Title of Invention	A BIOACTIVE PEPTIDE HAVING PREPTIN FUNCTIONALITY
Abstract	The present invention relates to a bioactive peptide, the amino acid sequence of which is as follows: Asp Val Ser Thr R1 R2 R3 Val Leu Pro Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe R5 R6 Asp Thr Trp R7 GIn Ser R8 R9 Arg Leu wherein: R1 is Ser or: Pro; R2 is GIn or Pro; RJ is Ala or Thr; R4 is Asp or Asn; Rs is GIn or Lys; R6 is Tyr or Phe; R7 is Arg or Lys; Rs is Ala or Thr; and R9 is Gly or GIn, [SEQ ID NO.1] or an analog thereof.

Title of Invention

A BIOACTIVE PEPTIDE HAVING PREPTIN FUNCTIONALITY

Abstract

The present invention relates to a bioactive peptide, the amino acid sequence of which is as follows: Asp Val Ser Thr R1 R2 R3 Val Leu Pro Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe R5 R6 Asp Thr Trp R7 GIn Ser R8 R9 Arg Leu wherein: R1 is Ser or: Pro; R2 is GIn or Pro; RJ is Ala or Thr; R4 is Asp or Asn; Rs is GIn or Lys; R6 is Tyr or Phe; R7 is Arg or Lys; Rs is Ala or Thr; and R9 is Gly or GIn, [SEQ ID NO.1] or an analog thereof.

