Indian Patents. 278395:"INHIBITORS OF AKT ACTIVITY"

Title of Invention	"INHIBITORS OF AKT ACTIVITY"
Abstract	Invented are novel heterocyclic carboxamide compounds, the use of such compounds as inhibitors of protein kinase B activity and in the treatment of cancer and arthritis.

Full Text	INHIBITORS OF Akt ACTIVITY FIELD OF THE INVENTION This invention relates to novel heterocyclic carboxamide compounds, the use of such compounds as inhibitors of protein kinase B (hereinafter PKB/Akt, PKB or Akt) activity and in the treatment of cancer and arthritis BACKGROUND OF THE INVENTION The present invention relates to heterocyclic carboxamide containing compounds that are inhibitors of the activity of one or more of the isoforms of the serine/threonine kinase, Akt (also known as protein kinase B), suitably the compounds of the invention are inhibitors of the activity of all three isoforms of the serine/threonine kinase, Akt The present invention also relates to pharmaceutical compositions comprising such compounds and methods of using the instant compounds in the treatment of cancer and arthritis (Liu et al Current Opin Pharmacology 3 317-22 (2003)) Apoptosis (programmed cell death) plays essential roles in embryonic development and pathogenesis of various diseases, such as degenerative neuronal diseases, cardiovascular diseases and cancer Recent work has led to the identification of various pro- and anti-apoptotic gene products that are involved in the regulation or execution of programmed cell death Expression of anti-apoptotic genes, such as Bcl2 or Bcl-xL, inhibits apoptotic cell death induced by vanous stimuli On the other hand, expression of pro-apoptotic genes, such as Bax or Bad, leads to programmed cell death (Adams et al Science, 281 1322-1326 (1998)) The execution of programmed cell death is mediated by caspase -1 related proteinases, including caspase-3, caspase- 7, caspase-8 and caspase-9 etc (Thornberry et al Science, 281 1312-1316(1998)) The phosphatidyhnositol 3'-OH kinase (PI3K)/Akt/PKB pathway appears important for regulating cell survival/cell death (Kulik et al Mol Cell Biol 17 1595-1606 (1997), Franke et al, Cell, 88 435-437 (1997), Kauffmann-Zeh et al Nature 385 544-548 (1997) Hemmings Science, 275 628-630 (1997), Dudek et al, Science, 275 661-665 (1997)) Survival factors, such as platelet derived growth factor (PDGF), nerve growth factor (NGF) and insulin-like growth factor-1 (IGF-I), promote cell survival under various conditions by inducing the activity of PI3K (Kulik et al 1997, Hemmings 1997) Activated PI3K leads to the production of phosphatidylinositol (3,4,5)-trtiphosphate (Ptdlns (3,4,5)-P3), which in turn binds to, and promotes the activation of, the serine/ threonine kinase Akt, which contains a pleckstrin homology (PH)-domain (Franke et al Cell, 81 727-736 (1995), Hemmings Science, 277 534 (1997), Downward, Curr Opm Cell Biol 10 262-267 (1998), Alessi et al, EMBO J 15 6541-6551 (1996)) Specific inhibitors of PI3K or dominant negative Akt/PKB mutants abolish survival-promoting activities of these growth factors or cytokines It has been previously disclosed that inhibitors of PI3K (LY294002 or wortmannin) blocked the activation of Akt/PKB by upstream kinases In addition, introduction of constitutively active PI3K or Akt/PKB mutants promotes cell survival under conditions in which cells normally undergo apoptotic cell death (Kulik et al 1997, Dudeketal 1997) Analysis of Akt levels in human tumors showed that Akt2 is overexpressed in a significant number of ovanan (J Q Cheung et al Proc Natl Acad Sci USA 89 9267-9271(1992)) and pancreatic cancers (J Q Cheung et al Proc Natl Acad Sci USA 93 3636-3641(1996)) Similarly, Akt3 was found to be overexpressed in breast and prostate cancer cell lines (Nakatani et al J Biol Chem 274 21528-21532 (1999) It was demonstrated that Akt-2 was over-expressed in 12% of ovarian carcinomas and that amplification of Akt was especially frequent in 50% of undifferentiated tumors, suggestion that Akt may also be associated with tumor aggressiveness (Bellacosa, et al, Int J Cancer, 64, pp 280-285, 1995) Increased Akt1 kinase activity has been reported in breast, ovarian and prostate cancers (Sun et al Am J Pathol 159 431-7(2001)) The tumor suppressor PTEN, a protein and lipid phosphatase that specifically removes the 3' phosphate of Ptdlns(3,4,5)-P3, is a negative regulator of the PI3K/Akt pathway (Li et al Science 275 1943-1947 (1997), Stambolic et al Cell 95 29-39(1998), Sun et al Proc Natl Acad Sci USA 96 6199-6204(1999)) Germhne mutations of PTEN are responsible for human cancer syndromes such as Cowden disease (Liaw et al Nature Genetics 16 64-67 (1997)) PTEN is deleted in a large percentage of human tumors and tumor cell lines without functional PTEN show elevated levels of activated Akt (Li et al supra, Guldberg et al Cancer Research 57 3660-3663 (1997), Risinger et al Cancer Research 57 4736-4738 (1997)) These observations demonstrate that the PI3K/Akt pathway plays important roles for regulating cell survival or apoptosis in tumongenesis Three members of the Akt/PKB subfamily of second-messenger regulated serine/threonine protein kinases have been identified and termed Akt1/ PKBa, Akt2/PKBp, and Akt3/PKBy respectively The isoforms are homologous, particularly in regions encoding the catalytic domains Akt/PKBs are activated by phosphorylation events occurring in response to PI3K signaling PI3K phosphorylates membrane inositol phospholipids, generating the second messengers phosphatidyl- inositol 3,4,5-tnsphosphate and phosphatidylinositol 3,4-bisphosphate, which have been shown to bind to the PH domain of Akt/PKB The current model of Akt/PKB activation proposes recruitment of the enzyme to the membrane by 3'-phosphorylated phosphoinositides, where phosphorylation of the regulatory sites of Akt/PKB by the upstream kinases occurs (B A Hemmings, Science 275 628-630 (1997), B A Hemmings, Science 276 534 (1997), J Downward, Science 279 673-674 (1998)) Phosphorylation of Akt1/PKBa occurs on two regulatory sites, Thr308 in the catalytic domain activation loop and on Ser473 near the carboxy terminus (D R Alessiefa/ EMBO J 15 6541-6551 (1996) and R Meier et al J Biol Chem 272 30491-30497 (1997)) Equivalent regulatory phosphorylation sites occur in Akt2/PKBB and Akt3/PKBy The upstream kinase, which phosphorylates Akt/PKB at the activation loop site has been cloned and termed 3 '-phosphoinositide dependent protein kinase 1 (PDK1) PDK1 phosphorylates not only Akt/PKB, but also p70 nbosomal S6 kinase, p90RSK, serum and glucocorticoid-regulated kinase (SGK), and protein kinase C The upstream kinase phosphorylating the regulatory site of Akt/PKB near the carboxy terminus has not been identified yet, but recent reports imply a role for the mtegnn-hnked kinase (ILK-1), a serine/threonine protein kinase, or autophosphorylation Inhibition of Akt activation and activity can be achieved by inhibiting PI3K with inhibitors such as LY294002 and wortmannin However, PI3K inhibition has the potential to mdiscnminately affect not just all three Akt isozymes but also other PH domain-containing signaling molecules that are dependent on Pdtlns(3,4,5)- P3, such as the Tec family of tyrosine kinases Furthermore, it has been disclosed that Akt can be activated by growth signals that are independent of PI3K Alternatively, Akt activity can be inhibited by blocking the activity of the upstream kinase PDK1 The compound UCN-01 is a reported inhibitor of PDK1 Biochem J 375(2) 255 (2003) Again, inhibition of PDK1 would result in inhibition of multiple protein kinases whose activities depend on PDK1, such as atypical PKC isoforms, SGK, and S6 kinases (Williams et al Curr Biol 10 439-448 (2000) Small molecule inhibitors of Akt are useful in the treatment of tumors, especially those with activated Akt (e g PTEN null tumors and tumors with ras mutations) PTEN is a critical negative regulator of Akt and its function is lost in many cancers, including breast and prostate