sample Specifications
Every sample in this experiment should conform with the requirements in the table below. Table 1 Standard of Samples in Experiment

Items Standards
1. Appearance white loose powder
2. Dissolving time dissolve rapidly in injection water( within 2 min) at room temperature
3. Clarity colorless liquid or with little milk-like glisten; should not be cloudy, impurity or
37-

with indiscernible deposit
4. pH value 6.5-7.5
5. Potency (IU/dose) 80%~150% of indicated quantity ( 9mg:4.5 * 106IU, 15mg: 7.5 x 106IU)
6. Moisture no more than 3.0% ( W/W)
3. Experiment Content
15.3.1 Test samples at 2~8°C: The test samples were put
into a 2~8°C refrigerator, then the above items of these
samples were respectively tested in the 1st' , 3rd , 6th, 9th, 12th, 18th, 24th, 30th, 36th month. The results were recorded.
15.3.2 Test samples at 25oC: The test samples were put into
a thermostat at 25°C, then the above items of these samples
were respectively tested in the 1st' , 3rd , 6th, 9th, 12th, 18th, 24th, 30th month. The results were recorded.
15.3.3 Test samples at 37°C: The test samples were put into
a thermostat at 37°C, then the above items of these samples
were respectively tested in the 1st' , 3rd , 6th, 9th, 12th, 18th, 24th month. The results were recorded.
4. Results and Conclusion
1) At 37°C, according to data collected at designated
points during testing and compared with data before testing,
the potency began descending from the 6th month and the changes in the three batches were similar. The appearance of other items had no changes.
2) At 25°C, according to data collected at designated
points during testing and compared with data before the
testing, the potency only had a little change, and the changes in the three batches were similar. The appearance of other items had no changes.
3). At 2-8°C, according to data collected at designated points during testing and compared with data before testing, the potency of the three batches all were stable. The
38

appearance of other items also had no changes.
In conclusion, it is suggested that the lyophilized powder of recombinant super-compound interferon for injection should be better stored and transported at low 5 temperatures. Without such conditions, the product can also be stored for short periods (i.e. 3 months) at room temperature.
EXAMPLE 3.5
Production Flow Chart of rSIFN-co
1. Production
1.1 Fermentation
Use mixture of LB+M9 as culturing medium. The amount of innoculum will be 1.5%. Agitate to OD600=0.4 (about 3.5 hours) under 32° C, then raise temperature to 42° C. Continue the agitation for another 6 hours, the expression of rSIFN-co will reach the maximum level. The examination under scanning of the gel resulting from SDS-PAGE shows that the level of expression is up to 57%, which is the highest standard in China.
1.2 Purification
Centrifuge the bacteria solution to collect the bacterial pellet

Physiological saline wash for two (2) times

Adding buffer (50mM Tris-HCl, ImM EDTA, l00mM
NaCl, 1% Triton X-100, 1-2 M Urea), sonication to
disrupt bacterial cells for 20-30 minutes

Precipitate the buffer solution and wash for a
39

few times until the color turns into purely white

Use 7M Guanidine HC1 to denature

Dilute the Guanidine HC1 to renature, stay
overnight

Use Sephadex G25 to desalt

Use 0.1 M NaCl to apply CM-Sepharose

Stepwise elution to collect the active peak

After the active peak is desalt, apply to HPLC
positively charged column

Use 0.1 M NaCl to stepwise elution, collect
active peak which is the product of rSIFN-co

Add protection carrier and lyophiling agent

Separate lyophilized materials (rSIFN-co)
The purity of the product (rSIFN-co) from this production procedure is shown to 95% under the test of SDS-PAGE where molecular weight is 14.5 Kda. The reverse phase HPLC shows a single peak and the purity is up to 97%. Its specific activity is up to lxl09 IU/mg protein.
1.3 Packaging and Inspection
After HPLC purification, 2% human serum albumin, 1% sucrose and 1% glucose were added to the rSIFN-co. It is then separated and lyophilized into injection sample. When test under the Wish-
VVS inspection system, the result was 4.5xl08 IU.
When test with aseptic inspection and pyrogen
40

inspection under the standard requirement of China, the results are negative. This result complies the IV injection.
2. Quality Control
2.1 Biological characteristics
(1) When use LB+M9 to cultivate bacteria, the characteristic should match with the typical characteristic of E-coli bacteria. No other bacteria were detected.
(2) When smeared for Gram staining and watched under microscope, it is bacteria-negative.
(3) Reaction to antibiotic is the same as those original bacteria.
(4) Electron microscope ' inspection would show typical characteristic of E-coli bacteria. No mycoplasma, virus spore or other micro pollutes was detected.
(5) Biochemical reaction test would show characteristics of E-coli bacteria.
2.2 Quality control of interferon expression
(1) Interferon expression (cultivated in an agitating platform) would match the amount of expression in original input bacteria.
(2) When test with anti-interferon serum, it shows reaction.
(3) Plasmid inspection: Restriction digest show match with original plasmid.
2.3 Bacteria strain product
Bacteria strain product denotes the specimen from the original bacteria strain that produced from the procedures show in 1.2.
The inspection of bacteria strain product to make sure no derivation as follows: Use LB plate 2-3 pieces and cultivate. Separate and take 5-10 bacteria groups for the test of interferon
40

expression. Repeat the test at least two (2)
times. Only use the one which shows the highest %
to be the bacteria strain product.
Innoculum
The innoculum denotes the chosen bacteria strain
product after fermentation. The amount,
cultivation time and most appropriate OD value of
innoculum" can be decided according to different
bacteria strain. An anti-polluted bacteria
procedure should apply for whatever innoculum
would be produced.
Growing of bacteria strain
Growing " of bacteria strain would be done in a
Bacteria Free room environment where no more than
one bacterium is growing in the same room. Same
culturing medium will be used for both bacteria
strain and innoculum. The one would be used in
rSIFN-co is LB.
Fermentation
(1) The fermentation would only take place in a clean fermentation room with a single bacteria fermentation environment.
(2) Cleaning of fermentation container and tube would be done twice, before and after the insertion of culturing medium. Then, the container should be frozen to reach the appropriate temperature for innoculum.-
(3) Avoid using antibiotic which might affect cell growth in the culturing medium.
(4) Fermentation parameters like temperature, pH value, dissolved oxygen and time required could be varying according to different type of bacterial strain.
Bacteria collection
(1) Centrifuge the bacteria solution to collect bacteria or other method can be used. All
41

apparatus should be cleaned before and after
the operation. The waste solution would be
drained after a cleaning procedure.
(2) The bacteria should be kept under 4-8° C if
they are going to be split within 24 hours.
Otherwise, it should be kept under -30° C.
Those are kept under such condition can be
used within 6 months. 2.8 Bacteria cell lysis
(1) Use appropriate buffer solution to balance the bacteria strain. Cell lysis can be done by physical, chemical or biological methods. Use centrifuge to precipitate the bacteria and apply cleaning solutions.
(2) If use chemical method to split cells, no harmful solution to human beings should be used..
Purification
(1) Purification would get rid of most of the non-interferon contents. In the process of purification, no toxic materials should be found if extra elements are added.
(2) If using antibody affinity chromatography for purification, there would be indication on source and degree of purify. Also, inspection of small quality IgG would be performed.
(3) During the process of purification, clearance of pyrogen is critical. All apparatus should be checked to eliminate this interference.
(4) The highly concentrated interferon is known as "intermediate product". After inspection and tests,. would add albumin to raise the concentration to 2% which now known as "albumin intermediate product". After
43