Full Text	This invention relates to a bioactive peptide. In particular, it relates to a peptide secreted by the pancreatic islet βcell that stimulates insulin secretion. BACKGROUND Pancreatic islet p-cells play a major regulatory role in physiology, mainly through their secretion of insulin, a peptide hormone which exerts profound effects on intermediary metabolism (Draznin et cd (1994)). A second β-cell hormone, amylin. may also contR1bute to p-cell regulatory function through its actions on insulin secretion and tissue insulin sensitivity (Cooper, G (1994); Hettiarachchi et al (1997)). In islet p-cells, hormones are packaged in secretory granules, which undergo regulated release in response to signals such as fuels (eg. glucose, amino acids) or neurohormonal stimuli. These granules contain dense cores R1ch in insulin and Zn, while smaller amounts of insulin C-peptide, amylin, proinsulin, chromogranin-deR1ved peptides, proteases and other proteins are found in the granule matR1x (Hutton, J(1989)). What the applicants have now determined is that pancreatic islet p-cells secrete yet a further regulatory peptide. The applicants have further determined that this peptide enhances glucose-mediated insulin secretion. It is generally towards this peptide, which the applicants have termed preptin, that the present invention is directed in its vaR1ous aspects. SUMASARY OF THE INVENTION Accordingly, in a first aspect the present invention provides the peptide preptin or an analog thereof. By "preptin", the applicants mean a peptide of 34 amino acids, the sequence of which is as follows; Asp Val Ser Thr R1 R2 R3 Val Leu Pro Asp R1 Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Rs Re Asp Thr Trp R7 Gln Ser R8 Ra Arg Leu wherein: R1 is Ser or Pro; R2 is Gln or Pro; R3 is Ala or Thr; R4 is Asp or Asn; Rs is Gln or Lys; Re is Tyr or Phe; R7 is Arg or Lys; R8 is Ala or Thr; and R9 is Gly or Gln. or an analog thereof. In one embodiment, the invention provides human preptin having the amino acid sequence: Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu. In another embodiment, the invention provides rat preptin having the amino acid sequence: Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu. In yet another embodiment, the invention provides mouse preptin having the amino acid sequence: Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu. The amino acid sequence corresponds to Aspeg-Leuioa of the prolGF-II E-peptide in each mammal. In still a further aspect, the present inArention provides a polynucleotide which encodes preptin or an analog thereof. In another aspect, the invention provides a vector or cell-line which includes a piolynucleotide which encodes preptin or an analog thereof and which is capable of expressing preptin or said analog. Preptin salts, which are preferably physiologically acceptable, are also provided. In a further aspect, the invention further provides a pharmaceutical composition which compR1ses preptin or an analog thereof, or preptin salts. In still a further aspect, the invention provides a method of stimulating insulin secretion for a therapeutic or prophylactic purpose which compR1ses the step of administeR1ng to a patient in need of such therapy or prophylaxis an effective amount of preptin or an analog thereof. In yet a further aspect, the invention provides the use of preptin or an analog thereof or a salt thereof in the preparation of a medicament, particularly for stimulating insulin secretion. In still a further aspect, the invention provides a method of modulating glucose mediated insulin secretion which compR1ses the step of administeR1ngjto^ patient an effective amount of preptin, a preptin analog, a preptin agonist or a preptin antagonist. In yet further embodiments, the invention provides antibodies which bmd preptin or its analogs, assays which employ such antibodies and assay kits which contain such antibodies. The above summary is not exhaustive. Other aspects of the invention will be apparent from the following descR1ption, and from the appended claims. DESCR1PTION OF THE DRAWINGS Although the invention is broadly as defined above, it will also be understood that it includes embodiments of which the descR1ption provided below gives examples. In addition, the invention will be better understood by reference to the accompanying drawings in which: Figure 1 shows puR1fication and characteR1sation of preptin. a) assays for marker proteins indicating the localisation of organelles from PTC6-F7 cells within the continuous OptlFrep gradient; granule core (insulin), granule matR1x (amylin), lysosomes (aryl sulphatase), mitochondia (citrate synthase), b) Granule proteins puR1fied by RP-HPLC. The indicated peak (hatched) was collected and further puR1fied, c) PuR1ty and mass (M + H+) of the major peptide from the hatched peak confirmed by MALDI-TOF MS. d) RP-HPLC profile from the Lys-C digest of the peptide puR1fied from the hatched peak. l:NH2-terminal fragment; 2: COOH-terrainal fragment; 3: undigested peptide, e) Structure of mouse preptin as determined by sequencing of Lys-C-deR1ved peptides from (d); NHa-terminal fragment: normal font; COOH-terminal fragment: italicised-bold, and its localisation in a segment of muR1ne proIGF-II E-peptide shown. Domains of prolGF-11 (B, C, A, D, E) are indicated. Recognised cleavage site at Arges is indicated in bold, while putative dibasic motifs are shown as discontinuous lines. Figure 2 shows cellular preptin secretion, a) Preptin R1A standard curve, b) R1A characteR1sation of preptin-like immunoreactive mateR1al (PLIM) in RP-HPLC fractions of 24-h pTC6-F7 conditioned medium and intra-granular fractions from Figure lb. c) MALDI-TOF MS of the major PLIM containing fraction secreted from PTC6-F7 cells. Peak corresponds to muR1ne preptin (M + H) with 0.07% error. Figure 3 shows the eflects of preptin on insulin secretion, a) Preptin-mediated insulin secretion from PTC6-F7 cells. Graph Illustrates increments in insulin concentration above basal (0 added preptin). b) preptin-mediated insulin secretion from isolated perfused rat pancreas. Points are mean + sem (duplicate analyses; n=4 pancreases for each curve). Area under curve (second phase of insulin secretion P = 0.03 unpaired 2-talled t-test). Figure 4 shows the immunohistochemistry of muR1ne pancreas. Pancreas harvested from adult FVB/n mice was sectioned and stained with haematoxylin and polyclonal rabbit antisera using immunoperoxldase-conjugated goat-anti-rabbit second antibody. Panels are: a, anti-insulin antiserum (1:40); b, anti-preptin antiserum, (1:40); c,d, anti-preptin antiserum (1:40) pre-incubated for 30 min with synthetic rat preptin ate, 1 mg.ml", d, 5 mg.ml". Bar = 100 μim. Figure 5 shows the R1A characteR1sation of preptin-llke immunoreactivc mateR1al (PLIM) in RP-HPLC fracUons from rat islets or PTC6-F7 granule fractions (standard; Fig. lb). Figure 6 shows preptin and insulin co-secretion from PTC6-F7 cells and isolated rat islets. a,b Glucose-mediated co-secretion of preptin with insulin from a, PTC6-F7 cells and b, isolated rat islets. Figure 7 shows the effects of preptin on insulin secretion, a, b. PuR1ty and mass of puR1fied a, rabbit anti-rat preptin y-globulln and b, non-immune rabbit y-globulin. 1: light chain IgG, M + H+: 2: whole IgG. M + 4H+; 3: heavy chain IgG, M + H+; 4: whole IgG, M + 2H+; whole IgG, M + H+. c, 1-min preptin-binding capacity of perfused anti-preptin 7-globulin at 35 jig.ml ^ 37oC, pH 7.4 to simulate contact time, dilution, temperature and pH of the antibody perfusion expeR1ments, d. Effect of infusion of anti-preptln y-globulin or control (non-immune rabbit y-globulin) on insulin secretion from glucose-stimulated (20 mM; square wave) isolated perfused rat pancreases. Each point is mean ± s.e.m. (duphcate analyses; n = 5 pancreases per curve). AUG (second phase of insulin secretion; P= 0.03, unpaired 1-tailed t-test). DESCR1PTION OF THE INVENTION As broadly defined above, the present invention is directed to a novel peptide which has been found in pancreatic islet β-cell granules. This peptide, preptin, has been determined to stimulate glucose-evoked insulin secretion. In summary, preptin was identified using a single-step density-gradient centR1fugal method to puR1fy secretory granules from cultured muR1ne βTC6-F7 cells with puR1ty being confirmed by marker-protein analysis (Figure la). Insulin was used to track puR1fication of granule-cores, whereas amylin, which is present in the granule-matR1x (Johnson, K (1988)). was measured to veR1fy granule-membrane integR1ty (Figure la). Soluble granule components were then separated using reversed-phase HPLC (A214; Figure lb). Peptide-ldentity was determined by mass spectrometry and NH2-terminal amino-acid sequencing. Major peaks contained muR1ne insulins-1 and -II and C-peptides-I and -II (Figure la). No non-p-cell peptides were detected and the molar ratio of amylininsulin (1:23) and mouse insulin I:mouse insulin II (1:3) were equivalent to those of physiological p-cells (Cooper (1994); Linde (1989)). A major peak eluting immediately pR1or to insulln-I was found to contain a previously unknown peptide (Figure lb). This was puR1fied to homogeneity and had a molecular mass of 3950 Da (Figure Ic). The molecule was digested with a lysine-specific protease, and the resulting peptides separated by RP-HPLC (Figure Id) pR1or to complete NHa-terminal protein sequencing. The complete sequence confirmed that the molecule contained 34-amlno acids, which corresponded to Aspea-Leuioa of muR1ne proIGF-lI E>-peptide (Figure le). This peptide is mouse preptin. Preptin is Hanked NH2-terminally by a recognised Arg cleavage-site, and COOH-terminally by a putative dibasic (Arg-Arg) cleavage motif (Bell et aL. (1985)) (Fig. le). These residues are highly conserved between species, and are likely to serve as post-translational processing signals. While others have shown the existence of different prolGF-II E-peptide-deR1ved peptides in cell culture medium and vaR1ous mammalian biological fluids (Hylka et aL. (1985). Daughaday et al (1992) and Liu et aL, (1993)), none have identified one that is equivalent to preptin. The amino acid sequence of mouse preptin is as follows: Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu The equivalent amino acid sequences for human and rat preptin are, respectively: Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu; and Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu. Preptin is encoded by polynucleotides having the following nucleotide sequences: gacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttcttccaatatga cacctggaagcagtccacccagcgcctg (human) gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttcaaattcgac acctggagacagtccgcgggacgcctg (rat) gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttccaatatgac acctggagacagtccgcgggacgcctg (mouse) Preptin may be generated by synthetic or recombinant means. For example, to be prepared synthetically, preptin may be synthesised using any of the commercially available solid phase techniques such as the Merryfield solid phase synthesis method, where amino acids are sequentially added to a growing amino acid chain (see Merryfield, J. Am. Soc. 85:2146-2149 (1963)). Equipment for automative synthesis of peptides is also commercially available from suppliers such as Perkln Elmer/Applied Biosystems, Inc and may be operated according to the manufacturers instructions. Preptin may also be produced recombinantly by inserting a polynucleotide (usually DNA) sequence that encodes the protein into an expression vector and expressing the peptide in an appropR1ate host. Any of a vaR1ety of expression vectors known to those of ordinary skill in the art may be employed. Excpression may be achieved in any appropR1ate host cell that has been transformed or transfected with an expression vector containing a DNA molecule which encodes the recombinant peptides. Suitable host cells include prokaryotes. yeasts and higher eukaryotic cells. Standard techniques for recombinant production are descR1bed for example, in Maniatis et cd. Molecular Cloning - A Laboratory Manual, Cold SpR1ng Harbour LaboratoR1es, Cold SpR1ng Harbour, New York (1989). Vectors and/or cells lines which express preptin have utility in their own R1ght and also form part of the invention. Analogs of preptin and of its encoding polynucleotides are also within the scope of the present invention. Such analogs Include functional equivalents of preptin and of the polynucleotides descR1bed above. In terms of preptin itself, functional equivalents include all proteins which are immunologically cross-reacUve with and have substantially the same function as preptin. That equivalent may, for example, be a fragment of preptin containing from 6 to 33 amino acids (usually representing a C-terminal truncation) and including a preptin active site or sites, a substitution, addition or deletion mutant of preptin, or a fusion of preptin or a fragment or a mutant with other amino acids. The six amino acids forming the smallest fragment can be from any part of the sequence, provided they are consecutive in that sequence and fulfil the functional requirement. It is of course also possible {and expressly contemplated) that the bioactive peptide include any one of those hexapeptides, or indeed be or include any heptajjeptide, octapeptide, nonapeptide, or decapeptide from the sequence. Peptides which are, or include a hexapeptide, heptapeptide, octapeptide, nonapeptide or decapeptide from human preptin are particularly preferred. VaR1ations in the residues included in the peptide are also both possible and contemplated. For example, it is possible to substitute amino acids in a sequence with equivalent amino acids using conventional techniques. Groups of amino acids known normally to be equivalent are: (a) Ala Ser Thr Pro Gly; (b) Asn Asp Glu Gln; (c) His Arg Lys; (d) Met Glu He Val; and (e) Phe Tyr Trp. Additions and/or deletions of amino acids may also be made as long as the resulting peptide is immunologically cross-reactive with and has substantially the same function as preptin. Equivalent polynucleotides include nucleic acid sequences that encode proteins equivalent to preptin as defined above. Equivalent polynucleotides also include nucleic acid sequences that, due to the degeneracy of the nucleic acid code, differ from native polynucleotides In ways that do not effect the corresponding amino acid sequences. A prediction of whether a particular polynucleotide or polypeptide is equivalent to those given above can be based upon homology. Polynucleotide or polypeptide sequences may be aligned, and percentage of identical nucleotides in a specified region may be determined against another sequence, using computer algoR1thms that are publicly available. Two exemplary algoR1thms for aligning and Identifying the similaR1ty of polynucleotide sequences are the BLASTN and FASTA algoR1thms. The similaR1ty of polypeptide sequences may be examined using the BLASTP algoR1thm. Both the BLASTN and BLASTP softwrare are available on the NCBI anonymous FTP server {ftp://ncbi.nlm.nih.gov) under /blast/executables/. The BLASTN algoR1thm version 2.0.4 IFeb-24-19981, set to the default parameters descR1bed in the documentation and distR1buted with the algoR1thm, is preferred for use in the determination of vaR1ants according to the present invention. The use of the BLAST family of algoR1thms, including BLASTN and BLASTP, is descR1bed at NCBI"s website at URL http://www.ncbi.nlm.nih.gov/BLAST/newblast.html and in the publication of Altschul, Stephen F. et cd (1997). "Gapped BLAST and PSl-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. The computer algoR1thm FASTA is available on the Internet at the ftp site ftp://ftp.virginia.edu.pub/fasta/. Version 2.0u4, Februaiy 1996, set to the default parameters descR1bed in the documentation and distR1buted with the al^R1thm, is preferred for use in the determination of vaR1ants according to the present invention. The use of the FASTA algoR1thm is descR1bed in the W R Pearson and D.J. Lipraan, "Improved Tools for Biological Sequence Analysis," Proc. NatL Acad. Set USA 65:2444-2448 (1988) and W.R. Pearson, "Rapid and Sensitive Sequence CompaR1son with FASTP and FASTA," Methods inEnzymology 183:63-98 (1990). Analogs according to the invention also include the homologues of preptin from species other than human, rat or mouse. Such homologues can be readily identified using, for example, nucleic acid probes based upon the conserved regions of the polynucleotides which encode human, rat and mouse preptin. Preptin or its analogs can also be present in vaR1ous degrees of puR1ty. Preferably, the preptin/analog component makes up at least 50% by weight of the preparation, more preferably at least 80% by weight, still more preferably at least 90% by weight, still more preferably at least 95% by weight and yet more preferably at least 99% by weight. It is however generally preferred that, for pharmaceutical application, the preptin or analog be present in a pvue or substantially pure form. For administration to a patient, It is possible for preptin or preptin analogs to be used as such pure or substcintiEdly pure compounds. However, preptin or preptin analogs may also be presented as a pharmaceutical composition. Such compositions may compR1se preptin or preptin analogs together with one or more phannaceutically acceptable carR1ers therefor and optionally other therapeutic ingredients where desirable. The carR1er must be acceptable in the sense of being compatible with the preptin or preptin analog and not deleteR1ous to the patient to be treated. Desirably, the composition should not include substances with which peptides are known to be incompatible. The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods weU known in the art of pharmacy. All methods include the step of bR1nging the active ingredients into association -with a carR1er which constitutes one or more accessory ingredients. The precise form the composition will take will largely be dependent upon the administration route chosen. For example, preptin or preptin analogs may be Injected parenterally, eg. intravenously into the blood stream of the patient being treated. However, it will be readily appreciated by those skilled in the art that the route can vary, and can be intravenous, subcutaneous, intramuscular, intrapeR1toneal, enterally, transdermally, transmucously, sustained release polymer comp)ositions (eg. a lactide polyrmer or co-polymer mlcropartlcle or implant), perfusion, pulmonary (eg. inhalation), nasal, oral, etc. Compositions suitable for parenteral and In particular intravenous administration are presently preferred. Such compositions conveniently compR1se steR1le aqueous solutions of preptin or the preptin analog. Preferably, the solutions are isotonic with the blood of the patient to be treated. Such compositions may be conveniently prepared by dissolving the preptin or analog in water to produce an aqueous solution and rendeR1ng this solution steR1le. The composition may then be presented in unit or multi-dose containers, for example sealed ampoules or vials. One particularly preferred composition Is preptin In a physiological buffer solution suitable for injection. Compositions suitable for sustained release parenteral administrations (eg. biodegradable polymer formulations) are also well known in the art. See, for example, US Patent Nos. 3,773,919 and 4,767,628 and PCT Publication No. WO 94/15587. It is also convenient for preptin to be converted to be in the form of a salt. Such a salt will generally be physiologically acceptable, and can be formed using any convenient art standard approach. Preptin salts formed by combination of preptin with anions of organic acids are particularly preferred. Such salts include, but are not limited to, malate, acetate, propionate, butyrate, oxaloacetate, citrate, isocitrate, a-ketoglutarate, succinate, fumarate and tR1fluoroacetate salts. The salts this formed can also be formulated into pharmaceutical compositions for therapeutic administration where this is desired. Aspects of the invention will now be descR1bed with reference to the following non-limiting expeR1mental section. EXPER1MENTAL Section A Metbods and MateR1als Cell Culture PTC6-F7 muR1ne pancreatic islet p-cells, passages 49-60, were cultured at 37°C in 02:C0295:5 (v/v) in tR1ple flasks in nDMEM (Gibco) supplemented with 15% heat-inactivated horse serum and 2.5% fetal bovine serum, and subcultured every 5 d by washing with PBS followed by trypsinization (2.5% Trypsin-EDTA). Each flask yielded approx 2.0 x 108 cells at 70% confluence. Granule puR1fication. P-cells at passages 55-60 from 8-12 tR1ple flasks were harvested by trypsinization, yielding on average 2.5-4.0 ml of pure cells (1.6 - 2.4 x 109), which then were concentrated (1700 x g, 5 min), washed twice with PBS, and once with Homogenisation Medium (0.3 M sucrose/10 tnM MES K (Sigma)/I mM K2EGTA/I mM MgzSOi/pH 6.5), then homogenised on ice in the same medium at 1:5 (v/v). The cell suspension was homogenised by 20 passages through a badl-beaR1ng homogeniser (7.87 x 10-^ cm clearance), then claR1fied by centrtfugation (400 x g, 10 min), the pellet once re-homogenised and centrlfuged. and the supematants combined (final vol = 20 ml). Solutions (v/v) of 13% and 31% OptiPrep^" (Nycoraed) were prepared by dilution with Homogenisation Medium, and 6 x 10 ml continous gradients (31%-13% OptiPrep) poured (Auto Densi-Flow II, Haakebuchler) into Ultra-Clear tubes (Beckman). Pelleted mateR1al was over-layered or under-layered, then ultracentR1fuged (SW40 Tl/160,000 x g/16 h/4C). Fractions with R1 of 1.363-1.368, containing highest puR1ty secretory granules, were collected, whereas mitochondR1a and lysosomes were isolated to fractions with Rl > 1.371. IntegR1ty of granule preparations was monitored using radioimmunoassays for insulin (crystalline granule core), amylin (granule matR1x); puR1ty by functional assays for aryl sulphatase (lysosomes) and citrate synthase (mitochondR1a); and total protein content using Bicinchoninic acid (Pierce), RP-HPLC Granule proteins were puR1fied in two sequential RP-HPLC runs (A: 0.08% TEA v/v; B: 80% acetonitR1le with 20% A; Applied Biosystems 140B/785A/112A system; Jupiter C18 RP column,250 x 2.0 mm (Phenomonex); 250-300 1/min; Aai4). Secretory granule mateR1al was initially centR1fuged (16,000 x g, 20 min) before loading. An initial 15 min isocratic step was employed, and sequential 30s fractions collected from 19 min post-injection. Sligtly different gradients were used sequentually to puR1fy proteins; the first semi-puR1fied granule proteins, whereas the second was slightly flatter, to increase resolution and puR1ty. Peptide sequence analysis PuR1fied peptides were identified by N-termlnal sequence determination (automated Eklman method; ABl Procisetm combined with accurate mass determination by MALDI-TOF MS. For complete sequence veR1fication, puR1fied mouse preptin isolates were cleaved using Lys-C (BoehR1nger Mannheim), and the resulting peptide fragments repuR1fled by RP-HPLC. MALDI-TOF mass spectrometry Peptide molecule weights were determined by MALDI-TOF MS (Hewlett-Packard G2025A; 337 nm-emission nitrogen laser/150 μJ maximum output/3 ns pulsewidth/30 kV ion acceleration potential) fitted with a 500 MHz digital oscilloscope (G2030AA, LeCroy) using an a-CHC matR1x with recombinant human insulin (Novo Nordisk; M + H. 5808.66 Da; M + 2H+, 2904.83) and somatostaUn (Bachem; M + H+, 1638.91. M + Na+, 1660.90) mass standards. MS was performed under high vacuum ( Chemical synthesis of Tot prepUn The sequences of rat and human preptin were determined by compaR1son with known predicted IGF-II sequences. Rat preptin was chemically synthesised (Auspep Pty, Australia), according to the predicted sequence, using Fmoc chemistry on an Advanced Chem Tech 396 Robotics Peptide Synthesiser starting with FmocLeu-Wang resin. The peptide was deprotected and cleaved from the resin Awith a solution of 92.5% TFA: 2.5% water:2.5% tR1isopropylsilane: 2.5% dithiothreitol for 3 h. The peptide was precipitated from the TFA solution by addition of diisopropyl ether and the precipitate dissolved in 30% acetonitR1le: water, lyophilised, and puR1fied by RP-HPLC. PuR1ty was confirmed as >99% by analjrtical RP-HPLC (rat preptin eluted at 47%B), while MALDI-TOF MS validated the mass as 3932.4 Da + 0.026%. Preptin radioimmunoassay Synthetic rat preptin was conjugated to the carR1er, ovalbumin, using the single step glutaraldehyde method at pH 7.0, then used to raise polyclonal antisera in NZW rabbits. Preptin was wsi-radiolabelled using the chloramine-T method, and p25iipreptin (362 nCi/fig) puR1fied by Sephadex G-10 chromatography (50 mM phosphate buffer, pH 7,5). An optimised R1A for preptin was then developed, with B/F separation by the PEG-assisted second antibody (goat-einti-rabbit method). This employed a final dilution of antiserum at 1: 10,000 (final assay dilution 1: 30.000) at an R/T value of 0:30; tracer at 8,000 cpm/tube; incubation times of 24h + 72h; and had an EX:;2o value of 344 pM preptin; ECso of 39 pM; minimum detectable concentration of 11.2 + 9.8 pM; and zero cross-reactivity with rodent (rat/mouse) insulins and amylin. Cellular preptin secretion Preptin secretion was studied in PTC6-F7 cells (passage #52), cultured otherwise as above in 24-well plates at 4 x 10^ cells per well. Preptin stimulation was performed after 3 d growth, at 80% confluence. Cells were washed twice in HEPES-buffered KRB before commencement of secretion studies, then prelncubated for 1 h In 1 ml/well incubation buffer (0 mM glucose; 0.1% w/w Fraction V BSA (Sigma) dissolved in HEPES-KRB) 500 μl/well was then removed, and replaced with an equivalent volume of fresh incubation buffer containing vaR1ous concentrations of glucose. After 2 h incubation (37°C), incubation medium was removed, cells washed thR1ce with PBS, then lysed with lysis buffer. Incubation supematants and cell lysates were then assayed for insulin and preptin contents using the descR1bed R1As. In separate expeR1ments, time-dependent hormone secretion was also determined. Charactensation of secreted preptm-Uke immunoreactive mateR1al (PLIM) Since preptin is a cleavage product of the E-peptide of IGF-II, and other cleavage products from a similar region have been isolated from serum in the past (Hylka (1985); Daughaday (1992); Liu (1993)), quantitation by preptin R1A was insufficient to characteR1se the nature of the secreted and circulating peptide. A combined RP-HPLC/preptin R1A method was therefore developed to further characteR1se PLIM.2 ml aliquots of separated plasma from a human donor, and PTC6-F7 conditioned medium, were acidified with 0.1 ml of 4M acetic acid and applied to a C-18 Sep Pak (Waters, I ml volume) which had been pre-equilibrated with 10 ml of 100% methanol and 20 ml of 4% (v/v) acetic acid. The Sep Pak was washed with 20 ml of 4% acetic acid, before bound components were eluted with 2 ml of 0.1 M acetic acid in 70% methanol, and the final volume of eluate reduced to 150 nl by rotary evaporation. Eluates were then subjected to RP-HPLC as above, and corresponding fractions combined from multiple runs. Fractions likely to contain preptin and insulin were subjected to MALDI-TOF MS. All fractions were then made up to a volume of 350 fil with preptin assay buffer, then analysed by preptin and insulin R1As. In order to compare profiles of immunoreactivety of these secreted products with the intragranular profile (Figure lb). 10 ^1 samples from the initial RP-HPLC granule fractions were diluted to a final volume of 610 ^1 with preptin R1A buffer, and also assayed for insulin and preptin. Rate of carbohydrate Tnetabolism in isolated rat skeletal muscle The p-cell hormones amylin and insulin modulate carbohydrate utilisation in peR1pheral tissues, including skeletal muscle. The ability of preptin to alter glucose uptake and incorporation into muscle glycogen was investigated using isolated incubated stR1pped soleus muscle as a model tissue. All animal methods -were carR1ed out with appropR1ate permission from the Institutional Animal Ethics Committee. Male Wistar rats (200 + 20 g) were housed in controlled conditions {20oC. 12 h light/dark cycle) and fed standard rat chow (Diet 86. NRM Tegel. Auckland) and water ad libitum. 18-h fasted rats were anaesthetised (45 mg/kg Pentobarbitone sodium) then sacR1ficed by cervical dislocation, and soleus mucles dissected under carboxygenated-KHB {02:C0295: 5 v/v), then Incubated in nDMEM supplemented with vaR1ous concentrations of insulin and preptin. Muscles were teased longitudinally into 3 equal stR1ps with a final radius of approximate^ 1.5 mm [(U)>*CI D(+)-glucose (1 mCi/ml, Amersham) was diluted 1: 20 (v/v) in 70% ethanol to yield a final concentration of 0.5 nCl/10 μl. Actrapid® Recombinant Human Insulin (100 U/ml, Novo Nordisk) was diluted 1/1000 in 10 ml nDMEM. 60 ng rat preptin was dissolved in 1526 jil of nDMEM to a concentration of 10 nM, then further diluted in nDMEM to give stock solutions of 1 jiM, 100 nM, 10 nM, 100 pM and 1 pM. Two different expeR1mental paradigms were employed to determine whether preptin (i) stimulated the rate of glucose incorporation into glycogen, or (u) acted as an antagonist of insulin-evoked glucose incorporation into glycogen. Preptin antagonist incubation protocol Four muscle stR1ps were transferred into each of 9 flasks, which contained 10 ml of carboxygenated nDMEM. 