Title of Invention	"AN IMPROVED PROCESS FOR SIMULTANEOUS PREPARATION OF SEX SPECIFIC AND GENDER NEUTRAL SEMISYNTHETIC AMPLICONS USEFUL FOR SEX DETERMINATION"
Abstract	An improved process of preparation of sex specific and gender neutral semisynthetic amplicons useful for sex determination, which comprises, isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis mthod, eluting the sex specific, double stranded, amplified product form the gel piece by known methods, synthesizing the single stranded chanins of synthetic oligonucleotides from the said double stranded amplified product by known method, amplifying the said single stranded chain of synthetic oligonucleotide in a conventional Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get desired sex specific and gender —neutral semisynthetic amplicons.

Title of Invention

"AN IMPROVED PROCESS FOR SIMULTANEOUS PREPARATION OF SEX SPECIFIC AND GENDER NEUTRAL SEMISYNTHETIC AMPLICONS USEFUL FOR SEX DETERMINATION"

Abstract

An improved process of preparation of sex specific and gender neutral semisynthetic amplicons useful for sex determination, which comprises, isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis mthod, eluting the sex specific, double stranded, amplified product form the gel piece by known methods, synthesizing the single stranded chanins of synthetic oligonucleotides from the said double stranded amplified product by known method, amplifying the said single stranded chain of synthetic oligonucleotide in a conventional Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get desired sex specific and gender —neutral semisynthetic amplicons.