examination and tests, it should be kept at
-30° C and never thawed before use. This
product should be used within 6 months.
(5) The albumin that used in this process should
also fulfill the tests and requirements such
as: negative under RBSAG inspection and the ratio among monomer, dimer and polymer should be indicated.
2.10 Production into tube product
(1) Filtration: Use 0.22 u membrane to filter
the bacteria. The product should be handled with aseptic techniques. Samples will be taken to test the value of the interferon.
(2) Dilution: Dilute the albumin intermediate
product with 2% diluent. No preservative
should be added. The product can be lyophilized after the aseptic inspection and pyrogen inspection.
2.11 Lyophilization
The lyophilization should not affect the activity
of interferon and the water content of said lyophilite will be maintained.
2.12 Inspection
There are two types of rSIFN-co made. One is for
injection and the other for topical use. The
specifications are different between these two.
There are intermediate product and final product
for each type. Under the injection portion,
intermediate product includes purified interferon,
albumin intermediate product and bacteria free
albumin intermediate product. Final product under
injection portion will denote only lyophilized
product. The intermediate product under topical
use portion denotes only purified interferon. The
final product under topical use portion denotes
only separated packed liquid formed lyophilized
44

products. 2.13 Packaging
There are different packaging between injection type and topical use type.
2.14 Storage
The product should be kept in 4° C. The
purification solution should not be stored in
frozen.
2.15 Expiration
The expiration period is two (2) years after the
lyophilization procedure for lyophilized products. The expiration period is 6 months after individual packing for liquidated products.
EXAMPLE 4
rSIFN-co inhibits HBV-DNA duplication and secretion of HBsAg and HBeAg.
Materials
Solvent and Dispensing Method: Add 1ml saline into each vial, dissolve, and mix with MEM culture medium at different concentrations. Mix on the spot.
Control drugs: IFN-a2b (Intron A) as lyophilized powder, purchased from Schering Plough. 3xl06U each, mix to
3xl06IU/ml with culture medium; Infergen® (liquid solution) , purchased from Amgen, 9mg, 0.3ml each, equal to 9X106IU, and mix with 9X106IU/ml culture medium preserve at 4°C; 2.2.15 cell: 2.2.15 cell line of hepatoma (Hep G2) cloned and transfected by HBV DNA, constructed by Mount Sinai Medical
Center.
Reagent: MEM powder, Gibco American Ltd. cattle fetal blood serum, HycloneLab American Ltd. G-418(Geneticin); MEM dispensing, Gibco American Ltd.; L-Glutamyl, imported and packaged by JING KE Chemical Ltd.; HBsAg and HBeAg solid-phase radioimmunoassay box, Northward Reagent Institute of Chinese Isotope Ltd.; Biograncetina, Northern China
45

Medicine; And Lipofectin, Gibco American Ltd.
Experimental goods and equipment: culture bottle, Denmark Tunclon™; 24-well and 96-well culture board, Corning American Ltd.; Carbon Dioxide hatching box, Shel-Lab American Ltd.; MEM culture medium 100ml: 10% cattle fetal blood serum, 3% Glutamyll%, G418 380mg/ml, biograncetina50U/ml.
Method:
2.2.15 cell culture: Added 0.25% pancreatic enzyme into culture box with full of 2.2.15 cell, digest at 37°C for 3 minutes, and add culture medium to stop digest and disturb it to disperse the cells, reproduce with ratio of 1:3. They
will reach full growth in 10 days.
Toxicity test: Set groups of different concentrations and a control group in which cell is not acted on with medicine. Digest cell, and dispense to a 100,000 cell/ml solution. Inoculate to 96-well culture board, 200ml each well, culture at 37°C for 24h with 5% C02. Test when simple cell layer grows.
Dispense rSIFN-co to 1.8x107IU/ml solution than prepare a series of solutions diluted at two-fold gradients. Add into 96-well culture board, 3 wells per concentration. Change the solution every 4 days. Test cytopathic effect by microscope after 8 days. Fully destroy as 4, 75% as 3, 50% as 2, 25% as 1, zero as 0. Calculate average cell lesion 30 and inhibition rate of different concentrations. Calculate TC50 and TC0 according to the Reed Muench method.
50-5
TC50 = Antilog (B + x C)
A-B
A=log >50% medicine concentration, B=log concentration, C=log dilution power
Inhibition test for HBeAg and HBsAg: Separate into positive
46

and negative HBeAg and HBsAg contrast groups, cell contrast group and medicine concentration groups. Inoculate 700,000 cells/ml of 2.2.15 cell into 6-well culture board, 3 ml each well, culture at 37°C for 24h with 5% C02, then prepare
5 gradiently diluted solutions with 3-fold as the grade (Prepare 5 solutions, each with a different protein concentration. The concentration of Solution 2 is 3 times lower than that of Solution 1, the concentration of Solution 3 is 3 times lower than that of Solution 2, etc.)
4.5xl06IU/ml, 1.5xl06IU/ml, 0.5xl06IU/ml, 0.17xl06lU/ml, and 0.056xl06lU/ml, 1 well per concentration, culture at 37°C for 24h with 5% CO2. Change solutions every 4 days using the same solution. Collect all culture medium on the 8th day.
Preserve at -20°C Repeat test 3 times to estimate HBsAg and HBeAg with solid-phase radioimmunoassay box (Northward Reagent Institute of Chinese Isotope Ltd.). Estimate cpm value of each well with a y- accounting machine.
Effects calculation: Calculate cpm mean value of contrast groups and different-concentration groups and their standard deviation, P/N value such as inhibition rate, IC50 and SI.
A-B
1) Antigen inhibition rate (%) = — x 100
A
A = cpm of control group; B = cpm of test group;
2) Counting the half-efficiency concentration of the
medicine
50-5
Antigen inhibition IC50 = Antilog (B + x c)
A-B
A=log>50% medicine concentration, B=log concentration, C=log dilution power
3) SI of interspace-conformation changed rSIFN-co effect on HBsAg and HBeAg in 2.2.15 cell culture:
TC50
SI =
IC50
47

4), Estimate the differences in cpm of each dilution degree from the control group using student t test
Southern blot: (1) HBV-DNA extract in 2.2.15 cell: Culture cell 8 days. Exsuction culture medium (Separate cells from culture medium by ~means of draining the culture medium.). Add lysis- buffer to break cells, then extract 2 times with a mixture of phenol, chloroform and isoamyl alcohol (1:1:1), 10,000g centrifuge. Collect the supernatant adding anhydrous alcohol to deposit nucleic acid. Vacuum draw, re-dissolve into 20mlTE buffer. (2) Electrophoresis: Add 6XDNA loading buffer, electrophoresis on 1.5% agarose gel, IV/cm, at fixed pressure for 14-18h. (3) Denaturation and hybridization: respectively dip gel into HC1, denaturaion buffer and neutralization buffer. (4) Transmembrane: Make an orderly transfer of DNA to Hybond-N membrane. Bake, hybridize and expose with dot blot hybridization. Scan and analyze relative density with gel-pro software. Calculate inhibition rate and IC50.