0 (control) or maximally-effective insulin (23.7 nM). and vaR1ous concentrations of preptin (10 fM. 100 fM, 1 pM, 0, 10 pM, 100 pM, 1 nM or 10 nM). Flasks were then equilibrated in a shaking water bath (30°C, 20 min), following which 10 ^1 of (0.5 ^Ci) D-I(U)>4C] glucose was added, at stR1ct 1.5 min intervals. Muscle stR1ps were then incubated for 120 min at 30°C under carbogen. After incubation, stR1ps were removed from each flask at 1.5 min intervals, and blotted dry. They were then snap-frozen in liquid Na. freeze-dR1ed for 24 h in pre-weighed tubes, then stR1p dry-weights determined. Muscle stR1ps were then solubilised in 250 ^1 or 60% KOH. incubated at 70°C for 45 min. then cooled before overnight precipitation at -20OC with ice-cold ethanol. Glycogen pellets were then prepared by centR1fugation O.OOOxg, 15 min, 0C), pellets resuspended, and re-precipltated twice, before the supernatant was finally aspirated and glycogen pellets over-dR1ed at 70C for 2 h. incorporation of "^C was then determined by scintillation counting. Preptin agonist protocol All methods were as descR1bed above, except that stR1ps were incubated in the absence of insulin (except for the positive control, at 23.7 nM) and final preptin concentrations of 0. 0.1, 1, 10 and 100 nM. Effect qfpreptin on insulin secretion Insulin and amylin are known to modulate p-cell insulin secretion via presumed autocR1ne mechanisms. The effect of preptin on insulin secretion was therefore tested using a p-cell secretagogue protocol PTC6-F7 cells were subcultured at passage #52 into 24-well plates at 4 x lO5 cells/well. They were grown for 3d in nDMEM to 80% confluence, then washed twice with KRB-HEPES. Stock preptin was seR1ally dUuted in incubation medium containing 10 mM D{+) glucose to yield final concentrations of 150, 75, 25, 5, 1 and 0.1 nM. Cells were then washed, and 1 ml/well of incubation medium containing 10 mM and vaR1ous final preptin concentrations was added to each well. Cells were incubated at 37°C for 2 h, then medium removed. Cells were washed thR1ce with PBS, then lysed with 500 ^1 of lysis buffer. Incubation medium was centR1fuged (16,000 x g, 3 min) and the supernatant separated from pelleted debR1s. Incubation medium and lysates were then analysed for insulin, preptin and protein as above. Results The results of the above are shown in Figures 1, 2 and 3. Discussion Mouse preptin is a 34 amino acid peptide which corresponds to Aspeg-Leuioa of muR1ne proIGF-II E-peptide. Preptin was present in granules at 1:8 the content of insulin, but 2:1 that of amylin (mol/mol), as determined by integration of RP-HPIXi peak-jireas. Preptin is flanked NH2-terminaUy by a recognised Arg cleavage site, and COOH-terminally by a putative dibasic (Arg-Arg) cleavage motif (Bell (1984)) (Figure le). These residues likely serve as post-translational processing signals, and are highly conserved between species. Many prohormone precursors incorporate more than one hormone with differential proteolytic processing often being tissue specific (Martinez (1989)). The above results indicated that proIGF-II is a prohormone with more than one peptide-hormone product. IGF-II is a member of the insulin family that regulates ceU growth, differentiation and metabolism (De Chiara et al (1990). It is a single polypeptide chain deR1ved from the BCA and D domains of proIGF-II (see Figure le) and is widely synthesised in fetal and adult tissues. Insulin expression, on the other hand, is almost completely confined to p-cells. In mammalian genomes, the IGF-II gene is contiguous with those of insulin (Bell (1985)) and recent studies in humans have identified a VNTR polymorphism upstream of the INS and IGF-II genes, which may contR1bute to differential regulation of both genes (Ong (1999)). The preptin radioimmunoassay (R1A) (Figure 2a) and reanalysis of the granule puR1fication profiles of Figures la with the preptin R1A showed that preptin co-purlfied with insulin and amylin, confirming that it was Indeed a granule component. Preptin-bke immunoreactive mateR1al (PUM) was characteR1sed by RP-HPLC/R1A in puR1fied granules and in PTC6-F7 conditioned medium. The major form of both intra-granular and extracellular PUM co-eluted on RP-HPLC (Figure 2b). Mass spectrometry of HPLC-puR1fied mateR1al corresponding to the PLIM peak from PTC6-F7 cells showed the presence of a single species, with molecular mass identical to that of muR1ne preptin (Figure 2c). RP-HPLC also demonstrated that the major form of PLIM from human and rat plasma co-eluted with intragranular muR1ne preptin. Preptin was co-secreted with insulin from pTC6-F7 cells in response to glucose-stimulation (Figure 2d), reaching maximal levels at 1-mM or greater. These results confirm that preptin is synthesised in islet p-cells and packaged in secretory granules. Further, it is co-secreted with insulin in a glucose-dependent manner. There is evidence that insulin secretion may be modulated by islet p-cell hormones, including insulin (Kulkami (1999); Elahi (1982); Argoud (1987)). amylin (Waggoner et al (1993); Silvestre (1996); Degano et al (1993)). and pancreastatin fTatemoto (1986)). These are thought to act through autocR1ne negative-feedback loops, mediated via binding to specific cell-svuface receptors. The effects of preptin on insulin secretion were therefore investigated. The results obtained showed that synthetic rat preptin enhanced the glucose (lO-mM)-stimulated secretion of insulin from cultured PTC6-F7 cells, in a manner that was both concentration-dependent and saturable (Figure 3a). Significant effects of preptin compared to controls (0 added preptin) were detected at concentrations of 0.1-nM and greater, and reached maximal at 75-nM. This concentration is equivalent to that at which amylin elicits inhibition of insulin secretion (Degano et al (1993)). These preptin concentrations are similar to those secreted finra pTC6-F7 cells (Figure 2d), and are thus likely to occur adjacent to p- cell membranes in situ in physiological islets. This demonstration of concentration-dependent and saturable stimulation of insulin secretion by preptin suggests that it elicits these effects by binding to a cell surface receptor. The effect of Infused synthetic rat preptin on glucose (20-mM)-stimulated insulin secretion in the isolated-perused rat pancrease (Figure 3b) was measured employing a maximally-effective preptin concentration (75-nM). Preptin significantly enhanced (by 30%; p = 0.03, 2-tailed t-test of areas-under-curve) the second phase of insulin secretion, compared with control values (0-added preptin) (Figure 3b). These findings are consistent with those obtained from PTC6-F7 cells (Figure 3a). They suggest that preptin is a physiological regulator of insulin secretion, which acts in a newly recognised feed-forward autocR1ne loop to enhance glucose-stimulated insulin secretion, and may function to counterbalance the inhlbitoiy effects of other p-cell hormones on insulin secretion. It is therefore the applicants view that preptin acts to recruit, pR1me and co-ordinate the glucose-responsive activity of p-cells in a local manner, amplifying the glucose-evoked signal to the p-cell organ. This action would be similar to the feed-forward mechanism effected in platelets by the thrombin-elicited release of thromboxane A2 (Banntt(1992)). The existence of a previously unsuspected mechanism, through which a new islet p-cell hormone amplifies glucose-mediated insulin secretion, suggests that preptin biology will be important in type 2 diabetes mellitus, which is characteR1sed by a complex impairment of insvUin secretion (De Fronzo et cd (1992)). A defect in preptin synthesis, secretion, or action could contR1bute to the defective glucose-mediated insulin secretion in this condition and preptin administration may be advantageous for the treatment of type 2 diabetes melUtus or other disorders associated with diminished p-cell insulin secretion. It is noted that, in humans, the vaR1able number of tandem repeat (VNTR) polymorphism upstream of the adjacent insulin (INS) and IGF-II genes regulates expression of both genes, and is associated with an increased tendency to both type 2 diabetes mellitus and polycystic ovaiy syndrome. Section B Preptin is co-packaged with insulin in islet tissue To study preptin physiology, immunohistochemical studies were performed in normal muR1ne pancreas using a preptin-specific antiserum. Synthetic rat preptin, prepared as above, (Auspep Pty Ltd) was conjugated to ovalbumin using the single-step gluteraldehyde method at pH 7.0 (Harlow and Lane). New Zealand white rabbits were used to raise polyclonal antisera against the rat preptin conjugate. SeR1al sections from normal adult mouse (FVB/n) pancreas were stained with haematoxylin and sjieclfic anti-preptin or anti-insulin antisera, all at fmal dilutions of 1:40 (v/v), and with goat-anti-rabbit immunoperoxidase-labelled second antibody. Preptin (1 or 5 mg.ml-") was pre-incubated with anti-preptin antiserum for 30 min before addition to sections to demonstrate the specificity of preptin immunostaining. Preptin-like immunoreactive mateR1al (PLIM) and insulin-like immunoreactive mateR1al were co-localised in islet p-cells (Figs. 4a,b). Competition studies showed that PLlM-staining was suppressed by pre-incubating preptin antiserum with synthetic preptin in a concentration dependent manner (Figs. 4b-d). These studies suggest that preptin is present in physiological pancreatic islet p-cells. PUM is present in normal islet tissue To establish the identity of PLIM in normal islet tissue, we performed RP-HPLC/R1A of acid ethanol extracts from isolated rat islets. Pancreatic islets were isolated from normal adult male Wistar rats, and the contents extracted with acid ethanol according to a modification of published methods (Wollheim and Sharp (1981), Romanus (1988)). The results are shown in Figure 5. Although preptin levels were much lower than in PTC6-F7 cells, the major peak of PLIM co-eluted with intra-granular preptin, indicating that preptin is the dominant physiological component of PLIM in normal islets {Fig. 5). These data confirm that the preptin puR1fied from the PTC6-F7 cells was not simply an artefact resulting from proteolysis duR1ng puR1fication, but exists and is secreted in this form from both PTC6-F7 cells and normal rat islets. Prepiin is co-secreted with insulin in response to glucose stinudation. Given the co-localisation of preptin and insulin within the βcell secretory granule, expeR1ments were undertaken to determine whether preptin and insulin are co-secreted in a regulated manner. Glucose-stimulated peptide secretion was studied according to published methods using both PTC6-F7 cells (Efrat et al (1993), Knaack et at (1994)) and isolated rat islets (Gotoh etcd(1987)), and concentrations of preptin and insulin were measured using specific R1As. The results are shown in Figure 6. These indicated that while PTC6-F7 cells were responding to sub-physiological concentrations of glucose ( Removal of endogenous preptin significantly decreases insulin secretion from the isolated-perfused rat pancreas. To determine the role that endogenous pancreatic preptin might play in insulin secretion, the action of endogenous preptin was removed by infusing anti-preptin antibodies into the isolated perfused pancreas model as follows: Pancreases were perfused with KHB supplemented with 4% dextran, 0.5% BSA, 3 mM-arginine and 5.5 mM glucose (final concentrations). Perfusate was gassed with a mixture of 95% 02/5% CO2 and infused by peR1staltic pump at 2.7 ml.min-" without re-circulation. Pancreases were perfused and equilibrated for 20-min pR1or to each 70-min perfusion. 10-min into the expeR1ment either antl-prepUn y-globulin or non¬immune rabbit 7-globulln were introduced via a side-arm infusion (final Y-globulin concentration in perfusate: 35 ng.ml" in carR1er buffer (0.1% BSA in 0.9% NaCl). In addition, at 25-min, glucose was infused for 20-min (measured final concentration in perfusate: 20 mM). Continuous 1-min fractions were collected on ice and assayed for insulin (R1A). Rabbit anti-rat preptin 7-globulln or control (non-immune rabbit) y-globulin were puR1fied by Protein A affinity chromatography (Pharmacia-Biotech, Hi-Trap Protein A Tech. Rep. (Wikstroms. Sweden (1999)) to diminish the potential influence from other serum constituents. The compositions of the two different y-globulln fractions were confirmed by MALDI-TOF MS (Fig. 7a.b). and the binding capacities of the two different 7-globulln fractions were determined under conditions simulating the antibody perfusion expeR1ments as above. The maximal amount of preptin completely bound by anti-preptin 7-globulin under the perfused pancreas exjieR1mental conditions was 20 ng/min (Fig. 7c). Isolated perfused pancreases were infused with anti-preptin or control y-globulin and subjected to square-wave stimulation by 20 mM glucose (Fig. 7d). Secretion of insulin in both the first and second phase was significantly decreased by anti-prepUn 7-globulin (first phase: average 29% inhibition compared to controls, P = 0.02, 1-tailed t-test; second phase: average 26% inhibition compared to controls. P=0.03, 1-tailed t-test of AUC). In this expeR1ment we have shown that removal of endogenous circulating preptin causes a significant decrease in glucose-mediated insulin secretion. This result is all the more interesting given that preptin has been estimated to be present in relatively low concentrations in the physiological islet (approximately 500x less than insulin) and yet still has the ability to exert a significant effect on insulin secretion. These expeR1ments are consistent with the premise that physiological concentrations of paincreatic preptin play an autocR1ne role to increase glucose-mediated insulin secretion. This action may be similar to the feed-forward mechanism evoked in platelets by the thrombin-elicited release of thromboxane A2 (BarR1t (1992)). Overall Conclusion In summary, preptin is a previously unknown, pancreatic islet p-cell hormone. It is produced from the E-peptide of pro-IGF-II, is present in islet p-cell granules in significant amounts. Is co-secreted with insulin in a regulated manner, enhances glucose-stimulated insulin secretion, and may act in a feed-forward autocR1ne loop, probably via binding to a p-cell surface receptor. INDUSTR1AL APPLICATION As descR1bed above, the present invention provides preptin (including in its human, rat and mouse forms) and analogs of preptin. Preptin and its analogs play a physiological role in the stimulation of glucose evoked insulin secretion. The invention therefore also provides methods by which glucose-evoked insulin secretion can be modulated. Such modulation will usually involve administration of preptin and its analogs as descR1bed above. However, modulation can also be achieved by use of preptin agonists and antagonists. A preptin agonist is a compound which promotes or potentiates the effect of preptin on insulin secretion. In contrast, a preptin antagonist is a compound which competes with preptin or otherwise interacts with preptin to block or reduce the effect of preptin on insulin secretion. Preptin agonists and preptin antagonists can be identified by assay systerns which measure the effect preptin has on insulin secretion in the presence and absence of a test compound. For example, the assay systems descR1bed in the expeR1mental section herein can be used. Where it is desired that a preptin agonist or preptin antagonist be employed in modulating insulin secretion, the agonist/antagonist can be administered as a pure compovmd or formulated as a pharmaceutical composition as descR1bed above for preptin. Also provided herein are immunological reagents which bind preptin. Such reagents (which can be polyclonal antibodies) can be generated using art standard techniques, including those descR1bed in the expeR1mental section. Monoclonal antibodies can also be provided. Such antibodies will typically be made by standard procedures as descR1bed, eg. in Harlow and Lane 1988. BR1efly, appropR1ate animals are selected and the desired immunisation protocol followed. After the appropR1ate peR1od of time, the spleens of such animals are excised and individual spleen cells fused, typically, to immortalised myeloma cells under appropR1ate selection conditions. Thereafter, the cells are clonally separated and the supematants of each clone tested for the production of an appropR1ate antibody specific for the desired region of the immunising antigen. )ther suitable techniques for prepguing antibodies involve in vitro exposure of pymphocytes to the antigen or alternatively, to selection of libraR1es of antibodies in )hage or similar vectors. See, for example Huse et al 1989. Use, recombinant antibodies may be produced using procedures known in the art. see, for example, US Patent 4,816,567. rhe antibodies may be used with or vvR1thout modification. Frequently, antibodies will De labelled by joining, either covalently or non-covalently a substance which provides a detectable signal. A wide vaR1ety of labels and conjugation techniques are known and are reported extensively in the literature. Antibodies as above to preptin can therefore be used to monitor the presence of preptin in a patient or in preptin quantification assays. In such assays, any convenient immunological format can be employed. Such formats include immunohistochemical assays, R1A, IRMA and ELISA assays. The assays can be conducted in relation to any biological fluid which does, or should, contain preptin. Such fluids include blood, serum, plasma, uR1ne and cerebrospinal fluid. The antibodies can also be included in assay kits. Such kits can contain, in addition, a number of optional but conventional components, the selection of which willl be routine to the art skilled worker. Such additional components will however generally include a preptin reference standard, which may be preptin itself or an analog (such as a fragment). It will also be appreciated that antibodies such as descR1bed above can, if some circumstances, also function as preptin antagonists by binding to preptin and partly or completely interfeR1ng with preptin activity. As alluded to above, the applicants findings in respect of preptin also have diagnostic Implications. For example, individuals whose preptin production is less than is required in order to elicit insulin secretion at appropR1ate levels, or who produce preptin in a less active or inactive (mutant) form will require therapeutic intervention. Diagnostic or prognostic methods are therefore within the scope of the invention. In one specific embodiment, a diagnostic or prognostic method will involve detection of mutations in the gene coding for preptin and/or the preptln secretory mechanism. Detection can occur using any one of a number of art standard techniques including Single Stranded Confirmation Analysis (OR1ta et al (1989)) or the Amplification Refractory Mutation System (ARMS) as disclosed in European Patent Application Publication No 0 332 435. If a mutation is detected, corrective approaches become possible. These include but are not limited to gene therapy. Again, art standard techniques will be employed. Other implications and applications of the applicants identification of preptin will be apparent to those persons skilled in the art, who will appreciate that the above descR1ption is provided by way of example only and that the invention is not limited thereto. RBPERBNCBS Draznin. B. and LeRoith. D. (eds). Molecular biology of diabetes II. Insulin action, effects on gene expression and regulation, and glucose transport (Humana Press Inc., New Jersey (1994)). cooper, G. Endocr. Rev. 15, 163-201 (1994). Waggoner, P., Chen. C, Worley. J., Dukes, I. and Oxford, G. Proc. Natn. Acad. ScL, USA, 90, 9145-9149 (1993). Hettiarachchi, M., etoL Am J. PhysioL 273. E859-E867 (1997). Hutton, J. Diabetologia 12, 271-281 (1989). Efrat, S. et oL Diabetes. 42. 901-907 (1993). Knaack, D. etaL Diabetes. 43, 1413-1417 (1994). Linde, S. etaL J. Chromatgr. 4642. 243-254 (1989). Johnson, K.,etaL Am. J. PathoL 130. 1-8 (1988). Bell, G. 1., etoL Nature. 310,775-777(1984). Martinez. J. (ed) Peptide hormones prohormones; processing, biological activity, pharmacology (ElUs Horwood Ltd, Chichester, 1989). DeChiara. T., Efstradiadis, A. and Robertson, E. Nature 345. 78-89 (1990). Kulkami, R. etal. CeU 96, 329-339 (1999). Elahi, D. et aL N. Eng. J. Me± 306. 1196-1202 (1982). Argoud, G., Schade. D. and Eaton. R. Diabetes 36, 959-962 (1987). Silvestre, R. et aL Br. J. Pharmacol 117, 347-350 (1996). Degano, P.. Silvestre, R, Salas, M. and Peiro, E. ReguL Pep. 43, 91-96 (1993). Tatemoto, K. etaL Nature 324. 476-478 (1986). BarR1tt, G. Communication within animal cells. (Oxford University Press. Oxford. 1992). DeFronzo, R., Bonadonna. R. and Ferrannini. E. Diabetes Care 15, 318-368 (1992). Hutton, J., Penn, E. and PeshavaR1a, M. Diabetologia2, 365-373 (1982). Grodsky, G. and Fanska, R. Methods EnzymoL 39. 364-372 (1975). Stempien. M., Fong, N., Rail. L. and Bell. G. DNA, 5. 357-361 (1986). Dull. T.. Gray. A. Hayflick. J. and UllR1ch. A. Nature 310, 777-780 (1984). Harlow and Lane (1988). Antibodies: A Laboratory Manual. (Cold SpR1ng Harbour Laboratory. Cold SpR1ng Harbour. New York). Huse etaL (1989). Science246: 1275-1281. OR1ta etal (1989). Proc. NatL Set. USA. 86: 276-277. Hylka. V.. Teplow. D.. Kent, S. and Strauss. D. J. BioL Chem. 260. 14417-14420 (1985). Daughaday, W. and TR1vedi, B. J. Clin. EndocR1noL Metab. 75. 641-645 (1992). Liu. F.. Baker, B., Powell, D. and Hintz, R. J. Clin. EndocR1noL MetaboL 76, 1095-1100(1993). Bell, G., Gerhard, D., Fong, N., Sanchez-Pescador, R. and Rail, L. Proc. NatL Acad. Set USA 82. 6450-6454 (1985). Ong, K. etaL NaL Genet 21, 262-263 (1999). WE CLAIM: 1. A bioactive peptide, the amino acid sequence of which is as follows: Asp Val Ser Thr Rj R2 R3 Val Leu Pro Asp R4 Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe R5 R6 Asp Thr Trp R7 Gln Ser R8 R9 Arg Leu wherein: R1 is Ser or: Pro; R2 is Gln or Pro; R3 is Ala or Thr; R4 is Asp or Asn; R5 is Gln or Lys; R6 is Tyr or Phe; R7 is Arg or Lys; R8 is Ala or Thr; and R9 is Gly or Gln, [SEQ ID NO. 1] or an analog thereof 2. The bioactive peptide according to claim 1 having the amino acid sequence of human preptin which is as follows: Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Set Thr Gln Arg Leu [SEQ ID N0.3], or an analog thereof 3. The bioactive peptide according to claim 1 having the amino acid sequence of rat preptin which is as follows: Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly R1. R2 R3 R4 Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu [SEQ ID N0.5], R5 R6. R7 R8 R9^ or an analog thereof. 4. The bioactive peptide according to claim 1 having the amino acid sequence of mouse preptin which is as follows: Asp Val SerThr Ser Gln AlaVal Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu [SEQ ID N0.7)) or an analog thereof 5. A preptin analog as defined in anyone of claims 1 to 4 wherein said analog is a mammalian analog. 6. A preptin analog which includes from 6 to 33 amino acids from a sequence as claimed in anyone of claims I to 4, and which retains preptin functionality. 7. A preptin analog which is, or includes, a hexapeptide, a heptapeptide, an octapeptide, a nonapeptide or a decapeptide derived from human preptin or an analog thereof as claimed in claim 2. 8. A peptide selected from human preptin having the amino acid sequence: Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu, or an analog thereof, wherein said analog retains preptin functionality, and wherein said analog is selected from the following: (i) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Set Thr Gln Arg; (ii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln; (iii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr; (iv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser; (v) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln; (vi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys; (vii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp; (vii!) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr; (ix) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp; (x) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr; (xl) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln; (xii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe; (xiii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe; (xiv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys; (xv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly; (xvi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val; (xvii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro; (xviii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro ASp Asn Phe Pro Arg Tyr; (xix) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg; (xx) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro; (xxi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe; (xxii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn; (xxiii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp; (xxiv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro; (xxv) Asp Val Ser Thr Pro Pro Thr Val Leu; (xxvi) Asp Val Ser Thr Pro Pro Thr Val; (xxvii) Asp Val Ser Thr Pro Pro Thr; and (xxviii) Asp Val Ser Thr Pro Pro. 9. A polynucleotide which encodes a peptide, a preptin, or an analog or fragment thereof as defined in anyone of claims 1 to 8. 10. A polynucleotide which encodes preptin or an analog thereof as defined in anyone of claims 1 to 9. 11. A polynucleotide which encodes human preptin and which comprises the following nucleotide sequence: gacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttcttccaatatga cacctggaagcagtccacccagcgcctg [SEQ ID NO.2]. 12. A polynucleotide which encodes rat preptin and which comprises the following nucleotide sequence: gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttcaaattcgac acctggagacagtccgcgggacgcctg [SEQ ID NO.4]. 13. A polynucleotide which encodes mouse preptin and which comprises the following nucleotide sequence: gacgtgctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttccaatatgac acctggagacagtccgcgggacgcctg [SEQ ID NO.6]. -i.. 14. A vector or cell line which includes a polynucleotide having the nucleotide sequence of any one of claims 10 to 13 and which is capable of expressing a peptide having preptin functionality. 15. A vector or cell line as claimed in claim 14 which includes the nucleotide 3 , ) sequence of claim 11. 16. A pharmaceutical composition which comprises a peptide, a preptin, or an analog thereof as defined in anyone of claims 1 to 8. 17. A dosage form comprising a peptide, a preptin, or an analog thereof as defined, in anyone of claims 1 to 8 in combination with a physiological buffer solution suitable for administration to humans. 18. A dosage form as claimed in claim 17 which is for administration by injection. 19. A dosage form as claimed in claim 17 or claim 18 in which said preptin is human preptin or an analog thereof as defined in anyone of claims 2, 7 and 8. 20. A preparation of a peptide, a preptin, or an analog thereof as claimed in anyone of claims 1 to 8 in which said preptin, or analog is present in an amount of at least 50% by weight, 21. A preparation as claimed in claim 20 in which said peptide, preptin or analog thereof is at least 80% by weight of said preparation. 22. A preparation as claimed in claim 20 in which said peptide, preptin, or analog thereof is at least 90%) by weight of said preparation. 23. A preparation as claimed in claim 20 in which said peptide, preptin, or analog thereof is at least 95% by weight of said preparation. 24. A preparation as claimed in claim 20 in which said peptide, preptin, or analog thereof is at least 99%) by weight of said preparation. 25. A preparation as claimed in claim 20 in which said peptide, preptin, or analog is pure. 26. A preparation as claimed in claim 20 in which said preptin or analog is human preptin or an analog thereof. 27. A salt of a peptide, a preptin, or an analog thereof as claimed in anyone of claims 1 to 8. 28. A salt as claimed in claim 27 which is a physiologically acceptable sah 29. A salt as claimed in claim 28 in which said peptide, preptin, or analog thereof is formed by combination with anions of an organic acid. 30. A salt as claimed in claim 29 in which said salt is selected from malate, acetate, propionate, butyrate, oxaloacetate, citrate, isocitrate, a-ketoglutarate, succinate, fumarate and trifluoroacetate salts. 31. A pharmaceutical composition which includes a salt as defined in any one of claims 28 to 30. 32. Antibodies which bind a peptide, a preptin, or an analog thereof as defined in any one of claims 1 to 8. 33. A monoclonal antibody which binds a peptide, a preptin, or an analog thereof as claimed in anyone of claims 1 to 8. 34. A monoclonal antibody which binds human preptin or an analog thereof as claimed in anyone of claims 2, 7 and 8. 35. An in vitro immunological assay which employs an antibody as claimed in any one of claims 32 to 34. 36. An assay as claimed claim 35 in which the presence of preptin is quantitatively measured in a biological fluid. 37. An assay as claimed in claim 36 in which the biological fluid is blood, serum, plasma, urine or cerebrospinal fluid. 38. An in vitro immunological assay which employs an antibody as claimed in anyone of claims 32 to 34 and which is a RIA, IRMA or ELISA. 39. An assay kit which includes an antibody as claimed in anyone of claims 32 to 34. 40. An assay kit as claimed in claim 39 which comprises an antibody as defined in anyone of Claim32 to 34 and a preptin reference standard. 41. An assay kit as claimed in claim 40 in which said reference standard is preptin or an analog thereof as defined in anyone of claims 1 to 8. 42. A method of identifying a preptin agonist which comprises the steps of: testing the degree of insulin secretion induced by a pre-determined concentration of the peptide or analog as claimed in anyone of claims 1 to 8 in the presence and absence of a candidate agonist; and identifying as an agonist any compound which effects an increase in preptin-mediated insulin secretion. 43. A method of identifying a preptin antagonist which comprises the steps of: testing the degree of insulin secretion induced by a pre-determined concentration of the peptide or analog as claimed in anyone of claims 1 to 8 in the presence and absence of a candidate antagonist; and identifying as an antagonist any compound which effects a decrease in preptin-mediated insulin secretion.