Full Text	This invention relates to an improved process for preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination. This invention particularly relates to an improved process for preparation of sex specific and gender - neutral semisynthetic amplicons useful for sex determination. The invention particularly relates to a process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination of papaya plants. The process involves amplification of nucleic acid of a Polymerase Chain Reaction (PCR) using synthetic oligonucleotide primers. The process of the present invention is more accurate and in an improvement of our copending patent application no. 2447/DEL/97, entitled "A process for preparation of semisynthetic amplicon useful for sex determination of the papaya plant". In an another copending patent application no. 268/DEL/97, a process for preparation of duplex polynucleotide useful for sex determination of papaya plant has been reported. Apart from our own-filed patent applications, there is no prior art available for the identification of sex of dioecious papaya plant. Carica papaya commonly known as papaya, is a native of tropital America. It belongs to the genus Carica, a member of family caricaceae. The plant adopts itself to diverse soil and climatic conditions, and hence is grown extensively in tropical and subtropical areas for its profitable and continuous yield of fruits. The fruits are mostly consumed ripe and are a rich source of vitamins A, B, C and D (Kumar et at, J. Bom Natural His. Society, vol. XV, no. 2, Dec 43, 252-256). Thin , milky latex is extracted out of young green fruits . This latex contains a high percentage of papain which is one of the most valuable of plant proteolytic enzymes. Papain is of interest to many industries among which food industry is one of the biggest consumers. Papain is used for chillproofing beer, tenderising meat and freeing food proteins. It is used in peptone preparation from meat and milk in bacteriological laboratories, in textile industry for degumming of silk, in dairy industry for cheese preparation, in tanning industry for skin dehairing and bating of hides, in pharmaceutical industry, perfume industry and in effluent treatment. Papain is also used to produce animal feed products and recover animal wastes by digestion of proteins. (Jones et al, Process Biochemistry 9, 1976, 21-24). Papaya plants are propagated through seeds. The seeds are sown in seedbeds and 1-2 months old seedlings are transplanted to the field. 2-3 seedlings are planted in one pit, as the sex of the seedlings is unknown. Plants attain reproductive maturity after 5-8 months. Most of the male plants are then uprooted from the field. This unnecessary cultivation and uprooting leads to wastage of time, money and labour. The dioecious cultivars are preferred for the extraction of papain as the female yields of crude papain exceed that of hermaphrodite and also the proteolytic activity of the crude papain from female fruits is greater than hermaphrodites (Madrigal et al., J. Sci. Food Agri. 1980, 31: 279-285). Breeding programs are initiated with objectives to evolve disease resistant and true breeding papaya varieties with good quality fruits and high papain content. The dioecious nature' poses problems and inconvenience to papaya breeders and growers since it takes 5-8 months to know the sex of the seedling. Unfortunately sex cannot be deduced from external morphology or cytology with embryonic or juvenile forms. If the sex of plants is known at the juvenile stage, it would facilitate screening of the seedlings for female plants saving time and economic resources and thereby helping in the breeding program. The objective of the present invention is to provide an improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination. Another objective of the present invention is to provide a process for simultaneous preparation of sex specific and gender-neutral semisynthetic ampiicons useful for sex determination papaya plants. Another objective of the present invention is to provide a process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination papaya plants at juvenile stage. Accordingly, the present invention provides an improved process for preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination, which comprises, isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double strandes, amplified product from the gel piece by known methods , synthesizing the single stranded chains of synthetic oligonucleotides from the said double stranded amplified product by known method, amplifying the said single stranded chain of synthetic oligonucleotide in a conventional Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get desired sex specific and gender-neutral semisynthetic amplicons. In an embodiment of the present invention, isolation of nucleic acid can be carried out by conventional method such as Roger & Bendich method from any part of a papaya plant such as leaf, root, petiole. In an embodiment of the present invention , the polymerase chain reaction is carried out by using a thermostable DNA polymerase enzyme. In another embodiment of the present invention, the Random Amplification of Polymorphic DNA Polymerase Chain Reaction (RAPD-PCR) may be effected by using one or more single stranded oligonucleotide primers, such as 5-12 mer primers, preferably known decamers. In an another embodiment of the present invention separation of the products of Polymerase Chain Reaction may be effected by conventional electrophoresis method using agarose gel, polyacrylamide gel and mixtures thereof. In an embodiment of the present invention, elution of the sex specific amplification product from the gel piece may be effected by conventional elution methods, such as electroelution, freeze-thaw method. In an embodiment of the present invention, cloning of the sex specific amplified, eluted product may be effected by using a plasmid vector, such as PCR product cloning vector. In a feature of the present invention sequencing of the cloned product is effected by known methods, such as Sanger's chain termination method. In an another embodiment of the present invention the cloned semisynthetic amplicon has the following sequence. (Sequence Removed) In an another embodiment of the present invention, simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons may be effected by conventional Sequence Tagged Site Polymerase Chain Reaction by using synthetic oligonucleotide primers, such as primers spanning the sequence of the said sex specific semisynthetic amplicon and synthetic oligonucleotide primers based on the known sequence data such as chloroplast DNA sequence, mitochondrial DNA sequence and combinations thereof. In a process of the present invention, DNA can be isolated from a variety of tissues including leaf, anther, ovary, seed, stem and root. The choice of tissue depends on many factors, including the quantity of the starting material required and difficulty in isolating DNA from a particular tissue. A variety of techniques for extracting nucleic acids from biological samples are known, for example those described by Sambrook et al, Molecular Cloning -A laboratory manual, Cold Spring Harbor Laboratory, NY (1985) and by Roger & Bendich (Roger et al, 1988, PMB manual A6 1Ed) In a process of this invention oligonucleotide primers can be prepared by any suitable method for example, direct chemical synthesis by using phosphoramidite chemistry (Gait M.J., Oligonucleotide synthesis a practical approach, IRL press Ltd) Since the PCR reaction is supersensitive, minute contamination of the undesirable DNA or deviation in the experimental conditions may affect the amplification signal, the possibility exists that male samples will not show male signals. In order to avoid this and to verify accuracy of sex diagnosis, PCR primers giving a gender-neutral signal are needed. The gender-neutral oligonucleotide primers can be designed based on any suitable and known DNA sequence. For example the. PCR primers designed from the chloroplast and mitochondrial DNA sequences as described by Taberlet et. at. (PMB17: 1105-1109,1991). Primers for the PCR reaction described above have to be selected carefully to meet two criteria. The lengths of PCR products need to be sufficiently different to allow clear differentiation between the male-specific sequence and the gender-neutral one. Secondly, the lengths of the anticipated PCR amplification products preferably should not be longer than a length compatible with the activity of DNA polymerase. The difference of the length of PCR products should preferably around 50-100 bases. After the PCR reaction is allowed to proceed, the PCR products are analysed by gel electrophoresis and stained with a fluorescence dye, the DNA samples which reveal two semisynthetic amplicons, one sex-specific whereas the second being gender-neural are male while the DNA samples which exhibit a single gender-neutral semisynthetic amplicon are female. In a process of this invention, the amplified products of a polymerase chain reaction may be resolved by known methods for example, on agarose gel, on polyacrylamide gel, on a mixture of polyacrylamide and agarose, as described in Maniatis et al, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982. In the process of this invention detection of the resolved amplified products on the gel can be carried out by various conventional methods for example autoradiography of the gel, staining of the gel by known methods, such as, ethidium bromide staining, silver staining as mentioned in Maniatis et al, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982. In a process of the present invention, oligonucleotide primers and nucleotides used in the polymerase chain reaction may be detectably labelled, using any reporter element that is capable of generating a detectable signal. Such detectable labels include radioactive markers such as 32P, 3H, 14C or 125I, and non-radioactive markers, such as alkaline phosphate, biotin bromodeoxyuridine, fluorescent or chromogenic molecules. The term "oligonucleotide" refers to a molecule comprising of two or more deoxyribonucleotides or ribonucleotides. The term "Polymerase Chain Reaction (PCR)" is an in vitro method of nucleic acid synthesis by which a particular segment of DNA can be specifically replicated. The process of PCR involves repeated cycles of heat denaturation of the DNA, annealing of the primers to their complementary sequences and extension of the annealed primers with thermostable DNA Polymerase. The term "primer" refers to an oligonucleotide, whether natural or synthetic, capable of acting as a point of initiation of DNA synthesis complementary to a nucleic acid strand, in the presence of four different nucleoside triphosphates and an agent for polymerization (i.e. DNA polymerase or reverse transcirptase). The term "semisynthetic amplicon" refers to a deoxyribonucleotide polymer in double-stranded form, amplified artificially in a polymerase chain reaction and it is a non living chemical substance. The amplicon is biologically inactive and can not replicate on its own. Amplifying or amplification, as used herein describes both linear and exponential increase in the number of target sequence of nucleic acid. The term "Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR)" as used herein describes a process wherein exponential increase in the number of target sequence of nucleic acid takes place by using random decamer primers having arbitrary sequence. The term "Sequence Tagged Site Polymerase Chain Reaction" as used herein describes a process wherein exponential increase in the number of selected target sequence of nucleic acid takes place by a pair of specific primers having sequence specificity to the selected target sequence. The term "gender-neutral semisynthetic amplicon " as used herein refers to the product amplified irrespective of the gender of the plant i. e. amplified in both male and female DNA samples. The method of the present invention is described herein below with reference to examples, which are illustrative only and should not be construed to limit the scope of the present invention in any manner. The following example relates to the simultaneous preparation of sex specific and gender- neutral semisynthetic amplicons useful for determination of sex in papaya plants. \| EXAMPLE NO.1 [ Matured male and female plants of dioecious papaya cultivar PUSA-GIANT were identified in the field. Young leaf tissue from both male and female individuals of this cultivar was harvested and frozen in liquid nitrogen. Ten grams of the frozen tissue of each sample was mechanically ground to a fine powder using pestle and mortar in liquid nitrogen. The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6 1Ed), where 15 ml of extraction buffer containing 2% CTAB (Cetyltriethyl ammonium bromide), 100 mM Tris-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCI, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chlorofornrdsoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer containing, 1% CTAB, 50 mM Tris-HCI (pH 8.0) and 10 mM EDTA (pH 8.0) was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of absolute ethanol. The DNA precipitate was washed with 70 % ethanol, centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA. The isolated DNA was quantified spectrophotometrically and subjected to Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR) with a synthetic, arbitrary, 10bp primer. The final volume of the reaction mixture was 25 µl, which contained 20ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 100 µM of each dATP, dCTP, dGTP and dTTP, 25µM spermidine, 0.6 Units of thermostable DNA polymerase and 15 pmoles of decamer primer having the sequence 5' GAGGATCCCT 3'. The reaction mixture was overlaid with 30 nl of mineral oil and spun for 30 sec. at 1000rpm. Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 5 minutes, followed by 45 cycles of 94°C for 1 minute, 36°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification products were analysed on 1.8% neutral agarose horizontal slab gel in TAE buffer (40.0mM Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1p.g/ml) and was visualised on a long wavelength (302nm) UV transilluminator. A sex specific amplicon having molecular weight of 0.8 Kb was identified in the male individual. A gel slice containing DNA of the sex specific amplicon was cut out from the gel using a sharp blade and the DNA was eluted from the gel piece as described in Maniatis et al, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982. 100ng of the eluted DNA was ligated to 100ng of a PCR product cloning vector in a reaction containing, 1µl 10X DNA ligase buffer [500mM Tris-HCI (pH 7.4), 100mM spermidine, 1mg/ml BSA (Bovine Serum Albumin)], 1µl of 1M ATP, 1µl of 0.1 M MgCI2 and 2.0U of the enzyme DNA ligase. Final volume of the reaction was adjusted to 10µl by adding sterile water. The libation reaction was carried out at 16°C for 16 hours and the ligated products were directly transformed into the competent cells of E.coli. The transformed E.coli cells were plated on LB (Luria-Bertani) medium [Bacto tryptonelOgm/lit, Bacto yeast extract 5gm/lit, Sodium chloride 10gm/lit] containing the antibiotic ampicillin (100ng/ml).Resulting colonies were screened for the presence of the recombinants as described in Maniatis et al, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982. The plasmid DNA was isolated by inoculating a colony positive for the insert in 1ml LB medium containing the antibiotic ampicillin (100µg/ml). The culture was grown at 37°C, for 16 hours with constant shaking at 175rpm. The culture was spun in 1.5ml plastic tube for 10 minutes to pellet the cells and the supernatant was discarded. The cell pellet was suspended in a 10µl solution of GTE buffer [50mM Glucose, 25mM Tris-HCI (pH 8.0), and 10mM EDTA (pH 8.0)], vortexed and incubated at room temperature for ten minutes. 200µl of freshly prepared solution containing 1% SDS and 0.2N NaOH was added to the cell suspension, mixed well by tapping the tube and incubated on ice for ten minutes and further purified as described by Maniatis et al [ Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982]. The cloned sex specific semisynthetic amplicon was sequenced by Sanger's dideoxy chain termination method, as described by Sanger et al, PNAS 74, 1977:54-63. To denature the template DNA, 2µg of plasmid DNA was dried in a centrifuge tube and dissolved in 40µl denaturation buffer (0.2M NaOH, 0.2mM EDTA, pH 8.0) and kept at 37°C for 30 minutes. 4µl of 3M Sodium acetate, pH 5.2 was added, followed by 100µl of chilled ethanol and precipitated for 30 minutes at -70°C. The sample was spun at 10,000rpm for 10 minutes at 4°C. Supernatant was discarded and pellet was washed with 70% ethanol, dried and dissolved in 70µl of sterile water. To anneal the sequencing primer to the template DNA, 1µl of sequencing primer and 2µl of 5X reaction buffer were added to the template DNA and incubated at 65°C for 2 minutes. The labelling reaction was carried out by adding, 1µl DTT(0.1M), 2µl labelling nucleotide mix(7.5M.m dGTP, 7.5µm dTTP, 7.5µm dCTP ), 5µCi of α-32P dATP and 0.6 units of enzyme to the annealed template-primer. The sample was incubated for 5 minutes at room temperature. Two microliters of dideoxynucleotide mixture (ddGTP, ddCTP, ddATP and ddTTP) was taken in four labelled tubes and warmed to 37°C for 2 minutes. 