Results
Results from Tables 1, 2 and 3 show: After maximum
innocuous concentration exponent culturing for 8 days with
2.2.15 cell, the maxima is 9.0 ± 0xl06IU/ml average
inhibition rate of maximum innocuous concentration rSIFN-co to HBeAg is 46.0±5.25% (P and HBsAg, but that the IFN of the contrast group and Infergen® cannot. It has also been proved in clinic that rSIFN-co can decrease HBeAg and HBsAg or return them to normal levels.

48
Table 1: Results of inhibition rate of rSIFN-co to HBsAg and HBeAg First batch: (rSIFN-co)

Inhibition effect to HBeAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulated inhibition rate '
First well Second well Third well
900 9026 8976 10476 0.436227 0.43935 0.345659 0.407079 0.945909 0.592921 0.614693546
300 9616 12082 10098 0.3993754 0.245347 0.369269 0.337997 0.5388299 1.254924 0.300392321
100 9822 16002 12800 0.386508 0.0005 0.2005 0.195836 0.200833 2.059088 0.08867188
33.33333 15770 19306 16824 0.014991 0 0 0.004997 0.0049969 3.054091 0.001633453
11.11111 19172 22270 18934 0 0 0 0 0 4.054091 0
Control Cell 16010 Blank 0 Dilution 3 IC50 602.74446016
Inhibition effect to HBsAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 7706 7240 7114 0.342155 0.381936 0.392693 r0.372261 0.922258 0.627739 0.595006426
300 8856 7778 9476 0.2439816 0.336008 0.191053 0.257014 0.5499972 1.370724 0.286349225
100 10818 10720 10330 0.07649 0.084856 0.118149 0.093165 0.292983 2.27756 0.113977019
33.33333 10744 11114 10570 0.082807 0.051221 0.097661 0.07723 0.1998179 3.20033 0.058767408,
11.11111 10672 9352 10810 0.088953 0.201639 0.077173 0.122588 0.122588 4.077742 0.02918541
Control Cell 11714 Blank 0 Dilution 3 IC50 641.7736749
49

Second batch: (rSIFN-co)

Inhibition effect to HBeAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 7818 8516 9350 0.554378 0.514592 0.4 67054 0.512008 1.371181 0.487992 0.737521972
300 10344 10628 9160 0.4103967 0.394209 0.477884 0.427497 0.8591731 1.060496 0.447563245
100 12296 14228 13262 0.299134 0.18901 0.244072 0.244072 0.4316522 1.816423 0.19201839
33,33333 15364 17414 16188 0.124259 0.00741 0.77291 0.069653 0.1876045 2.74677 0.063933386
11.11111 17386 13632 15406 0.009006 0.222982 0.121865 0.117951 0.117951 3.628819 0.03148073
Control Cell 16962 Blank 0 Dilution 3 IC50 365.9357846
Inhibition effect to HBsAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 5784 6198 5792 0.498265 0.462353 0.497571 0.486063 0.893477 0.513937 0.634835847
300 7150 8534 8318 0.379771 0.259715 0.278452 0.30598 0.4074138 1.207957 0.252210647
100 9830 11212 10210 0.147294 0.027412 0.11433 0.096345 0.101434 2.111612 0.04583464
33.33333 13942 12368 13478 0 0 0 0 0.0050891 3.111612 0.001632835
11.11111 12418 11634 11352 0 0 0.015267 0.005089 0.005089 4.106523 0.001237728
Control Cell Blank 0 Dilution 3 IC50 611.0919568

















50
Third batch: (rSIFN-co)

Inhibition effect to HBeAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Average inhibitio n rate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 9702 9614 8110 0.428016 0.433204 0.52187 2 0.461031 '1.316983 0.538969 0.709599543
300 8914 10032 8870 0.4744723 0.40856 0.47706 6 0.453366 0.8559525 1.085603 0.440859127
100 16312 12688 13934 0.038321 0.251975 0.17851 7 0.156271 0.402586 1.929332 0.172641621
33.33333 15080 12814 13288 0.110954 0.244547 0.21660 2 0.190701 0.2463153 2.738631 0.082519158
11.11111 21928 15366 15728 0 0.094093 0.072751 0.0055615 0.055615 3.683017 0.014875633
Control Cell 17544 Blank 0 Dilution 3 IC50 382.0496935
Inhibition effect to HBsAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Average inhibitio n rate Accumulatio n 1-Accumulation Accumulatedinhibitionrate
First well Second well Third , well
900 5616 6228 5346 0.496864 0.442035 0.52105 4 0.486651 0.763125 0.513349 0.597838293
300 8542 8590 7096 0.234725 0.230425 0.36427 2 0.276474 0.2764738 1.236875 0.182690031
100 11420 11360 11394 0 0 0 0 0 2.236875 0
33.33333 12656 11582 13110 0 0 0 0 0 0
11.11111 13142 12336 13342 0 0 0 0 0 4.236875 0
Control Cell 11528 Blank 0 Dilution 3 IC50 694.7027149
HBeAg: Average IC50: 450.2434 SD: 132.315479 HBsAg: Average IC50: 649.1894 SD: 42.29580
51

Table 2: Results of inhibition rate of Intron A(IFN-a2b) to HBsAg and HBeAg

Inhibition effect to HBeAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
300 14918 11724 9950 0 0.029711 0.176529 0.068747 0.068747 0.931253 0.068746724
100 14868 16890 15182 0 0 0 0 0 1.931253 0
33.33333 16760 21716 16400 0 0 0 0 0 2.931253 0
11.11111 20854 15042 16168 0 0 0 0 0 3.931253 0
3.703704 12083 12083 12083 0 0 0 0 0 4.931253 0
Control Cell 17544 Blank 0 Dilution 3 IC50 FALSE
Inhibition effect to HBsAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
300 9226 8196 9658 0.152489 0.247106 0.521054 0.1708 0.189295 0.8292 0.185857736
100 10946 10340 10828 0 0.050156 0.364272 0.018495 0.0184947 1.810705 0.010110817
33.33333 12250 12980 13934 0 0 0 0 0 2.810705 0
11.11111 12634 12342 12000 0 0 0 0 0 3.810705 0
3.703704 10886 10886 10886 0 0 0 0 0 4.810705 0
Control Cell 10886 Blank 0 Dilution 3 IC50 FALSE
52

Table 3: Results of inhibition rate of Infergen to HBsAg and HBeAg First batch: (Infergen®)

Inhibition effect to HBeAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 14172 12156 17306 0.091655 0.220869 0 0.104175 0.306157 0.895825 0.254710274
300 13390 12288 16252 0.1417767 0.212409 0 0.118062 . 0.2019827 1.777764 0.102024519
100 14364 18834 14194 0.079349 0 0.090245 0.056531 0.083921 2.721232 0.029916678
33.33333 15722 16034 16340 0 0 0 0 0.0273897 3.721232 0.007306592
11.11111 17504 17652 14320 0 0 0.082169 0.02739 0.02739 4.693843 0.005801377
Control Cell 15602 Blank 0 Dilution 3 IC50 FALSE
Inhibition effect to HBsAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 12080 11692 12234 0 0.01275 0 0.00425 0.025163 0.99575 0.024647111
300 12840 11484 12350 0 0.030313 0 0.010104 0.0209125 1.985646 0.010422073
100 12894 14696 15086 0 0 0 0 0.010808 2.985646 0.003606955
33.33333 15032 12928 13020 0 0 0 0 0.0108081 3.985646 0.002704416
11.11111 11794 11984 11508 0.004137 0 0.028287 0.010808 0.010808 4.974837 0.002167838
Control Cell 11843 Blank 0 Dilution 3 IC50" FALSE
53