Full Text

This invention relates to a bioactive peptide. In particular, it relates to a peptide secreted by the pancreatic islet βcell that stimulates insulin secretion.
BACKGROUND
Pancreatic islet p-cells play a major regulatory role in physiology, mainly through their secretion of insulin, a peptide hormone which exerts profound effects on intermediary metabolism (Draznin et cd (1994)). A second β-cell hormone, amylin. may also contR1bute to p-cell regulatory function through its actions on insulin secretion and tissue insulin sensitivity (Cooper, G (1994); Hettiarachchi et al (1997)).
In islet p-cells, hormones are packaged in secretory granules, which undergo regulated release in response to signals such as fuels (eg. glucose, amino acids) or neurohormonal stimuli. These granules contain dense cores R1ch in insulin and Zn, while smaller amounts of insulin C-peptide, amylin, proinsulin, chromogranin-deR1ved peptides, proteases and other proteins are found in the granule matR1x (Hutton, J(1989)).
What the applicants have now determined is that pancreatic islet p-cells secrete yet a further regulatory peptide. The applicants have further determined that this peptide enhances glucose-mediated insulin secretion.
It is generally towards this peptide, which the applicants have termed preptin, that the present invention is directed in its vaR1ous aspects.
SUMASARY OF THE INVENTION
Accordingly, in a first aspect the present invention provides the peptide preptin or an analog thereof.
By "preptin", the applicants mean a peptide of 34 amino acids, the sequence of which is as follows;
Asp Val Ser Thr R1 R2 R3 Val Leu Pro Asp R1 Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Rs Re Asp Thr Trp R7 Gln Ser R8 Ra Arg Leu

wherein:
R1 is Ser or Pro;
R2 is Gln or Pro;
R3 is Ala or Thr;
R4 is Asp or Asn;
Rs is Gln or Lys;
Re is Tyr or Phe;
R7 is Arg or Lys;
R8 is Ala or Thr; and
R9 is Gly or Gln. or an analog thereof.
In one embodiment, the invention provides human preptin having the amino acid sequence:
Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu.
In another embodiment, the invention provides rat preptin having the amino acid sequence:
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu.
In yet another embodiment, the invention provides mouse preptin having the amino acid sequence:
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu.
The amino acid sequence corresponds to Aspeg-Leuioa of the prolGF-II E-peptide in each mammal.
In still a further aspect, the present inArention provides a polynucleotide which encodes preptin or an analog thereof.