3.5µl of the template primer mixture was added to each of the labelled tubes, mixed and incubated at 37°C for 5 minutes. After the incubation, 4µl of formamide buffer (95%Formamide, 20 mM EDTA, 0.05%Bromophenol Blue, 0.05% Xylene Cyanol FF) was added to stop the reaction. The sequencing reaction was then resolved on a 6%, 0.4mm thick, denaturing polyacrylamide gel. Electrophoresis was carried out at a constant voltage (2000V) in 1XTBE buffer (89mM Tris-borate and 2 mM EDTA). After the electrophoresis, the gel was covered in thin plastic sheet and exposed to a X-ray film at -70°C for 16 hours. Sequencing of the cloned sex specific semisynthetic amplicon revealed a sequence as shown in the sequence identity no.1 sequence identity no.1 (Sequence Removed) Based on the sequence data as mentioned in sequence identity no.1, the primers were designed so as to amplify the entire sequence of the sex specific semisynthetic amplicon. The sequence of the synthetic oligonucleotide primers is as given below in sequence identity no.2, sequence identity no.3, sequence identity no.4 and sequence identity no.5. sequence identity no. 2 5 'GGATCCCTATTAGTGTAAGGG 3' sequence identity no. 3 5 'GGATCCCTTTTGCACTCTGCTG 3' sequence identity no. 4 5 'GGATCCCTATTAGTG 3' sequence identity no. 5 5 'GGATCCCTTTTGCACTC 3' The isolated DNA samples of the cultivar PUSA-GIANT were quantified spectrophotometrically and subjected to sequence tagged site polymerase chain reaction by using two pairs of synthetic oligonucleotide primers so as to simultaneously amplify sex specific and gender-neutral semisynthetic amplicons. The sequence of the synthetic oligonucleotide primers used in the present invention for the preparation of gender-neutral amplicon are sequence identity no. 6 5' CGAAATCGGTAGACGATACG 3' and sequence identity no. 7 5' GGGGATAGAGGGACTTGAAC 3" [Sequence identities 6 and 7 are as described by Taberlet et. al. (PMB17: 1105-1109, 1991)]. The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTGTAAGGG 3' (sequence identity no. 2) and 5 'GGATCCC Mil GCACTCTGCTG 3' (sequence identity no. 3), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'(sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µ of mineral oil and spun for 30 sec. at 1000rpm. Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutral agarose horizontal slab gel in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator. It was observed, that on using the said pairs of synthetic oligonucleotide primers in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants. The following examples 2 and 3 relate to the determination of sex in dioecious cultivars of papaya by simultaneously preparing sex specific and gender-neutral semisynthetic amplicons. I EXAMPLE NO.2 Matured male and female plants of dioecious papaya cultivars namely, CO-2, CO-4, CO-5, CO-6, MF-1, PANT-1, WASHINGTON, PUSA-GIANT and PUSA-DWARF were identified in the field. Young leaf tissue from both male and female individuals of these cultivars was harvested frozen in liquid nitrogen. Ten grams of this frozen tissue of each sample was mechanically ground to a fine powder using a pestle and mortar in liquid nitrogen. The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6:1Ed), where 15 ml of extraction buffer containing 2% CTAB (Cetyltriethyl ammonium bromide), 100 mM Tris-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCI, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chloroform:isoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer containing, 1% CTAB, 50 mM Tr/s-HC/ (pH 8.0) and 10 mM EDTA (pH 8.0) was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of absolute ethanol. The DNA precipitate was washed with 70 % ethanol,-centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA. The isolated DNA samples were quantified spectrophotometrically and were subjected to sequence tagged site polymerase chain reaction by using two pairs of synthetic oligonucleotide primers so as to simultaneously amplify sex specific and gender-neutral semisynthetic amplicons. The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence -5' GGATCCCTATTAGTGTAAGGG 3' ( sequence identity no. 2) and 5' GGATCCCTTTTGCACTCTGCTG 3' (sequence identity no. 3), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3' ( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3' (sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm. Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutraf agarose horizontal slab gel in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (3Q2nm) UV trsmsilluminator. It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, in all the dioecious cultivars tested. EXAMPLE NO.3 Male and female plants of dioecious papaya cultivars namely, CO-2, CO-4, CO-5, CO-6, MF-1, PANT-1, WASHINGTON, PUSA-GIANT and PUSA-DWARF were identified in the field. Leaf tissue from male and female individuals of these cultivars was harvested in the form of leaf discs and then frozen in liquid nitrogen, in sterile, 1.5 ml microcentrifuge tubes. The leaf discs, weighing 10 mg were used for DNA isolation, which was carried out by modifying the method described by Thompson et al, Biotechniques, Vol.19, No.3, 1995, 394-400. Fifty microliters of extraction buffer containing 100 mM Tris-HCI (pH 9.5), 1M KCI and 5 mM EDTA was added per 10mg of plant tissue in 1.5 ml microcentrifuge tubes. The tubes were further incubated at 95°C for 20 min in a dry bath. The contents were mixed intermittently by inverting and tapping the tubes. After incubation, the tubes were placed on ice for 5min. the DNA thus isolated was diluted by adding 120 (al of dilution buffer containing 10mM Tris ( pH9.0), 1 mM EDTA (pH 8.0) and 0.1 mg RNAse A. The diluted supernatant was directly used in the polymerase chain reaction. The final volume of reaction mixture was 25µl, which contained 5µl of the diluted supernatant, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 Units of thermostable DNA polymerase, and 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTG 3' (sequence identity no. 4) and 5 'GGATCCCl I n GCACTC 3' (sequence identity no. 5), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm. Amplification reaction was performed in a thermocycler. The reaction mixture was initially incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds,45°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification products were then analysed on 1.5% neutral agarose horizontal slab gels in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current of 40mA. After electrophoresis, the gel was stained in dark with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator. It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, in all the dioecious cultivars tested. Following examples 4 and 5 relate to the sex determination in wild species of the genus Carica, by simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons. EXAMPLE NO.4 Male and female plants of wild species, Carica cauliflora were identified in the field. Young leaf tissue from both male and female individuals was harvested and frozen in liquid nitrogen. Ten grams of this frozen tissue of each sample was mechanically ground to a fine powder using a pestle and mortar in liquid nitrogen. The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6:1Ed), where 15 ml of extraction buffer containing 2% CTAB (Cetyltriethyl ammonium bromide), 100 rnM Tri-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M Nacl, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chloroformrisoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer containing, 1% CTAB, 50 mM Tris-HCI (pH 8.0) and 10 mM EDTA (pH 8.0) was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0) 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of absolute ethanol. The DNA precipitate was washed with 70 % ethanol, centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA. The isolated DNA samples were quantified spectrophotometrically and were subjected to sequence tagged site polymerase chain reaction. The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCi, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence 5' GGATCCCTATTAGTGTAAGGG 3' ( sequence identity no. 2) and 5' GGATCCCTTTTGCACTCTGCTG 3' (sequence identity no. 3), 12.5ng of each of synthetic oligonucfeotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at lOOOrpm. Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutral agarose horizontal slab gel in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator. It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, of the dioecious wild species tested. EXAMPLE NO.5 Male and female plants of wild species, Car/ca cauliflora were identified in the field. Leaf tissue from male and female individuals was harvested in the form of leaf discs and then frozen in liquid nitrogen, in sterile, 1.5 ml microcentrifuge tubes. The leaf discs, weighing 10 mg were used for DNA isolation, which was carried out by modifying the method described by Thompson et a/, Biotechniques, Vol.19, No.3, 1995, 394-400. Fifty microliters of extraction buffer containing 100 mM Tris-HCI (pH 9.5), 1M KCI and 5 mM EDTA was added per 10mg of plant tissue in 1.5 ml microcentrifuge tubes. The tubes were further incubated at 95°C for 20 min in a dry bath. The contents were mixed intermittently by inverting and tapping the tubes. After incubation, the tubes were placed on ice for 5min. the DNA thus isolated was diluted by adding 120 \L\ of dilution buffer containing 1QmM Tris ( pH9.0), 1 mM EDTA (pH 8.0) and 0.1 mg RNAse A. The diluted supernatant was directly used in the polymerase chain reaction. The final volume of reaction mixture was 25}il, which contained 5µl of the diluted supernatant, 1.5 rnM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethy!) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50^M spermidine, 1.0 Units of thermostable DNA polymerase, and 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTG 3' (sequence identity no. 4) and 5 'GGATCCCTTTTGCACTC 3f (sequence identity no. 5), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µI by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm. Amplification reaction was performed in a thermocycler. The reaction mixture was initially incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds,45°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification products were then analysed on 1.5% neutral agarose horizontal slab gels in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current of 40mA. After electrophoresis, the gel was stained in dark with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator. It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, of the dioecious wild species tested. The following examples 6 and 7 relate to the sex determination of papaya plants of unknown sex at the seedling stage, by simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons. EXAMPLE NO.6 Fifty seedling plants were serially numbered 1-50 in the field. Young leaf tissue of 25 randomly selected individuals was harvested frozen in liquid, nitrogen. One gram of this frozen tissue of each sample was mechanically ground to a fine powder using a pestle and mortar in liquid nitrogen. The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6:1 Ed), where 15 ml of extraction buffer containing 2% CTAB (cetyltriethyl ammonium bromide), 100 mM Tri-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M Nacl, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chlorofomr.isoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer containing, 1% CTAB, 50 mM Tris-HCI (pH 8.0) and 10 mM EDTA (pH 8.0) was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0) 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of absolute ethanol. The DNA precipitate was washed with 70 % ethanol, centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA. The isolated DNA samples were quantified spectrophotometrically and were subjected to sequence tagged site polymerase chain reaction. The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50^M spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence 5' GGATCCCTATTAGTGTAAGGG 3' (sequence identity no. 2) and 5' GGATCCCTTTTGCACTCTGCTG 3' (sequence identity no. 3), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm. Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutral agarose horizontal slab gel in TAE buffer, (Q.09M Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator. The results obtained were compared with the sex of the plant observed after flowering. The results are tabulated in the following table. (Table Removed) It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the DNA samples which revealed presence of two semisynthetic amplicons : one sex specific, 831 bp (base pairs) in size while the other being gender-neutral 0.6kb in size were males, whereas the DNA samples which showed a single gender-neutral semisynthetic amplicon, 0.6kb in size were females. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants at the seedling stage. EXAMPLE NO: 7 Fifty seedling plants were serially numbered 1-50 in the field. Young leaf tissue of 22 randomly selected individuals was harvested frozen in liquid nitrogen. Leaf tissue from these individuals was harvested in the form of leaf discs and then frozen in liquid nitrogen in sterile, 1.5 ml microcentrifucje tubes The leaf discs, weighing 10 mg were used for DNA isolation, which was carried out by modifying the method described by Thompsori et al, Biotechniques, Vol.19, No.3, 1995, 394-400, Fifty microliters of extraction buffer containing 100 mM Tris-HCI (pH 9.5), 1M KCI and 5 mM EDTA was added per 10mg of plant tissue in 1.5 ml microcentrifuge tubes. The tubes were further incubated at 95°C for 20 min in a dry bath. The contents were mixed intermittently by inverting and tapping the tubes. After incubation, the tubes were placed on ice for 5min. the DNA thus isolated was diluted by adding 120 µl of dilution buffer containing 10mM Tris ( pH9.0), 1 mM EDTA (pH 8.0) and 0.1 mg RNAse A. The diluted supernatant was directly used in the polymerase chain reaction. The final volume of reaction mixture was 25µl, which contained 5µl of the diluted supernatant, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydrosymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 nM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 Units of thermostable DNA polymerase, and 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTG 3' (sequence identity no. 4) and 5 'GGATCCCTTTTGCACTC 3' (sequence identity no. 5), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm. Amplification reaction was performed in a thermocycler. The reaction mixture was initially incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 45°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification products were then analysed on 1.5% neutral agarose horizontal slab gels in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current of 40mA. After electrophoresis, the gel was stained in dark with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator. The results obtained were compared with the sex of the plant observed after flowering. The results are tabulated in the following table. (Table Removed) It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the DNA samples which revealed presence of two semisynthetic amplicons : one sex specific, 831 bp (base pairs) in size while the other being gender-neutral 0.6kb in size were males, whereas the DNA samples which showed a single gender-neutral semisynthetic amplicon, 0.6kb in size were females. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants at the seedling stage. Advantages of the present invention 1. -The important advantage is to provide process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons. useful for sex determination of dioecious papaya plant. 2. The present invention will be highly useful in intra and interspecific breeding experiments, and for screening the F1 and F2 generations for male and female plants. 3. With this invention, the sex of the papaya plants can be identified before flowering, allowing direct transplantation and distribution of only the identified female plants. 4. The said process is fast, accurate, does not involve any hazardous chemicals. 5. The genoptype of the plant is not affected in the process of identification of sex of the plant. 6. The said process requires minimal amount of sample material. 7. The process is very much cost effective and a large number of samples can be processed in a very short duration. 8. Environmental and seasonal variations do not interfere in the process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons. We Claim: 1. An improved process for preparation of sex specific and gender- neutral semisynthetic amplicons useful for sex determination, which comprises, isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double stranded, amplified product from the gel piece by known methods, synthesizing the single stranded chains of synthetic oligonucleotides from the said double stranded amplified product by known method, amplifying the said single stranded chain of synthetic oligonucleotide in a conventional Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get desired sex specific and gender-neutral semisynthetic amplicons. 2. An improved process as claimed in claim 1 wherein, isolation of nucleic acid can be carried out by conventional method such as Roger & Bendich method from any part of a papaya plant such as leaf, root, petiole. 3. An improved process as claimed in claims 1 and 2 wherein, the polymerase chain reaction is carried out by using a thermostable DNA polymerase enzyme. 4. An improved process as claimed in claims 1-3 wherein, the Random Amplification of polymorphic DNA-Polymerase Chain Reaction (RAPD-PCR) may be effected by using one or more single stranded oligonucleotide primers, such as 5-12 mers, preferably known decamers. 5. An improved process as claimed in claims 1-4 wherein, separation of the products of polymerase chain reaction may be effected by conventional electrophoresis method using agarose gel, Polyacrylamide gel and mixtures thereof. 6. An improved process as claimed in claim 1-5 wherein, elution of the sex specific amplification product from the gel piece may be effected by conventional elution methods, such as electroelution, freeze-thaw method. 7. An improved process for preparation of sex specific and gender- neutral semisynthetic amplicons useful for sex determination substantially as herein described with reference to the examples.