Second batch: (Infergen )

Inhibition effect to HBeAg
Concentration (*104IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 6278 6376 6408 0.200051 0.187564 0.183486 0.190367 0.274635 0.809633 0.253290505
300 7692 9092 6394 0.0198777 0 0.18527 0.068383 0.0842678 1.74125 0.046161005
100 8960 7474 8190 0 0.047655 0 0.015885 0.015885 2.725365 0.005794856
33.33333 8530 8144 9682 0 0 0 0 0 3.725365 0
11.11111 7848 7848 7848 0 0 0 0 0 4.725365 0
Control Cell 7848 Blank 0 Dilution 3 IC50 FALSE
Inhibition effect to HBsAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 12364 12268 12274 0.036171 0.043655 0.043187 0.041004 0.140162 0.958996 0.12751773
300 11590 12708 13716 0.0965076 0.009355 0 0.035287 0.0991581 1.923709 0.0490186
100 12448 13468 13982 0.029623 0 0 0.009874 0.063871 2.913834 0.02144964
33.33333 12616 11346 12444 0.016526 0.115529 0.029935 0.053996 0.0539965 3.859838 0.013796309
11.11111 12828 12828 ' 12828 0 0 0 0 0 4.859838 0
Control Cell 12828 Blank 0 Dilution 3 IC50 FALSE
54

Third batch: (Infergen®)

Inhibition effect to HBeAg ,
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulatedinhibitionrate
First well Second well Third well
900 7240 6642 6158 0.064599 0.14186 0.204393 0.136951 0.217399 0.863049 0.201211735
300 11072 8786 6902 0 0 0.108269 0.03609 0.0804479 1.82696 0.042176564
100 7016 9726 7552 0.09354 0 0.024289 0.039276 0.044358 2.787683 0.015663017
33.33333 7622 8866 8676 0..015245 0 0 0.005082 0.0050818 3.782601 0.001341671
11.11111 7740 7740 7740 0 0 0 .0 0 4.782601 0
Control Cell 7740 Blank 0 Dilution 3 IC50 FALSE
Inhibition effect to HBsAg
Concentration (xl04IU/ml) First well Second well Third well Inhibition rate Averageinhibitionrate Accumulation 1-Accumulation Accumulate dinhibition rate
First well Second well Third well
900 11048 11856 11902 0.04775 0 0 0.015917 0.015917 0.984083 0.01591679 6
300 13454 12896 11798 0 0 0 0 0 1.984083 0
100 12846 13160 12546 0 0 0 0 0 2.984083 0
33.33333 ,., 12680 12458 12360 0 0 0 0 0 3.984083 0
11.11111 11602 11602 11602 0 0 0 0 0 4.984083 0
Control Cell 11602 Blank 0 Dilution 3 IC50 FALSE
HBeAg: Average IC50: 0 SD: 0 HBsAg: Average IC50: 0 SD: 0
55

Dkt. #792-BA-IN EXAMPLE 5 Preparation of rSIFN-co
Preparation of lyophilized injection
Lyophilized powder
Stock Solution of 34.5 ug/ml
rSIFN-co
PB (pH7.0) l0mmol/L
Glycine 0.4mol/L

Preparation technique: Weigh materials according to recipe.
Dissolve with sterile and pyrogen-free water. Filter
through 0.22mm membrane to de-bacterialize, preserve at 6-
10°C. Fill in vials after affirming it is sterile and
pyrogen-free, 0.3 ml /vial or 0.5 ml/vial, and lyophilize
in freeze dryer.
Preparation of liquid injection
Solution Stock Solution of 34.5 ug/ml rSIFN-co
PB (pH7.0) 25mmol/L
NaCl 0.lmol/L
Preparation: Weigh materials according to recipe. Add to desired level with sterile and pyrogen-free water. Filter through 0.22mm membrane to de-bacterialize, preserve at 6-10°C. Fill in airtight vial after affirming it is sterile and non-pyrogen at 0.3 ml /vial or 0.5 ml/vial. Storage at
2-10oC, and protect from light.
EXAMPLE 6
Acute Toxicity of rSIFN-co
Treat mice with large dose (150mg/kg, equal to 1000 times of the normal dose per kilo used in treatment of adult patients) of rSIFN-co at one time by intramuscular injection. Then, observe and record their deaths and toxic reactions. Results show that: 24 hours after injection, no
56

abnormal reaction had been recorded. The organs of the animals which had been selected to be killed also had no signs of abnormal changes. Those remaining mice were all kept alive and were normal after two weeks. The weights of
mice in the experimental group and control group all increased, and the ratio of increase had no obvious difference between the two groups (P>0.05) according to their weights on the fourteenth day. No abnormal changes were seen from the main organs of those mice after two
weeks.
1. Experimental material
1.1 Animals
40 healthy adult mice, weighing 18-22g, half male and half female, qualified by Sichuan experiment animal control center.
2.2 Medicines
rSIFN-co (Provided by Sichuan Huiyang Life-engineering Ltd.) sterilized solution, 0.15 mg/ml, Lot: 981201 rSIFN-co was administered i./n. in saline.
2. Method
Separate the 40 mice into two groups randomly, one for experimental medicine, another for control. Inject
medicines or saline at the same ratio (0.1 ml/10 g) through
muscle to each mouse according to which group they belong.
(150 ug/kg of rSIFN-co for experimental group; and saline
for control group). After injection, observe and record
acute toxicity shown in mice. Kill half of the mice (male
and female each half) to check whether there were any abnormal pathologic changes in their main organs, such as heart, spleen, liver, lung, kidney, adrenal gland, stomach, duodenum, etc. after 2 4 hours. Those remains were kept and observed until the fourteenth day. Weigh all mice, kill
them, and then observe the appearance of the organs listed above to see if there are any abnormalities. Take pathological tissue and examine it, using the examination
57

to assess the difference in weight increases in the two groups.
3. Results
Results show that there was no acute toxicity seen after all mice were treated with i.m. rSIFN-co with 150 ug/kg at a time, equal to 1000 times the normal dose per kilo used in treatment of adult patients. In the 14 days after injection, all mice lived well. They ate, drank, exercised,
and excreted normally and showed normal hair conditions. . None of them died. The observation of the main organs of the randomly selected mice shows no abnormal changes 24 hours after injection. 14 days after injection, all remaining mice were killed. Autopsies also showed no
changes. The weights of mice in the two groups all increased, but no obvious difference was shown when accessed with statistic method (p > 0.05). See Table 1:
Table 1 Influence to weights of mice after injection of rSIFN-co
Group Dose Animal Weightsbeforeinjection(g) Weightsafterinjection(g) Increased value of weights(g)
Control 0 20 19.8 ± 1.7 30.8 ± 2.8 11.0 ± 2.9
rSIFN-co 150 20 19.4 ± 1.7 32.1 ± 3.3 12.7 ± 4.3
3. Conclusion
Under conditions of this experiment, there were no toxic reactions in all mice after injection of rSIFN-co with 150 ug/kg. The conclusion can be reached that the maximum tolerable dose of i.m. in mice is 150 ug/kg, which is equal to 1000 times the normal dose per kilo used in treatment of adult patients.