In another aspect, the invention provides a vector or cell-line which includes a piolynucleotide which encodes preptin or an analog thereof and which is capable of expressing preptin or said analog.
Preptin salts, which are preferably physiologically acceptable, are also provided.
In a further aspect, the invention further provides a pharmaceutical composition which compR1ses preptin or an analog thereof, or preptin salts.
In still a further aspect, the invention provides a method of stimulating insulin secretion for a therapeutic or prophylactic purpose which compR1ses the step of administeR1ng to a patient in need of such therapy or prophylaxis an effective amount of preptin or an analog thereof.
In yet a further aspect, the invention provides the use of preptin or an analog thereof or a salt thereof in the preparation of a medicament, particularly for stimulating insulin secretion.
In still a further aspect, the invention provides a method of modulating glucose mediated insulin secretion which compR1ses the step of administeR1ngjto^ patient an effective amount of preptin, a preptin analog, a preptin agonist or a preptin antagonist.
In yet further embodiments, the invention provides antibodies which bmd preptin or its analogs, assays which employ such antibodies and assay kits which contain such antibodies.
The above summary is not exhaustive. Other aspects of the invention will be apparent from the following descR1ption, and from the appended claims.
DESCR1PTION OF THE DRAWINGS
Although the invention is broadly as defined above, it will also be understood that it includes embodiments of which the descR1ption provided below gives examples. In addition, the invention will be better understood by reference to the accompanying drawings in which:

Figure 1 shows puR1fication and characteR1sation of preptin. a) assays for marker proteins indicating the localisation of organelles from PTC6-F7 cells within the continuous OptlFrep gradient; granule core (insulin), granule matR1x (amylin), lysosomes (aryl sulphatase), mitochondia (citrate synthase), b) Granule proteins puR1fied by RP-HPLC. The indicated peak (hatched) was collected and further puR1fied, c) PuR1ty and mass (M + H+) of the major peptide from the hatched peak confirmed by MALDI-TOF MS. d) RP-HPLC profile from the Lys-C digest of the peptide puR1fied from the hatched peak. l:NH2-terminal fragment; 2: COOH-terrainal fragment; 3: undigested peptide, e) Structure of mouse preptin as determined by sequencing of Lys-C-deR1ved peptides from (d); NHa-terminal fragment: normal font; COOH-terminal fragment: italicised-bold, and its localisation in a segment of muR1ne proIGF-II E-peptide shown. Domains of prolGF-11 (B, C, A, D, E) are indicated. Recognised cleavage site at Arges is indicated in bold, while putative dibasic motifs are shown as discontinuous lines.
Figure 2 shows cellular preptin secretion, a) Preptin R1A standard curve, b) R1A characteR1sation of preptin-like immunoreactive mateR1al (PLIM) in RP-HPLC fractions of 24-h pTC6-F7 conditioned medium and intra-granular fractions from Figure lb. c) MALDI-TOF MS of the major PLIM containing fraction secreted from PTC6-F7 cells. Peak corresponds to muR1ne preptin (M + H*) with 0.07% error.
Figure 3 shows the eflects of preptin on insulin secretion, a) Preptin-mediated insulin secretion from PTC6-F7 cells. Graph Illustrates increments in insulin concentration above basal (0 added preptin). b) preptin-mediated insulin secretion from isolated perfused rat pancreas. Points are mean + sem (duplicate analyses; n=4 pancreases for each curve). Area under curve (second phase of insulin secretion P = 0.03 unpaired 2-talled t-test).
Figure 4 shows the immunohistochemistry of muR1ne pancreas. Pancreas harvested from adult FVB/n mice was sectioned and stained with haematoxylin and polyclonal rabbit antisera using immunoperoxldase-conjugated goat-anti-rabbit second antibody. Panels are: a, anti-insulin antiserum (1:40); b, anti-preptin antiserum, (1:40); c,d, anti-preptin antiserum (1:40) pre-incubated for 30 min with synthetic rat preptin ate, 1 mg.ml", d, 5 mg.ml". Bar = 100 μim.

Figure 5 shows the R1A characteR1sation of preptin-llke immunoreactivc mateR1al (PLIM) in RP-HPLC fracUons from rat islets or PTC6-F7 granule fractions (standard; Fig. lb).
Figure 6 shows preptin and insulin co-secretion from PTC6-F7 cells and isolated rat islets. a,b Glucose-mediated co-secretion of preptin with insulin from a, PTC6-F7 cells and b, isolated rat islets.
Figure 7 shows the effects of preptin on insulin secretion, a, b. PuR1ty and mass of puR1fied a, rabbit anti-rat preptin y-globulln and b, non-immune rabbit y-globulin. 1: light chain IgG, M + H+: 2: whole IgG. M + 4H+; 3: heavy chain IgG, M + H+; 4: whole IgG, M + 2H+; whole IgG, M + H+. c, 1-min preptin-binding capacity of perfused anti-preptin 7-globulin at 35 jig.ml ^ 37oC, pH 7.4 to simulate contact time, dilution, temperature and pH of the antibody perfusion expeR1ments, d. Effect of infusion of anti-preptln y-globulin or control (non-immune rabbit y-globulin) on insulin secretion from glucose-stimulated (20 mM; square wave) isolated perfused rat pancreases. Each point is mean ± s.e.m. (duphcate analyses; n = 5 pancreases per curve). AUG (second phase of insulin secretion; P= 0.03, unpaired 1-tailed t-test).
DESCR1PTION OF THE INVENTION
As broadly defined above, the present invention is directed to a novel peptide which has been found in pancreatic islet β-cell granules. This peptide, preptin, has been determined to stimulate glucose-evoked insulin secretion.
In summary, preptin was identified using a single-step density-gradient centR1fugal method to puR1fy secretory granules from cultured muR1ne βTC6-F7 cells with puR1ty being confirmed by marker-protein analysis (Figure la). Insulin was used to track puR1fication of granule-cores, whereas amylin, which is present in the granule-matR1x (Johnson, K (1988)). was measured to veR1fy granule-membrane integR1ty (Figure la). Soluble granule components were then separated using reversed-phase HPLC (A214; Figure lb). Peptide-ldentity was determined by mass spectrometry and NH2-terminal amino-acid sequencing. Major peaks contained muR1ne insulins-1 and -II and C-peptides-I and -II (Figure la). No non-p-cell peptides were detected and the

molar ratio of amylininsulin (1:23) and mouse insulin I:mouse insulin II (1:3) were equivalent to those of physiological p-cells (Cooper (1994); Linde (1989)).
A major peak eluting immediately pR1or to insulln-I was found to contain a previously unknown peptide (Figure lb). This was puR1fied to homogeneity and had a molecular mass of 3950 Da (Figure Ic). The molecule was digested with a lysine-specific protease, and the resulting peptides separated by RP-HPLC (Figure Id) pR1or to complete NHa-terminal protein sequencing. The complete sequence confirmed that the molecule contained 34-amlno acids, which corresponded to Aspea-Leuioa of muR1ne proIGF-lI E>-peptide (Figure le). This peptide is mouse preptin.
Preptin is Hanked NH2-terminally by a recognised Arg cleavage-site, and COOH-terminally by a putative dibasic (Arg-Arg) cleavage motif (Bell et aL. (1985)) (Fig. le). These residues are highly conserved between species, and are likely to serve as post-translational processing signals.
While others have shown the existence of different prolGF-II E-peptide-deR1ved peptides in cell culture medium and vaR1ous mammalian biological fluids (Hylka et aL. (1985). Daughaday et al (1992) and Liu et aL, (1993)), none have identified one that is equivalent to preptin.
The amino acid sequence of mouse preptin is as follows:
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu
The equivalent amino acid sequences for human and rat preptin are, respectively:
Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu; and
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu.

Preptin is encoded by polynucleotides having the following nucleotide sequences:
gacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttcttccaatatga
cacctggaagcagtccacccagcgcctg (human)
gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttcaaattcgac
acctggagacagtccgcgggacgcctg (rat)
gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttccaatatgac
acctggagacagtccgcgggacgcctg (mouse)
Preptin may be generated by synthetic or recombinant means. For example, to be prepared synthetically, preptin may be synthesised using any of the commercially available solid phase techniques such as the Merryfield solid phase synthesis method, where amino acids are sequentially added to a growing amino acid chain (see Merryfield, J. Am. Soc. 85:2146-2149 (1963)). Equipment for automative synthesis of peptides is also commercially available from suppliers such as Perkln Elmer/Applied Biosystems, Inc and may be operated according to the manufacturers instructions.
Preptin may also be produced recombinantly by inserting a polynucleotide (usually DNA) sequence that encodes the protein into an expression vector and expressing the peptide in an appropR1ate host. Any of a vaR1ety of expression vectors known to those of ordinary skill in the art may be employed. Excpression may be achieved in any appropR1ate host cell that has been transformed or transfected with an expression vector containing a DNA molecule which encodes the recombinant peptides. Suitable host cells include prokaryotes. yeasts and higher eukaryotic cells.
Standard techniques for recombinant production are descR1bed for example, in Maniatis et cd. Molecular Cloning - A Laboratory Manual, Cold SpR1ng Harbour LaboratoR1es, Cold SpR1ng Harbour, New York (1989).
Vectors and/or cells lines which express preptin have utility in their own R1ght and also form part of the invention.
Analogs of preptin and of its encoding polynucleotides are also within the scope of the present invention. Such analogs Include functional equivalents of preptin and of the polynucleotides descR1bed above.

In terms of preptin itself, functional equivalents include all proteins which are immunologically cross-reacUve with and have substantially the same function as preptin. That equivalent may, for example, be a fragment of preptin containing from 6 to 33 amino acids (usually representing a C-terminal truncation) and including a preptin active site or sites, a substitution, addition or deletion mutant of preptin, or a fusion of preptin or a fragment or a mutant with other amino acids.
The six amino acids forming the smallest fragment can be from any part of the sequence, provided they are consecutive in that sequence and fulfil the functional requirement. It is of course also possible {and expressly contemplated) that the bioactive peptide include any one of those hexapeptides, or indeed be or include any heptajjeptide, octapeptide, nonapeptide, or decapeptide from the sequence.
Peptides which are, or include a hexapeptide, heptapeptide, octapeptide, nonapeptide or decapeptide from human preptin are particularly preferred.
VaR1ations in the residues included in the peptide are also both possible and contemplated. For example, it is possible to substitute amino acids in a sequence with equivalent amino acids using conventional techniques. Groups of amino acids known normally to be equivalent are:
(a) Ala Ser Thr Pro Gly;
(b) Asn Asp Glu Gln;
(c) His Arg Lys;
(d) Met Glu He Val; and
(e) Phe Tyr Trp.
Additions and/or deletions of amino acids may also be made as long as the resulting peptide is immunologically cross-reactive with and has substantially the same function as preptin.
Equivalent polynucleotides include nucleic acid sequences that encode proteins equivalent to preptin as defined above. Equivalent polynucleotides also include nucleic acid sequences that, due to the degeneracy of the nucleic acid code, differ from native polynucleotides In ways that do not effect the corresponding amino acid sequences.

A prediction of whether a particular polynucleotide or polypeptide is equivalent to those given above can be based upon homology. Polynucleotide or polypeptide sequences may be aligned, and percentage of identical nucleotides in a specified region may be determined against another sequence, using computer algoR1thms that are publicly available. Two exemplary algoR1thms for aligning and Identifying the similaR1ty of polynucleotide sequences are the BLASTN and FASTA algoR1thms. The similaR1ty of polypeptide sequences may be examined using the BLASTP algoR1thm. Both the BLASTN and BLASTP softwrare are available on the NCBI anonymous FTP server {ftp://ncbi.nlm.nih.gov) under /blast/executables/. The BLASTN algoR1thm version 2.0.4 IFeb-24-19981, set to the default parameters descR1bed in the documentation and distR1buted with the algoR1thm, is preferred for use in the determination of vaR1ants according to the present invention. The use of the BLAST family of algoR1thms, including BLASTN and BLASTP, is descR1bed at NCBI"s website at URL http://www.ncbi.nlm.nih.gov/BLAST/newblast.html and in the publication of Altschul, Stephen F. et cd (1997). "Gapped BLAST and PSl-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. The computer algoR1thm FASTA is available on the Internet at the ftp site ftp://ftp.virginia.edu.pub/fasta/. Version 2.0u4, Februaiy 1996, set to the default parameters descR1bed in the documentation and distR1buted with the al^R1thm, is preferred for use in the determination of vaR1ants according to the present invention. The use of the FASTA algoR1thm is descR1bed in the W R Pearson and D.J. Lipraan, "Improved Tools for Biological Sequence Analysis," Proc. NatL Acad. Set USA 65:2444-2448 (1988) and W.R. Pearson, "Rapid and Sensitive Sequence CompaR1son with FASTP and FASTA," Methods inEnzymology 183:63-98 (1990).
Analogs according to the invention also include the homologues of preptin from species other than human, rat or mouse. Such homologues can be readily identified using, for example, nucleic acid probes based upon the conserved regions of the polynucleotides which encode human, rat and mouse preptin.
Preptin or its analogs can also be present in vaR1ous degrees of puR1ty. Preferably, the preptin/analog component makes up at least 50% by weight of the preparation, more preferably at least 80% by weight, still more preferably at least 90% by weight, still more preferably at least 95% by weight and yet more preferably at least 99% by weight. It is however generally preferred that, for pharmaceutical application, the preptin or analog be present in a pvue or substantially pure form.

