Title of Invention

"A VACCINE, MODIFIED NON-PATHOGENIC PESTIVIRUS, NUCLEIC ACID AND PHARMACEUTICAL COMPOSITION COMPRISING THE SAME"

Abstract

A modified non-pathogenic pestivirus, wherein the RNase activity residing in glycoprotein E8^ is inactivated by deletions and/or mutations of at least one amino acid of said glycoprotein, wherein said deletions and/or mutations are selected from the group consisting of: i) 297-K, ii) 295-S or G, iii) 300-W or G, ,-'' iv) 346-K or d, > v) 297-K and 346-K vi) 297-K and 346-L, vji) 297-L and 346-L viii) deletion of histidine 346 according to SEQ ID NO:25 of said glycoprotein.

Full Text

FORM 2 THE PATENTS ACT 1970 [39 OF 1970], "THE PATENTS. (AMENDMENT) RULES, 2006 COMPLETE SPECIFICATION [See Section 10; rule 13] A VACCINE, MODIFIED NON-PATHOGENIC PESTIVIRUS NUCLEIC . ACID AND PHARMACEUTICAL COMPOSITION COMPRISING THE SAME" BOEHRINGER INGELHEIM . VETMEDICA GMBH, a German company, of D-55216 Ingelheim am Rhein, Germany The following specification particularly describes the invention and. the manner in which it is to be performed: GRANTED The present invention relates to a . vaccine, modified non-pathogenic pestivirus, nucleic acid and pharmaceutical composition comprising the same. The present invention relates to a method for attenuating pestiviruses by inactivating the ribonuclease activiry(RNase activity) . residing in glycoprotein ERNS The invention also relates to pestiviruses attenuated according to the invention, nucleic acid for preparing such pestivruses, vaccines and pharmaceutical compositions comprising the attenuated pestiviruses of the invention. The invention further relates to . methods for distinguishing between the attenuated viruses of the invention and pathogenic viruses. Pestiviruses are causative agents of economically important diseases of animals in many countries worldwide. Presently known virus isolates have been grouped into three different species which together form one genus within the family Flaviviridae. I Bovine viral diarrhea virus (BVDV) causes bovine viral diarrhea (BVD) and mucosal disease (MD) in cattle (Baker 1987; Moenning and Plagemann, 1992; Thielet al., 1996). II Classical swine fever virus (CSFV), formerly named hog cholera virus, is responsible for classical swine fever (CSF) or hog cholera (HC) Moenning and Plagemann, 1992; Thiel et al., 1996), III Border disease virus (BDV) is typically found in sheep and causes border disease (BD). Symptoms similar to MD in cattle have also been described to occur after intrauterine infection of lambs with BDV (Moennig and Plagemann, 1992; Thiel et al, 1996). An alternative classification of pestiviruses is provided by Becher et al (1995) or others. Pestiviruses are small enveloped viruses with a single stranded RNA genome of positive polarity lacking both 5' cap and 3' poly(A) sequences. The viral genome codes for a polyprotein of about 4000 amino acids giving rise to final cleavage products by co-and posttranslational rocessing involving cellular and viral proteases. The viral proteins are arranged in the polyprotein in the order NH2-Npro-C-ERNS-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH (Rjce. 1996). Protein C and the glycoproteins ERNS, E1 and E2 represent structural components of the pestivirus virion (Thiel et al., 1991). E2 and to a lesser extent ERNS were found to be targets for antibody neutralization (Donis et a!., 1988; Paton et al., 1992; van Rijn et al., 1993; Weiland etal., 1990.1992). ERNS lacks a membrane anchor and is secreted in considerable amounts from the infected cells; this protein has been reported to exhibit RNase activity (Hulst et al., .1994; Schneider et al., 1993; Windisch et al., 1996). The function of this enzymatic activity for the viral life cycle is presently unknown. In the ease of a CSFV vaccine strain experimental destruction of the RNase by site directed mutagenesis has been reported to result in a cytopathogenic virus that has growth characteristics in cell culture equivalent to wild type virus (Hulst et al., 1998). The enzymatic activity depends on the presence of two stretches of anino acids conserved between the pestivirus ERNS and different known RNases of plant and fungal origin. Both of these conserved sequences contain a histidine residue (Schneider et al., 1993). Exchange of each of these residues against lysine in the ERNS protein of a CSFV vaccine strain resulted in the destruction of RNase activity (Hulst et al., 1998). Introduction of these mutations into the genome of the CSFV vaccine strain did not influence viral viability or growth properties but led to a virus exhibiting a slightly cytopathogenic phenotype (Hulst etal., 1998). Vaccines comprising attenuated or killed viruses or viral proteins expressed in heterologous expression systems have been generated for CSFV and BVDV and are presently used. The structural basis of the attenuation of these viruses used as life vaccines is not known. This leads to the risk of unpredictable revertants by backmutation or recombination subsequent to vaccination. On the other hand, the efficacy of inactivated vaccines or heterologously expressed viral proteins (subunit vaccines) in the induction of immunity is rather low. In general, live vaccines with defined mutations as a basis for attenuation would allow to avoid the disadvantages of the present generation of vaccines. Potential targets for attenuating mutations in pestiviruses are not available at present. A further advantage of said attenuating mutations lies in their molecular uniqueness which allows to use them as distinctive labels for an attenuated pestiviruses and to distinguish them from pestiviruses from the field. Because of the importance of an effective and safe as well as detectable prophylaxis and treatment of pestiviral infections, there is a strong need for live and specifically attenuated vaccines with a high potential for induction of immunity as well as a 5 defined basis of attenuation which can also be distinguished from pathogenic pestiviruses. Therefore, the technical problem underlying the present invention is to provide specifically attenuated and detectably labeled pestiviruses for use as live attenuated 10 vaccines with a high efficiency for the induction of immunity which, as a result of this method, can also be distinguished from pathogenic pestiviruses from the field. Disclosure of the invention 15 The solution to the above technical problem is achieved by the description and the embodiments characterized in the claims. It has surprisingly been found that pestiviruses can be specifically attenuated by the inactivation of the RNase activity residing in glycoprotein ERNS The attenuated pestiviruses now provide live vaccines of high immunogenicity. 20 Therefore, in one aspect the present invention provides a live vaccine comprising a pestivirus, wherein the RNase activity residing in glycoprotein ERNS is inactivated. The term "vaccine" as used herein refers to a pharmaceutical composition comprising at least one immunologically active component that induces an immunological response in an animal and possibly but not necessarily one or more 25 additional components that enhance the immunological" activity of said active component. A vaccine may. additionally comprise further components typical to pharmaceutical compostions. The immunologically active component of a vaccine may comprise complete live organisms in either its original form or as attenuated organisms in a so called modified live vaccine (MLV) or organisms inactivated by 30 appropriate methods in a so called killed vaccine (KV). In another form the immunologically active component of a vaccine may comprise appropriate elements of said organisms (subunit vaccines) whereby these elements are generated either by destroying the whole organism or the growth cultures of such organisms and subsequent purification steps yielding in the desired structure(s). or by synthetic processes induced by an appropriate manipulation of a suitable system like, but not restricted to bacteria, insects, mammalian or other species plus subsequent isolation and purification procedures or by induction of said synthetic processes in the animal needing a vaccine by direct incorporation of genetic material using suitable 5 pharmaceutical compositions (polynucleotide vaccination). A vaccine may comprise one or simultaneously more than one of the elements described above. Additional components to enhance the immune response are constituents commonly referred to as adjuvants, like e.g. aluminiumhydroxide. mineral or other oils or ancillary molecules added to the vaccine or generated by the body after the 10 respective induction by such additional* components, like but not restricted to interferons, interleukins or growth factors. A "pharmaceutical composition" essentially consists of one or more ingredients capable of modifying physiological e.g. immunological functions of the organism it is inistered to, or of organisms living in or on its surface like but not restricted to 15 antibiotics or antiparasitics, as well as other constituents added to it in order to achieve certain other objectives like, but not limited to, processing traits, sterility, stability, feasibility to administer the composition via enteral or parenteral routes such as oral, intranasal, intravenous, intramuscular, subcutaneous intradermal or other suitable route, tolerance after administration, controlled release properties. 