Full Text

This invention relates to an improved process for preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination.
This invention particularly relates to an improved process for preparation of sex specific and gender - neutral semisynthetic amplicons useful for sex determination. The invention particularly relates to a process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination of papaya plants. The process involves amplification of nucleic acid of a Polymerase Chain Reaction (PCR) using synthetic oligonucleotide primers.
The process of the present invention is more accurate and in an improvement of our copending patent application no. 2447/DEL/97, entitled "A process for preparation of semisynthetic amplicon useful for sex determination of the papaya plant". In an another copending patent application no. 268/DEL/97, a process for preparation of duplex polynucleotide useful for sex determination of papaya plant has been reported. Apart from our own-filed patent applications, there is no prior art available for the identification of sex of dioecious papaya plant. Carica papaya commonly known as papaya, is a native of tropital America. It belongs to the genus Carica, a member of family caricaceae. The plant adopts itself to diverse soil and climatic conditions, and hence is grown extensively in tropical and subtropical areas for its profitable and continuous yield of fruits. The fruits are mostly consumed ripe and are a rich source of vitamins A, B, C and D (Kumar et at, J. Bom Natural His. Society, vol. XV, no. 2, Dec 43, 252-256). Thin , milky latex is extracted out of young green fruits . This latex contains a high percentage of papain
which is one of the most valuable of plant proteolytic enzymes. Papain is of
interest to many industries among which food industry is one of the biggest consumers. Papain is used for chillproofing beer, tenderising meat and freeing food proteins. It is used in peptone preparation from meat and milk in bacteriological laboratories, in textile industry for degumming of silk, in dairy industry for cheese preparation, in tanning industry for skin dehairing and bating of hides, in pharmaceutical industry, perfume industry and in effluent treatment. Papain is also used to produce animal feed products and recover animal wastes by digestion of proteins. (Jones et al, Process Biochemistry 9, 1976, 21-24).
Papaya plants are propagated through seeds. The seeds are sown in seedbeds and 1-2 months old seedlings are transplanted to the field. 2-3 seedlings are planted in one pit, as the sex of the seedlings is unknown. Plants attain reproductive maturity after 5-8 months. Most of the male plants are then uprooted from the field. This unnecessary cultivation and uprooting leads to wastage of time, money and labour.
The dioecious cultivars are preferred for the extraction of papain as the female yields of crude papain exceed that of hermaphrodite and also the proteolytic activity of the crude papain from female fruits is greater than hermaphrodites (Madrigal et al., J. Sci. Food Agri. 1980, 31: 279-285).
Breeding programs are initiated with objectives to evolve disease resistant and true breeding papaya varieties with good quality fruits and high papain content. The dioecious nature' poses problems and