For administration to a patient, It is possible for preptin or preptin analogs to be used as such pure or substcintiEdly pure compounds. However, preptin or preptin analogs may also be presented as a pharmaceutical composition. Such compositions may compR1se preptin or preptin analogs together with one or more phannaceutically acceptable carR1ers therefor and optionally other therapeutic ingredients where desirable.
The carR1er must be acceptable in the sense of being compatible with the preptin or preptin analog and not deleteR1ous to the patient to be treated. Desirably, the composition should not include substances with which peptides are known to be incompatible.
The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods weU known in the art of pharmacy. All methods include the step of bR1nging the active ingredients into association -with a carR1er which constitutes one or more accessory ingredients.
The precise form the composition will take will largely be dependent upon the administration route chosen. For example, preptin or preptin analogs may be Injected parenterally, eg. intravenously into the blood stream of the patient being treated. However, it will be readily appreciated by those skilled in the art that the route can vary, and can be intravenous, subcutaneous, intramuscular, intrapeR1toneal, enterally, transdermally, transmucously, sustained release polymer comp)ositions (eg. a lactide polyrmer or co-polymer mlcropartlcle or implant), perfusion, pulmonary (eg. inhalation), nasal, oral, etc.
Compositions suitable for parenteral and In particular intravenous administration are presently preferred. Such compositions conveniently compR1se steR1le aqueous solutions of preptin or the preptin analog. Preferably, the solutions are isotonic with the blood of the patient to be treated. Such compositions may be conveniently prepared by dissolving the preptin or analog in water to produce an aqueous solution and rendeR1ng this solution steR1le. The composition may then be presented in unit or multi-dose containers, for example sealed ampoules or vials.
One particularly preferred composition Is preptin In a physiological buffer solution suitable for injection.

Compositions suitable for sustained release parenteral administrations (eg. biodegradable polymer formulations) are also well known in the art. See, for example, US Patent Nos. 3,773,919 and 4,767,628 and PCT Publication No. WO 94/15587.
It is also convenient for preptin to be converted to be in the form of a salt. Such a salt will generally be physiologically acceptable, and can be formed using any convenient art standard approach.
Preptin salts formed by combination of preptin with anions of organic acids are particularly preferred. Such salts include, but are not limited to, malate, acetate, propionate, butyrate, oxaloacetate, citrate, isocitrate, a-ketoglutarate, succinate, fumarate and tR1fluoroacetate salts.
The salts this formed can also be formulated into pharmaceutical compositions for therapeutic administration where this is desired.
Aspects of the invention will now be descR1bed with reference to the following non-limiting expeR1mental section.
EXPER1MENTAL
Section A
Metbods and MateR1als
Cell Culture
PTC6-F7 muR1ne pancreatic islet p-cells, passages 49-60, were cultured at 37°C in 02:C0295:5 (v/v) in tR1ple flasks in nDMEM (Gibco) supplemented with 15% heat-inactivated horse serum and 2.5% fetal bovine serum, and subcultured every 5 d by washing with PBS followed by trypsinization (2.5% Trypsin-EDTA). Each flask yielded approx 2.0 x 108 cells at 70% confluence.
Granule puR1fication.
P-cells at passages 55-60 from 8-12 tR1ple flasks were harvested by trypsinization, yielding on average 2.5-4.0 ml of pure cells (1.6 - 2.4 x 109), which then were concentrated (1700 x g, 5 min), washed twice with PBS, and once with

Homogenisation Medium (0.3 M sucrose/10 tnM MES K (Sigma)/I mM K2EGTA/I mM MgzSOi/pH 6.5), then homogenised on ice in the same medium at 1:5 (v/v). The cell suspension was homogenised by 20 passages through a badl-beaR1ng homogeniser (7.87 x 10-^ cm clearance), then claR1fied by centrtfugation (400 x g, 10 min), the pellet once re-homogenised and centrlfuged. and the supematants combined (final vol = 20 ml). Solutions (v/v) of 13% and 31% OptiPrep^" (Nycoraed) were prepared by dilution with Homogenisation Medium, and 6 x 10 ml continous gradients (31%-13% OptiPrep) poured (Auto Densi-Flow II, Haakebuchler) into Ultra-Clear tubes (Beckman). Pelleted mateR1al was over-layered or under-layered, then ultracentR1fuged (SW40 Tl/160,000 x g/16 h/4C). Fractions with R1 of 1.363-1.368, containing highest puR1ty secretory granules, were collected, whereas mitochondR1a and lysosomes were isolated to fractions with Rl > 1.371. IntegR1ty of granule preparations was monitored using radioimmunoassays for insulin (crystalline granule core), amylin (granule matR1x); puR1ty by functional assays for aryl sulphatase (lysosomes) and citrate synthase (mitochondR1a); and total protein content using Bicinchoninic acid (Pierce),
RP-HPLC
Granule proteins were puR1fied in two sequential RP-HPLC runs (A: 0.08% TEA v/v; B: 80% acetonitR1le with 20% A; Applied Biosystems 140B/785A/112A system; Jupiter C18 RP column,250 x 2.0 mm (Phenomonex); 250-300 1/min; Aai4). Secretory granule mateR1al was initially centR1fuged (16,000 x g, 20 min) before loading. An initial 15 min isocratic step was employed, and sequential 30s fractions collected from 19 min post-injection. Sligtly different gradients were used sequentually to puR1fy proteins; the first semi-puR1fied granule proteins, whereas the second was slightly flatter, to increase resolution and puR1ty.
Peptide sequence analysis
PuR1fied peptides were identified by N-termlnal sequence determination (automated Eklman method; ABl Procisetm combined with accurate mass determination by MALDI-TOF MS. For complete sequence veR1fication, puR1fied mouse preptin isolates were cleaved using Lys-C (BoehR1nger Mannheim), and the resulting peptide fragments repuR1fled by RP-HPLC.
MALDI-TOF mass spectrometry
Peptide molecule weights were determined by MALDI-TOF MS (Hewlett-Packard
G2025A; 337 nm-emission nitrogen laser/150 μJ maximum output/3 ns

pulsewidth/30 kV ion acceleration potential) fitted with a 500 MHz digital oscilloscope (G2030AA, LeCroy) using an a-CHC matR1x with recombinant human insulin (Novo Nordisk; M + H*. 5808.66 Da; M + 2H+, 2904.83) and somatostaUn (Bachem; M + H+, 1638.91. M + Na+, 1660.90) mass standards. MS was performed under high vacuum ( Chemical synthesis of Tot prepUn
The sequences of rat and human preptin were determined by compaR1son with known predicted IGF-II sequences. Rat preptin was chemically synthesised (Auspep Pty, Australia), according to the predicted sequence, using Fmoc chemistry on an Advanced Chem Tech 396 Robotics Peptide Synthesiser starting with FmocLeu-Wang resin. The peptide was deprotected and cleaved from the resin Awith a solution of 92.5% TFA: 2.5% water:2.5% tR1isopropylsilane: 2.5% dithiothreitol for 3 h. The peptide was precipitated from the TFA solution by addition of diisopropyl ether and the precipitate dissolved in 30% acetonitR1le: water, lyophilised, and puR1fied by RP-HPLC. PuR1ty was confirmed as >99% by analjrtical RP-HPLC (rat preptin eluted at 47%B), while MALDI-TOF MS validated the mass as 3932.4 Da + 0.026%.
Preptin radioimmunoassay
Synthetic rat preptin was conjugated to the carR1er, ovalbumin, using the single step glutaraldehyde method at pH 7.0, then used to raise polyclonal antisera in NZW rabbits. Preptin was wsi-radiolabelled using the chloramine-T method, and p25iipreptin (362 nCi/fig) puR1fied by Sephadex G-10 chromatography (50 mM phosphate buffer, pH 7,5). An optimised R1A for preptin was then developed, with B/F separation by the PEG-assisted second antibody (goat-einti-rabbit method). This employed a final dilution of antiserum at 1: 10,000 (final assay dilution 1: 30.000) at an R/T value of 0:30; tracer at 8,000 cpm/tube; incubation times of 24h + 72h; and had an EX:;2o value of 344 pM preptin; ECso of 39 pM; minimum detectable concentration of 11.2 + 9.8 pM; and zero cross-reactivity with rodent (rat/mouse) insulins and amylin.
Cellular preptin secretion
Preptin secretion was studied in PTC6-F7 cells (passage #52), cultured otherwise as
above in 24-well plates at 4 x 10^ cells per well. Preptin stimulation was performed

after 3 d growth, at 80% confluence. Cells were washed twice in HEPES-buffered KRB before commencement of secretion studies, then prelncubated for 1 h In 1 ml/well incubation buffer (0 mM glucose; 0.1% w/w Fraction V BSA (Sigma) dissolved in HEPES-KRB) 500 μl/well was then removed, and replaced with an equivalent volume of fresh incubation buffer containing vaR1ous concentrations of glucose. After 2 h incubation (37°C), incubation medium was removed, cells washed thR1ce with PBS, then lysed with lysis buffer. Incubation supematants and cell lysates were then assayed for insulin and preptin contents using the descR1bed R1As. In separate expeR1ments, time-dependent hormone secretion was also determined.
Charactensation of secreted preptm-Uke immunoreactive mateR1al (PLIM) Since preptin is a cleavage product of the E-peptide of IGF-II, and other cleavage products from a similar region have been isolated from serum in the past (Hylka (1985); Daughaday (1992); Liu (1993)), quantitation by preptin R1A was insufficient to characteR1se the nature of the secreted and circulating peptide. A combined RP-HPLC/preptin R1A method was therefore developed to further characteR1se PLIM.2 ml aliquots of separated plasma from a human donor, and PTC6-F7 conditioned medium, were acidified with 0.1 ml of 4M acetic acid and applied to a C-18 Sep Pak (Waters, I ml volume) which had been pre-equilibrated with 10 ml of 100% methanol and 20 ml of 4% (v/v) acetic acid. The Sep Pak was washed with 20 ml of 4% acetic acid, before bound components were eluted with 2 ml of 0.1 M acetic acid in 70% methanol, and the final volume of eluate reduced to 150 nl by rotary evaporation. Eluates were then subjected to RP-HPLC as above, and corresponding fractions combined from multiple runs. Fractions likely to contain preptin and insulin were subjected to MALDI-TOF MS. All fractions were then made up to a volume of 350 fil with preptin assay buffer, then analysed by preptin and insulin R1As. In order to compare profiles of immunoreactivety of these secreted products with the intragranular profile (Figure lb). 10 ^1 samples from the initial RP-HPLC granule fractions were diluted to a final volume of 610 ^1 with preptin R1A buffer, and also assayed for insulin and preptin.
Rate of carbohydrate Tnetabolism in isolated rat skeletal muscle
The p-cell hormones amylin and insulin modulate carbohydrate utilisation in peR1pheral tissues, including skeletal muscle. The ability of preptin to alter glucose uptake and incorporation into muscle glycogen was investigated using isolated incubated stR1pped soleus muscle as a model tissue. All animal methods -were carR1ed out with appropR1ate permission from the Institutional Animal Ethics

Committee. Male Wistar rats (200 + 20 g) were housed in controlled conditions {20oC. 12 h light/dark cycle) and fed standard rat chow (Diet 86. NRM Tegel. Auckland) and water ad libitum. 18-h fasted rats were anaesthetised (45 mg/kg Pentobarbitone sodium) then sacR1ficed by cervical dislocation, and soleus mucles dissected under carboxygenated-KHB {02:C0295: 5 v/v), then Incubated in nDMEM supplemented with vaR1ous concentrations of insulin and preptin. Muscles were teased longitudinally into 3 equal stR1ps with a final radius of approximate^ 1.5 mm [(U)>*CI D(+)-glucose (1 mCi/ml, Amersham) was diluted 1: 20 (v/v) in 70% ethanol to yield a final concentration of 0.5 nCl/10 μl. Actrapid® Recombinant Human Insulin (100 U/ml, Novo Nordisk) was diluted 1/1000 in 10 ml nDMEM. 60 ng rat preptin was dissolved in 1526 jil of nDMEM to a concentration of 10 nM, then further diluted in nDMEM to give stock solutions of 1 jiM, 100 nM, 10 nM, 100 pM and 1 pM. Two different expeR1mental paradigms were employed to determine whether preptin (i) stimulated the rate of glucose incorporation into glycogen, or (u) acted as an antagonist of insulin-evoked glucose incorporation into glycogen.
Preptin antagonist incubation protocol
Four muscle stR1ps were transferred into each of 9 flasks, which contained 10 ml of carboxygenated nDMEM. 0 (control) or maximally-effective insulin (23.7 nM). and vaR1ous concentrations of preptin (10 fM. 100 fM, 1 pM, 0, 10 pM, 100 pM, 1 nM or 10 nM). Flasks were then equilibrated in a shaking water bath (30°C, 20 min), following which 10 ^1 of (0.5 ^Ci) D-I(U)>4C] glucose was added, at stR1ct 1.5 min intervals. Muscle stR1ps were then incubated for 120 min at 30°C under carbogen. After incubation, stR1ps were removed from each flask at 1.5 min intervals, and blotted dry. They were then snap-frozen in liquid Na. freeze-dR1ed for 24 h in pre-weighed tubes, then stR1p dry-weights determined. Muscle stR1ps were then solubilised in 250 ^1 or 60% KOH. incubated at 70°C for 45 min. then cooled before overnight precipitation at -20OC with ice-cold ethanol. Glycogen pellets were then prepared by centR1fugation O.OOOxg, 15 min, 0C), pellets resuspended, and re-precipltated twice, before the supernatant was finally aspirated and glycogen pellets over-dR1ed at 70C for 2 h. incorporation of "^C was then determined by scintillation counting.
Preptin agonist protocol
All methods were as descR1bed above, except that stR1ps were incubated in the absence of insulin (except for the positive control, at 23.7 nM) and final preptin concentrations of 0. 0.1, 1, 10 and 100 nM.