20 A vaccine of the invention refers to a vaccine as defined above, wherein one immunologically active component is a pestivirus or of pestiviral origin. The term "live vaccine" refers to a vaccine comprising a living, in particular, a living viral active component. The term "pestivirus" as used herein refers to all pestiviruses, characterized by 25 belonging to the same genus as BVDV, CSFV and BDV within the family Flaviviridae and by their expression of glycoprotein ERNS.Of course, said term also refers to all pestiviruses as characterized by Becher" ef al. (1995) or others that express glycoprotein ERNS. "RNase activity" as used herein refers to the ability of the glycoprotein ERNS to hydrolyze RNA. 30 It should be noted that the term glycoprotein EO is often used synonymously to glycoprotein ERNS in publications. The term "inactivation of the RNase activity residing in said glycoprotein" refers to the inability or reduced capability of a modified glycoprotein ERNS to hydrolyze RNA as compared to the unmodified wild type of said glycoprotein ERNS. inactivation of the RNase activity residing in glycoprotein E can be achieved by deletions and/or mutations of at least one amino acid of said glycoprotein as demonstrated herein and by Hulst et al. (1998). Therefore, in a preferred embodiment the present invention relates to live vaccines, wherein said RNase activity is inactivated by deletions and/or mutations of at least one amino acid of said glycoprotein. It has been shown that the glycoprotein ERNS forms a disulfide-bonded homodimer of about 97 kD, wherein each monomer consists of 227 amino acids corresponding to the amino acids 268 to 494 of the CSFV polyprotein as described by Rumenapf et al. (1993). The first 495 amino acids as expressed by the Alfort strain of CSFV are shown in figure 1 for reference purpose only. The genome sequence-of the Alfort strain of CSFV is available in the GenBank/EMBL data library under accession number J04358; alternatively, the amino acid sequence for the BVDV strain CP7 can b*ef accessed in the GenBank/EMBL data library (accession number U63479). Two regions of amino acids are highly conserved in glycoprotein ERNS as well as in some plant and fungal RNase-active proteins (Schneider et al., 1993). These two regions are of particular importance to the RNase enzymatic activity. The first region consists of the region at the amino acids at position 295 to 307 an8l the second region consists of the amino acids at position 338 to 357 of said viral polyprotein as exemplified by figure 1 for the Alfort strain of CSFV (numbering according to the published deduced amino acid sequence of CSFV strain Alfort (Meyers et al., 1989). The amino acids of particular importance to the RNase activity as mentioned above are by no means limited to the exact position as defined for the-Alfort strain of CSFV but are simply used in an exemplary manner to point out the preferred amino acids being at that position or corresponding to that position in other strains such as found in BVDV, BDV and pestiviruses in general since they are highly conserved. For pestiviruses other than the CSFV Alfort strairr'the numbering of the positions of the preferred amino acids is often different but an expert in the field of the molecular biology of pestiviruses will easily identify these preferred amino acids by their position relative to the highly conserved amino acids of said glycoprotein. In one particular non-limiting example, the position of CSFV Alfort 346 is identical to position 349 of BVDV strain cp7. As a consequence, the present invention relates in a more preferred embodiment to a vaccine of the invention, wherein said inactivating deletions and/or mutations are located at the amino acids at position 295 to 307 and/or position 338 to 357. as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein: In a very preferred embodiment the present invention discloses that the inactivation of said RNase activity by deletion or mutation of the amino acid at position 346 of said glycoprotein leads to particularly useful live vaccines. Therefore, the present invention relates to vaccines according to the invention, wherein said Rnase activity is inactivated by deletion or mutation of the amino acid at position 346, as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. The present invention demonstrates that pestiviruses are viable and code for an E protein without RNase activity when the histidine residue ai position 346 di the viral polyprotein (numbering according to the published sequence of CSFV A|fort/Tubingen (Meyers et al., 1989)). which represents one of the conserved putative active site residues of the ERNS RNase, is deleted. It has also been demonstrated for this invention that the deletion of the respective histidine in the ERNS of a BVD pestivirus (position 349, numbered according to the sequence of BVDV CP7 GenBank/EMBL data library (accession number U63479)) results in a viable virus in which the ERNS glycoprotein has lost the RNase activity. In contrast to point mutations changing one amino acid into another, a deletion mutant is generally much more stable with respect to revertants. Infection of pigs with a mutant of the pathogenic CSFV Alfort/Tubingen expressing ERNS with this deletion did not lead to fever or other typical clinical signs of CSFV infections whereas the infection with wild type virus resulted in fever, diarrhea, anorexia, apathy, depletion of B-cells and central nervous disorders. These pigs were killed in a moribund stage showing severe hemorrhages in the skin and internal organs 14 days post inoculation. The pigs infected with the mutant did neither show viremia nor B-cell depletion as tested on days 3, 5, 7. 10. 14 post infection while CSFV was easily isolated from blood samples derived from the pigs inoculated with wild type virus. The deletion mutant apparently replicated in the animals as indicated by the induction of neutralizing antibodies (see Example 3, Table 3c). The immune response to the mutant virus was sufficient to permit to survive a lethal challenge with 2x105 TCID50 of the highly pathogenic infection with the CSFV strain Eystrup (Konig, 1994) which is heterologous to the Alfort strain. Moreover, the tested animals displayed ho typical clinical signs for CSFV infection like fever, diarrhea, hemorrhages.'B-cell depletion or anorexia after the challenge infection. This data demonstrates that infection of pigs with the deletion mutant induces an immune response sufficient for protection against a stringent challenge. Therefore, in a most preferred embodiment, the invention relates to vaccines according to the invention, wherein said RNase activity is inactivated by the deletion of the histidine residue at position 346, as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. Jn a further-most preferred embodiment, the invention relates to BVDV vaccines according to the invention, wherein said RNase activity is inactivated by the deletion of the histidine residue at position 346, as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other BVDV strains, of said glycoprotein. In another aspect the present invention relates to attenuated pestiviruses, wherein the RNase activity residing in glycoprotein ERNSis inactivated by deletions and/or mutations of at least one amino acid of said glycoprotein with the proviso that the amino acids at position 297 and/or 346 of said glycoprotein as described in figure 1 for CSFV are not lysine. A recombinant pestivirus, wherein amino acids at position 297 and/or 346 of said glycoprotein are lysine has been described by Hulst et al. in 1998. These particular pestiviruses demonstrated cytopathic effects in swine kidney cells. Up to now, there has been total unawareness of the surprising and innovative attenuating feature due to the inactivation of the ERNS enzymatic activity. In a preferred embodiment for the reasons stated above "for vaccines the present invention also relates to pestiviruses according to the invention, wherein said RNase activity is inactivated by deletions and/or mutations located at the amino acids at position 295 to 307 and/or position 338 to 357, as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. In a more preferred embodiment for the reasons stated above for vaccines the present invention also relates to pestiviruses of the invention, wherein said RNase activity is inactivated by deletion or mutation of the amino acid at position 346. as described in figure 1 for the CSFV Aifort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. In a most preferred embodiment for the reasons stated above for vaccines the present invention also relates to pestiviruses, wherein said RNase activity is 5 inactivated by the deletion of the histidine residue at position 346, as described in figure 1 for the CSFV Aifort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. In a further most preferred embodiment, the present invention relates to BVDV pestiviruses, wherein said RNase activity is inactivated by the deletion of the histidine 10 residue at position 346, as described in figure 1 for the CSFV Aifort strain in an exemplary manner or corresponding thereto in other BVDV strains, of said glycoprotein. Hhte attenuated pestiviruses and active components of the vaccines of the present 15 invention can easily be prepared by nucleic acid-modifying recombinant techniques resulting in the expression of a mutant amino acid sequence in glycoprotein ERNS. Therefore, a further aspect of the present invention relates to nucleic acids coding for a glycoprotein ERNS, wherein the RNase activity residing in said glycoprotein is inactivated by deletions and/or mutations of at least one amino acid of said 20 glycoprotein with the proviso that the amino acids at position 297 and/or 346 of the ; glycoprotein as described in figure 1 for the CSFV Aifort strain are not lysine. In a preferred embodiment the present invention relates, for reasons as mentioned above, to nucleic acids according to the invention, wherein said RNase activity is inactivated by deletions and/or mutations that are located at the amino acids at 25 position 295 to 307 and/or position 338 to 357, as described in figure 1 for the CSFV Aifort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. In a more preferred embodiment the present invention relates, for reasons as mentioned for vaccines, to nucleic acids according to the invention, wherein said 30 RNase activity is inactivated by deletion or mutation of the amino acid at position 346, as described in figure 1 for the CSFV Aifort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. In a most preferred embodiment the present invention relates to nucleic acids according to the invention, wherein said RNase activity is inactivated by the deletion of the histidine residue at position 346. as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. In a further most preferred embodiment the present invention relates to BVDV nucleic acids accordirig to the invention, wherein said RNase activity is inactivated by the deletion of the histidine residue at position 346. as described in figure 1 for the CSFV Aifort strain in an exempfary manner or corresponding thereto in other BVDV strains, of said glycoprotein. Nucleotides, e.g. DNA or RNA. are also useful for preparing DNA-, RNA- and/or vector-vaccines. In these vaccines, the nucleotides are applied directly to the animal or indirectly Via vectors other than the original'virus. Nucleotide vaccines and vector vaccines are well known from the present state of the art and will not be elaborated further. in afurther aspect the present invention relates to the use of nucleic acids of the present invention for preparing nucleotide- and/or vector-vaccines. The vaccines, attenuated pestiviruses, and/or nucleic acids according to the invention are particularly useful for the preparation of a pharmaceutical composition. In consequence, a further aspect of the present invention relates to pharmaceutical compositions comprising a vaccine according to the invention, and/or a pesUvirus according to the invention, and/or a nucleotide sequence according to the invention One non-limiting example of such a pharmaceutical composition, solely given for demonstration purposes, could be prepared as follows: Cell culture supernatant of an infected cell culture is mixed with a stabilizer (e.g. spermidine and/or BSA (bovine serum albumin)) and the mixture is subsequently lyophilized or dehydrated by other methods. Prior to vaccination, said mixture is then rehydrated