inconvenience to papaya breeders and growers since it takes 5-8 months to know the sex of the seedling. Unfortunately sex cannot be deduced from external morphology or cytology with embryonic or juvenile forms. If the sex of plants is known at the juvenile stage, it would facilitate screening of the seedlings for female plants saving time and economic resources and thereby helping in the breeding program.
The objective of the present invention is to provide an improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination.
Another objective of the present invention is to provide a process for simultaneous preparation of sex specific and gender-neutral semisynthetic ampiicons useful for sex determination papaya plants.
Another objective of the present invention is to provide a process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination papaya plants at juvenile stage.
Accordingly, the present invention provides an improved process for preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination, which comprises, isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double strandes, amplified product from the gel piece by known methods , synthesizing the single
stranded chains of synthetic oligonucleotides from the said double stranded amplified product by known method, amplifying the said single stranded chain of synthetic oligonucleotide in a conventional Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get desired sex specific and gender-neutral semisynthetic amplicons.
In an embodiment of the present invention, isolation of nucleic acid can be carried out by conventional method such as Roger & Bendich method from any part of a papaya plant such as leaf, root, petiole.
In an embodiment of the present invention , the polymerase chain reaction is carried out by using a thermostable DNA polymerase enzyme.
In another embodiment of the present invention, the Random Amplification of Polymorphic DNA Polymerase Chain Reaction (RAPD-PCR) may be effected by using one or more single stranded oligonucleotide primers, such as 5-12 mer primers, preferably known decamers.
In an another embodiment of the present invention separation of the products of Polymerase Chain Reaction may be effected by conventional electrophoresis method using agarose gel, polyacrylamide gel and mixtures thereof.
In an embodiment of the present invention, elution of the sex
specific amplification product from the gel piece may be effected by conventional elution methods, such as electroelution, freeze-thaw method.
In an embodiment of the present invention, cloning of the sex specific amplified, eluted product may be effected by using a plasmid vector, such as PCR product cloning vector.
In a feature of the present invention sequencing of the cloned product is effected by known methods, such as Sanger's chain termination method.
In an another embodiment of the present invention the cloned semisynthetic amplicon has the following sequence.
(Sequence Removed)
In an another embodiment of the present invention, simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons may be effected by conventional Sequence Tagged Site Polymerase Chain Reaction by using synthetic oligonucleotide primers, such as primers spanning the sequence of the said sex specific semisynthetic amplicon and synthetic oligonucleotide primers based on the known sequence data such as chloroplast DNA sequence, mitochondrial DNA sequence and combinations thereof.
In a process of the present invention, DNA can be isolated from a variety of tissues including leaf, anther, ovary, seed, stem and root. The choice of tissue depends on many factors, including the quantity of the starting material required and difficulty in isolating DNA from a particular tissue. A variety of techniques for extracting nucleic acids from biological samples are known, for example those described by Sambrook et al, Molecular Cloning -A laboratory manual, Cold Spring Harbor Laboratory, NY (1985) and by Roger & Bendich (Roger et al, 1988, PMB manual A6 1Ed)
In a process of this invention oligonucleotide primers can be prepared by any suitable method for example, direct chemical synthesis by using phosphoramidite chemistry (Gait M.J., Oligonucleotide synthesis a practical approach, IRL press Ltd)
Since the PCR reaction is supersensitive, minute contamination of the undesirable DNA or deviation in the experimental conditions may affect
the amplification signal, the possibility exists that male samples will not show male signals. In order to avoid this and to verify accuracy of sex diagnosis, PCR primers giving a gender-neutral signal are needed.
The gender-neutral oligonucleotide primers can be designed based on any suitable and known DNA sequence. For example the. PCR primers designed from the chloroplast and mitochondrial DNA sequences as described by Taberlet et. at. (PMB17: 1105-1109,1991).
Primers for the PCR reaction described above have to be selected carefully to meet two criteria. The lengths of PCR products need to be sufficiently different to allow clear differentiation between the male-specific sequence and the gender-neutral one. Secondly, the lengths of the anticipated PCR amplification products preferably should not be longer than a length compatible with the activity of DNA polymerase. The difference of the length of PCR products should preferably around 50-100 bases.
After the PCR reaction is allowed to proceed, the PCR products are analysed by gel electrophoresis and stained with a fluorescence dye, the DNA samples which reveal two semisynthetic amplicons, one sex-specific whereas the second being gender-neural are male while the DNA samples which exhibit a single gender-neutral semisynthetic amplicon are female.
In a process of this invention, the amplified products of a polymerase chain reaction may be resolved by known methods for example, on agarose gel, on polyacrylamide gel, on a mixture of
polyacrylamide and agarose, as described in Maniatis et al, Molecular
Cloning : A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982.
In the process of this invention detection of the resolved amplified products on the gel can be carried out by various conventional methods for example autoradiography of the gel, staining of the gel by known methods, such as, ethidium bromide staining, silver staining as mentioned in
Maniatis et al, Molecular Cloning : A Laboratory Manual, Cold Spring
Harbor, NY: Cold Spring Harbor Laboratory, 1982.
In a process of the present invention, oligonucleotide primers and nucleotides used in the polymerase chain reaction may be detectably labelled, using any reporter element that is capable of generating a detectable signal. Such detectable labels include radioactive markers such as 32P, 3H, 14C or 125I, and non-radioactive markers, such as alkaline phosphate, biotin bromodeoxyuridine, fluorescent or chromogenic molecules.
The term "oligonucleotide" refers to a molecule comprising of two or more deoxyribonucleotides or ribonucleotides.
The term "Polymerase Chain Reaction (PCR)" is an in vitro method of nucleic acid synthesis by which a particular segment of DNA can be specifically replicated. The process of PCR involves repeated cycles of heat denaturation of the DNA, annealing of the primers to their
complementary sequences and extension of the annealed primers with thermostable DNA Polymerase.
The term "primer" refers to an oligonucleotide, whether natural or synthetic, capable of acting as a point of initiation of DNA synthesis complementary to a nucleic acid strand, in the presence of four different nucleoside triphosphates and an agent for polymerization (i.e. DNA polymerase or reverse transcirptase).
The term "semisynthetic amplicon" refers to a deoxyribonucleotide polymer in double-stranded form, amplified artificially in a polymerase chain reaction and it is a non living chemical substance. The amplicon is biologically inactive and can not replicate on its own.
Amplifying or amplification, as used herein describes both linear and exponential increase in the number of target sequence of nucleic acid.
The term "Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR)" as used herein describes a process wherein exponential increase in the number of target sequence of nucleic acid takes place by using random decamer primers having arbitrary sequence.
The term "Sequence Tagged Site Polymerase Chain Reaction" as used herein describes a process wherein exponential increase in the number of selected target sequence of nucleic acid takes place by a pair of specific primers having sequence specificity to the selected target sequence.
The term "gender-neutral semisynthetic amplicon " as used herein refers to the product amplified irrespective of the gender of the plant i. e. amplified in both male and female DNA samples.
The method of the present invention is described herein below with reference to examples, which are illustrative only and should not be construed to limit the scope of the present invention in any manner.
The following example relates to the simultaneous preparation of
sex specific and gender- neutral semisynthetic amplicons useful for
determination of sex in papaya plants.
| EXAMPLE NO.1 [
Matured male and female plants of dioecious papaya cultivar PUSA-GIANT were identified in the field. Young leaf tissue from both male and female individuals of this cultivar was harvested and frozen in liquid nitrogen. Ten grams of the frozen tissue of each sample was mechanically ground to a fine powder using pestle and mortar in liquid nitrogen.
The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6 1Ed), where 15 ml of extraction buffer containing 2% CTAB (Cetyltriethyl ammonium bromide), 100 mM Tris-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCI, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chlorofornrdsoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer
containing, 1% CTAB, 50 mM Tris-HCI (pH 8.0) and 10 mM EDTA (pH 8.0)
was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of absolute ethanol. The DNA precipitate was washed with 70 % ethanol, centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA.
The isolated DNA was quantified spectrophotometrically and subjected to Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR) with a synthetic, arbitrary, 10bp primer. The final volume of the reaction mixture was 25 µl, which contained 20ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 100 µM of each dATP, dCTP, dGTP and dTTP, 25µM spermidine, 0.6 Units of thermostable DNA polymerase and 15 pmoles of decamer primer having the sequence 5' GAGGATCCCT 3'. The reaction mixture was overlaid with 30 nl of mineral oil and spun for 30 sec. at 1000rpm.
Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 5 minutes, followed by 45 cycles of 94°C for 1 minute, 36°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification products were analysed on 1.8%
neutral agarose horizontal slab gel in TAE buffer (40.0mM Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1p.g/ml) and was visualised on a long wavelength (302nm) UV transilluminator.
A sex specific amplicon having molecular weight of 0.8 Kb was identified in the male individual. A gel slice containing DNA of the sex specific amplicon was cut out from the gel using a sharp blade and the DNA was eluted from the gel piece as described in Maniatis et al, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982.
100ng of the eluted DNA was ligated to 100ng of a PCR product cloning vector in a reaction containing, 1µl 10X DNA ligase buffer [500mM Tris-HCI (pH 7.4), 100mM spermidine, 1mg/ml BSA (Bovine Serum Albumin)], 1µl of 1M ATP, 1µl of 0.1 M MgCI2 and 2.0U of the enzyme DNA ligase. Final volume of the reaction was adjusted to 10µl by adding sterile water. The libation reaction was carried out at 16°C for 16 hours and the ligated products were directly transformed into the competent cells of E.coli. The transformed E.coli cells were plated on LB (Luria-Bertani) medium [Bacto tryptonelOgm/lit, Bacto yeast extract 5gm/lit, Sodium chloride 10gm/lit] containing the antibiotic ampicillin (100ng/ml).Resulting colonies were screened for the presence of the recombinants as described in Maniatis et al, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982. The plasmid DNA was
isolated by inoculating a colony positive for the insert in 1ml LB medium containing the antibiotic ampicillin (100µg/ml). The culture was grown at 37°C, for 16 hours with constant shaking at 175rpm. The culture was spun in 1.5ml plastic tube for 10 minutes to pellet the cells and the supernatant was discarded. The cell pellet was suspended in a 10µl solution of GTE buffer [50mM Glucose, 25mM Tris-HCI (pH 8.0), and 10mM EDTA (pH 8.0)], vortexed and incubated at room temperature for ten minutes. 200µl of freshly prepared solution containing 1% SDS and 0.2N NaOH was added to the cell suspension, mixed well by tapping the tube and incubated on ice for ten minutes and further purified as described by Maniatis et al [ Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982].
The cloned sex specific semisynthetic amplicon was sequenced by Sanger's dideoxy chain termination method, as described by Sanger et al, PNAS 74, 1977:54-63.
To denature the template DNA, 2µg of plasmid DNA was dried in a centrifuge tube and dissolved in 40µl denaturation buffer (0.2M NaOH, 0.2mM EDTA, pH 8.0) and kept at 37°C for 30 minutes. 4µl of 3M Sodium acetate, pH 5.2 was added, followed by 100µl of chilled ethanol and precipitated for 30 minutes at -70°C. The sample was spun at 10,000rpm for 10 minutes at 4°C. Supernatant was discarded and pellet was washed with 70% ethanol, dried and dissolved in 70µl of sterile water.
To anneal the sequencing primer to the template DNA, 1µl of
sequencing primer and 2µl of 5X reaction buffer were added to the template DNA and incubated at 65°C for 2 minutes.
The labelling reaction was carried out by adding, 1µl DTT(0.1M), 2µl labelling nucleotide mix(7.5M.m dGTP, 7.5µm dTTP, 7.5µm dCTP ), 5µCi of α-32P dATP and 0.6 units of enzyme to the annealed template-primer. The sample was incubated for 5 minutes at room temperature.
Two microliters of dideoxynucleotide mixture (ddGTP, ddCTP, ddATP and ddTTP) was taken in four labelled tubes and warmed to 37°C for 2 minutes. 3.5µl of the template primer mixture was added to each of the labelled tubes, mixed and incubated at 37°C for 5 minutes. After the incubation, 4µl of formamide buffer (95%Formamide, 20 mM EDTA, 0.05%Bromophenol Blue, 0.05% Xylene Cyanol FF) was added to stop the reaction.
The sequencing reaction was then resolved on a 6%, 0.4mm thick, denaturing polyacrylamide gel. Electrophoresis was carried out at a constant voltage (2000V) in 1XTBE buffer (89mM Tris-borate and 2 mM EDTA). After the electrophoresis, the gel was covered in thin plastic sheet and exposed to a X-ray film at -70°C for 16 hours.
Sequencing of the cloned sex specific semisynthetic amplicon revealed a sequence as shown in the sequence identity no.1
sequence identity no.1
(Sequence Removed)
Based on the sequence data as mentioned in sequence identity no.1, the primers were designed so as to amplify the entire sequence of the sex specific semisynthetic amplicon. The sequence of the synthetic oligonucleotide primers is as given below in sequence identity no.2, sequence identity no.3, sequence identity no.4 and sequence identity no.5.
sequence identity no. 2
5 'GGATCCCTATTAGTGTAAGGG 3'
sequence identity no. 3
5 'GGATCCCTTTTGCACTCTGCTG 3'
sequence identity no. 4
5 'GGATCCCTATTAGTG 3'
sequence identity no. 5
5 'GGATCCCTTTTGCACTC 3'