58

EXAMPLE 7
The clinic effects of recombinant super-compound interferon
(rSIFN-co)
The recombinant super-compound interferon (rSIFN-co) is an invention for viral disease therapy, especially for hepatitis. Meanwhile, it can inhibit the activity of EB viruses, VSV, Herpes simplex viruses, cornaviruses, measles viruses et al. Using Wish cells /VSV system as the assay
for anti-virus activity, the results showed that: the other rIFN, was 0.9x108 IU/mg, Intron A was 2.0*108 IU/mg and rSIFN-co was 9x108 IU/mg. The anti-viral activity of rSIFN-co is much higher than those of the former two.
Under the permission of the State Food and Drug Administration (SFDA), People's Republic of China, the clinical trials have taken place in West China Hospital, Sichuan University, the Second Hospital of Chongqing Medical University, the First Hospital of School of Medical,
Zhejiang University since the Feb 2003. The clinical treatment which focuses on the hepatitis B is conducted under the guidance of the mutilcenter, double-blind random test. IFN-alb was used as control, and the primary results showed the following:

The effect of rSIFN-co compared with IFN-alb in the
treatment of chronic active hepatitis B
1. Standard of patients selection: The standard 1-4 are
effective to both treatment with rSIFN-co (9mg) and IFN-alb (5MU, 50mg) , and the standard 1-5 are for rSIFN-co (15mg)
treatment.
1). Age: 18-65
2) . HBsAg test positive last over six months, HBeAg test
positive, PCR assay, HBV-DNA copies ^105/ml
3). ALT>two times of the normal value
4). Never received IFN treatment; or those received the
59

Lamividine treatment but failed or relapsed
5) Once received other IFNs (3MU or 5MU) treatment six months ago, following the Standard of SFDA but failed or relapsed
2. Evaluation of the effects:
In reference to the recommendations from the Tenth China National Committee of Virus Hepatitis and Hepatopathy, the effects were divided into three degrees according to the ALT level, HBV-DNA and HBeAg tests.
Response: ALT normal level, HBV-DNA negative, HBeAg
negative Partial response: ALT normal level, HBV-DNA or HBeAg negative Non response: ALT, HBV-DNA and HBeAg unchanged
The response and partial response groups consider as effective cases.
3. Results of clinic trial:
Group A: treatment with rSIFN-co(9mg)
20 Group B: treatment with IFN-alb (5MU, 50 ug)
Per iod gro up Medicine cas es Effecti'veRate HBsAg Transfer to negative rate HBeAg Transfer to negative rate HBV-DNA Transfer tonegativerate Heptal functionRecoverrate
8-12week A rSIFN-co(9mg) 32 46.88 (15) 9.38 (3) 28.12 (9) 37.50 (12) 84.38 (27)
B IFN-alb(5MU, 50ug) 32 21.88 (7) 0.00 (0) 9.38 (3) 15.62 (5) 56.25 (18)
16-24week A rSIFN-co(9mg) 64 54.69 (35) 7.81 (5) 25.00 (16) 34.38 (22) 90.62 (58)
B IFN-alb(5MU, 50ug) 64 25.00 (16) 0.00 (0) 9.38 (6) 18.75 (12) 78.13 (50)
In Group C, the cases were chronic active hepatitis B treatment with other IFNs (3MU or 5MU) before but failed or relapsed and treated with rSIFN-co (15 ug) , subcutaneous injection, every one day, last 24 weeks. The total cases are
13. After 12 weeks treatment, 7 of 13 (53.85%) were


60

effective. 3 of 13 (23.08%) HBeAg transferred to negative; 7 of 13(53.85%) HBV-DNA transferred to negative; 11 of 13 (84.62%) hepal functions recovered to normal.
4. The side effects of rSIFN-co compared with IFN-alb in the treatment
The side effects of IFN include fever, nausea, myalgia, anorexia, hair lose, leucopenia and thrombocytopenia, etc. The maximum dose of IFN-alb is 5MIU per time; the routine
dose is 3 MIU. When taken the routine dose, 90% patients have I- II degree (WHO standard) side effects. They are fever lower than 38°C, nausea, myalgia, anorexia, etc. When taken at maximum dose, the rate of side effects do not rise obviously, but are more serious. The maximum dose of rSIFN-
co is 24mg, subcutaneous injection, every one day for 3 months. The routine dose is 9mg. When routine doses were used, less than 50% patients have I-II degree (WHO standard) side effects, including fever below 38°C, nausea, myalgia, anorexia, leucopenia and thrombocytopenia slightly. With
maximum dosage, about 50% patients suffered from leucopenia and thrombocytopenia after using rSIFN-co one month, but those side effects would disappear after stopping treatment for one week. It is safe for continue use.
The observations of rSIFN-co treat hepatitis C
1. Standard of patient's selection
1) age: 18-65
2) HCV antibody positive
3) ALT>1.5 times of the normal value, last more than 6 months
2. Evaluation of the effects:
Referring to the standard of Infergen® for treatment of hepatitis C and according to the ALT level and HCV-RNA test, divided the effects into three degree: Response: ALT normal level, HCV-RNA negative
61

Partial response: ALT normal level, HCV-RNA unchanged
Non response: ALT and HCV-RNA unchanged
3. Effects in clinic
The clinical trial was done at the same time with hepatitis
B treatment. 4 6 cases received the treatment, 9 ug each
time, subcutaneous injection, every day for 24 weeks. After.
treatment, 26 of 46 (56.52%) have obvious effects, 12 of 46
(26.08%) HCV-RNA transferred to negative, 26 of 46 (56.52%)
hepal functions recovered to normal.
EXAMPLE 8
Recombinant Super-Compound Interferon Spray
Major component: Recombinant Super Compound Interferon
Characteristic: Liquid, no insoluble material
Pharmacology: Recombinant Super-Compound Interferon is a wide spectrum anti- virus activity. Its effect is 5-20 times higher than those interferons (IFNs) which are available in the market. It can inhibit coronavirus growth
in cell culture, the mechanism is interrupt of combination reaction between the IFN and the correspondent receptor, and induce the express of 2'5'-A synthesizenzyme, protein kinase R in the target cell, therefore inhibit expression of the viral protein. IFN can induce expression of various
anti-virus protein to inhibit the reproduce of viral
proteins, enhance the function of Natural Killer (NK) cell and other Immune regulative functions, and' inhibit the invade of the viruses. Acute toxicity: All mice are alive by the maximum dose
(1000 times to human dose) Subcutaneous injection, do not observe LD50.
Indication: Prevention of severe acute respiratory syndrome Dosage and Administration: Spray to both nasal cavity and throat, three times a day.
Adverse reactions: It is no report about the adverse
reaction of the rIFN spray. It won't induce allergy. If the
62

stimulation is occasion, the adverse reaction in gastrointestin is small and no other obvious adverse reaction during the treatment, it is safe to continue use. All those reaction will self-release.
Warning: Allergic to alFN and productions of E. Coli. patients can not use this produce.
Precautions: Before first use, spray twice to expel the air. If there is any cloudy, precipitation material, out of date or cleavage on the vial, please do not use it.
Pediatric Use: It is unclear. Geriatric Use: It is unclear.
Nursing mothers and pregnant women: Forbidden Drug Interactions: It is unclear.
Overdose: Excess 150 ug (7.5xl07 IU) each time, fever,
anorexia, myalgia, chill will happen more frequently. There is no severe adverse reaction.
Supplied: 1 spray/ pack, 20 ug (1x107IU)/3ml
Storage: Store at 4-8°C. Do not freeze, protect from light. Effective period: Approximately one year
Manufacture: Manufactured by Sichuan Huiyang life-engineering Ltd.
Address: 8 Yusa road, room 902, Building A Chengdu, 610017 Sichuan, P.R. China