Effect qfpreptin on insulin secretion
Insulin and amylin are known to modulate p-cell insulin secretion via presumed autocR1ne mechanisms. The effect of preptin on insulin secretion was therefore tested using a p-cell secretagogue protocol PTC6-F7 cells were subcultured at passage #52 into 24-well plates at 4 x lO5 cells/well. They were grown for 3d in nDMEM to 80% confluence, then washed twice with KRB-HEPES. Stock preptin was seR1ally dUuted in incubation medium containing 10 mM D{+) glucose to yield final concentrations of 150, 75, 25, 5, 1 and 0.1 nM. Cells were then washed, and 1 ml/well of incubation medium containing 10 mM and vaR1ous final preptin concentrations was added to each well. Cells were incubated at 37°C for 2 h, then medium removed. Cells were washed thR1ce with PBS, then lysed with 500 ^1 of lysis buffer. Incubation medium was centR1fuged (16,000 x g, 3 min) and the supernatant separated from pelleted debR1s. Incubation medium and lysates were then analysed for insulin, preptin and protein as above.
Results
The results of the above are shown in Figures 1, 2 and 3.
Discussion
Mouse preptin is a 34 amino acid peptide which corresponds to Aspeg-Leuioa of muR1ne proIGF-II E-peptide.
Preptin was present in granules at 1:8 the content of insulin, but 2:1 that of amylin (mol/mol), as determined by integration of RP-HPIXi peak-jireas. Preptin is flanked NH2-terminaUy by a recognised Arg cleavage site, and COOH-terminally by a putative dibasic (Arg-Arg) cleavage motif (Bell (1984)) (Figure le). These residues likely serve as post-translational processing signals, and are highly conserved between species. Many prohormone precursors incorporate more than one hormone with differential proteolytic processing often being tissue specific (Martinez (1989)). The above results indicated that proIGF-II is a prohormone with more than one peptide-hormone product.
IGF-II is a member of the insulin family that regulates ceU growth, differentiation and metabolism (De Chiara et al (1990). It is a single polypeptide chain deR1ved from the

BCA and D domains of proIGF-II (see Figure le) and is widely synthesised in fetal and adult tissues. Insulin expression, on the other hand, is almost completely confined to p-cells. In mammalian genomes, the IGF-II gene is contiguous with those of insulin (Bell (1985)) and recent studies in humans have identified a VNTR polymorphism upstream of the INS and IGF-II genes, which may contR1bute to differential regulation of both genes (Ong (1999)).
The preptin radioimmunoassay (R1A) (Figure 2a) and reanalysis of the granule puR1fication profiles of Figures la with the preptin R1A showed that preptin co-purlfied with insulin and amylin, confirming that it was Indeed a granule component. Preptin-bke immunoreactive mateR1al (PUM) was characteR1sed by RP-HPLC/R1A in puR1fied granules and in PTC6-F7 conditioned medium. The major form of both intra-granular and extracellular PUM co-eluted on RP-HPLC (Figure 2b). Mass spectrometry of HPLC-puR1fied mateR1al corresponding to the PLIM peak from PTC6-F7 cells showed the presence of a single species, with molecular mass identical to that of muR1ne preptin (Figure 2c). RP-HPLC also demonstrated that the major form of PLIM from human and rat plasma co-eluted with intragranular muR1ne preptin. Preptin was co-secreted with insulin from pTC6-F7 cells in response to glucose-stimulation (Figure 2d), reaching maximal levels at 1-mM or greater.
These results confirm that preptin is synthesised in islet p-cells and packaged in secretory granules. Further, it is co-secreted with insulin in a glucose-dependent manner.
There is evidence that insulin secretion may be modulated by islet p-cell hormones, including insulin (Kulkami (1999); Elahi (1982); Argoud (1987)). amylin (Waggoner et al (1993); Silvestre (1996); Degano et al (1993)). and pancreastatin fTatemoto (1986)). These are thought to act through autocR1ne negative-feedback loops, mediated via binding to specific cell-svuface receptors. The effects of preptin on insulin secretion were therefore investigated. The results obtained showed that synthetic rat preptin enhanced the glucose (lO-mM)-stimulated secretion of insulin from cultured PTC6-F7 cells, in a manner that was both concentration-dependent and saturable (Figure 3a). Significant effects of preptin compared to controls (0 added preptin) were detected at concentrations of 0.1-nM and greater, and reached maximal at 75-nM. This concentration is equivalent to that at which amylin elicits inhibition of insulin secretion (Degano et al (1993)). These preptin concentrations are similar to those secreted finra pTC6-F7 cells (Figure 2d), and are thus likely to occur adjacent to p-

cell membranes in situ in physiological islets. This demonstration of concentration-dependent and saturable stimulation of insulin secretion by preptin suggests that it elicits these effects by binding to a cell surface receptor.
The effect of Infused synthetic rat preptin on glucose (20-mM)-stimulated insulin secretion in the isolated-perused rat pancrease (Figure 3b) was measured employing a maximally-effective preptin concentration (75-nM). Preptin significantly enhanced (by 30%; p = 0.03, 2-tailed t-test of areas-under-curve) the second phase of insulin secretion, compared with control values (0-added preptin) (Figure 3b). These findings are consistent with those obtained from PTC6-F7 cells (Figure 3a). They suggest that preptin is a physiological regulator of insulin secretion, which acts in a newly recognised feed-forward autocR1ne loop to enhance glucose-stimulated insulin secretion, and may function to counterbalance the inhlbitoiy effects of other p-cell hormones on insulin secretion.
It is therefore the applicants view that preptin acts to recruit, pR1me and co-ordinate the glucose-responsive activity of p-cells in a local manner, amplifying the glucose-evoked signal to the p-cell organ. This action would be similar to the feed-forward mechanism effected in platelets by the thrombin-elicited release of thromboxane A2 (Banntt(1992)).
The existence of a previously unsuspected mechanism, through which a new islet p-cell hormone amplifies glucose-mediated insulin secretion, suggests that preptin biology will be important in type 2 diabetes mellitus, which is characteR1sed by a complex impairment of insvUin secretion (De Fronzo et cd (1992)). A defect in preptin synthesis, secretion, or action could contR1bute to the defective glucose-mediated insulin secretion in this condition and preptin administration may be advantageous for the treatment of type 2 diabetes melUtus or other disorders associated with diminished p-cell insulin secretion. It is noted that, in humans, the vaR1able number of tandem repeat (VNTR) polymorphism upstream of the adjacent insulin (INS) and IGF-II genes regulates expression of both genes, and is associated with an increased tendency to both type 2 diabetes mellitus and polycystic ovaiy syndrome.
Section B

Preptin is co-packaged with insulin in islet tissue
To study preptin physiology, immunohistochemical studies were performed in normal muR1ne pancreas using a preptin-specific antiserum. Synthetic rat preptin, prepared as above, (Auspep Pty Ltd) was conjugated to ovalbumin using the single-step gluteraldehyde method at pH 7.0 (Harlow and Lane). New Zealand white rabbits were used to raise polyclonal antisera against the rat preptin conjugate.
SeR1al sections from normal adult mouse (FVB/n) pancreas were stained with haematoxylin and sjieclfic anti-preptin or anti-insulin antisera, all at fmal dilutions of 1:40 (v/v), and with goat-anti-rabbit immunoperoxidase-labelled second antibody. Preptin (1 or 5 mg.ml-") was pre-incubated with anti-preptin antiserum for 30 min before addition to sections to demonstrate the specificity of preptin immunostaining.
Preptin-like immunoreactive mateR1al (PLIM) and insulin-like immunoreactive mateR1al were co-localised in islet p-cells (Figs. 4a,b). Competition studies showed that PLlM-staining was suppressed by pre-incubating preptin antiserum with synthetic preptin in a concentration dependent manner (Figs. 4b-d). These studies suggest that preptin is present in physiological pancreatic islet p-cells.
PUM is present in normal islet tissue
To establish the identity of PLIM in normal islet tissue, we performed RP-HPLC/R1A of acid ethanol extracts from isolated rat islets. Pancreatic islets were isolated from normal adult male Wistar rats, and the contents extracted with acid ethanol according to a modification of published methods (Wollheim and Sharp (1981), Romanus (1988)).
The results are shown in Figure 5.
Although preptin levels were much lower than in PTC6-F7 cells, the major peak of PLIM co-eluted with intra-granular preptin, indicating that preptin is the dominant physiological component of PLIM in normal islets {Fig. 5). These data confirm that the preptin puR1fied from the PTC6-F7 cells was not simply an artefact resulting from proteolysis duR1ng puR1fication, but exists and is secreted in this form from both PTC6-F7 cells and normal rat islets.

Prepiin is co-secreted with insulin in response to glucose stinudation. Given the co-localisation of preptin and insulin within the βcell secretory granule, expeR1ments were undertaken to determine whether preptin and insulin are co-secreted in a regulated manner. Glucose-stimulated peptide secretion was studied according to published methods using both PTC6-F7 cells (Efrat et al (1993), Knaack et at (1994)) and isolated rat islets (Gotoh etcd(1987)), and concentrations of preptin and insulin were measured using specific R1As.
The results are shown in Figure 6. These indicated that while PTC6-F7 cells were responding to sub-physiological concentrations of glucose ( Removal of endogenous preptin significantly decreases insulin secretion from the isolated-perfused rat pancreas.
To determine the role that endogenous pancreatic preptin might play in insulin secretion, the action of endogenous preptin was removed by infusing anti-preptin antibodies into the isolated perfused pancreas model as follows:
Pancreases were perfused with KHB supplemented with 4% dextran, 0.5% BSA, 3 mM-arginine and 5.5 mM glucose (final concentrations). Perfusate was gassed with a mixture of 95% 02/5% CO2 and infused by peR1staltic pump at 2.7 ml.min-" without re-circulation. Pancreases were perfused and equilibrated for 20-min pR1or to each 70-min perfusion. 10-min into the expeR1ment either antl-prepUn y-globulin or non¬immune rabbit 7-globulln were introduced via a side-arm infusion (final Y-globulin concentration in perfusate: 35 ng.ml" in carR1er buffer (0.1% BSA in 0.9% NaCl). In addition, at 25-min, glucose was infused for 20-min (measured final concentration in perfusate: 20 mM). Continuous 1-min fractions were collected on ice and assayed for insulin (R1A).

Rabbit anti-rat preptin 7-globulln or control (non-immune rabbit) y-globulin were puR1fied by Protein A affinity chromatography (Pharmacia-Biotech, Hi-Trap Protein A Tech. Rep. (Wikstroms. Sweden (1999)) to diminish the potential influence from other serum constituents. The compositions of the two different y-globulln fractions were confirmed by MALDI-TOF MS (Fig. 7a.b). and the binding capacities of the two different 7-globulln fractions were determined under conditions simulating the antibody perfusion expeR1ments as above. The maximal amount of preptin completely bound by anti-preptin 7-globulin under the perfused pancreas exjieR1mental conditions was 20 ng/min (Fig. 7c).
Isolated perfused pancreases were infused with anti-preptin or control y-globulin and subjected to square-wave stimulation by 20 mM glucose (Fig. 7d). Secretion of insulin in both the first and second phase was significantly decreased by anti-prepUn 7-globulin (first phase: average 29% inhibition compared to controls, P = 0.02, 1-tailed t-test; second phase: average 26% inhibition compared to controls. P=0.03, 1-tailed t-test of AUC). In this expeR1ment we have shown that removal of endogenous circulating preptin causes a significant decrease in glucose-mediated insulin secretion. This result is all the more interesting given that preptin has been estimated to be present in relatively low concentrations in the physiological islet (approximately 500x less than insulin) and yet still has the ability to exert a significant effect on insulin secretion. These expeR1ments are consistent with the premise that physiological concentrations of paincreatic preptin play an autocR1ne role to increase glucose-mediated insulin secretion. This action may be similar to the feed-forward mechanism evoked in platelets by the thrombin-elicited release of thromboxane A2 (BarR1t (1992)).
Overall Conclusion
In summary, preptin is a previously unknown, pancreatic islet p-cell hormone. It is produced from the E-peptide of pro-IGF-II, is present in islet p-cell granules in significant amounts. Is co-secreted with insulin in a regulated manner, enhances glucose-stimulated insulin secretion, and may act in a feed-forward autocR1ne loop, probably via binding to a p-cell surface receptor.

INDUSTR1AL APPLICATION
As descR1bed above, the present invention provides preptin (including in its human, rat and mouse forms) and analogs of preptin. Preptin and its analogs play a physiological role in the stimulation of glucose evoked insulin secretion.
The invention therefore also provides methods by which glucose-evoked insulin secretion can be modulated. Such modulation will usually involve administration of preptin and its analogs as descR1bed above. However, modulation can also be achieved by use of preptin agonists and antagonists.
A preptin agonist is a compound which promotes or potentiates the effect of preptin on insulin secretion. In contrast, a preptin antagonist is a compound which competes with preptin or otherwise interacts with preptin to block or reduce the effect of preptin on insulin secretion.
Preptin agonists and preptin antagonists can be identified by assay systerns which measure the effect preptin has on insulin secretion in the presence and absence of a test compound. For example, the assay systems descR1bed in the expeR1mental section herein can be used.
Where it is desired that a preptin agonist or preptin antagonist be employed in modulating insulin secretion, the agonist/antagonist can be administered as a pure compovmd or formulated as a pharmaceutical composition as descR1bed above for preptin.
Also provided herein are immunological reagents which bind preptin. Such reagents (which can be polyclonal antibodies) can be generated using art standard techniques, including those descR1bed in the expeR1mental section.
Monoclonal antibodies can also be provided. Such antibodies will typically be made by standard procedures as descR1bed, eg. in Harlow and Lane 1988. BR1efly, appropR1ate animals are selected and the desired immunisation protocol followed. After the appropR1ate peR1od of time, the spleens of such animals are excised and individual spleen cells fused, typically, to immortalised myeloma cells under appropR1ate selection conditions. Thereafter, the cells are clonally separated and the supematants of each clone tested for the production of an appropR1ate antibody specific for the desired region of the immunising antigen.