carcinomas, glioblastomas, and several cancer syndromes including Bannayan-Zonana syndrome (Maehama, T et al Annual Review of Biochemistry, 70 247 (2001)), Cowden disease (Parsons, R , Simpson, L Methods in Molecular Biology (Totowa, NJ, United States), 222 (Tumor Suppressor Genes, Volume 1) 147 (2003)), and Lhermitte-Duclos disease (Backman, S et al Current Opinion in Neurobiology, 12(5) 516 (2002)) Akt3 is up-regulated in estrogen receptor-deficient breast cancers and androgen-independent prostate cancer cell lines and Akt2 is over-expressed in pancreatic and ovanan carcinomas Akt1 is amplified in gastnc cancers (Staal, Proc Natl Acad Sci USA 84 5034-7 (1987) and upregulated in breast cancers (Stal et al Breast Cancer Res 5 R37-R44 (2003)) Therefore a small molecule Akt inhibitor is expected to be useful for the treatment of these types of cancer as well as other types of cancer Akt inhibitors are also useful in combination with further chemotherapeutic and anticancer agents It is an object of the instant invention to provide novel compounds that are inhibitors of Akt/PKB It is also an object of the present invention to provide pharmaceutical compositions that comprise a pharmaceutical carner and compounds useful in the methods of the invention It is also an object of the present invention to provide a method for treating cancer that comprises administering such inhibitors of Akt/PKB activity It is also an object of the present invention to provide a method for treating arthritis that comprises admmistenng such inhibitors of Akt/PKB activity SUMMARY OF THE INVENTION This invention relates to novel compounds of Formula (I) (Formula Removed) wherein (Formula Removed) R41 and R42 are independently selected from hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted C1-4alkyloxy, furan, substituted fruan, thiophene and substituted thiophene, where Q and Y are independently selected from nitrogen and -C(R70)-, and Z is selected from nitrogen and -C(R48)-, provided that at least one and at most 2 of Q, Y and Z are nitrogen, and R30 is selected from C1-4alkyl and C1-4alkyl substituted with form one to three fluorine atoms, where R is selected from hydrogen, and halogen, and 48 R is selected from hydrogen, C1-4alkyl, substituted C1-4alkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, cylcoalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, and halogen, 43 R is selected from hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted C1-4alkyloxy, furan and thiophene, R is absent or selected from -(CR60R61 )mAR wherein the AR is unsubsttuted, -( CR60 R61 )mAR wherein the AR is substituted and C1-6alkyl. where m is 0 to 3 and AR is a cyclic or polycyclic aromatic or saturated or unsaturated non-aromatic ring containing from 3 to 16 carbon atoms and optionally containing from one to three heteroatoms, provided that when the ring is aromatic and the number of carbon atoms is 3 the ring contains at least two heteroatoms and when the ring is aromatic and the number of carbon atoms is 4 the ring contains at least one heteroatom, and R60 and R61 are independently selected from hydrogen and C1-4alkyl, provided that when m is 3 no more than 4 of R and R when added together are C1-4alkyl, 45 R is selected from hydrogen and C1-4alkyl, 20 R is selected from hydrogen, C1-4alkyl and hydroxy, X is selected from O, S and NR49 , 49 where R is selected from hydrogen and C1-4alkyl, and n is 0 to 2 and this moiety is optionally, if applicable, substituted by hydroxyC1-4alkyl, (Formula Removed) provided that one and only one of R41 and R42 is and/or pharmaceutically acceptable salts thereof This invention relates to a method of treating cancer, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I) This invention relates to a method of treating arthritis, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I) The present invention also relates to the discovery that the compounds of Formula (I) are active as inhibitors of Akt/PKB In a further aspect of the invention there is provided novel processes and novel intermediates useful in preparing the presently invented Akt/PKB inhibiting compounds Included in the present invention are pharmaceutical compositions that compnse a pharmaceutical carrier and compounds useful in the methods of the invention Also included in the present invention are methods of co-administering the presently invented Akt/PKB inhibiting compounds with further active ingredients DETAILED DESCRIPTION OF THE INVENTION This invention relates to compounds of Formula (I) as described above The presently invented compounds of Formula (I) inhibit Akt/PKB activity In particular, the compounds disclosed herein inhibit each of the three Akt/PKB isoforms Included among the presently invented compounds of Formula (I) are those in which (Formula Removed) R41 and R42 are independently selected from hydrogen, , halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted C1-4alkyloxy, furan, substituted fruan, thiophene and substituted thiophene, where Q is nitrogen, Y is selected from nitrogen and -C(R70)-, and Z is selected from nitrogen and 48 -C(R )-, provided that at most one of Y and Z are nitrogen, and 30 R is selected from C1-4alkyl and C1-4alkyl substituted with form one to three fluorine atoms, where R is selected from hydrogen, and halogen, and 48 R is selected from hydrogen, C1-4alkyl, substituted C1-4alkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, cylcoalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, and halogen, 43 R is selected from hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted C1-4alkyloxy, furan and thiophene, R is absent or selected from -(CR R )mAR wherein the AR is unsubstituted, -( CR60 R61 )mAR wherein the AR is substituted and C1-6alkyl, where m is 0 to 3 and AR is a cyclic or polycyclic aromatic or saturated or unsaturated non-aromatic ring containing from 3 to 16 carbon atoms and optionally containing from one to three heteroatoms, provided that when the ring is aromatic and the number of carbon atoms is 3 the ring contains at least two heteroatoms and when the ring is aromatic and the number of carbon atoms is 4 the nng contains at least one heteroatom, and R60 and R61 are independently selected from hydrogen and C1- 4alkyl, provided that when m is 3 no more than 4 of R and R when added together are C1-4alkyl, R45 is selected from hydrogen and C1-4alkyl, R20 is selected from hydrogen, C1-4alkyl and hydroxy, X is selected from O, S and NR49 , where R49 is selected from hydrogen and C1-4alkyl, and n is 0 to 2 and this moiety is optionally, if applicable, substituted by hydroxyC1-4alkyl, (Formula Removed) provided that one and only one of R41 and R42 is and/or pharmaceutically acceptable salts thereof Included among the presently invented compounds of Formula (I) are those in which (Formula Removed) R and R are independently selected from hydrogen, halogen, C1-4alkyl, trifluoromethyl, methoxy, furan and thiophene, where Q is nitrogen, Y is selected from nitrogen and -C(R )-, and Z is selected from nitrogen and 48 -C(R )-, provided that at most one of Y and Z are nitrogen, and R30 is C1-4alkyl, where R70 is selected from hydrogen, and halogen, and R48 is selected from hydrogen, C1-4alkyl, trifluoromethyl, aryl, heteroaryl, cylcoalkyl, heterocycloalkyl, and halogen, R43 is selected from hydrogen, halogen, C1-4alkyl and methoxy, R44 is absent or selected from -(CR60 R61 )mAAR wherein the AAR is unsubstituted, -( CR60 R61)mAAR wherein the AAR is substituted and C1-6alkyl, where m is 0 to 3 and AAR is selected from phenyl, indole, naphthalene, pyridine and cyclohexyl, and R60 and R61 are independently selected from hydrogen and methyl, provided that when m is 3 no more than 4 of R60 and R61 when added together are methyl, R45 is selected from hydrogen and C1-4alkyl, R20 is selected from hydrogen, methyl and hydroxy, X is selected from O, S and NR49 , where R49 is selected from hydrogen and methyl, and n is 1 to 2 and this moiety is optionally substituted by