EXAMPLE 9-A
In vitro effect of a hew -style recombinant compound, interferon on SARS-associated coronavirus
Sample supplied by: Huiyang Life Engineering Lt Company,
SiChuan
Province
Experimenter: Molecular Biology Department, microorganism
and epidemiology Institute, Academy of Military Medical Science
63

Original data: Preserved in archive of Molecular Biology Department, microorganism and epidemiology Institute, Academy of Military Medical Science
1. Materials
Medicine: New-type recombinant compound interferon, 9mg each, supplied by Huiyang Life Engineering Lt Company, SiChuan province, Lot number:20020501.
Cells: Vero E6, supplied by Molecular Biology Department of
Microorganism and Epidemiology Institute, Academy of Military Medical Science.
Virus: SARS-associated coronavirus, BJ-01, supplied by Molecular Biology Department of Microorganism and Epidemiology Institute, Academy of Military Medical Science.
Cell medium: DMEM supplemented with 10% FBS.
2. Condition Virus was measured in grade 3rd laboratory of biosafety
3. Method
CPE (cytopathic effect) assay of TCID50: l00ml of Vero E6 cells were plated in 96-well plates at 2*104 cells per well. After 24 hr incubation at 37 °C, Vero E6 monolayer cells were treated with 9 levels of SARS-associated coronavirus
dilution by 10-fold dilution, 4 wells per dilution. The cells were incubated at 37 °C and 5% C02. CPE (cytopathic effect) was examined daily by microscopy. CPE less than 25% was determined as +, 26-50% as ++, 51-75% as +++, 76-100% as ++++. CPE was recorded. Then TCID50 was calculated by
Reed-Muench method.
Cytotoxicity of medicine: Vero E6 cells were inoculated into 96-well plates at 2*104 cells (l00ml) per well. After 24-hr incubation at 37°C, cells grew up to monolayer. The medicine was diluted into 36, 18, 9, 4.5, 2.25mg /ml (final
concentration) and added into wells each for 4 wells. The normal cells as control group were set. CPE of medicine
64

group was daily observed during 5 -day period, and then the concentration of medicine exhibiting no toxicity was determined.
CPE assay of the activity of the medicine against SARS-5 associated coronavirus: l00ml of Vero E6 cells were plated in 96-well plates at 2*104 cells per well. After 24hr incubation at 37°C, cells grew up to monolayer. The medicine at the maximal concentration exhibiting no cytotoxicity was diluted into 5 levels by 2-fold dilution
and added into wells (l00ml per well). By incubation with 5% C02 at 37°C for 24-hour, different concentration of virus (10~3, 10~4, 10"5) were added. After treatment with virus for 48-72 hours, CPE was examined (CPE less than 25% was determined as +, 26-50% as ++, 51-75% as +++, 76-100% as
++++, normal cell as -) . The cells were divided into the normal group, the medicine control group, and the different dilution of virus control group, 4 wells per group. CPE was examined daily. Till cytopathic effect was obviously exhibited in the virus control group, the anti-virus
activity of interferon was evaluated. The experiment was repeated. IC50 of the medicine was calculated by Reed-Muench method.
4. Results
Toxicity of virus: TCID50 of virus was 10~8.
Cytotoxicity of medicine: the concentration of Recombinant compound interferon exhibiting no cytotoxicity was 18mg/ml, the cells shape was similar with the control group, and no cytopathic effect was exhibited.
The anti-virus effect of the medicine: Shown in table 1 and table 2


Table 1, the anti-virus effect of new-type recombinant compound interferon (first experiment)


65

10-3 10-4 10-5
18
9
4.5 ++
2.25 +++ ++ "
1.125 ++++ ++++ ++
Virus control group ++++ ++++ +++
Normal group
Medicine control group
Table 2, the anti-virus effect of new-type recombinant compound interferon (second experiment)

Concentration ofIFN(mg /ml) CPE at different concentration of virus
10-3 10-4 10-5
18
9
4.5 +
2.25 +++ ++
1.125 ++++ ++++ ++
Virus control group ++++ ++++ ++++
Normal group
Medicine control group
66

5. Conclusion
The concentration of the new-type recombinant compound interferon exhibiting no cytotoxicity at 18mg /ml. Its IC50 5 were 1.27, 2.25, and 4.04mg/ml respectively according to the concentration of 10"5 (1000TCID50) , 10"4 (1000TCID50) , 3(100000TCID50) of SARS-associated coronavirus (table 3) .
Table 3, IC50 of IFN at different concentration of virus

Dilution of virus IC50 of IFN(ug/ml)
10-3 4.04
10-4 2.25
10-5 1.27
Principal: Jin-yan Wang
Laboratory assistant: Yan-hong Zhao, Xiao-guang Ji, Xiao-yu Li.
Original data: Preserved in archives of Molecular Biology Department, microorganism and epidemiology Institute, Academy of Military Medical Science Date: From May 12th to 30th, 2003
EXAMPLE 9-B
In vitro effect of a new -type recombinant compound interferon and recombinant interferon -cc-2b injection on SARS-associated coronavirus
Sample supplied by: Huiyang Life Engineering Ltd., Sichuan province
Experimenter: Molecular Biology Department, microorganism
and epidemiology Institute, Academy of Military Medical
Science
Original data: Preserved in muniment room of Molecular Biology Department, microorganism and epidemiology
Institute, Academy of Military Medical Science
67

1. Materials
Medicine: New-type recombinant compound interferon , 618mg
/ml , supplied by Huiyang Life Engineering Ltd., SiChuan province ; Anfulong (recombinant interferon -a-2b
injection), supplied by Hua-li-da Biology Engineering Ltd.
Company, Tianjin City, 30ug/vial(300,0000lU/vial), Lot
Number:20030105.
Cells: Vero E6, supplied by Molecular Biology Department of Microorganism and Epidemiology Institute, Academy of
Military Medical Science.
Virus: SARS-associated coronavirus, BJ-01, supplied by
Molecular Biology Department of Microorganism and
Epidemiology Institute, Academy of Military Medical Science. 4Condition: Virus were measured in grade 3rd laboratory of
biosafety
2. Method
TCID50 was measured with CPE assay: Vero E6 cells were
inoculated in 96-well plates at 2*104 cells (l00ml) per well. After a 2 4-hr incubation at 37°C, Vero E6 monolayers were treated with 9 levels of SARS-associated coronavirus dilution by 10 times decreasing, each dilution per 4 wells . The cells were incubated at 37°C and 5% carbon dioxide. CPE
was examined daily by phase-contrast microscopy. CPE less than 25% was determined as +, 26-50% as ++, 51-75% as +++, 76-100% as ++++. CPE was recorded. Then TCID50 was calculated by Reed-Muench method.
TC50 of IFNs were measured by MTT assay: Vero E6 cells were
inoculated in 96-well plates at 2*104 cells per well (l00ml). After 24-hr incubation at 37°C, the supernatant liquid was removed when cells grew up to monolayer, then Vero E6 wasl treated with different concentration of IFNs, each dilution per 4 wells. Normal group was set. After 5-day observation,
the cells were mixed with MTT for 4 hours. After that, remove the liquid, and then thereafter DMSO were added into
68