The isolated DNA samples of the cultivar PUSA-GIANT were quantified spectrophotometrically and subjected to sequence tagged site polymerase chain reaction by using two pairs of synthetic oligonucleotide primers so as to simultaneously amplify sex specific and gender-neutral semisynthetic amplicons. The sequence of the synthetic oligonucleotide primers used in the present invention for the preparation of gender-neutral amplicon are
sequence identity no. 6
5' CGAAATCGGTAGACGATACG 3' and
sequence identity no. 7
5' GGGGATAGAGGGACTTGAAC 3"
[Sequence identities 6 and 7 are as described by Taberlet et. al. (PMB17: 1105-1109, 1991)].
The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTGTAAGGG 3' (sequence identity no. 2) and 5 'GGATCCC Mil GCACTCTGCTG 3' (sequence identity no. 3),
12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'(sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µ of mineral oil and spun for 30 sec. at 1000rpm.
Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutral agarose horizontal slab gel in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator.
It was observed, that on using the said pairs of synthetic oligonucleotide primers in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants.
The following examples 2 and 3 relate to the determination of sex in dioecious cultivars of papaya by simultaneously preparing sex specific and gender-neutral semisynthetic amplicons.
I EXAMPLE NO.2
Matured male and female plants of dioecious papaya cultivars namely, CO-2, CO-4, CO-5, CO-6, MF-1, PANT-1, WASHINGTON, PUSA-GIANT and PUSA-DWARF were identified in the field. Young leaf tissue from both male and female individuals of these cultivars was harvested frozen in liquid nitrogen. Ten grams of this frozen tissue of each sample was mechanically ground to a fine powder using a pestle and mortar in liquid nitrogen.
The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6:1Ed), where 15 ml of extraction buffer containing 2% CTAB (Cetyltriethyl ammonium bromide), 100 mM Tris-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCI, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chloroform:isoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer containing, 1% CTAB, 50 mM Tr/s-HC/ (pH 8.0) and 10 mM EDTA (pH 8.0) was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of
absolute ethanol. The DNA precipitate was washed with 70 % ethanol,-centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA.
The isolated DNA samples were quantified spectrophotometrically and were subjected to sequence tagged site polymerase chain reaction by using two pairs of synthetic oligonucleotide primers so as to simultaneously amplify sex specific and gender-neutral semisynthetic amplicons.
The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence -5' GGATCCCTATTAGTGTAAGGG 3' ( sequence identity no. 2) and 5' GGATCCCTTTTGCACTCTGCTG 3' (sequence identity no. 3), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3' ( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3' (sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm.
Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes
each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutraf agarose horizontal slab gel in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (3Q2nm) UV trsmsilluminator.
It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, in all the dioecious cultivars tested.
EXAMPLE NO.3
Male and female plants of dioecious papaya cultivars namely, CO-2, CO-4, CO-5, CO-6, MF-1, PANT-1, WASHINGTON, PUSA-GIANT and PUSA-DWARF were identified in the field. Leaf tissue from male and female individuals of these cultivars was harvested in the form of leaf discs and then frozen in liquid nitrogen, in sterile, 1.5 ml microcentrifuge tubes.
The leaf discs, weighing 10 mg were used for DNA isolation, which was carried out by modifying the method described by Thompson et al, Biotechniques, Vol.19, No.3, 1995, 394-400. Fifty microliters of extraction buffer containing 100 mM Tris-HCI (pH 9.5), 1M KCI and 5 mM EDTA was added per 10mg of plant tissue in 1.5 ml microcentrifuge tubes. The tubes were further incubated at 95°C for 20 min in a dry bath. The contents were mixed intermittently by inverting and tapping the tubes. After incubation, the tubes were placed on ice for 5min. the DNA thus isolated was diluted by adding 120 (al of dilution buffer containing 10mM Tris ( pH9.0), 1 mM EDTA (pH 8.0) and 0.1 mg RNAse A.
The diluted supernatant was directly used in the polymerase chain reaction. The final volume of reaction mixture was 25µl, which contained 5µl of the diluted supernatant, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 Units of thermostable DNA polymerase, and 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTG 3' (sequence identity no. 4) and 5 'GGATCCCl I n GCACTC 3' (sequence identity no. 5), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final
volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm.
Amplification reaction was performed in a thermocycler. The reaction mixture was initially incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds,45°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification products were then analysed on 1.5% neutral agarose horizontal slab gels in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current of 40mA. After electrophoresis, the gel was stained in dark with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator.
It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, in all the dioecious cultivars tested.
Following examples 4 and 5 relate to the sex determination in wild species of the genus Carica, by simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons.
EXAMPLE NO.4
Male and female plants of wild species, Carica cauliflora were identified in the field. Young leaf tissue from both male and female individuals was harvested and frozen in liquid nitrogen. Ten grams of this frozen tissue of each sample was mechanically ground to a fine powder using a pestle and mortar in liquid nitrogen.
The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6:1Ed), where 15 ml of extraction buffer containing 2% CTAB (Cetyltriethyl ammonium bromide), 100 rnM Tri-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M Nacl, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chloroformrisoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer containing, 1% CTAB, 50 mM Tris-HCI (pH 8.0) and 10 mM EDTA (pH 8.0) was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0) 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of absolute ethanol. The DNA precipitate was washed with 70 % ethanol,
centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA.
The isolated DNA samples were quantified spectrophotometrically and were subjected to sequence tagged site polymerase chain reaction.
The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCi, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence 5' GGATCCCTATTAGTGTAAGGG 3' ( sequence identity no. 2) and 5' GGATCCCTTTTGCACTCTGCTG 3' (sequence identity no. 3), 12.5ng of each of synthetic oligonucfeotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at lOOOrpm.
Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutral agarose horizontal slab gel in TAE buffer, (0.09M Tris-acetate and
2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator.
It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, of the dioecious wild species tested.
EXAMPLE NO.5
Male and female plants of wild species, Car/ca cauliflora were identified in the field. Leaf tissue from male and female individuals was harvested in the form of leaf discs and then frozen in liquid nitrogen, in sterile, 1.5 ml microcentrifuge tubes.
The leaf discs, weighing 10 mg were used for DNA isolation, which was carried out by modifying the method described by Thompson et a/, Biotechniques, Vol.19, No.3, 1995, 394-400. Fifty microliters of extraction buffer containing 100 mM Tris-HCI (pH 9.5), 1M KCI and 5 mM EDTA was added per 10mg of plant tissue in 1.5 ml microcentrifuge tubes. The tubes
were further incubated at 95°C for 20 min in a dry bath. The contents were
mixed intermittently by inverting and tapping the tubes. After incubation, the tubes were placed on ice for 5min. the DNA thus isolated was diluted by adding 120 \L\ of dilution buffer containing 1QmM Tris ( pH9.0), 1 mM EDTA (pH 8.0) and 0.1 mg RNAse A.
The diluted supernatant was directly used in the polymerase chain reaction. The final volume of reaction mixture was 25}il, which contained 5µl of the diluted supernatant, 1.5 rnM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethy!) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP, dGTP and dTTP, 50^M spermidine, 1.0 Units of thermostable DNA polymerase, and 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTG 3' (sequence identity no. 4) and 5 'GGATCCCTTTTGCACTC 3f (sequence identity no. 5), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µI by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm.
Amplification reaction was performed in a thermocycler. The reaction mixture was initially incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds,45°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of
72°C for 5 minutes. The amplification products were then analysed on
1.5% neutral agarose horizontal slab gels in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current of 40mA. After electrophoresis, the gel was stained in dark with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator.
It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the male DNA samples revealed presence of two semisynthetic amplicons, one sex specific amplicon of 831 bp (base pairs) in size while the other being gender-neutral amplicon 0.6kb in size. The female DNA samples showed a single gender-neutral semisynthetic amplicon, 0.6kb in size. Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants, of the dioecious wild species tested.
The following examples 6 and 7 relate to the sex determination of papaya plants of unknown sex at the seedling stage, by simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons.
EXAMPLE NO.6
Fifty seedling plants were serially numbered 1-50 in the field. Young leaf tissue of 25 randomly selected individuals was harvested frozen in liquid, nitrogen. One gram of this frozen tissue of each sample was
mechanically ground to a fine powder using a pestle and mortar in liquid
nitrogen.
The DNA isolations were carried out by Roger and Bendich method (Roger, 1988, PMB manual, A6:1 Ed), where 15 ml of extraction buffer containing 2% CTAB (cetyltriethyl ammonium bromide), 100 mM Tri-HCI (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M Nacl, and 1% polyvinyl pyrrolidone was added per 10gm of frozen tissue. Equal volume of chlorofomr.isoamyl alcohol (24:1) mixture was added and mixed thoroughly to form an emulsion, which was centrifuged for 10 minutes at 10,000 rpm in a SS34 rotor. To the supernatant, equal volume of CTAB precipitation buffer containing, 1% CTAB, 50 mM Tris-HCI (pH 8.0) and 10 mM EDTA (pH 8.0) was added, mixed gently and centrifuged at 10,000 rpm. The DNA pellet was dissolved in high salt TE buffer [1M NaCI, 10 mM Tris-HCI (pH 8.0) 1 mM EDTA (pH 8.0) ] and was precipitated with twice the volume of absolute ethanol. The DNA precipitate was washed with 70 % ethanol, centrifuged and the pellet was redissolved in TE buffer [10 mM Tris-HCI (pH 8.0), 1 mM EDTA (pH 8.0)]. For removal of RNA, the DNA was incubated at 37°C for 1 hour with the enzyme RNaseA.
The isolated DNA samples were quantified spectrophotometrically and were subjected to sequence tagged site polymerase chain reaction.
The reaction mixture contained, 50ng of template DNA, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydroxymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 µM of each dATP, dCTP,
dGTP and dTTP, 50^M spermidine, 1.0 units of thermostable DNA polymerase, 75ng of each of synthetic oligonucleotide primers having sequence 5' GGATCCCTATTAGTGTAAGGG 3' (sequence identity no. 2) and 5' GGATCCCTTTTGCACTCTGCTG 3' (sequence identity no. 3), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm.
Amplification reaction was performed in a thermocycler, where the reaction mixture was incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 55°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification product was analysed on a 1.5% neutral agarose horizontal slab gel in TAE buffer, (Q.09M Tris-acetate and 2 mM EDTA) at a constant current. After electrophoresis, gel was stained with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator.
The results obtained were compared with the sex of the plant observed after flowering. The results are tabulated in the following table.
(Table Removed)
It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the DNA samples which revealed presence of two semisynthetic amplicons : one sex specific, 831 bp (base pairs) in size while the other being gender-neutral 0.6kb in size were males, whereas the DNA samples which showed a single gender-neutral semisynthetic amplicon, 0.6kb in size were females.
Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants at the seedling stage.
EXAMPLE NO: 7
Fifty seedling plants were serially numbered 1-50 in the field. Young leaf tissue of 22 randomly selected individuals was harvested frozen in liquid nitrogen. Leaf tissue from these individuals was harvested in the form of leaf discs and then frozen in liquid nitrogen in sterile, 1.5 ml microcentrifucje tubes The leaf discs, weighing 10 mg were used for DNA isolation, which was carried out by modifying the method described by Thompsori et al, Biotechniques, Vol.19, No.3, 1995, 394-400, Fifty microliters of extraction buffer containing 100 mM Tris-HCI (pH 9.5), 1M KCI and 5 mM EDTA was added per 10mg of plant tissue in 1.5 ml microcentrifuge tubes. The tubes were further incubated at 95°C for 20 min in a dry bath. The contents were mixed intermittently by inverting and tapping the tubes. After incubation, the tubes were placed on ice for 5min. the DNA thus isolated was diluted by adding 120 µl of dilution buffer containing 10mM Tris ( pH9.0), 1 mM EDTA (pH 8.0) and 0.1 mg RNAse A.
The diluted supernatant was directly used in the polymerase chain
reaction. The final volume of reaction mixture was 25µl, which contained
5µl of the diluted supernatant, 1.5 mM MgCI2, 50 mM KCI, 10 mM TAPS [3-tri (hydrosymethyl) methyl amino propane sulphonic acid], 0.01% gelatine, 200 nM of each dATP, dCTP, dGTP and dTTP, 50µM spermidine, 1.0 Units of thermostable DNA polymerase, and 75ng of each of synthetic oligonucleotide primers having sequence 5 'GGATCCCTATTAGTG 3' (sequence identity no. 4) and 5 'GGATCCCTTTTGCACTC 3' (sequence
identity no. 5), 12.5ng of each of synthetic oligonucleotide primer having the sequence 5' CGAAATCGGTAGACGATACG 3'( sequence identity no. 6) and 5' GGGGATAGAGGGACTTGAAC 3"(sequence identity no. 7). The final volume was made up to 25µl by adding sterile water. The reaction mixture was then overlaid with 30µl of mineral oil and spun for 30 sec. at 1000rpm.
Amplification reaction was performed in a thermocycler. The reaction mixture was initially incubated at 94°C for 4 minutes, followed by 30 cycles of 94°C for 45 seconds, 45°C for 1 minute and 72°C for 2 minutes each. The amplification reaction was concluded by a final extension of 72°C for 5 minutes. The amplification products were then analysed on 1.5% neutral agarose horizontal slab gels in TAE buffer, (0.09M Tris-acetate and 2 mM EDTA) at a constant current of 40mA. After electrophoresis, the gel was stained in dark with ethidium bromide (1µg/ ml) and was visualised on a long wavelength (302nm) UV transilluminator.
The results obtained were compared with the sex of the plant observed after flowering. The results are tabulated in the following table.