hydroxylmethyl, (Formula Removed) provided that one and only one of R41 and R42 is and/or pharmaceutically acceptable salts thereof Included among the presently invented compounds of Formula (I) are those in which (Formula Removed) R41 and R42 are independently selected from hydrogen, halogen, C1-4alkyl, trifluoromethyl, methoxy and furan, where Q is nitrogen, Y is selected from nitrogen and -C(R70)-, and Z is selected from nitrogen and -C(R48 )-, provided that at most one of Y and Z are nitrogen, and R30 is C1-4alkyl, where R70 is selected from hydrogen, and halogen, and R48 is selected from hydrogen, C1-4alkyl, trifluoromethyl, phenyl, cylcopropyl, and halogen, R43 is selected from hydrogen, halogen, C1-4alkyl and methoxy, R44 is absent or selected from -(CR60 R461 )mAAR wherein the AAR is unsubstituted, -( CR60 R61 )mAAR wherein the AAR is substituted and C1-6alkyl, where m is 0 to 3 and AAR is selected from phenyl, indole, naphthalene, pyndine and cyclohexyl, and R60 and R61 are independently selected from hydrogen and methyl, provided that when m is 3 no more than 4 of R60 and R61 when added together are methyl, R45 is selected from hydrogen and C1-4alkyl, R20 is selected from hydrogen, methyl and hydroxy, X is selected from O, S and NR49, where R49 is selected from hydrogen and methyl, and n is 1 to 2 and this moiety is optionally substituted by hydroxylmethyl, (Formula Removed) provided that one and only one of R41 and R42 is and/or pharmaceutically acceptable salts thereof Included among the presently invented compounds of Formula (I) are those in which R41 is selected from chlorine, ethyl, methyl and methoxy, (Formula Removed) where Q is nitrogen, Y is -CH- and Z is -C(R48 )-, and R30 is selected from methyl and ethyl, where R48 is selected from hydrogen, methyl, chlorine and bromine, R43 is hydrogen, R44 is -CH2-phenyl wherein the phenyl is substituted by one or two substituents selected from fluorine and trifluoromethyl, 45 R is hydrogen, R is hydrogen, X is selected from O and S, and n is 1, and/or pharmaceutically acceptable salts thereof Included in the presently invented compounds of Formula (I) are compounds of Formula (AA) (Formula Removed) R and R are independently selected from hydrogen halogen, C1-4alkyl, furan and thiophene, where R6 is C1-4alkyl and R7 is selected from hydrogen, C1-4alkyl and halogen, 3 R is selected from hydrogen, halogen, C1-4alkyl, furan and thiophene, R4 is selected from -(CH2)maryl and ~(CHfe2 )maryl wherein the aryl is substituted, where m is 0 to 2, R5 is selected from hydrogen and C1-4alkyl, X is selected from O and S, and n is 0 to 2, (Formula Removed) provided that one and only one of R and R is and further provided that at least one of R , R and R is hydrogen, and/or pharmaceutically acceptable salts thereof Included in the presently invented compounds of Formula (I) are compounds of Formula (BB) (Formula Removed) R and R are independently selected from hydrogen, halogen, C1-4alkyl, furan and thiophene, R is C1-4alky!, R is selected from hydrogen, C1-4alkyl and halogen, R is selected from -(CH2)mC5-C12aryl and -(CH2)mC5-C12aryl wherein the aryl is substituted, where m is 0 to 2, 11 R is selected from hydrogen and C1-4alkyl, X is selected from O and S, and provided that at least one of R and R is hydrogen, and/or pharmaceutically acceptable salts thereof Included in the presently invented compounds of Formula (I) are compounds of Formula (CC) (Formula Removed) wherein 12 R is selected from hydrogen, halogen, C1-4alkyl, furan and thiophene, 13 R is selected from -(CH2)mPhenyl and -(CH2)mPhenyl wherein the phenyl is substituted, where m is 0 to 2, X is selected from O and S, and and/or pharmaceutically acceptable salts thereof Included among the compounds useful in the present invention are N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide, N-(2-amino-1-phenylethyl)-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide, N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)--2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-(3-furanyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylrnethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[3-amino-1-(phenylmethyl)propyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, 4-bromo-N-[2-(methylamino)-1-phenylethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1 -(phenylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-[1-(aminomethyl)-3-phenylpropyl]-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[1-(aminomethyl)-3-phenylpropyl]-5-(1-methyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide, 4-bromo-N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, 4-bromo-N-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-1 -methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide, N-[2-a mi no-1 -(phenyl methyl )ethy I]-1 -methyl-4-( 1 -methyl-1 H-py razol-5-y I )-1 H-pyrrole-2-carboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-(methylamino)-1-(phenylmethyl)ethyl]-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-N-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-ylly-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -20- N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1 -{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,4-triazol-5-yl )-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-imidazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-3,4-dibromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(1 H-indol-3-ylmethyl)ethyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -21 - N-[2-amino-1-(1-naphthalenyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(1-naphthalenyl)ethyl]-4-(1-methyl-1f/-pyrazol-5-yl)-2-thiophenecarboxamide, N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-(1-methyl-1H-pyra2ol-5-yl)-2-thiophenecarboxamide, N-{2-amino-1 -[2-(trifluoromethyl)phenyl]ethyl}-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,5-difIuorophenyl)methyl]ethyl}-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-[(3-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{{ 1 S)-2-am ino-1-[(4-ch lorophenyl )methyl]ethyl}-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-(3-amino-1-phenylpropyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -22- N-[2-amino-1-(phenylmethyl)ethyl]-3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1,4-dimethyl-1 f/-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxy-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl )-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -23- N-[2-amino-1 -(phenylmethyl)ethyl]-3-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyI]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, -24- N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamicle, N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, -25- N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(4-chlora-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyi)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenylJmethyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1 -methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide, -26- N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide, N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide, N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide, -27- N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-(( 1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,6-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,4-difIuorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S}-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -28- N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-methyl-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxam!de, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, -29- N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide, N-{( 1 S)-2-amino-1 -[(4-fluorophenyl)methylJethyl}-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,5-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -30- N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl}-2-thiophenecarboxamide, N-{( 