cells for 0.5 hour. The OD570nm was measured by microplate reader. Finally, TC50 was calculated by Reed-Muench method.
The activity of the INFs against SARS-associated coronavirus was measured with MTT assay: l00ml of Vero Eg 5 cells were inoculated in 96-well plates at 2*104 cells per well. After 24-hr incubation 37°C, cells became monolayer. The medicine dilution at the concentration of exhibiting no cytotoxicity was 5 times decreasing and there were 5 levels of dilution. Then each dilution was added per 4 wells,
100ml per well. After 24-hour incubation at 37°C and 5% C02, IFN solution was removed, then different concentration of virus dilution (10000, 1000, 100 TCID50) were added into dishes, each dilution per 4 wells. The cells were divided into the normal group, the medicine control group, and the
different dilution of virus control group (10000, 1000, 100 TCID50) . The: cells were incubated at 37°C and 5% C02 for 48-72hr, till cytopathic effect was exhibited in the virus control group, CPE was recorded (CPE less than 25% was determined as +, 26-50% as ++, 51-75% as +++, 76-100% as
++++, normal cell as -) . The growth ability of cells was measured with MTT assay, and then the antivirus effect of the INFs was evaluated. The experiment was repeated 3 times. IC50 of the medicine was calculated by Reed-Muench method.
3. Results
TCID50 of virus: TCID50 of virus wasl0-7.
TC50 of IFNs: The concentration of new -type recombinant compound interferon exhibiting no cytotoxicity was l00mg/ml, and that of recombinant IFN-a-2b was 12.5mg/ml, the cells
shape was identical with the normal group at that concentration. TC50 of new -type recombinant compound interferon was 139.18mg/ml, that of recombinant IFN-a-2b was 17.18mg/ml.
69












The anti-virus effect of the medicine: The anti-virus effects of two IFNs were observed in vitro, the results of experiment Were seen on the table 2, and the results of TI were seen on the table 3.
Table 2, The anti-virus activity of IFNs




















4. Conclusion
The protect effect of new-type recombinant compound interferon and IFN-a-2b on Vero E6 was observed in vitro, and the anti-virus ability of IFNs was manifested. IC50 of new-type recombinant compound interferon on SARS-associated
coronavirus at the concentration of 10000,1000,100 was 0.92,0.18,and 0.10mg/ml in three experiments, TI of that was 151.28, 773.32, and 1391.80 respectively. IC50 of IFN-a-2b was 4.75, 1.16, and 0.28mg/ml, TI (treatment index) of that was 3.62,14.78,61.36 respectively.

Most importantly, the two tests (See the above Examples 9A & 9B) of in vitro anti-SARS virus effect of rSIFN-co all testified that even the effective dose of rSIFN-co to inhibit SARS virus is 1/5 of that of Interferon a-2b which
was used clinicly in China at present, the Treatment Index


71
(TI) of rSIFN-co is nearly 50 times of that of Interferon a-2b.(SEE: In vitro effect of a new -type recombinant compound interferon and recombinant interferon-a-2b injection on SARS-associated coronavirus. By The Institute of Microbiology & Epidemiology, Academy of Military Medical Science)
Thirty thousand sprays of rSIFN-co had been used among front-line nurses and doctors, and people in high risk in Sichuan province. The result shows that none of nurses and doctors infected SARS in Sichuan province.
Principal: Jin-yan Wang
Laboratory assistant: Yan-hong Zhao, Xiao-guang Ji, Min Zhang, Jing-hua, Zhao.
Date: From July 1st to 30th, 2003
72-

What is claimed is:
1. A method for producing a recombinant super-compound
interferon with changed spatial configuration and
enhanced antiviral activity comprising steps of:
(a) Introducing nucleic acid molecule which
codes for said interferon with preferred
codons for expression to an appropriate host;
and
(b) Placing the introduced host in conditions
allowing expression of said interferon.
2. The method of claim 1, further comprising recovery
of the expressed interferon.

3. A process for production of recombinant super-
compound interferon with changed spatial
configuration comprising introducing an artificial
gene with selected codon preference into an
appropriate host, culturing said introduced host in
an appropriate condition for the expression of said compound interferon and harvesting the expressed compound interferon.
4. The method of claim 1 or 3, the produced interferon comprising similar or identical interferon DNA sequence but with changed spatial configuration and enhanced antiviral activity wherein for anti-hepatitis B activities, it can inhibit HBV-DNA
replication, and secretion of HBsAg and HBeAg.
5. The process for production of claim 3, comprising
extraction of recombinant super-compound interferon
from fermentation broth, collection of inclusion
body, denaturation and renaturation of the harvested
protein.
73

6. The process of claim 3, wherein the process maintains the high efficacy even when the recombinant super-compound interferon is used with an agent and in a particular concentration.
7. The process of claim 3, comprising separation and purification of the recombinant super-compound interferon.
8. The process of claim 3, comprising lyophilization of the purified recombinant super-compound interferon.
9. The process of claim 3, comprising production of liquid injection of recombinant super-compound interferon.
10. A method for preventing or treating viral diseases or tumor in a subject comprising administering to the subject an effective amount of the recombinant super-compound interferon or a functional equivalent thereof.
11. The method of claim 10 wherein the viral diseases is hepatitis A, hepatitis B, hepatitis C, other types of hepatitis, infections of viruses caused by Epstein-Barr virus, Cytomegalovirus, herpes simplex viruses, or other type of herpes viruses, papovaviruses, poxviruses, picornaviruses, adenoviruses, rihnoviruses, human T cell leukaemia viruses I, or human T cell leukaemia viruses II, or human T cell leukemia virus III.
12. The method of- claim 10, wherein for anti-hepatitis activities, it can inhibit HBV-DNA replication, HBsAg and HBeAg production.
13. The method of claim 10, wherein the tumor is skin
74

cancer, basal cell carcinoma and malignant melanoma, renal cell carcinoma, liver cancer, thyroid cancer, rhinopharyngeal cancer, solid carcinoma, prostate cancer, tummy cancer, esophagus cancer, recta cancer,
pancreas cancer and mammary cancer, ovarian cancer &
superficial bladder cancer, hemangioma, epidermoid carcinoma, cervical cancer, non-small Cell lung cancer, small cell lung cancer, glioma, leucocythemia, acute leucocythemia and chronic
leucocythemia, chronica myelocytic leukemia, hairy
cell leukemia, lymphadenoma, multiple myeloma, polycythemia vera or kaposi's sarcoma.
14. The method of claim 10 wherein recombinant super-
compound interferon was administered via oral, vein
injection, muscle injection, peritoneal injection,
subcutaneous injection, nasal, mucosal
administration, by inhalation via an inspirator.
15. The method of claim 10 wherein . recombinant super-compound interferon was administered following the protocol of injection 9 ug or 15 ug every two days, 3 times a week, totally 24 weeks.
16. A method for preventing or treating virus-induced upper respiratory diseases and Severe Acute Respiratory Syndrome of a subject comprising administering to the subject an effective amount of recombinant super-compound interferon or a
functional equivalent thereof.
17. The method of claim 16, wherein the virus is
respiratory syncytical virus, adenovirus, rhinovirus,
cox-sackie virus, corona virus and its variant, avia
influenza virus and its variant, influenza A virus
and its variant, influenza B virus and its variant, parainfluenza virus and its variant or enterovirus
75

and its variant.
18. The method of claim 16, wherein the recombinant
super-compound interferon is either a, p, or co.