in aquous (e.g. saline. , PBS (phosphate buffered saline)) or non aquous solutions (e.g. oil emulsion, aluminum-based adjuvant). An additional aspect of the present invention relates to a method of attenuation for pestiviruses. The invention provides a unique and unexpected method for attenuating pestiviruses characterized in that the RNase activity residing in glycoprotein ERNS is inactivated. The specifically attenuated pestiviruses are especially useful for the preparation of vaccines. Therefore, in a further additional aspect the present invention relates to methods for producing a specifically attenuated pestivirus vaccine characterized in that the Rnase activity residing in glycoprotein ERNS is inactivated. The inactivation of the RNase activity residing in glycoprotein ERN provides a surprising and new method fordetectably labeling pestiviruses. In a further aspect the present invention provides a method for detectably labeling pestiviruses characterized in that the RNase activity residing in glycoprotein ERNS is inactivated. The feature of absence of RNase activity residing in the glycoprotein ERNS of pestiviruses of the invention now enables for detectably labeling these pestiviruses. Labeled and unlabeled pestiviruses or the ERNS secreted from pestivirus infected cells in body fluids can clearly be distinguished by the absence or presence of -RNS auuvny ui uits yiyuupiuitJirus t activity. For pestiviruses inactivated in their RNase activity residing in glycoprotein ERNS by deletion and/or mutation, a number of other techniques can be used. Such pestiviruses can easily be detected because of the structural consequences resulting from such deletions and/or mutations. For example, the sequence difference of the nucleic acid sequence of altered glycoprotein ERNS is detectable by nucleic acid sequencing techniques or PCR-techniques (polymerase-chain reaction) as demonstrated in example 8; the altered protein sequence can be detected by specific monoclonal antibodies, that do not recognize unaltered proteins. Vice versa, it is also possible to detect the altered and thereby structurally labeled proteins by the absence of binding to specific monoclonal antibodies that recognize unaltered glycoproteins ERNS under the proviso that the presence of pestiviruses can be .-/ s established otherwise. And, of course, the deletions and/or mutations abrogating the RNase activity in the labeled viruses will result in different immune responses in animals when compared to the responses resulting from unlabeled pestivirus infections. A preferred embodiment for all aspects referring to methods for attenuating pestiviruses, methods for producing a specifically attenuated pestivirus vaccine and methods for detectably labeling pestiviruses according to the invention are those methods relating to the inactivation of the glycoprotein ERNS, wherein said RNase R nase activity of the glycoproteins ERNS upon isolation and assaying such enzymatic activity is inactivated by deletions and/or mutations of at Jeast one amino acid of said glycoprotein. A more preferred embodiment for all aspects referring to methods for attenuating pestiviruses, methods for producing a specifically attenuated pestivirus vaccine and . 5 methods for detectably labeling pestiviruses according to the invention are those methods relating to the inactivation of the glycoprotein ERNS, wherein said deletions and/or mutations are located at'the amino acids at position 295 to 307 and/or position 338 to 357, as described in figure 1 for the CSFV Affort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. 10 A very preferred embodiment for all aspects referring to methods for attenuating pestiviruses. methods for producing a specifically attenuated pestivirus vaccine and methods for detectably labeling pestiviruses according to the invention are those methods relating to the inactivation of the glycoprotein ERNS, wherein said RNase activityis inactivated by deletion or mutation of the amino acid at position 346, as 15 described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. A most preferred embodiment for all aspects referring to methods for attenuating pestiviruses, methods for producing a specifically attenuated pestivirus vaccine and methods for detectably labeling pestiviruses according to the invention are those 20 methods relating to the inactivation of the glycoprotein ERNo, wherein said RNase activity is inactivated by the deletion of the histidine residue at position 346, as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. 25 The present invention provides vaccines and or other pharmaceutical compositions which are particularly useful for the prophylaxis and treatment of pestivirus infections in animals. Therefore, a further aspect of the present invention relates to methods for the prophylaxis and treatment of pestivirus infections in animals characterized in that a vaccine according to the invention or another pharmaceutical composition 30 according to the invention is applied to an animal in need of such prophylaxis or treatment. In a further aspect the present invention provides a process for the preparation of specifically attenuated pestiviruses characterized in that the RNase activity residing in glycoprotein ERNS is inactivated. In one aspect the present invention provides a process for the preparation of specifically labeled pestiviruses characterized in that the RNase activity residing in glycoprotein E 'N" is inactivated . A preferred embodiment for all aspects referring to a process for the preparation of specifically attenuated pestiviruses, a process for the preparation of specifically labeled pestiviruses according to the invention are those processes relating to the inactivation of the glycoprotein ERNS, wherein said RNase activity is inactivated by deletions and/or mutations of at least one amino acid of said glycoprotein. %& more preferred embodiment for all aspects referring to a process for the preparation of specifically attenuated pestiviruses, a process for the preparation of specifically labeled pestiviruses according to the invention are those processes relating to the inactivation of the glycoprotein ERNS, wherein said deletions and/or mutations are located at the amino acids at position 295 to SO/ and/or position 338 to 357, as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. „ A very preferred embodiment for all aspects referring to a process for the preparation of specifically attenuated pestiviruses, a process for the preparation of specifically labeled pestiviruses according to the invention are those processes relating to the inactivation of the glycoprotein ERNS, wherein said Rnase activity is inactivated by deletion or mutation of the amino acid at position 346, as described in figure 1 for the CSFV Alfort strain in an exemplary manner corresponding thereto in other strains, of said glycoprotein. A most preferred embodiment for all aspects referring to a process for the preparation of specifically attenuated pestiviruses, a process for the preparation of specifically labeled pestiviruses according to the invention are those processes relating to the inactivation of the glycoprotein ERNS wherein said RNase activity is inactivated by the deletion of the histidine residue at position 346, as described in figure 1 for the CSFV Alfort strain in an exemplary manner or corresponding thereto in other strains, of said glycoprotein. The vaccines or other pharmaceutical compositions of the present invention are useful for the prophylaxis and treatment of pestivirus infections in animals. Therefore, in one aspect the present invention relates to the use of a vaccine 5 according to the invention for the prophylaxis and treatment of pestivirus infections in animals. In a further aspect the present invention relates to the use of a pharmaceutical composition according to the invention for the prophylaxis and treatment of pestivirus infections in animals. 10 Pestiviruses and/or nucleic acids according to the invention are useful active components of a pharmaceutical composition or a vaccine. Therefore, the present invention relates in a further aspect to the use of a pestivirus of the invention and/or a nucleic acid of the invention for the preparation of a vaccine or a pharmaceutical composition. 15 As mentioned above the inactivation of the RNase activity residing in glycoprotein ERNS provides a surprising and new method for labeling pestiviruses. As a consequence" one aspect of the present invention relates to methods for distinguishing the detectably labeled pestiviruses according to the invention from 20 unlabeled and possibly pathogenic pestiviruses. Such methods are especially useful for tracing the efficacy of labeled pestiviruses in animals. A vaccine treated animal will prove label-positive after obtaining a sample of such animal and assaying for said label. Unlabeled animals and especially unlabeled animals-that prove pestivirus positive can be immediately separated, isolated or slaughtered to remove the 25 imminent danger of spreading the pathogenic infection to other animals. The present invention provides a method for detectably labeling pestiviruses characterized in that the RNase activity residing in glycoprotein ERNS is inactivated. This feature of absence of RNase activity residing in the glycoprotein E of pestiviruses of the invention now enables for detectably labeling these pestiviruses. 