1 S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1-methyi-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yI)-5-methyl-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1N-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -31 - N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(3-pyndinylmethyl)ethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1 R)-2-amino-1-phenylethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-phenylethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -phenylethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -phenylethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, -32- N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1 -(4-chlorophenyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(3-chlorophenyl)ethyf]-5-chloro-4-(1-methyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1 -(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide, N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-(2-aminoethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[2-amino-1-(4-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, -33- N-[(1S)-2-amino-1 -phenylethyl]-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -methylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[3-(trifluoromethyl)phenyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-[(1S)-1 -(aminomethyl)-3-methylbutyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, -34- N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1 -methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-t(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, N-{(1S)-2-amino-1-[(3-f!uorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -35- N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-5-(trifiuoromethyl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, (N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1 -ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S>2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-diethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, -36- N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl )-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-[2-amino-1-(phenylmethyl)ethyl]-3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-furancarboxamide, N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, -37- N-[(1S)-2-amino-1 -(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(IS)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1 -{[2-(trifluoromethyl )phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide, -38- N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3)4-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1 -methyl-1 H-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecarboxamide, N-[(1S)-2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, -39- N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-[(3-fiuorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(pyphenylmethyl)ethyl]-5-chloro-4-C1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, -40- N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fiuorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chlor(>-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-((1S )-2-am mo-1 -{[2-(tnfluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-nriethyl-1H-1,2,4-triazol-5-yl)-2-furancarboxamide, N-{(1S)-2-amino-1 -[(2,4-dichlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(2,4-dich!orophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(3,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl)-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide, N-[(1S,2S)-2-amino-3-hydroxy-1 -phenylpropyl]-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide, N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide, and N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide, and/or pharmaceutically acceptable salts thereof Compounds of Formula (I) are included in the pharmaceutical compositions of the invention and used in the methods of the invention Certain of the compounds described herein may contain one or more chiral atoms, or may otherwise be capable of existing as two enantiomers Accordingly, the compounds of this invention include mixtures of enantiomers as well as purified enantiomers or enantiomencally enriched mixtures Also, it is understood that all tautomers and mixtures of tautomers are included within the scope of the compounds of Formula (I) Certain compounds described herein may form a solvate which is understood to be a complex of variable stoichiometry formed by a solute (in this invention, a compound of Formula I a salt thereof) and a solvent Such solvents for the purpose of the invention may not interfere with the biological activity of the solute Examples of suitable solvents include, but are not limited to, water, methanol, ethanol and acetic acid Preferably the solvent used is a pharmaceutically acceptable solvent Examples of suitable pharmaceutically acceptable solvents include, without limitation, water, ethanol and acetic acid Most preferably the solvent used is water By the term "aryl", and denvatives thereof, used alone or as part of a larger moiety as in "-(CH2)maryl" as used herein, unless otherwise defined, is meant monocyclic, bicyclic, and tricyclic ring systems having a total of five to fourteen ring members, wherein at least one ring system is aromatic and wherein each ring in the system contains 3 to 7 members, such as phenyl, naphthalene, tetrahydronaphthalene and biphenyl Suitably, by the term "aryl" is meant a monocyclic aromatic ring system having a total of five to 7 ring members By the term "heteroaryl", and derivatives thereof, used alone or as part of a larger moiety as in "-(CH^mheteroaryl" as used herein, unless otherwise defined, is meant a cyclic aromatic ring containing from 3 to 7 carbon atoms and containing from one to 3 heteroatoms, provided that when the number of carbon atoms is 3 the aromatic ring contains at least two heteroatoms Exemplary "heteroaryl" groups include pyridine and indole By the term " cycloalkyl", and denvatives thereof, used alone or as part of a larger moiety as in "-(CH2)mcycloalkyl" as used herein, unless otherwise defined, is meant a non-aromatic cyclic hydrocarbon ring having from three to seven carbon atoms Exemplary "cycloalkyl" groups include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl By the term "heterocycloalkyl", and derivatives thereof, used alone or as part of a larger moiety as in "-(CH2)mheterocycloalkyl" as used herein, unless otherwise defined, is meant a non-aromatic cyclic hydrocarbon ring having from three to six carbon atoms and containing 1 or 2 heteroatoms Exemplary "cycloalkyl" groups include piperazine and pyrrolidine By the term "C5-C-\|2aryl", used alone or as part of a larger moiety as in "-(CH2)rnC5-C12aryl", as used herein, is meant an aromatic group selected from phenyl, naphthalene, tehrahydronaphthanlene and biphenyl The term "substituted" as used herein, unless otherwise defined, is meant that the subject chemical moiety has from one to five substituents, suitably from one to three substituents, selected from the group consisting of -CC^R^O, C1-C4alkyl, hydroxyC-]-C4alkyl, C-j-C4alkyloxy, amino, C1-C4alkyiamino, aminoC-j-C4alkyl, diC1-C4alkylamino, hydroxy, nitro, tetrazole, cyano, oxo, halogen and trifluoromethyl, where R20 is selected form hydrogen, C1-C4alkyl, and trifluoromethyl Suitably, the term "substituted" as used herein is meant that the subject chemical moiety has from one to three substituents, selected from the group consisting of C1-C4alkyl, hydroxyC1-C4alkyl, C1-C4alkyloxy, amino, C1-C4alkylamino, aminoC1-C4alkyl, hydroxy, tetrazole, halogen and trifluoromethyl Suitably, the term "substituted" as used herein is meant that the subject chemical moiety has from one to three substituents, selected from the group consisting of halogen and trifluoromethyl By the term "heteroatom" as used herein is meant oxygen, nitrogen or sulfur By