(Table Removed)
It was observed, that on using the said pairs of synthetic oligonucleotides in a sequence tagged site polymerase chain reaction, all the DNA samples which revealed presence of two semisynthetic amplicons : one sex specific, 831 bp (base pairs) in size while the other being gender-neutral 0.6kb in size were males, whereas the DNA samples which showed a single gender-neutral semisynthetic amplicon, 0.6kb in size were females.
Thus, the simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons could accurately identify male and female papaya plants at the seedling stage.
Advantages of the present invention
1. -The important advantage is to provide process for simultaneous
preparation of sex specific and gender-neutral semisynthetic amplicons.
useful for sex determination of dioecious papaya plant.
2. The present invention will be highly useful in intra and interspecific
breeding experiments, and for screening the F1 and F2 generations for
male and female plants.
3. With this invention, the sex of the papaya plants can be identified
before flowering, allowing direct transplantation and distribution of only
the identified female plants.
4. The said process is fast, accurate, does not involve any hazardous
chemicals.
5. The genoptype of the plant is not affected in the process of
identification of sex of the plant.

6. The said process requires minimal amount of sample material.
7. The process is very much cost effective and a large number of samples
can be processed in a very short duration.
8. Environmental and seasonal variations do not interfere in the process
for simultaneous preparation of sex specific and gender-neutral
semisynthetic amplicons.