30 As a result labeled and unlabeled pestiviruses can clearly be distinguished by the absence or presence of RNase activity of the glycoprotein ERNS upon isolation and assaying such enzymatic activity. The determination of presence or absence of this enzymatic activity upon obtaining a sample containing a pestivirus of interest or material thereof can be performed according to standard methods as, for example, described in Example 2 or in Hulst et al. (1994). Therefore, in a- preferred embodiment the present invention relates to a method for distinguishing pestivirus-infected animals from animals vaccinated with a specifically 5 attenuated pestivirus according to the invention, comprising the following steps: (1) Obtaining a sample from an animal of interest suspected of pestivirus infection or a vaccinated animal; (2) Determining the absence or presence of RNase activity of a glycoprotein ERNS within said sample; 10 (3) Correlating the absence of RNase activity of glycoprotein ERNS with a vaccinated animal and correlating the presence of said activity with a pestivirus infection of said animal. Wjpe present invention provides pestiviruses inactivated in their RNase activity 15 residing in glycoprotein ERNS by deletion and/or mutation. Such pestiviruses are easily detected because of the structural consequences resulting from such deletions and/or mutations. The sequence difference of the ERNS gene coding for the altered glycoprotein ERNS is detectable by sequencing techniques or PCR-techniques. As a result, the present invention provides in a preferred embodiment a 20 method for distinguishing pestivirus-infected animals from animals vaccinated with a specifically attenuated pestivirus according to the invention, comprising the following steps: (1) Obtaining a sample from an animal of interest suspected of pestivirus infection or a vaccinated animal; 25 (2) Identifying the nucleotide sequence of a pestfvirus genome or protein within said sample; (3) Correlating the deletions and/or mutations of the ERNS nucleotide sequence as present in the vaccine with a vaccinated animal and correlating the absence of said deletions and/or mutations with a 30 pestivirus infection of said animal. Furthermore, the structural changes resulting from the altered protein sequence of the glycoprotein ERNS of pestiviruses of the invention can be detected by specific monoclonal or polyclonal antibodies, that do not recognize unaltered proteins. Therefore, in a further embodiment, the present invention relates to a method for distinguishing pestivirus-infected animals from animals vaccinated with an attenuated pestivtrus according to the invention, comprising the following steps: (1) Obtaining a sample from an animal of interest suspected of pestivirus infection or a vaccinated animal; (2) Identifying a modified ERNS glycoprotein of an attenuated pestivirus by the specific binding of monoclonal or polyclonal antibodies to ERNS glycoproteins present in said sample, said glycoproteins being modified by a method according to the invention, whereby said monoclonal or polyclonal antibodies do not bind to unmodified ERNS glycoproteins; (3) Correlating the specific binding of said monoclonal or polyclonal antibodies with a vaccinated animal and correlating the absence of antibody binding to a pestivirus infection of said animal under the proviso that the presence of pestiviral material in said animal and/or said sample is established otherwise. Vice versa, it is also possible to detect the altered and thereby structurally labeled proteins by the absence of binding to specific monoclonal or polyclonal antibodies that recognize unaltered glycoproteins ERNS only, if the presence of pestiviruses can be established otherwise. In a preferred embodiment the present invention relates to a method for distinguishing pestivirus-infected animals from animals vaccinated with an attenuated pestivirus according to the invention, comprising the following steps; (1) Obtaining a sample from an animal of interest suspected of pestivirus infection or a vaccinated animal; (2) Identifying an unmodified ERNS glycoprotein of a pestivirus by the specific binding of monoclonal' or polyclonal antibodies to E glycoproteins present in said sample, said glycoproteins not being modified by a method according to the invention, whereby said monoclonal or polyclonal antibodies do not bind to modified E glycoproteins; (3) Correlating the specific binding of said monoclonal or polyclonal antibodies with a pestivirus infection in said animal and correlating the absence of antibody binding to an vaccinated animal under the proviso that the presence of pestiviral material in said animal and/or said sample is established otherwise. Of course, the structural modification and absence of the RNase activity in the labeled viruses of the invention will result in different immune responses in animals when compared to the responses resulting from unlabeled pestivirus infections. The pestiviruses of the invention elicit a different and distinct immune response, cellular as well as humoral, that differs from unmodified and possibly pathogenic immune responses. For example, glycoproteins ERNS according to the invention will result in 10 polyclonal antibodies that are different in their binding specificity when compared to polyclonal antibodies resulting from unmodified glycoproteins. This difference in binding specificity provides a label for distinguishing animals vaccinated with pestiviruses from the invention from pestivirus field infected animals. Tests for screening sera for specific polyclonal antibodies that either bind to a wildtype epitope 15 or a marker deletion mutation of that epitope for the purpose of differentiating infected and vaccinated animals have been described, for example for pseudorabies-infected and vaccinated pigs (Kit et al., 1991). In a preferred embodiment the present invention relates to a method for distinguishing pestivirus-infected animals from animals vaccinated with an attenuated 20 pestivirus according to the invention, comprising the following steps: (1) Obtaining a sample of polyclonal antibodies from an animal of interest suspected of pestivirus infection or a vaccinated animal; (2) Identifying any specific binding of said polyclonal antibodies to unmodified glycoprotein ERNS or glycoprotein ERNS as modified 25 according to the invention. (3) Correlating the binding of said ^polyclonal antibodies to unmodified glycoprotein ERNS with a pestivirus infection and correlating the binding of said polyclonal antibodies to glycoprotein E N as modified according 30 to the invention with a vaccinated. References 1. Baker, J.C. 1987. Bovine viral diarrhea virus: a review. J. Am. Vet. Med.Assoc 190: 1449- 2. Becher, P., Konig, M., Paton, D.J., Thiel, H.J., 1995, Further characterization of border disease virus isolates: evidence for the presence of more than three species within the genus pesivirus. Virology 209 (1)7200-206. 3. Donis, R.O., Corapi, W., and Dubovi, E.J. 1988. Neutralizing monoclonal antibodies to bovine viral diarrhea virus bind to the 56K to 58K glycoprotein. J. Gen. Virol. 69: 77-86. 4. Fuerst T.R. et al. 1986. Eukaryotic transient expression system* based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. 83: 8122-8126. 5. Hulst, M.M., Himes, G., Newbigin, EM Moormann, R.J.M. 1994. Glycoprotein E2 of classical swine fever virus: expression in insect cells and identification as a ribonuclease. Virology 200: 558-565. 6. Hulst, M.M., F.E. Panoto, A. Hooekmann, H.G.P. van Gennip., and Moormann, R.J.M. 1998. Inactivation of the RNase activity of glycoprotein Ems of classical swine fever virus results in a cytopathogenic virus. J. Virol. 72: 151-157. 7. Kit, M. and S. Kit. 1991. Sensitive glycoprotein gill blockingVELISA to distinguish between pseudorabies (Aujeszky's disease) -infected and vaccinated pigs. Veterinary Microbiology 28:141 -155. 8. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-392. 9. Konig, Matthias, 1994, Virus der klassischen Schweinepest: Untersuchungen zur Pathogenese und zur Induktion einer protektiven Immunantwort. Dissertation, Tierarztliche Hdchschule Hannover, Germany^ 10. Meyers, G., Riimenapf, T. and Thiel, H.-J. 1989. Molecular cloning and nucleotide sequence of the genome of hog cholera virus.Virology 171: 555-567. 11. Meyers, G., Tautz, N., Becher, P., Thiel, H.-J., & Kummerer, B.M. 1996b. Recovery of cytopathogenic and noncytopathogenic bovine viral diarrhea viruses from cDNA constructs. J. Virol., 70: 8606-8613. 12. Meyers, G., Thiel, H.-J., and Rumenapf, T. 1996a. Classical swine fever virus: Recovery of infectious viruses from cDNA constructs and generation of recombinant cytopathogenic swine fever virus. J. Virol. 67:7088-709526. 13. Moennig, V. and Plagemann, J. 1992. The pestiviruses. Adv. Virus Res. 41: 53- 5 91. 14. Paton, D.J., Lowings, J.P., Barrett, A.D. 1992. Epitope mapping of the gp53 envelope protein of bovine viral diarrhea virus. Virology 190: 763-772. 15. Pellerin, C. et. al. Identification of a new group of bovine viral diarrhea virus Strains associated with severe outbreaks and high mortalities. Virology 203, 10 1994:260-268. 16. Rice, CM. 1996The pestiviruses. In Fields Virology, eds. Fields, B.N.. Knipe, .D.M., & Howley. P.M. (Lippincott-Raven. Philadelphia), pp. 931-959. 17. Rumenapf, T., Unger, G.f Strauss, J.H., and Thiel, H.-J. 1993. Processing of the evelope glycoproteins of pestiviruses. J. Virol. 67: 3288-3294 15 18. Schneider, R., G. Unger, R. Stark, E. Schneider-Scherzer, and H.-J. Thiel. 1993. Identification of a structural glycoprotein of an RNA virus as a ribonuclease. Science 261: 1169-1171. 19. Thiel, H.-J., Plagemann, G.W., & Moennig, V. 1996. THe pestiviruses. In Fields Virology, eds. Fields, B.N., Knipe, D.M., & Howley, P.M. (Lippincott-Raven, 20 Philadelphia), pp.1059-1073. 20. Thiel, H.-J., Stark, R., Weiland, E., Rumenapf, T. & Meyers, G. 1991. Hog cholera virus: molecular composition of virions from a' pestivirus. J. Virol. 65: 4705-4712.31. 21. van Rijn, P.A., van Gennip, H.G., de Mefjer, E.J., Moormann, R.J. 1993. Epitope 25 mapping of envelope glycoprotein E1 of hog cholera virus strain Brescia. J. Gen Virol. 74: 2053-2060. 22. Wetland, E., Thief, H.-J., Hess, G., and Weiland, F. (1989). Development of monoclonal neutralizing antibodies agaist bovine viral diarrhea virus after pretreatment of mice with normal bovine cells and cyclophosphamide. J. Virol. 30 Methods 24: 237-244. WO 99/64604 PCT/EP99/03642 23. Weiland, E., Stark, R., Haas, B., Riimenapf, T., Meyers, G. and Thiel, H.-J. (1990). Pestivirus glycoprotein which induces neutralizing antibodies forms part of a disulfide-linked heterodimer. J. ViroJogy 64. 3563-3569. 24. Weiland, E., Ahl, R., Stark, R., Weiland, F. and Thiel, H.-J. (1992). A second envelope glycoprotein mediates neutralization of a pestivirus, hog cholera virus. J. Virology 66, 3677-3682. 25. Windisch, J.M., Schneider, R., Stark, R., Weiland, E., Meyers, G., and Thiel, H.-J. 1996. RNase of classical swine fever virus: biochemical characterization and inhibition by virus-neutralizing monoclonal antibodies. J. Virol. 