the term "halogen" as used herein is meant a substituent selected from bromide, iodide, chloride and fluoride By the term "alkyl" and derivatives thereof and in all carbon chains as used herein, including alkyl chains defined by the term "-(CH2)n". "-(CH2)m" and the like, is meant a linear or branched, saturated or unsaturated hydrocarbon chain, and unless otherwise defined, the carbon chain will contain from 1 to 12 carbon atoms Examples of alkyl as used herein include -CH3, -CH2-CH3, -CH2-CH2-CH3, -CH(CH3)2, -CH2-CH2-C(CH3)3, -C=C-C(CH3)3, -C(CH3)3, -(CH2)3-CH3, -CH2-CH(CH3)2, -CH(CH3)-CH2-CH3, -CH=CH2, and -CEC-CH3 By the term "treating" and denvatives thereof as used herein, is meant prophylactic and therapeutic therapy Prophylactic therapy is appropriate, for example, when a subject is considered at high nsk for developing cancer, or when a subject has been exposed to a carcinogen As used herein, the term "effective amount" and derivatives thereof means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal or human that is being sought, for instance, by a researcher or clinician Furthermore, the term "therapeutically effective amount" and derivatives thereof means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder The term also includes within its scope amounts effective to enhance normal physiological function Compounds of Formula (I) are included in the pharmaceutical compositions of the invention and used in the methods of the invention Where a -COOH or -OH group is present, pharmaceutically acceptable esters can be employed, for example methyl, ethyl, pivaloyloxymethyl, and the like for -COOH, and acetate maleate and the like for -OH, and those esters known m the art for modifying solubility or hydrolysis characteristics, for use as sustained release or prodrug formulations The pharmaceutically acceptable salts of the compounds of the invention are readily prepared by those of skill in the art The novel compounds of Formulas (I), (AA), (BB) and (CC) are generally prepared as shown in Schemes 1 to 3 below, or by analogous methods, provided the X and 'R' substituents in Formulas (I), (AA), (BB) and (CC) respectively do not include any such substituents that render inoperative the processes of any of Schemes 1 to 3 All of the starting materials are commercially available or are readily made from commercially available starting materials by those of skill in the art General Schemes Scheme 1 (Scheme Removed) Reagents (a) Phthahmide, PPh3, DEAD, THF, RT, (b) NH2NH2) MeOH, 50 °C Amino alcohol (1-1) was reacted under Mitsunobu conditions to provide the differentially protected diamine (I-2) Mitsunobu reactions are well know to those skilled in the art of organic synthesis Methods and reaction conditions for such transformations are discussed in Synthesis 1981, 1-28 Selective deprotection of the phthahmide group of (1-2) using a nucleophilic amine such as hydrazine or methyl amine in a polar solvent such as methanol, afforded amine (1-3) Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein Methods for the protection of amines are descnbed in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience) Scheme 2 (Scheme Removed) Reagents (a) PyBrop, (i-Pr)2NEt, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate, DCM, RT, (b)5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole, K2CO3, Pd(PPh3)4, dioxane/H2O, (c) TFA / DCM, RT Carboxylic acid (II-1) was reacted with 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate to form amide (II-2) A vanety of amide coupling reagents such as EDC, PyBrop, etc are commercially available Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (i-Pr)2NEt Dibromide (II-2) was regioselectively coupled with 1,1-dimethylethyl (2-{[(4,5-dibromo-2-furanyl)carbonyl]amino}-3-phenylpropyl)carbamate using a Suzuki coupling procedure Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4 in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF Methods for palladium-mediated couplings are described in standard reference volumes, such as Schlosser "Organometallics in Synthesis" (published by Wiley and sons) Acidic treatment of II-3 with HCI or TFA to remove the Boc protecting group produced amine (II-4) Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience) Scheme 3 (Scheme Removed) Reagents (a) MeOH, H2SO4, 60°C, (b) AICI3, Br2, CHCI3, (c) 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole, K2CO3, Pd2(t-Bu)3, dioxane/H2O, 70°C, (d) NCS, THF, 70°C, (e) 6M NaOH, THF/MeOH, 50°C, (f) PyBrop, (i-Pr)2NEt, 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione, DCM, RT, (g) NH2NH2, THF/MeOH, RT Carboxylic acid (III-1) was estenfied under standard Fisher estenfication conditions and then selectively halogenated with the aid of a Lewis acid to give (III-2) The dihalogenated ester was selectively coupled with 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole using Suzuki coupling chemistry to give (III-3) Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4 in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF Methods for palladium-mediated couplings are described in standard reference volumes, such as Schlosser "Organometallics in Synthesis" (published by Wiley and sons) Ester (III-3) was chlorinated using NCS and in situ saponified using aqueous NaOH The resulting carboxylic acid (III-4) was coupled with 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione to form amide (III-5) A vanety of amide coupling reagents such as EDC, PyBrop, etc are commercially available Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (i-Pr)2NEt Amide (III-5) was deprotected using hydrazine to give amine (III-6) Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience) By the term "co-administering" and derivatives thereof as used herein is meant either simultaneous administration or any manner of separate sequential administration of an AKT inhibiting compound, as described herein, and a further active ingredient or ingredients, known to be useful in the treatment of cancer, including chemotherapy and radiation treatment, or to be useful in the treatment of arthritis The term further active ingredient or ingredients, as used herein, includes any compound or therapeutic agent known to or that demonstrates advantageous properties when administered to a patient in need of treatment for cancer or arthritis Preferably, if the administration is not simultaneous, the compounds are administered in a close time proximity to each other Furthermore, it does not matter if the compounds are administered in the same dosage form, e g one compound may be administered topically and another compound may be administered orally Typically, any anti-neoplastic agent that has activity versus a susceptible tumor being treated may be co-administered in the treatment of cancer in the present invention Examples of such agents can be found in Cancer Principles and Practice of Oncology by V T Devita and S Hellman (editors), 6th edition (February 15, 2001), Lippincott Williams & Wilkins Publishers A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved Typical antineoplastic agents useful in the present invention include, but are not limited to, anti-microtubule agents such as diterpenoids and vinca alkaloids, platinum coordination complexes, alkylating agents such as nitrogen mustards, oxazaphosphonnes, alkylsulfonates, nitrosoureas, and triazenes, antibiotic agents such as anthracyclins, actmomycins and bleomycins, topoisomerase II inhibitors such as epipodophyllotoxins, antimetabolites such as punne and pynmidine analogues and anti-folate compounds, topoisomerase I inhibitors such as camptothecins, hormones and hormonal analogues, signal transduction pathway inhibitors, nonreceptor tyrosine kinase angiogenesis inhibitors, immunotherapeutic agents, proapoptotic agents, and cell cycle signaling inhibitors Examples of a further active ingredient or ingredients (anti-neoplastic agent) for use in combination or co-administered with the presently invented AKT inhibiting compounds