)ther suitable techniques for prepguing antibodies involve in vitro exposure of pymphocytes to the antigen or alternatively, to selection of libraR1es of antibodies in )hage or similar vectors. See, for example Huse et al 1989.
Use, recombinant antibodies may be produced using procedures known in the art. see, for example, US Patent 4,816,567.
rhe antibodies may be used with or vvR1thout modification. Frequently, antibodies will De labelled by joining, either covalently or non-covalently a substance which provides a detectable signal. A wide vaR1ety of labels and conjugation techniques are known and are reported extensively in the literature.
Antibodies as above to preptin can therefore be used to monitor the presence of preptin in a patient or in preptin quantification assays. In such assays, any convenient immunological format can be employed. Such formats include immunohistochemical assays, R1A, IRMA and ELISA assays.
The assays can be conducted in relation to any biological fluid which does, or should, contain preptin. Such fluids include blood, serum, plasma, uR1ne and cerebrospinal fluid.
The antibodies can also be included in assay kits. Such kits can contain, in addition, a number of optional but conventional components, the selection of which willl be routine to the art skilled worker. Such additional components will however generally include a preptin reference standard, which may be preptin itself or an analog (such as a fragment).
It will also be appreciated that antibodies such as descR1bed above can, if some circumstances, also function as preptin antagonists by binding to preptin and partly or completely interfeR1ng with preptin activity.
As alluded to above, the applicants findings in respect of preptin also have diagnostic Implications. For example, individuals whose preptin production is less than is required in order to elicit insulin secretion at appropR1ate levels, or who produce preptin in a less active or inactive (mutant) form will require therapeutic intervention. Diagnostic or prognostic methods are therefore within the scope of the invention.

In one specific embodiment, a diagnostic or prognostic method will involve detection of mutations in the gene coding for preptin and/or the preptln secretory mechanism. Detection can occur using any one of a number of art standard techniques including Single Stranded Confirmation Analysis (OR1ta et al (1989)) or the Amplification Refractory Mutation System (ARMS) as disclosed in European Patent Application Publication No 0 332 435.
If a mutation is detected, corrective approaches become possible. These include but are not limited to gene therapy. Again, art standard techniques will be employed.
Other implications and applications of the applicants identification of preptin will be apparent to those persons skilled in the art, who will appreciate that the above descR1ption is provided by way of example only and that the invention is not limited thereto.

RBPERBNCBS
Draznin. B. and LeRoith. D. (eds). Molecular biology of diabetes II. Insulin action, effects on gene expression and regulation, and glucose transport (Humana Press Inc., New Jersey (1994)).
cooper, G. Endocr. Rev. 15, 163-201 (1994).
Waggoner, P., Chen. C, Worley. J., Dukes, I. and Oxford, G. Proc. Natn. Acad. ScL, USA, 90, 9145-9149 (1993).
Hettiarachchi, M., etoL Am J. PhysioL 273. E859-E867 (1997).
Hutton, J. Diabetologia 12, 271-281 (1989).
Efrat, S. et oL Diabetes. 42. 901-907 (1993).
Knaack, D. etaL Diabetes. 43, 1413-1417 (1994).
Linde, S. etaL J. Chromatgr. 4642. 243-254 (1989).
Johnson, K.,etaL Am. J. PathoL 130. 1-8 (1988).
Bell, G. 1., etoL Nature. 310,775-777(1984).
Martinez. J. (ed) Peptide hormones prohormones; processing, biological activity, pharmacology (ElUs Horwood Ltd, Chichester, 1989).
DeChiara. T., Efstradiadis, A. and Robertson, E. Nature 345. 78-89 (1990).
Kulkami, R. etal. CeU 96, 329-339 (1999).
Elahi, D. et aL N. Eng. J. Me± 306. 1196-1202 (1982).
Argoud, G., Schade. D. and Eaton. R. Diabetes 36, 959-962 (1987).
Silvestre, R. et aL Br. J. Pharmacol 117, 347-350 (1996).

Degano, P.. Silvestre, R, Salas, M. and Peiro, E. ReguL Pep. 43, 91-96 (1993).
Tatemoto, K. etaL Nature 324. 476-478 (1986).
BarR1tt, G. Communication within animal cells. (Oxford University Press. Oxford. 1992).
DeFronzo, R., Bonadonna. R. and Ferrannini. E. Diabetes Care 15, 318-368 (1992).
Hutton, J., Penn, E. and PeshavaR1a, M. Diabetologia2, 365-373 (1982).
Grodsky, G. and Fanska, R. Methods EnzymoL 39. 364-372 (1975).
Stempien. M., Fong, N., Rail. L. and Bell. G. DNA, 5. 357-361 (1986).
Dull. T.. Gray. A. Hayflick. J. and UllR1ch. A. Nature 310, 777-780 (1984).
Harlow and Lane (1988). Antibodies: A Laboratory Manual. (Cold SpR1ng Harbour Laboratory. Cold SpR1ng Harbour. New York).
Huse etaL (1989). Science246: 1275-1281.
OR1ta etal (1989). Proc. NatL Set. USA. 86: 276-277.
Hylka. V.. Teplow. D.. Kent, S. and Strauss. D. J. BioL Chem. 260. 14417-14420 (1985).
Daughaday, W. and TR1vedi, B. J. Clin. EndocR1noL Metab. 75. 641-645 (1992).
Liu. F.. Baker, B., Powell, D. and Hintz, R. J. Clin. EndocR1noL MetaboL 76, 1095-1100(1993).
Bell, G., Gerhard, D., Fong, N., Sanchez-Pescador, R. and Rail, L. Proc. NatL Acad. Set USA 82. 6450-6454 (1985).
Ong, K. etaL NaL Genet 21, 262-263 (1999).

WE CLAIM:
1. A bioactive peptide, the amino acid sequence of which is as follows:
Asp Val Ser Thr Rj R2 R3 Val Leu Pro Asp R4 Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe R5 R6 Asp Thr Trp R7 Gln Ser R8 R9 Arg Leu wherein:
R1 is Ser or: Pro;
R2 is Gln or Pro;
R3 is Ala or Thr;
R4 is Asp or Asn;
R5 is Gln or Lys;
R6 is Tyr or Phe;
R7 is Arg or Lys;
R8 is Ala or Thr; and
R9 is Gly or Gln, [SEQ ID NO. 1] or an analog thereof
2. The bioactive peptide according to claim 1 having the amino acid sequence of
human preptin which is as follows:
Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Set Thr Gln Arg Leu [SEQ ID N0.3], or an analog thereof
3. The bioactive peptide according to claim 1 having the amino acid sequence of
rat preptin which is as follows:
Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val
Gly R1. R2 R3 R4
Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu [SEQ ID
N0.5], R5 R6. R7 R8 R9^
or an analog thereof.

4. The bioactive peptide according to claim 1 having the amino acid sequence of
mouse preptin which is as follows:
Asp Val SerThr Ser Gln AlaVal Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu [SEQ ID
N0.7))
or an analog thereof
5. A preptin analog as defined in anyone of claims 1 to 4 wherein said analog is a mammalian analog.
6. A preptin analog which includes from 6 to 33 amino acids from a sequence as claimed in anyone of claims I to 4, and which retains preptin functionality.
7. A preptin analog which is, or includes, a hexapeptide, a heptapeptide, an octapeptide, a nonapeptide or a decapeptide derived from human preptin or an analog thereof as claimed in claim 2.
8. A peptide selected from human preptin having the amino acid sequence:
Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu, or an analog thereof, wherein said analog retains preptin functionality, and wherein said analog is selected from the following: (i) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Set Thr Gln Arg; (ii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln; (iii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr;

(iv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser; (v) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln; (vi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys; (vii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr Trp; (vii!) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp Thr; (ix) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val
Gly Lys Phe Phe Gln Tyr Asp; (x) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly
Lys Phe Phe Gln Tyr; (xl) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys
Phe Phe Gln; (xii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys
Phe Phe; (xiii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys
Phe; (xiv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly
Lys; (xv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly; (xvi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val; (xvii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro; (xviii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro ASp Asn Phe Pro Arg Tyr; (xix) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg; (xx) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro; (xxi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe; (xxii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn; (xxiii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp; (xxiv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro; (xxv) Asp Val Ser Thr Pro Pro Thr Val Leu;

(xxvi) Asp Val Ser Thr Pro Pro Thr Val; (xxvii) Asp Val Ser Thr Pro Pro Thr; and (xxviii) Asp Val Ser Thr Pro Pro.
9. A polynucleotide which encodes a peptide, a preptin, or an analog or fragment thereof as defined in anyone of claims 1 to 8.
10. A polynucleotide which encodes preptin or an analog thereof as defined in anyone of claims 1 to 9.
11. A polynucleotide which encodes human preptin and which comprises the following nucleotide sequence:
gacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttcttccaatatga cacctggaagcagtccacccagcgcctg [SEQ ID NO.2].
12. A polynucleotide which encodes rat preptin and which comprises the following
nucleotide sequence:
gacgtgtctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttcaaattcgac acctggagacagtccgcgggacgcctg [SEQ ID NO.4].
13. A polynucleotide which encodes mouse preptin and which comprises the
following nucleotide sequence:
gacgtgctacctctcaggccgtacttccggacgacttccccagataccccgtgggcaagttcttccaatatgac acctggagacagtccgcgggacgcctg [SEQ ID NO.6].
-i.. 14. A vector or cell line which includes a polynucleotide having the nucleotide sequence of any one of claims 10 to 13 and which is capable of expressing a peptide having preptin functionality.

15. A vector or cell line as claimed in claim 14 which includes the nucleotide 3 , ) sequence of claim 11.
16. A pharmaceutical composition which comprises a peptide, a preptin, or an analog thereof as defined in anyone of claims 1 to 8.
17. A dosage form comprising a peptide, a preptin, or an analog thereof as defined, in anyone of claims 1 to 8 in combination with a physiological buffer solution suitable for administration to humans.
18. A dosage form as claimed in claim 17 which is for administration by injection.
19. A dosage form as claimed in claim 17 or claim 18 in which said preptin is human preptin or an analog thereof as defined in anyone of claims 2, 7 and 8.
20. A preparation of a peptide, a preptin, or an analog thereof as claimed in anyone of claims 1 to 8 in which said preptin, or analog is present in an amount of at least 50% by weight,
21. A preparation as claimed in claim 20 in which said peptide, preptin or analog thereof is at least 80% by weight of said preparation.
22. A preparation as claimed in claim 20 in which said peptide, preptin, or analog thereof is at least 90%) by weight of said preparation.
23. A preparation as claimed in claim 20 in which said peptide, preptin, or analog thereof is at least 95% by weight of said preparation.
24. A preparation as claimed in claim 20 in which said peptide, preptin, or analog thereof is at least 99%) by weight of said preparation.

25. A preparation as claimed in claim 20 in which said peptide, preptin, or analog is pure.
26. A preparation as claimed in claim 20 in which said preptin or analog is human preptin or an analog thereof.
27. A salt of a peptide, a preptin, or an analog thereof as claimed in anyone of claims 1 to 8.
28. A salt as claimed in claim 27 which is a physiologically acceptable sah
29. A salt as claimed in claim 28 in which said peptide, preptin, or analog thereof is formed by combination with anions of an organic acid.
30. A salt as claimed in claim 29 in which said salt is selected from malate, acetate, propionate, butyrate, oxaloacetate, citrate, isocitrate, a-ketoglutarate, succinate, fumarate and trifluoroacetate salts.
31. A pharmaceutical composition which includes a salt as defined in any one of claims 28 to 30.
32. Antibodies which bind a peptide, a preptin, or an analog thereof as defined in any one of claims 1 to 8.
33. A monoclonal antibody which binds a peptide, a preptin, or an analog thereof as claimed in anyone of claims 1 to 8.
34. A monoclonal antibody which binds human preptin or an analog thereof as claimed in anyone of claims 2, 7 and 8.

35. An in vitro immunological assay which employs an antibody as claimed in any one of claims 32 to 34.
36. An assay as claimed claim 35 in which the presence of preptin is quantitatively measured in a biological fluid.
37. An assay as claimed in claim 36 in which the biological fluid is blood, serum, plasma, urine or cerebrospinal fluid.
38. An in vitro immunological assay which employs an antibody as claimed in anyone of claims 32 to 34 and which is a RIA, IRMA or ELISA.
39. An assay kit which includes an antibody as claimed in anyone of claims 32 to 34.
40. An assay kit as claimed in claim 39 which comprises an antibody as defined in anyone of Claim32 to 34 and a preptin reference standard.
41. An assay kit as claimed in claim 40 in which said reference standard is preptin or an analog thereof as defined in anyone of claims 1 to 8.
42. A method of identifying a preptin agonist which comprises the steps of: testing the degree of insulin secretion induced by a pre-determined concentration of the peptide or analog as claimed in anyone of claims 1 to 8 in the presence and absence of a candidate agonist; and
identifying as an agonist any compound which effects an increase in preptin-mediated insulin secretion.

43. A method of identifying a preptin antagonist which comprises the steps of: testing the degree of insulin secretion induced by a pre-determined concentration of the peptide or analog as claimed in anyone of claims 1 to 8 in the presence and absence of a candidate antagonist; and identifying as an antagonist any compound which effects a decrease in preptin-mediated insulin secretion.

Documents:

in-pct-2001-1742-che abstract.pdf

in-pct-2001-1742-che claims-duplicate.pdf

in-pct-2001-1742-che claims.pdf

in-pct-2001-1742-che correspondence-others.pdf

in-pct-2001-1742-che correspondence-po.pdf

in-pct-2001-1742-che description(complete)-duplicate.pdf

in-pct-2001-1742-che description(complete).pdf

in-pct-2001-1742-che drawings-duplicate.pdf

in-pct-2001-1742-che drawings.pdf

in-pct-2001-1742-che form-1.pdf

in-pct-2001-1742-che form-19.pdf

in-pct-2001-1742-che form-26.pdf

in-pct-2001-1742-che form-3.pdf

in-pct-2001-1742-che form-4.pdf

in-pct-2001-1742-che form-5.pdf

in-pct-2001-1742-che form-6.pdf

in-pct-2001-1742-che pct search report.pdf

in-pct-2001-1742-che pct.pdf

in-pct-2001-1742-che petition.pdf

« Previous Patent

Next Patent »

Patent Number

215971

Indian Patent Application Number

IN/PCT/2001/1742/CHE

PG Journal Number

13/2008

Publication Date

31-Mar-2008

Grant Date

05-Mar-2008

Date of Filing

11-Dec-2001

Name of Patentee

PROTEMIX DISCOVERY LIMITED

Applicant Address

28, 151 QUEEN STREET, ACKLAND,

Inventors:

#	Inventor's Name	Inventor's Address
1	COOPER, Garth, James, Smith	7 Marine Parade, Herne Bay, Auckland,
2	BUCHANAN, Christina, Maree	92 Hadfield Street, Birkenhead, Auckland,

PCT International Classification Number

C07K 14/47

PCT International Application Number

PCT/NZ00/00102

PCT International Filing date

2000-06-19

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1	NZ 336359	1999-06-18	New Zealand