70: 352-358 10 Example 1 Examples Generation of RNase-negative pestivirus mutants 15 Starting with the full length cDNA clones pA/CSFV (Meyers et ah. 1996a\or pA/BVDV (Meyers et al., 1996b), from which infectious cRNA can be obtained by in vitro transcription, subclones were generated. For CSFV, a Xhol/Sspl fragment of pA/CSFV was cloned into pBluescript SK+, cut with Xhc! and Smal. For BVDV, a Xhol/Bglll fragment from pA/BVDV was cloned into plasmid pCITE-2C, cut with the 20 same enzymes. Single stranded plasmid DNA was produced from these constructs according to the method of Kunkel (Kunkel et al., 1987) using E. coli CJ 236 cells (BioRad) and the VCMS single strand phage (Stratagene). The single stranded DNA was converted to double strands using the 'Phagemid in vitro Mutagenesis Kit' (BioRad), Some of the synthetic oligonucleotides which were used as primers for 25 generating the desired pestivirus mutants are Jisted below in an exemplary fashion: C-297-L: AGGAGCTTACTTGGGATCTG C-346-L: GGAACAAACTTGGATGGTGT C-297-K: ACAGGAGCTTAAAAGGGATCTGGC 30 C-346-K: ATGGAACAAAAAGGGATGGTGTAA C-346-d: GAATGGAACAAAGGATGGTGTAAC B-346-d: CATGAATGGAACAAAGGTTGGTGCAACTGG The double stranded plasmid DNA was used for transformation of E.coli XL1-Blue cells (Stratagene). Bacterial colonies harboring plasmids were isolated via ampicillin selection. Plasmid DNA was prepared and further analyzed by nucleotide sequencing using the T7 polymerase sequencing kit (Pharmacia). Plasmids containing the desired mutations and no second site changes were used for the construction of full length cDNA clones. In the case of CSFV, a Xhol/Ndei fragment from the mutagenized plasmid was inserted together with a Ndel/Bglll fragment derived from plasmid 578 (pCITE 2A, containing the Xhol/Bglll fragment form pA/CSFV) into pA/CSFV cut with Xhol and Bglll. To obtain the BVDV CP7 mutant, a Xhol/Bglll fragment containing the deletion was inserted into pA/BVDV cut with Xhol and Ncol together with a Bglil/Ncol fragment isolated from pA/BVDV/lns-. From construct pA/BVDV/lns- a cRNA was transcribed that gives rise to a rfoficytopathogenic BVDV upon transfection in suitable cells (Meyers et al., 1996b). The different full length clones were amplified, and the plasmids isolated. The presence of the desired mutations was proven by DNA sequencing. After linearization with Srfl (CSFV full length clones) or Smal (BVDV full length clones) cRNA was transcribed as described previously (Meyers et al 1996ab). RNA was purified by gel filtration and phenol/chloroform extraction and used for transfection of porcine kidney (PK15) cells or bovine kidney (MDBK clone B2) cells (CSFV or BVDV constructs, respectively). The transfections were analyzed by immunofluorescence with virus specific antisera. In cases where the desired mutants could be recovered (immunofluorescence positive) the viruses were amplified by passage on the same cell lines used for the transfection experiments. Further analysis of the CSFV mutants included determination of one step growth curves and characterization of viral RNA by Northern blot with virus specific cDNA probes as well as reverse transcription polymerase chain reaction (RT:PCR) and subsequent sequencing of the PCR fragments to verify the presence of the desired mutations in the viral genome. In all cases the presence of the desired mutation was proven. All of the recovered viruses grew equally well and produced similar amounts of RNA just as the virus resulting from the plasmid displaying the wild type sequence. The viability of the BVDV mutant was shown by transfection of the respective cRNA and splitting of the cells 3 days thereafter. Part of the cells was seeded into a 3.5 cm diameter dish, fixed with acetone/methanol at the day thereafter and analyzed by immunofluorescence with a mixture of BVDV-specific monoclonal antibodies (Weiland et al., 1989). All cells were found positive whereas a control of cells transfected with noninfectious RNA showed no signal. From a part of the cells transfected with the respective cRNA, an extract was produced by one cyde of freezing and thawing. Fresh cells were infected with this cell extract and proved to be BVDV positive by BVDV specific immunofluorescence 3 days post infection. Table 1 summarizes the different changes introduced into the conserved sequences of ERNS representing the putative active site of the RN^se which are encoded by the indicated virus mutants Table 1 Sequence in RNase motif Name pA/gSFV C-297-L C-346-L C-297-L/346-L C-297-K C-346-K C-297-d C-346-d C-296/7/8-d C-345/6/7-d C-345/6-d C-346/7-d C-342-d C-342/6-d C-301-d C-295-S/G C-300-W/G C-302-E/A C-305-C/G C-300-W/G-302 C-340-R/G C-343-W/G C-345-KJA C-297-K/346-K. C-297-K/346-L . ...SLHGIWPEKIC ...SLLGIWPEKIC... ...SLHGIWPEKIC... ...SLLGIWPEKIC... ...SLKGIWPEKIC... ...SLHGIWPEKIC... . . .SL_GI WPEKIC... ...SLHGIWPEKIC. .. .. .S IWPEKIC. . ...SLHGIWPEKIC. .: . ..SLHGIWPEKIC... ...SLHGIWPEKIC... ...SLHGIWPEKIC... ..SLHGIWPEKIC... ...SLHGIW_EKIC. .. . . .GLHGI WPEKIC. . . ...SLHGIGPEKIC... .SLHGIWPAKIC. .. . .SLHGIWPEKIC . . ■E/A . S L H G I G P A K I C. ..SLHGIWPEKIC... ..SLHGIWPEKIC. . . ..SLHGIWPEKIC... ..SLKGIWPEKIC... .-SLKGIWPEKIC... + + + + + + RNase Viability activity of mutant . .RHEWNKHGWCNW.. .RHEWNKHGWCNW.. ..RHEWNKLGWCNW.. ..RHEWNKLGWCNW.. .RHEWNKHGWCNW.. ..RHEWNKKGWCNVtK. .RHEWNKHGWCNW.. . R H E W N K _ G W C N W . .-■ ..RHEWNKHGWCNW.. .RHEWN WCN W. . .RHEWN __GWCNW.. .RHEWNK __WCNW,. .RH_WNKHGWCNW.. .RH_WNK _GWCNW.. .RHEWNKHGWCNW. .RHEWNKHGWCNW. . RH^WNKHGWCN W . . .RHEWNKHGWCNW. RHEWNKHGWCNW. .RHEWNKHGWCNW.. .GHEWNKHGWCNW.. .RHEGNKHGWCNW.. RHEWNAHGWCNW. .RHEWN KKGWCNW.. RHEWNKKGWCNW.. pA/BVDV ...SLHGIWPEKIC RHEWNKHGWCNW. + + B-346-d ...SLHGIWPEKIC R H E W N K_G W C N W . . - + Legend to Table 1: Test for RNase activity was done in a transient assay. BHK21 cells were infected with Vaccina virus vTF7-3 (Fuerst et al. 1986) and then transfected with the respective cDNA construct (5 pg of plasmid DNA, transfection using Superfect as recommended by the supplier (Qiagen)). After 10 hours 5 incubation at 37 °C in a C02 incubator, the transfected celJs were lysed and^ processed for determination of RNase activity as described below). Viability was ' determined as described below. Example 2 Effect of different mutations on RNase activity of ERNS 10 To test the effect of the different mutations on the RNase activity of ERNS appropriate cellsfwere infected with the mutant viruses. For CSFV, the infection was carried out with a multiplicity of infection (m.o.i.) of 0.01. Infection with wild type virus served as a positive control whereas nbninfected cells were used as a negative control. At 48h 15 post infection, cells were washed twice with phosphate buffered*saline and lysed in 0.4 ml of lysis buffer (20 mM Tris/HCI; 100 mM NaCi, 1 mM EDTA, 2 mg/mi bovine serum albumin; 1% Triton X100; 0.1% deoxychoiic acid: 0.1% sodium dodecyl sulfate). The iysate was given into 1.5 ml reaction tubes, sonified (Branson sonifier B12, 120 Watt, 20 s in a cup horn water bath), cleared by centrifugation (5 min, ,20 14,000 rpm, Eppendorf Centrifuge, 4°C) and the supernatant subjected to ultracentrifugation (Beckmann table top ultracentifuge, 60 min at 4°C and 45,000 rpm in a TLA 45 rotor). Determination of RNase activity was done in a total volume of 200 p\ containing 5 or 50 μl of supernatant of the second centrifugation step and 80 μl of Poly(rU)(Pharmacia) in RNase-assay buffer (40mM Tris-acetate (pH 6.5), 0.5 mM 25 EDTA, 5 mM dithiothreitol (DTT)). After incubation of the reaction mixture at 37°C for 1 hour 200 μl of 1.2 M perchloric acid, 20 mM LaS04 was added. After 15 min incubation on ice the mixture was centrifugated for 15 min at 4°C and 14,000 rpm in an Eppendorf centrifuge. To the supernatant 3 volumes of water were added and an aliquot of the mixture was analyzed by measuring the optical density at 260 nm using 30 an Ultrospec 3000 spectrophotometer (Pharmacia). In all cases, the mutations introduced into the Ems gene completely abrogated RNase activity (Table 1). For the BVDV mutant RNase activity was tested with material obtained after RNA transfection without passage of the recovered viruses. Ceils transfected with the appropriate RNA were split 72h post transfection and seeded in two dishes. 24h later, from one dish, cell extracts were prepared and analyzed for RNase activity as 5 described above. To prove infection, the cells of the second dish were analyzed by immunofluorescence with BVDV specific monoclonal antibodies (Weiland et al., 1989) and found 100% positive. Transfection was carried out with RNA transcribed from pA/BVDV/lns- and from pA/B-346-d, the plasmid equivalent to pA/BVDV/lns-but containing the deletion of the codon equivalent to the codon 346 in the CSFV 10 Alfort genome. Nontransfected MDBK cells served as a negative' control. Table 2A Determination of RNase activity of different viruses 15 Description of Table 2A: PK15 cells were infected with the indicated viruses at an m.o.i. (multiplicity of infection) of 0.01, incubated at 37°C for 48 h in a CG2 incubator, and then lysed and subjected to RNase test. The acid soluble RNA resulting from incubation with the different cell extracts was quantified by measuring the optical density at 260 nm. The 20 . observed differences in RNase activity were not due to different amounts of E protein in the samples since similar values were obtained after quantification of E by radioactive labeling, immunoprecipitation and analysis of "radioactivity with a phosphorimager. Moreover, reduction of the Ems concentration in the assay down to only one tenth of the usual amount did not change the resulting OD values 25 considerably, indicating that with the chosen conditions the assay was saturated with 35 Description of table 2B CSFV strain Alfort; all other viruses were recovered from RNA transcribed in vitro from plasmids: e.g. C-WT from pA/CSFV; C-297-L from pA/C-297-L; etc.; C-346-d/Rs virus was recovered from pA/C-346-d/Rs (generated by reversion of mutation in 30 pA/C-346-d by exchange of the respective cDNA fragment against the equivalent fragment derived from pA/CSFV); control: extract of non-infected PK15 cells. MDBK cells were infected with in vitro transcribed RNA, split 72h post transfection and analyzed 24h later for RNase activity. Infection of the cells was proven by immunofluorescence analysis as described in the text. B-WT: virus recovered from pA/BVDV/lns-; B-346-d: virus recovered from pA/B-346-5 d; control; extract from noninfected MDBK cells. Example 3 Pathogenicity of CSFV after RNase inactivation To test, whether the destruction of the RNase activity influences the pathogenicity of 10 pestiviruses in their natural host, animal experiments were conducted with mutant V(pA/C-346-d) (C346-d in. tables). Virus recovered from the CSFV full length clone without mutation (V(pA/CSFV)) served as a positive control (G-WT in,tables). For each mutant three piglets (breed: German landrace; about 25kg body weight) were us^d. The infection dose was 1x105 TCID50 per animal; two thirds of the inoculate 15 was administered intranasally (one third in each nostril), one third intramuscularly. The two groups were housed in separate isolation units. Blood was taken from the animals two times before infection and on days 3, 5, 7, 10, 12 and 14. In addition, temperature was recorded daily (Figure 2). The animals infected with the wild type virus showed typical symptoms of classical swine fever like fever, ataxia, anorexia. 20 diarrhea, central nervous disorders, hemorrhages in the skin (Table 3a). Virus could be recovered form the blood on days 3 (animal #68) and on days 5, 7, 10, 14 (animals #68, #78, #121) (Table 3b) The animals were killed in a moribund stage at day 14 post infection. At this time, no virus neutralizing antibodies could be detected. In contrast, the animals infected with the mutant did not develop clinical symptoms 25 (Table 3a). The temperature stayed normal (Figure 2) over the whole experimental period and the animals never stopped taking up food. At no time virus could be recovered from the blood. Nevertheless, the-animals were clearly infected and the virus most likely replicated since all animals developed neutralizing antibodies (Table 3c). 30 Table 3a: Clinical signs after test infection: Description of Table.3a: 6 piglets (German land race; about 25kg. body weight) in two groups (each group was 5 housed separately) were included in the study. 