are chemotherapeutic agents Anti-microtubule or anti-mitotic agents are phase specific agents active against the microtubules of tumor cells during M or the mitosis phase of the cell cycle Examples of anti-microtubule agents include, but are not limited to, diterpenoids and vinca alkaloids Diterpenoids, which are denved from natural sources, are phase specific anti -cancer agents that operate at the G2/M phases of the cell cycle It is believed that the diterpenoids stabilize the ß-tubulin subunit of the microtubules, by binding with this protein Disassembly of the protein appears then to be inhibited with mitosis being arrested and cell death following Examples of diterpenoids include, but are not limited to, paclitaxel and its analog docetaxel Pachtaxel, 5ß,20-epoxy-1,2α,4,7ß, 10ß, 13α-hexa-hydroxytax-11 -en-9-one 4,10-diacetate 2-benzoate 13-ester with (2R,3S)-N-benzoyl-3-phenylisoserine, is a natural diterpene product isolated from the Pacific yew tree Taxus brevifolia and is commercially available as an injectable solution TAXOL® It is a member of the taxane family of terpenes It was first isolated in 1971 by Warn et al J Am Chem, Soc , 93 2325 1971), who characterized its structure by chemical and X-ray crystallographic methods One mechanism for its activity relates to pachtaxel's capacity to bind tubulin, thereby inhibiting cancer cell growth Schiff et al, Proc Natl, Acad, Sci USA, 77 1561-1565 (1980), Schiff et al, Nature, 277 665-667 (1979), Kumar, J Biol, Chem, 256 10435-10441 (1981) For a review of synthesis and anticancer activity of some paclitaxel derivatives see D G I Kingston et al, Studies in Organic Chemistry vol 26, entitled ' New trends in Natural Products Chemistry 1986", Attaur-Rahman, P W Le Quesne, Eds (Elsevier, Amsterdam, 1986) pp 219-235 Paclitaxel has been approved for clinical use in the treatment of refractory ovarian cancer in the United States (Markman et al, Yale Journal of Biology and -50- Medicine, 64 583, 1991, McGuire et al, Ann Intern, Med ,111 273,1989) and for the treatment of breast cancer (Holmes et al, J Nat Cancer Inst, 83 1797,1991 ) It is a potential candidate for treatment of neoplasms in the skin (Einzig et al, Proc Am Soc Clin Oncol, 20 46) and head and neck carcinomas (Forastire et al, Sem Oncol, 20 56, 1990) The compound also shows potential for the treatment of polycystic kidney disease (Woo et al, Nature, 368 750 1994), lung cancer and malaria Treatment of patients with paclitaxel results in bone marrow suppression (multiple cell lineages, Ignoff, R J et al, Cancer Chemotherapy Pocket Guide,. 1998) related to the duration of dosing above a threshold concentration (50nM) (Kearns, C M et al, Seminars in Oncology, 3(6) p 16-23, 1995) Docetaxel, (2R.3S)- N-carboxy-3-phenylisoserine,N-tert-butyl ester, 13-ester with 5p-20-epoxy-1,2α,4,7ß,10ß,13α-hexahydroxytax-11-en-9-one 4-acetate 2-benzoate, tnhydrate, is commercially available as an injectable solution as TAXOTERE® Docetaxel is indicated for the treatment of breast cancer Docetaxel is a semisynthetic derivative of paclitaxel q v, prepared using a natural precursor, 10-deacetyl-baccatin III, extracted from the needle of the European Yew tree The dose limiting toxicity of docetaxel is neutropenia Vinca alkaloids are phase specific antineoplastic agents derived from the periwinkle plant Vinca alkaloids act at the M phase (mitosis) of the cell cycle by binding specifically to tubulin Consequently, the bound tubulin molecule is unable to polymenze into microtubules Mitosis is believed to be arrested in metaphase with cell death following Examples of vinca alkaloids include, but are not limited to, vinblastine, vincristine, and vinorelbine Vinblastine, vincaleukoblastine sulfate, is commercially available as VELBAN® as an injectable solution Although, it has possible indication as a second line therapy of various solid tumors, it is primarily indicated in the treatment of testicular cancer and various lymphomas including Hodgkin's Disease, and lymphocytic and histiocytic lymphomas Myelosuppression is the dose limiting side effect of vinblastine Vincristine, vincaleukoblastine, 22-oxo-, sulfate, is commercially available as ONCOVIN® as an injectable solution Vincristine is indicated for the treatment of acute leukemias and has also found use in treatment regimens for Hodgkin's and non-Hodgkin's malignant lymphomas Alopecia and neurologic effects are the most common side effect of vincristine and to a lesser extent myelosupression and gastrointestinal mucositis effects occur Vinorelbine, 3',4'-didehydro -4'-deoxy-C'-norvincaleukoblastine [R-(R,R)-2,3-dihydroxybutanedioate (1 2)(salt)], commercially available as an injectable solution of vinorelbine tartrate (NAVELBINE®), is a semisynthetic vinca alkaloid Vinorelbine is indicated as a single agent or in combination with other chemotherapeutic agents, such as cisplatin, in the treatment of various solid tumors, particularly non-small cell lung, advanced breast, and hormone refractory prostate cancers Myelosuppression is the most common dose limiting side effect of vinorelbine Platinum coordination complexes are non-phase specific anti-cancer agents, which are interactive with DNA The platinum complexes enter tumor cells, undergo, aquation and form intra- and interstrand crosslinks with DNA causing adverse biological effects to the tumor Examples of platinum coordination complexes include, but are not limited to, cisplatin and carboplatin Cisplatin, cis-diamminedichloroplatinum, is commercially available as PLATINOL® as an injectable solution Cisplatin is primarily indicated in the treatment of metastatic testicular and ovarian cancer and advanced bladder cancer The primary dose limiting side effects of cisplatin are nephrotoxicity, which may be controlled by hydration and diuresis, and ototoxicity Carboplatin, platinum, diammine [1,1-cyclobutane-dicarboxylate(2-)-0,0'], is commercially available as PARAPLATIN® as an injectable solution Carboplatin is primarily indicated in the first and second line treatment of advanced ovarian carcinoma Bone marrow suppression is the dose limiting toxicity of carboplatin Alkylating agents are non-phase anti-cancer specific agents and strong electrophiles Typically, alkylating agents form covalent linkages, by alkylation, to DNA through nucleophilic moieties of the DNA molecule such as phosphate, amino, sulfhydryl, hydroxyl, carboxyl, and imidazole groups Such alkylation disrupts nucleic acid function leading to cell death Examples of alkylating agents include, but are not limited to, nitrogen mustards such as cyclophosphamide, melphalan, and chlorambucil, alkyl sulfonates such as busulfan, nitrosoureas such as carmustine, and triazenes such as dacarbazme Cyclophosphamide, 2-[bis(2-chloroethyl)amino]tetrahydro-2H-1,3,2-oxazaphosphonne 2-oxide monohydrate, is commercially available as an injectable solution or tablets as CYTOXAN® Cyclophosphamide is indicated as a single agent or in combination with other chemotherapeutic agents, in the treatment of malignant lymphomas, multiple myeloma, and leukemias Alopecia, nausea, vomiting and leukopenia are the most common dose limiting side effects of cyclophosphamide Melphalan, 4-[bis(2-chloroethyl)amino]-L-phenylalanine, is commercially available as an injectable solution or tablets as ALKERAN® Melphalan is indicated for the palliative treatment of multiple myeloma and non-resectable epithelial carcinoma of the ovary Bone marrow suppression is the most common dose limiting side effect of melphalan Chlorambucil, 4-[bis(2-chloroethyl)amino]benzenebutanoic acid, is commercially available as LEUKERAN® tablets Chlorambucil is indicated for the palliative treatment of chronic lymphatic leukemia, and malignant lymphomas such as lymphosarcoma, giant follicular lymphoma, and Hodgkin's disease Bone marrow suppression is the most common dose limiting side effect of chlorambucil Busulfan, 1,4-butanediol dimethanesulfonate, is commercially available as MYLERAN® TABLETS Busulfan is