We Claim:
1. An improved process for preparation of sex specific and gender-
neutral semisynthetic amplicons useful for sex determination,
which comprises, isolating nucleic acids from any part of a
papaya plant by conventional methods, amplifying the said
nucleic acids in a conventional Random Amplification of
polymorphic DNA Polymerase Chain Reaction (RAPD-PCR),
resolving the amplified products by conventional electrophoresis
method, eluting the sex specific, double stranded, amplified
product from the gel piece by known methods, synthesizing the
single stranded chains of synthetic oligonucleotides from the
said double stranded amplified product by known method,
amplifying the said single stranded chain of synthetic
oligonucleotide in a conventional Polymerase Chain Reaction by
using synthetic oligonucleotides as primers to get desired sex
specific and gender-neutral semisynthetic amplicons.
2. An improved process as claimed in claim 1 wherein, isolation of
nucleic acid can be carried out by conventional method such as
Roger & Bendich method from any part of a papaya plant such
as leaf, root, petiole.
3. An improved process as claimed in claims 1 and 2 wherein, the
polymerase chain reaction is carried out by using a
thermostable DNA polymerase enzyme.
4. An improved process as claimed in claims 1-3 wherein, the
Random Amplification of polymorphic DNA-Polymerase Chain
Reaction (RAPD-PCR) may be effected by using one or more
single stranded oligonucleotide primers, such as 5-12 mers,
preferably known decamers.
5. An improved process as claimed in claims 1-4 wherein,
separation of the products of polymerase chain reaction may be
effected by conventional electrophoresis method using agarose
gel, Polyacrylamide gel and mixtures thereof.
6. An improved process as claimed in claim 1-5 wherein, elution of
the sex specific amplification product from the gel piece may be
effected by conventional elution methods, such as
electroelution, freeze-thaw method.
7. An improved process for preparation of sex specific and gender-
neutral semisynthetic amplicons useful for sex determination
substantially as herein described with reference to the
examples.

Documents:

2377-del-1998-abstract.pdf

2377-del-1998-claims.pdf

2377-del-1998-complete specification (granted).pdf

2377-del-1998-correspondence-others.pdf

2377-del-1998-correspondence-po.pdf

2377-del-1998-description (complete).pdf

2377-del-1998-form-1.pdf

2377-del-1998-form-2.pdf

2377-del-1998-form-3.pdf

2377-del-1998-form-4.pdf

2377-del-1998-form-9.pdf

2377-del-1998-petition-others.pdf

« Previous Patent

Next Patent »

Patent Number

193289

Indian Patent Application Number

2377/DEL/1998

PG Journal Number

29/2004

Publication Date

17-Jul-2004

Grant Date

23-Dec-2005

Date of Filing

13-Aug-1998

Name of Patentee

COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH

Applicant Address

RAFI MARG, NEW DELHI-110001, INDIA.

Inventors:

#	Inventor's Name	Inventor's Address
1	VIDYA SHRIKANT GUPTA	NATIONAL CHEMICAL LABORATORY, PUNE 411008, MAHASRASHTRA, INDIA.
2	ANJALI SUNEEL PARASNIS	NATIONAL CHEMICAL LABORATORY, PUNE 411008, MAHASRASHTRA, INDIA.
3	PRABHAKAR KAMALAKAR RANJEKAR	NATIONAL CHEMICAL LABORATORY, PUNE 411008, MAHASRASHTRA, INDIA.

PCT International Classification Number

A61K 31/00

PCT International Application Number

N/A

PCT International Filing date

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1			NA