19. The method of claim 16, wherein the recombinant
super-compound interferon was administered via oral,
vein injection, muscle injection, peritoneal
injection, subcutaneous injection, nasal, mucosal.
administration, by inhalation via an inspirator.
20. The method of claim 16, wherein the recombinant
super-compound interferon is delivered by a spray
device.

21. The method of claim 20, wherein the device is
described in Figure 7.
22. The method of claim 16, wherein the interferon is
lyophilized.
23. A method for inhibiting the causative agent of
Severe Acute Respiratory Syndrome comprising
•directly or indirectly contacting the agent with an
effective amount of recombinant super-compound
interferon or its equivalent.
24. A method for inhibiting Severe Acute Respiratory
Syndrome virus or Severe Acute Respiratory Syndrome
virus-infected cells comprising contact an effective
amount of the recombinant super-compound interferon with said virus or cells.
25. A device to deliver the pharmaceutical composition
comprising an effective amount of the recombinant
super-compound interferon capable of inhibiting Severe Acute Respiratory Syndrome virus or Severe
76

Acute Respiratory Syndrome virus-infected cells and
a pharmaceutical^ acceptable carrier or a
pharmaceutical composition comprising an effective
amount of the recombinant super-compound interferon.
capable of preventing or treating Severe Acute
Respiratory Syndrome in a subject and a pharmaceutical^ acceptable carrier.
26. The method of any of claim 14-22, wherein the
subject is a human.
27. A method for preventing ' Severe Acute Respiratory
Syndrome in human comprising application of the
recombinant super-compound interferon three times a
day via a spray which contains twenty microgram
interferon, equal to ten million units of activity, in three milliliter.
Dated this the 5th day of March 2004


77

ABSTRACT
• ^ ■
This invention provides a method for producing interferon with changed spatial configuration and enhanced antiviral
activity comprising steps of: (a) Introducing nucleic acid molecule which codes for said interferon with preferred codons for expression to an appropriate host; and (b) Placing the introduced host in conditions allowing expression of said interferon. This invention also provides
the recombinant super-compound interferon or a functional equivalent thereof resulting from this method and various uses of said interferon.

Documents:

279-MUM-2004-ABSTRACT(5-3-2004).pdf

279-MUM-2004-ABSTRACT(GRANTED)-(6-1-2009).pdf

279-mum-2004-abstract.doc

279-mum-2004-abstract.pdf

279-mum-2004-cancelled pages(05-03-2004).pdf

279-mum-2004-cancelled pages(29-7-2008).pdf

279-mum-2004-claims (granted)(05-03-2004).pdf

279-MUM-2004-CLAIMS(29-7-2008).pdf

279-mum-2004-claims(5-3-2004).pdf

279-MUM-2004-CLAIMS(AMENDED)-(29-7-2008).pdf

279-MUM-2004-CLAIMS(AMENDED)-(29-9-2008).pdf

279-mum-2004-claims(granted)-(05-03-2004).doc

279-mum-2004-claims(granted)-(6-1-2009).pdf

279-mum-2004-claims.doc

279-mum-2004-claims.pdf

279-mum-2004-correspondence(29-09-2008).pdf

279-MUM-2004-CORRESPONDENCE(29-7-2008).pdf

279-MUM-2004-CORRESPONDENCE(29-9-2008).pdf

279-MUM-2004-CORRESPONDENCE(6-12-2007).pdf

279-mum-2004-correspondence(ipo)-(21-11-2008).pdf

279-mum-2004-correspondence(ipo)-(28-1-2009).pdf

279-mum-2004-correspondence-received-ver-031106.pdf

279-mum-2004-correspondence-received-ver-050304.pdf

279-mum-2004-correspondence-received-ver-130306.pdf

279-mum-2004-correspondence-received-ver-200404.pdf

279-mum-2004-correspondence-received-ver-290304.pdf

279-mum-2004-descripiton (complete).pdf

279-MUM-2004-DESCRIPTION(COMPLETE)-(29-7-2008).pdf

279-mum-2004-description(complete)-(5-3-2004).pdf

279-mum-2004-description(granted)-(6-1-2009).pdf

279-mum-2004-drawing(05-03-2004).pdf

279-MUM-2004-DRAWING(29-7-2008).pdf

279-mum-2004-drawing(granted)-(6-1-2009).pdf

279-mum-2004-form 1(05-03-2004).pdf

279-MUM-2004-FORM 1(20-4-2004).pdf

279-MUM-2004-FORM 1(29-7-2008).pdf

279-mum-2004-form 1(5-3-2004).pdf

279-mum-2004-form 18(03-11-2006).pdf

279-MUM-2004-FORM 18(3-11-2006).pdf

279-mum-2004-form 2(5-3-2004).pdf

279-mum-2004-form 2(granted)-(05-03-2004).doc

279-mum-2004-form 2(granted)-(05-03-2004).pdf

279-mum-2004-form 2(granted)-(6-1-2009).pdf

279-MUM-2004-FORM 2(TITLE PAGE)-(29-7-2008).pdf

279-MUM-2004-FORM 2(TITLE PAGE)-(29-7-2008).tif

279-mum-2004-form 2(title page)-(5-3-2004).pdf

279-mum-2004-form 2(title page)-(granted)-(6-1-2009).pdf

279-mum-2004-form 26(04-03-2004).pdf

279-MUM-2004-FORM 26(20-4-2004).pdf

279-mum-2004-form 3(05-03-2004).pdf

279-mum-2004-form 3(29-07-2008).pdf

279-MUM-2004-FORM 3(29-7-2008).pdf

279-mum-2004-form 5(29-07-2008).pdf

279-MUM-2004-FORM 5(29-7-2008).pdf

279-mum-2004-form-1.pdf

279-mum-2004-form-18.pdf

279-mum-2004-form-2-(drawings).doc

279-mum-2004-form-2.pdf

279-mum-2004-form-26.pdf

279-mum-2004-form-3.pdf

279-MUM-2004-OTHER DOCUMENT(29-7-2008).pdf

279-MUM-2004-REPLY TO FIRST EXAMINATION REPORT(28-7-2008).pdf


« Previous Patent
Next Patent »
Patent Number 227322
Indian Patent Application Number 279/MUM/2004
PG Journal Number 10/2009
Publication Date 06-Mar-2009
Grant Date 06-Jan-2009
Date of Filing 05-Mar-2004
Name of Patentee SICHUAN BIOTECHNOLOGY RESEARCH CENTER
Applicant Address BUILDING A SUITE 902 NO 8 YUSHA ROAD CHENGU SICHUAN 610017 P.R.CHINA
Inventors:
# Inventor's Name Inventor's Address
1 WEI GUANGWEN BUILDING A SUITE 902 NO 8 YUSHA ROAD CHENGU SICHUAN 610017 P.R.CHINA
2 GUO RONGBING BUILDING A SUITE 902 NO 8 YUSHA ROAD CHENGU SICHUAN 610017 P.R.CHINA
3 ZHANG RENHUAI BUILDING A SUITE 902 NO 8 YUSHA ROAD CHENGU SICHUAN 610017 P.R.CHINA
PCT International Classification Number C07H
PCT International Application Number N/A
PCT International Filing date
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 US60/498,923 2003-08-28 U.S.A.
2 US60/498,785 2003-08-28 U.S.A.