indicated for the palliative treatment of chronic myelogenous leukemia Bone marrow suppression is the most common dose limiting side effects of busulfan Carmustine, 1,3-[bis(2-chloroethyi)-1 -nitrosourea, is commercially available as single vials of lyophilized material as BiCNU® Carmustine is indicated for the palliative treatment as a single agent or in combination with other agents for brain tumors, multiple myeloma, Hodgkin's disease, and non-Hodgkin's lymphomas Delayed myelosuppression is the most common dose limiting side effects of carmustine Dacarbazine, 5-(3,3-dimethyl-1-triazeno)-imidazole-4-carboxamide, is commercially available as single vials of material as DTIC-Dome® Dacarbazine is indicated for the treatment of metastatic malignant melanoma and in combination with other agents for the second line treatment of Hodgkin's Disease Nausea, vomiting, and anorexia are the most common dose limiting side effects of dacarbazine Antibiotic anti-neoplasties are non-phase specific agents, which bind or intercalate with DNA Typically, such action results in stable DNA complexes or strand breakage, which disrupts ordinary function of the nucleic acids leading to cell death Examples of antibiotic anti-neoplastic agents include, but are not limited to, actinomycms such as dactinomycin, anthrocyclins such as daunorubicin and doxorubicin, and bleomycins Dactinomycin, also know as Actinomycin D, is commercially available in injectable form as COSMEGEN® Dactinomycin is indicated for the treatment of Wilm's tumor and rhabdomyosarcoma Nausea, vomiting, and anorexia are the most common dose limiting side effects of dactinomycin Daunorubicin, (8S-cis-)-8-acetyl-10-[(3-amino-2,3,6-tndeoxy-a-L-lyxo-hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-tnhydroxy-1-methoxy-5,12 naphthacenedione hydrochloride, is commercially available as a liposomal injectable form as DAUNOXOME® or as an injectable as CERUBIDINE® Daunorubicm is indicated for remission induction in the treatment of acute nonlymphocytic leukemia and advanced HIV associated Kaposi's sarcoma Myelosuppression is the most common dose limiting side effect of daunorubicm Doxorubicin, (8S, 10S)-10-[(3-amino-2,3,6-tndeoxy-a-L-lyxo-hexopyranosyl)oxy]-8-glycoloyl, 7,8,9,10-tetrahydro-6,8,11 -tnhydroxy-1 -methoxy-5,12 naphthacenedione hydrochlonde, is commercially available as an injectable form as RUBEX® or ADRIAMYCIN RDF® Doxorubicin is pnmanly indicated for the treatment of acute lymphoblastic leukemia and acute myeloblasts leukemia, but is also a useful component in the treatment of some solid tumors and lymphomas Myelosuppression is the most common dose limiting side effect of doxorubicin Bleomycin, a mixture of cytotoxic glycopeptide antibiotics isolated from a strain of Streptomyces verticillus, is commercially available as BLENOXANE® Bleomycin is indicated as a palliative treatment, as a single agent or in combination with other agents, of squamous cell carcinoma, lymphomas, and testicular carcinomas Pulmonary and cutaneous toxicities are the most common dose limiting side effects of bleomycin Topoisomerase II inhibitors include, but are not limited to, epipodophyllotoxins Epipodophyllotoxins are phase specific antineoplastic agents denved from the mandrake plant Epipodophyllotoxins typically affect cells in the S and G2 phases of the cell cycle by forming a ternary complex with topoisomerase II and DNA causing DNA strand breaks The strand breaks accumulate and cell death follows Examples of epipodophyllotoxins include, but are not limited to, etoposide and teniposide Etoposide, 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R )-ethylidene-p-D-glucopyranoside], is commercially available as an injectable solution or capsules as VePESID® and is commonly known as VP-16 Etoposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of testicular and non-small cell lung cancers Myelosuppression is the most common side effect of etoposide The incidence of leucopenia tends to be more severe than thrombocytopenia Teniposide, 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R )-thenylidene-ß-D-glucopyranoside], is commercially available as an injectable solution as VUMON® and is commonly known as VM-26 Teniposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia in -54- children Myelosuppression is the most common dose limiting side effect of teniposide Teniposide can induce both leucopenia and thrombocytopenia Antimetabolite neoplastic agents are phase specific anti-neoplastic agents that act at S phase (DNA synthesis) of the cell cycle by inhibiting DNA synthesis or by inhibiting purine or pynmidine base synthesis and thereby limiting DNA synthesis Consequently, S phase does not proceed and cell death follows Examples of antimetabolite anti-neoplastic agents include, but are not limited to, fluorouracil, methotrexate, cytarabme, mecaptopunne, thioguanine, and gemcitabine 5-fluorouracil, 5-fluoro-2,4- (1H,3H) pynmidinedione, is commercially available as fluorouracil Administration of 5-fluorouracil leads to inhibition of thymidylate synthesis and is also incorporated into both RNA and DNA The result typically is cell death 5-fluorouracil is indicated as a single agent or in combination with other chemotherapy agents in the treatment of carcinomas of the breast, colon, rectum, stomach and pancreas Myelosuppression and mucositis are dose limiting side effects of 5-fluorouracil Other fluoropyrimidine analogs include 5-fluoro deoxyundine (floxundine) and 5-fluorodeoxyuridine monophosphate Cytarabme, 4-amino-1-\|3-D-arabinofuranosyl-2 (1H)-pynmidinone, is commercially available as CYTOSAR-U® and is commonly known as Ara-C It is believed that cytarabme exhibits cell phase specificity at S-phase by inhibiting DNA chain elongation by terminal incorporation of cytarabme into the growing DNA chain Cytarabme is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia Other cytidine analogs include 5-azacytidme and 2',2'-difluorodeoxycytidine (gemcitabine) Cytarabme induces leucopenia, thrombocytopenia, and mucositis Mercaptopurme, 1,7-dihydro-6H-punne-6-thione monohydrate, is commercially available as PURINETHOL® Mercaptopurme exhibits cell phase specificity at S-phase by inhibiting DNA synthesis by an as of yet unspecified mechanism Mercaptopurme is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia Myelosuppression and gastrointestinal mucositis are expected side effects of mercaptopurme at high doses A useful mercaptopurme analog is azathiopnne Thioguanine, 2-amino-1,7-dihydro-6H-punne-6-thione, is commercially available as TABLOID® Thioguanine exhibits cell phase specificity at S-phase by inhibiting DNA synthesis by an as of yet unspecified mechanism Thioguanine is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia Myelosuppression, including leucopenia, -55- thrombocytopenia, and anemia, is the most common dose limiting side effect of thioguanine administration However, gastrointestinal side effects occur and can be dose limiting Other purine analogs include pentostatin, erythrohydroxynonyladenine, fludarabine phosphate, and cladnbine Gemcitabine, 2'-deoxy-2', 2'-difluorocytidine monohydrochlonde (p-isomer), is commercially available as GEMZAR® Gemcitabine exhibits cell phase specificity at S-phase and by blocking progression of cells through the G1/S boundary Gemcitabine is indicated in combination with cisplatin in the treatment of locally advanced non-small cell lung cancer and alone in the treatment of locally advanced pancreatic cancer Myelosuppre'ssion, including leucopenia, thrombocytopenia, and anemia, is the most common dose limiting side effect of gemcitabine administration Methotrexate, N-[4[[(2,4-diamino-6-ptendinyl) methyljmethylamino] benzoyl]-L-glutamic acid, is commercially available as methotrexate sodium Methotrexate exhibits cell phase effects specifically at S-phase by inhibiting DNA synthesis, repair and/or replication through the inhibition of dyhydrofolic acid reductase which is required for synthesis of purine