3 animal were infected with CSFV- y/T- (1-105 TC|D50) and 3 animals with C-346-d (1-105 TCID50). Rectal temperature and clinical signs were recorded and summarized as detailed in the table; n.a.: no necropsy was performed. 10 Table 3b: Blood cell viremia after test infection Description of Table 3b: Blood cell viremia was detected by cocultivation of blood with PK15 cells. After incubation at 37°C for 72h cells were washed with PBS. fixed with ice cold 15 acetone/methanol and analyzed for infection by immunofluorescence with a monoclonal antibody specific for glycoprotein E2 (mAb A18, Weiland et al. 1990). Table 3c: Development of CSFV specific serum neutralization titer days p.i .=3 0 17 25 69 76 79 87 .... pig # 70 pig # 72 pig # 74 - - 1:18 1:18 1:6 1:162 1:54 1:54 1:162 1:486 1:162 1:162 1:1458 1:162 1:486 1:1458 1:486 1:1458 1:4374 1:1458 Description of Table 3c: ' m Antibody titers of pigs infected with virus mutant C-346-d determined at different time 5 points during the animal experiment: 50 μl of the diluted serum were mixed with 50 μl of medium containing 30 TCID50 of virus (CSFV Alfort/Tubingen). After 90 minutes incubation at 37°C, 100 μl of cells (1.5x104 cells) were added and the mixture was seeded in 96 well plates. After 72 h the cells were fixed with ice cold acetone/methanol and analyzed for infection by 10 infmunofluorescence with a monoclonal antibody specific for glycoprotein E2 (mAb A18, Weiland et al. 1990). On day 69 post infection the animals were challenged with 2x105 TCID50 of CSFV strain Eystrup. The table gives the highest serum dilution resulting in complete neutralization of input virus. 15 Example 4 Induction of protective immunity by infection with RNase negative virus To analyze whether the infection with the mutant virus had led to a protective immunity, a challenge experiment was conducted about 9 weeks after the infection 20 with the CSFV mutant using a highly pathogenic heterologous CSFV strain (strain Eystrup, originated from Behring). 2x105 TCID50 of virus was used for the infection. This amount of virus was found to be sufficient to induce lethal disease in several preceeding experiments (Konig, 1994). However, the animals previously infected with the CSFV RNase mutant did not show symptoms of disease after challenge 25 infection. Neither fever (Figure 3) nor viremia could be detected but an increase in neutralizing antibodies indicated productive infection and replication of the challenge virus. Example 5 Confirmation of attenuation principle To show, that the observed attenuation of the mutant virus is indeed due to the deletion of the histidine at position 346 of the polyprotein and not a consequence of 5 an unidentified second site mutation, the wild type sequence was restored by exchange of a 1.6 kb Xhol/Ndel fragment of the full length clone pA/C-346-d against the corresponding fragment of pA/CSFV displaying the wild type sequence. The fragment excised from pA/C-346-d was analyzed by nucleotide sequencing for mutations. Except for the deletion of the triplet coding for histidine 346 of the 10 polyprotein, no difference with regard to the wild type sequence was found. From the cDNA construct with the rescued mutant* virus V(pA/C-346-d/Rs) could be'recovered that grew equally well as wild type virus and showed equivalent RNase activity (Table 2A). second animal experiment, the rescued virus was used for infection of pigs. As a 15 control, the deletion mutant was used. Again, two groups consisting of three animals were used. As the animals were younger (German landrace, about 20kg) than those in the first experiment, SxlO4TCIDso of virus were used for infection this time. Again, the animals infected with the mutant showed no clinical signs* (Table 5, Figure 4). Only one animal had fever for one day. Nevertheless, these animals developed 20 neutralizing antibodies and were protected against a Jethal CSFV challenge. Challenge was again performed by infection with 2x105 TCID50 of challenge strain Eystrup. The animals did not show clinical signs after challenge and the temperature stayed normal (Figure 5). In contrast to the pigs infected with the deletion mutant, the animals inoculated with the rescued wild type virus developed fatal classical swine 25 fever. One animal had to be killed 11 days after infection, the other two 3 days later. All animals showed typical symptoms of classical swine fever, i.e. fever, diarrhea, annorexia, and pathological signs like hemorrhages in different organs including the kidney. 30 Table 5a: Clinical signs after test infection Animal experiment 2 — Anim, No.: Infected with clinical signs moribund at day of euthanasia hemorrhages in organs at necropsy fever diarrhea CNS disorders anorexia hemor¬rhages in skin apathia #43 C-346-d +* - - - - - - n.a. #47 C-346-d - - - - - - - n.a. #87 C-346-d - - • - - - - - n.a. #27 C-346-d/RS + + + + - + + • + #28 C-346-d/RS + + + + - + + + #30 C-346-d/RS * i ♦ + + - + + + * fever for only 1 day Table 5a: 6 piglets (German land race; about 20 kg body weight) in two groups (each group 5 was housed separately under isolation conditions) were included in the study, 3 animal were infected with mutant C-346-d (5-104 TCID50) and 3 animals with C-346-d/RS (5-104 TCID50). C-346-d/RS was derived from mutant C-346-d by restoring the wijd type sequence of E^ gene. Rectal temperature and clinical signs were recorded and summarized; n.a.: no necropsy was performed. 10 Table 5b Diagnostic RNAsiebtest with viruses recovered from infected animals during viremia Alfort animal #3 C-297-K animal #5 C-297-K animal #27 C -346-d/RS animal #28 C -346-d/RS animal #30 C -346-d/RS Con¬trol OD260 r.84 0.60 0.56 1.84 1.93' 1.94 0.49 Viruses recovered form the blood of animals 3 and 5 at day 5 post infection and of animals 27, 28 and 30 of animal experiment #2 (described in example 5) at day 7 15 post infection were propagated in tissue culture, titrated and tested for RNase activity as described above. Non-infected PK15 cells and cells (contcol) infected with wild type CSFV (Alfort) served as controls. Animals 3 and 5 had been infected with -s' mutant C-297-K, whereas animals 27, 28 arid.3€fhad been infected with mutant C- 346-d/RS, as indicated in the table. 20 Example 6 Effects of double mutation within ERNS To test the effects of a double mutation within ER*S on the ability of the respective virus to replicate in its natural host and on pathogenicity, an animal experiment was 25 conducted with mutant V(pA/C-297-L/346-L). Virus recovered from the CSFV full length clone without mutation (V(pA/CSFV) served as a positive control. For each ntutant three piglets (breed: German land race; about 25 kg body weight) were used The infection dose was 1x105 TCID50 per animal; two thirds of the inoculate was administered intra-nasally (one third in each nostril), one third intramuscularly. Blood 5 was taken from the animals before infection (day 0) and on days 5, 8.12 and 20. In addition, temperature was recorded daily (Fig. 6). The animals infected with the double mutant did not develop any clinical symptoms, and the animals never stopped taking up food. The animals showed no fever over the whole experimental period (animals 45/2 and 45/3) except animal 45/1 on day 8, probably due to 10 bacterial infection caused by injury of the right hind leg. After treatment of this animal with an antibiotic on day 10, temperature returned to normal values within one day (Fig. 6). For all animals virus was recovered from the blood on day 5 whereas no viremia was detected at later time points (Table 6a). All animals developed ifielutralizing antibodies (Table 6b). For animal 45/1 the neutralization titer was again 15 determined about 4.5 months p.i. and was found tobe 1:4374. Thus, the infection with the double mutant resulted in long lasting immunological memory. Table 6a Test for viremia 20 Table 6b Neutralization titers 25 Example 7 Immunogenicity and attenuation principle of the BVDV virus "B-346-d" This experiment was designed to investigate the attenuation principle as well as the immunogenicity of the BVDV virus ,B-346-d' recovered from pA/B-346-d by comparing it with the ,B-WT' virus recovered from pA/BVDV/lns-. The virus ,B-346-d' is of course mutated in original BVDV position 349 but named "B-346" to indicate the position relative to the CSFV Alfort position 346 of figure 1. Three groups of BVDV seronegative animals of 3-6 months of age were selected. Groups 1 and 2 comprised 5 animals each while group 3 comprised 3 animals, Animals of group 1 and 2 were infected by administration of 2x10 TCID50 of B-346-d (group 1) or B-WT (group 2) in a volume of 5 ml per route. Animals were infected intra-muscularly (gluteal muscle), intranasally and subcutaneously (over scapula). Over a period of 14 days after infection, viremia in both groups was monitored through parameters like blood cell viremia and virus shedding in nasal swabs. In addition, clinical parameters like rectal temperatures, white blood cell counts and general health parameters were monitored. The protective immunity against an infection with an antigeneticaliy heterologous and virulent BVDV-isolate (#13) was investigated by challenge infection 77 days after infection of the animals of group 1 with B-346-d. Animals of group 3 served as challenge control and were infected according to the procedure for the animals of group 1 with the virulent BVDV-isolate. The BVDV virus (#13) belongs to a different antigenetic group (type II), whereas the B-346-d virus belongs to the antigenetic group (type I) according to the classification described by (Pellerin, C. et. a!., 1994). Animals of group 1 and 3 got infected by administration of 2x106 TCID50 of BVDV isolate (#13) in a volume of 5 ml per route. Animals were infected via the intra-muscular (gluteal muscle), intra-nasal and subcutaneous route (over Scapula). Over a period of 14 days after infection viremia in both groups-was monitored by parameters like blood cell viremia and virus shedding in nasal swabs. In addition, clinical parameters like rectal temperatures, white blood cell counts and general health parameters were monitored. After infection with B-346-d animals did not show any typical clinical symptoms of a BVDV infection such as rectal temperature increase (Table 7a), or any respiratory clinical symptomes (not shown). 10 15 The reduced blood cell viremia(Table 7b) and virus shedding in nasal swabs (Table 7c) did clearly indicate an attenuation of B-346-d compared to B-WT. The virulent BVDV isolate #f 3 didinduce in the animals of group 3 astrong viremia with typical signs of a BVDV infection, like rectal temperature increase over a period of several days (Table 7d), strong leucopenia (Table 7e). extended blood cell viremia (Table 7f) and virus shedding in nasal swab fluid (Table 7g). In contrast, animals of group 1, which had been vaccinated by infection with B-346-d, did show almost no e&mcat symptoms typicalfora BVDV infection after the challenge infection with the virulent BVDV isolate #13. There'was no significant increase in rectal temperatures after infection (Table 7d). The observed leucopenia was very marginal with regard to magnitude and duration (Table 7e). No BVDV could be isolated from the blood -(Table 7f) and for only one Animal virus shedding in nasal swab exudate could be detected (Table 7g). Therefore, infection with B-346-d induces a strong immunity which clearly reduces clinical signs, virus shedding and blood ceil viremia after challenge infection with a heterologous BVDV isolate. 8 4 7 4 9 4 7 4 10 4 8 5 EDTA blood was sampled daily up to day 10 post infection with B-346-d and B-WT, respectively. 0.2 ml of blood were added to each of 3 cultures of calf testis (Cte) cells with medium containing heparin (1 unit/ml to prevent clotting). After overnight incubation inoculum/medium was replaced with fresh medium without heparin. After incubation for 4 to 6 days, BVDV infected celis were detected by immunefluorescence with a polyclonal serum specific for BVDV. Negative cultures were frozen and subsequently thawed. 0.2 ml thereof were passed to a second passage on Cte cells to confirm the absence of BVDV. Table 7c: Virus shedding in nasal fluid: Group Animal First day nasal shedding recorded Final day nasal shedding recorded Number of days virus detected in exudate* Mean number of days detected virus per group 1 1 4 8 4 2.6 2 6 6 1 3 4 4 1 4 5 7 3 5 3 6 4 2 6 6 8 3 3,6 7 5 7 3 8 5 8 4 9 5 6 2 10 3 9 6 Nasal exudate was centrifuged (1000g) to remove gross debris and contaminants. Supernatant fluid was removed and 0,2 ml were seeded to each of three cell cultures. After overnight incubation the inoculum/medium was replaced with 2 ml of fresh medium. After incubation for 4-6 days, BVDV infected cells were detected by immunofluorescence with a polyclonal serum specific for BVDV. Table 7d: Mean rectal temperatures of groups 1 and 3 Day of study: -2 -1 0 1 2 3 4 5 6 7 8 9 10 12 14 Group 1 38.4 38.6 38.5 38.5 38.6 38.4 38.4 38.4 38.3 38.4 38.4 38.4 38.4 38.4 38.5 Group 3 38.8 39.1 38.8 39,1 39.4 39.7 40.2 40.2 40.4 41.3 40,2 40.1 40.2 40.8 40,4 Rectal temperatures were recorded up to 16 days after challenge infection. Animals of group 1 and 3 were infected by 6x106 TCID50 of the virulent BVDV isolate #13. Table 7e: Mean white blood cell counts Dayof study: -2 -1 0 1 2 3 v 4 5 6 7 8 9 10 12 14 Group 1 11,9 11.9 11.3 10.8 9.2 8.2 8.9 9.9 11,2 11.6 11.6 10.6 10.8 10.8 9.4 GrdupKJ 11;7 15.8 13.8 11.1 7.7 9.8 7.4 : W 7.5 8.7 7.0 8.1 6.2 6,4 6,2 EDTA bood cell samples were taken daily from day -2 to 14 post chakkenge from :ell Sc rniple s wer e tak en da ily fro mda y -2 to 14 post challenge from eagh?animal in both groups. Counts of white blood cells in EDTA blood samples were determined using a Sysmex Micro-Cell Counter F800. Table 7f: BVDV isolated from blood samples ^ Group Animal First day virus detected in blood Final day virus detected in blood Recorded duration of virus in blood (days) Mean duration (days) 1 1 - - 0 0 2 - * 0 3 - - 0 4 - - 0 5 - - 0 3 11 3 10 8 9.7 12 3 14 12 13 3 9 9 EDTA blood was sampled daily up to day 10 post challenge. 0.2 ml of blood were added to each of 3 cultures of calf testis (Cte) cells with medium containing heparin (1 unit/ml to prevent clotting). After overnight incubation inoculum/medium was replaced with fresh medium witho ut heparin. After incubation for 4 to 6 days cells BVDV infected cells were detected by immunefluoreszence with a polyclonal serum specific for BVDV. Negative cultures were frozen and subsequently thawed. 0.2 ml thereof were passed to a second passage on Cte ceils to confirm the absence of BVDV. Table 7g: Virus shedding in nasal fluid Group Animal First day nasal shedding recorded Final day nasal shedding recorded Recorded duration of nasal shedding (days) Mean duration (days, per group) 1 ■i 1 3 4 2 0,8 2 - - 0 3 - 0 4 - - 0 5 4 5 2 11 3 14 12 10 12 3 14 12 13 3 8 6 Nasal exudate was centrifuged (1000g) to remove gross debris and contaminants. Supernatant fluid was removed and 0,2 ml thereof were seeded to each of three cell cultures. After overnight incubation the inoculum/medium was replaced with 2 ml of 10 fresh medium. After incubation for 4-6 days BVDV infected cells were detected by immunefluorescence with a polyclonal serum specific for BVDV. Example 8 Discrimination between C-346-d and CSFV without deletion of the 15 histidine codon 346 by RT-PCR The RNA sequence coding for the conserved RNase motif in CSFV glycoprotein E is highly conserved. Among all known CSFV sequences no nucleotide exchanges were found in the region corresponding to residues 1387 to 1416 of the 20 published sequence of the CSFV Alfort strain (Meyers et a!, 1987). Thus. oligonucleotide primers derived from this conserved region of the genome can be used in an RT-PCR assay for detection of all CSFV isolates (see figure 7). In consequence, the absence of the triplet coding for histidine 346 (nucleotides 1399-1401) could be detected by an RT-PCR assay with an appropriately designed primer. 25 Different oligonucleotides covering the conserved region were synthesized that either contained the histidine codon or not. These oligonucleotides served as upstream primers in RT-PCR reactions with oligonucleotide ERNS-Stop as downstream primer. RNA purified from tissue culture cells infected with C-346-d. C-WT, 0346-L or C-346-K, respectively, were used as templates. Reverse transcription of 2 pg heat 5 denatured RNA (2 min 92°C. 5 min on ice in11.5 μl of water in the presence of 30 pMol reverse primer) was done after addition of 8 μl RT mix (125 mM Tris/HCI pH 8.3, 182.5 mM KCI. 7.5 mM MgCi2. 25 mM dithiothreitol. 1.25 mM of each dATP, dTTP, dCTP, dGTP), 15 U of RNAouard (Pharmacia, Freiburg, Germany) and 50 U of Superscript (Life Technoloojes/BRL, Eggenstein, Germany) for 45 min at 37°C. After 10 finishing reverse transcription, the tubes were placed on ice and 30 pi of PCR mix (8.3 - mM Tris/HCI. pH8.3; 33.3 mM KCI; 2.2 mM MgCI2; 0.42 mM of each dATP, dTTP,.. dCTP, dGTP; 0.17% TritonX100; 0.03% bovine serum albumine; 5 U of Taq polymerase (Appiigene, Heidelberg, Germahy) and 16.7% DMSO) were added. When printerOl H+3 was used, the reaction mix for amplification contained no DMSO. 15 Amplification was earned out in 36 cycles (30 sec 94°C; 30 sec 57°C; 45 sec 74°C). 1 pi of amplification reaction was loaded on a 1% agarose gel, the amplified products were separated by electrophoresis, and stained with ethidium bromide. As demonstrated in Fig. 7, primer pair Ol H-3/OI EmsStop allowed to specifically amplify a band derived from RNA containing the deletion of codon 346 whereas with the other 20 two primer combinations products containing codon 346 were amplified and ho band was observed when the RNA with the deletion of this codon was used as a template. Primers for RT-PCR: upstream: 25 Ol H-3: TGGAACAAAGGATGGTGT Ol H+2: TGGAACAAACATGGATGG OIH+3: GAATGGAACAAAGATGGA downstream: OIEmsStop: GGAATTCTCAGGCATAGGCACCAAACCAGG Figure legends Figure 1: The first 495 amino acids as expressed by the Alfort strain of CSFV The sequence listing shows the first 495 amino acids as expressed by the Alfort 5 strain of CSFV (Meyers et al.. 1989). One monomer of the glycoprotein ERNS of said strain corresponds to the amino acids 268 to 494 as described by Rumenapf et al. (1993). Residues 295 to 307 and 338 to 357 representing the regions showing homology to plant and fungal RNases (Schneider et al... 1993) are underlined. 10 Figure 2: Rectal temperature curve of animals after test infection Daily rectal temperature was recorded from day 2 before till day 18 post infection. Rectal temperature curve is detailed for each animal of the group infected with the * ,£virus V(pA/CSFV) (continuous line) derived from plasmid pA/CSFV or with the virus 15 V(pA/C-346-d) derived from plasmid pA/C-346-d (dotted line). Figure 3: Rectal temperature curve of animals after challenge infection Daily rectal temperature was recorded at days 1-21 post challenge virus infection. 20 Animals challenged with a lethal dosis of the CSFV challenge strain Eystrup had been infected with mutant C-346-d [V(pA/C-346-d)]"T59 days in before as detailed in the text. Rectal temperature curve is detailed for each animal of the group challenged with 2x105 TCID50 from the CSFV challenge strain Eystrup 25 Figure 4: Rectal temperature curve of animals after test infection Daily rectal temperature was. recorded at days 0-18 post infection. Rectal temperature curve is detailed for each animal of the two groups infected either with C-346-d [V(pA/C-346-d)] (dotted line) or with the restored virus C-346-d/RS [V(pA/C-30 346-d/Rs)] (continuous line). Figure 5: Rectal temperature after challenge infection animal experiment #2 Daily rectal temperature was recorded at days 1-10 post challenge virus infection. Animals challenged with a lethal dose (2x105 TCID50) of the CSFV challenge strain 5 Eystrup had been infected with mutant C-346-d 37 days in before. Figure 6: Rectal temperature of animals treated with a double mutant according to example 6 10 Daily rectal temperature was recorded prior and post challenge virus infection with mutant V(pA/C-297-L/346-L). Figure 7: Discrimination between C-346-d and CSFV without deletion of the histidine codon 346 by RT-PCR according to example 8 15 a) Primer pair Ol H-3/OI EmsStop allows to specifically amplify a band derived from RNA containing the deletion of codon 346 (C-346-d) as described in detail in example 8. In contrast, RNA, not containing said deletion^does not interact with said primer pair (C-WT, C-346-L, C-346-K). 20 b) And c) The other two primer combinations (Ol H+2 and Ol H+3) amplify bands derived from RNA that do not contain the deletion of codon 346 (Ol H+2 and Ol H+3). No band can be observed when RNA from the 346-deletion mutant C-346-d is used as a template. WE CLAIM: 1. A modified non-pathogenic pestivirus, wherein the RNase activity residing in glycoprotein E8^ is inactivated by deletions and/or mutations of at least one amino acid of said glycoprotein, wherein said deletions and/or mutations are selected from the group consisting of: i) 297-K, ii) 295-S or G, iii) 300-W or G, ,-' iv) 346-K or d, > v) 297-K and 346-K vi) 297-K and 346-L, vji) 297-L and 346-L viii) deletion of histidine 346 according to SEQ ID NO:25 of said glycoprotein. 2. The modified non-pathogenic pestivirus as claimed in claim 1, wherein said RNase activity is inactivated by deletion or mutation of the histidine residue at position 346. 3. The modified non-pathogenic pestivirus as claimed in claim 1, wherein said RNase activity is inactivated by deletion of the histidine residue at position 346. 4. A pharmaceutical composition comprising the modified non¬pathogenic pestivirus as claimed in any one of claims 1 to 3. i 5. A vaccine comprising the modified non-pathogenic pestivirus as claimed in any one of claims 1 to 3. Dated this 29th day of July 2004 [SHUKADEV KHURAIJAM OF REMFRY & SAGAR ATTORNEY OF THE APPLICANTS -9 JUL 2008

Documents:

413-mumnp-2004-abstract(2-7-2008).doc

413-mumnp-2004-abstract(2-7-2008).pdf

413-mumnp-2004-abstract(3-6-2008).pdf

413-mumnp-2004-abstract(granted)-(11-7-2008).pdf

413-mumnp-2004-cancelled pages(2-7-2008).pdf

413-mumnp-2004-cancelled pages(9-7-2008).pdf

413-MUMNP-2004-CLAIMS 9-7-2008.pdf

413-mumnp-2004-claims(amanded)-(9-7-2008).pdf

413-mumnp-2004-claims(complete)-(29-7-2004).pdf

413-mumnp-2004-claims(granted)-(11-7-2008).pdf

413-MUMNP-2004-CORRESPONDENCE 9-7-2008.pdf

413-mumnp-2004-correspondence(09-07-2008).pdf

413-mumnp-2004-correspondence(8-7-2008).pdf

413-mumnp-2004-correspondence(ipo)-(11-07-2008).pdf

413-mumnp-2004-correspondence(ipo)-(11-7-2008).pdf

413-mumnp-2004-description(complete)-(29-7-2004).pdf

413-mumnp-2004-description(granted)-(11-7-2008).pdf

413-mumnp-2004-drawing(complete)-(29-7-2004).pdf

413-mumnp-2004-drawing(granted)-(11-7-2008).pdf

413-mumnp-2004-form 1(3-6-2008).pdf

413-mumnp-2004-form 13(14-09-2007).pdf

413-mumnp-2004-form 13(14-9-2007).pdf

413-mumnp-2004-form 18(15-12-2005).pdf

413-mumnp-2004-form 1a(02-07-2008).pdf

413-mumnp-2004-form 1a(29-07-2004).pdf

413-mumnp-2004-form 2(complete)-(29-7-2004).pdf

413-mumnp-2004-form 2(granted)-(11-7-2008).pdf

413-mumnp-2004-form 2(title page)-(complete)-(29-7-2004).pdf

413-mumnp-2004-form 2(title page)-(granted)-(11-7-2008).pdf

413-mumnp-2004-form 3(12-9-2007).pdf

413-mumnp-2004-form 3(29-07-2004).pdf

413-mumnp-2004-form 5(27-7-2004).pdf

413-mumnp-2004-form-pct-isa-210 (09-07-2008).pdf

413-mumnp-2004-petition under rule 137(14-09-2007).pdf

413-mumnp-2004-power of authority(29-9-2004).pdf

413-mumnp-2004-power of authority(3-6-2008).pdf

413-mumnp-2004-sequence listing(2-7-2008).pdf

413-mumnp-2004-specification(amended)-(2-7-2008).pdf

413-mumnp-2004-specification(amended)-(3-6-2008).pdf

413-mumnp-2004-wo internation publication report(29-7-2004).pdf

abstract1.jpg