nucleotides and thymidylate Methotrexate is indicated as a single agent or in combination with other chemotherapy agents in the treatment of choriocarcinoma, meningeal leukemia, non-Hodgkin's lymphoma, and carcinomas of the breast, head, neck, ovary and bladder Myelosuppression (leucopenia, thrombocytopenia, and anemia) and mucositis are expected side effect of methotrexate administration Camptothecins, including, camptothecin and camptothecin denvatives are available or under development as Topoisomerase I inhibitors Camptothecins cytotoxic activity is believed to be related to its Topoisomerase I inhibitory activity Examples of camptothecins include, but are not limited to innotecan, topotecan, and the various optical forms of 7-(4-methylpiperazino-methylene)-10,11-ethylenedioxy-20-camptothecin described below Innotecan HCI, (4S)-4,11-diethyl-4-hydroxy-9-[(4-pipendinopipendino) carbonyloxy]-1 H-pyrano[3',4',6,7]indohzmo[1,2-b]quinohne-3,14(4H, 12H)-dione hydrochloride, is commercially available as the injectable solution CAMPTOSAR® Innotecan is a derivative of camptothecin which binds, along with its active metabolite SN-38, to the topoisomerase I - DNA complex It is believed that cytotoxicity occurs as a result of irreparable double strand breaks caused by interaction of the topoisomerase I DNA inntecan or SN-38 ternary complex with replication enzymes Innotecan is indicated for treatment of metastatic cancer of -56- the colon or rectum The dose limiting side effects of innotecan HCI are myelosuppression, including neutropenia, and Gl effects, including diarrhea Topotecan HCI, (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1 H-pyrano[3',4',6,7]indohzino[1,2-b]quinoline-3,14-(4H, 12H)-dione monohydrochlonde, is commercially available as the injectable solution HYCAMTIN® Topotecan is a derivative of camptothecin which binds to the topoisomerase I - DNA complex and prevents rehgation of singles strand breaks caused by Topoisomerase I in response to torsional strain of the DNA molecule Topotecan is indicated for second line treatment of metastatic carcinoma of the ovary and small cell lung cancer The dose limiting side effect of topotecan HCI is myelosuppression, primarily neutropenia Also of interest, is the camptothecin derivative of formula A following, currently under development, including the racemic mixture (R,S) form as well as the R and S enantiomers (Formula Removed) known by the chemical name "7-(4-methylpiperazino-methylene)-10,11-ethylenedioxy-20(R,S)-camptothecin (racemic mixture) or "7-(4-methylpiperazmo-methylene)-10,11-ethylenedioxy-20(R)-camptothecin (R enantiomer) or "7-(4-methylpiperazino-methylene)-10,11 -ethylenedioxy-20(S)-camptothecin (S enantiomer) Such compound as well as related compounds are described, including methods of making, in U S Patent Nos 6,063,923, 5,342,947, 5,559,235, 5,491,237 and pending U S patent Application No 08/977,217 filed November 24, 1997 Hormones and hormonal analogues are useful compounds for treating cancers in which there is a relationship between the hormone(s) and growth and/or lack of growth of the cancer Examples of hormones and hormonal analogues useful in cancer treatment include, but are not limited to, adrenocorticosteroids such as prednisone and prednisolone which are useful in the treatment of malignant lymphoma and acute leukemia in children, aminoglutethimide and other aromatase inhibitors such as anastrozole, letrazole, vorazole, and exemestane useful in the -57- treatment of adrenocortical carcinoma and hormone dependent breast carcinoma containing estrogen receptors, progestnns such as megestrol acetate useful in the treatment of hormone dependent breast cancer and endometnal carcinoma, estrogens, androgens, and anti-androgens such as flutamide, nilutamide, bicalutamide, cyproterone acetate and 5a-reductases such as finastende and dutastende, useful in the treatment of prostatic carcinoma and benign prostatic hypertrophy, anti-estrogens such as tamoxifen, toremifene, raloxifene, droloxifene, lodoxyfene, as well as selective estrogen receptor modulators (SERMS) such those described in U S Patent Nos 5,681,835, 5,877,219, and 6,207,716, useful in the treatment of hormone dependent breast carcinoma and other susceptible cancers, and gonadotropm-releasmg hormone (GnRH) and analogues thereof which stimulate the release of leutinizing hormone (LH) and/or follicle stimulating hormone (FSH) for the treatment prostatic carcinoma, for instance, LHRH agonists and antagagonists such as goserelin acetate and luprolide Signal transduction pathway inhibitors are those inhibitors, which block or inhibit a chemical process which evokes an intracellular change As used herein this change is cell proliferation or differentiation Signal tranduction inhibitors useful in the present invention include inhibitors of receptor tyrosine kinases, non-receptor tyrosine kinases, SH2/SH3domain blockers, serine/threonine kinases, phosphotidyl inositol-3 kinases, myo-inositol signaling, and Ras oncogenes Several protein tyrosine kinases catalyse the phosphorylation of specific tyrosyl residues in various proteins involved in the regulation of cell growth Such protein tyrosine kinases can be broadly classified as receptor or non-receptor kinases Receptor tyrosine kinases are transmembrane proteins having an extracellular ligand binding domain, a transmembrane domain, and a tyrosine kinase domain Receptor tyrosine kinases are involved in the regulation of cell growth and are generally termed growth factor receptors Inappropriate or uncontrolled activation of many of these kinases, i e aberrant kinase growth factor receptor activity, for example by over-expression or mutation, has been shown to result in uncontrolled cell growth Accordingly, the aberrant activity of such kinases has been linked to malignant tissue growth Consequently, inhibitors of such kinases could provide cancer treatment methods Growth factor receptors include, for example, epidermal growth factor receptor (EGFr), platelet derived growth factor receptor (PDGFr), erbB2, erbB4, vascular endothelial growth factor receptor (VEGFr), tyrosine kinase with immunoglobulm-like and epidermal growth factor homology domains (TIE-2), insulin growth factor-I (IGFI) receptor, macrophage -58- colony stimulating factor (cfms), BTK, ckit, cmet, fibroblast growth factor (FGF) receptors, Trk receptors (TrkA, TrkB, and TrkC), ephnn (eph) receptors, and the RET protooncogene Several inhibitors of growth receptors are under development and include ligand antagonists, antibodies, tyrosine kinase inhibitors and anti-sense oligonucleotides Growth factor receptors and agents that inhibit growth factor receptor function are described, for instance, in Kath, John C , Exp Opin Ther Patents (2000) 10(6) 803-818, Shawver et al DDT Vol 2, No 2 February 1997, and Lofts, F J et al, "Growth factor receptors as targets", New Molecular Targets for Cancer Chemotherapy, ed Workman, Paul and Kerr, David, CRC press 1994, London Tyrosine kinases, which are not growth factor receptor kinases are termed non-receptor tyrosine kinases Non-receptor tyrosine kinases for use in the present invention, which are targets or potential targets of anti-cancer drugs, include cSrc, Lck, Fyn, Yes, Jak, cAbl, FAK (Focal adhesion kinase), Brutons tyrosine kinase, and Bcr-Abl Such non-receptor kinases and agents which inhibit non-receptor tyrosine kinase function are described in Sinh, S and Corey, S J , (1999) Journal of Hematotherapy and Stem Cell Research 8 (5) 465 - 80, and Bolen, J B , Brugge, J S , (1997) Annual review of Immunology 15 371-404 SH2/SH3 domain blockers are agents that disrupt SH2 or SH3 domain binding in a variety of enzymes or adaptor proteins including, PI3-K p85 subunit, Src family kinases, adaptor molecules (She, Crk, Nek, Grb2) and Ras-GAP SH2/SH3 domains as targets for anti-cancer drugs are discussed in Smithgall, T E (1995), Journal of Pharmacological and Toxicological Methods 34(3) 125-32 Inhibitors of Serine/Threonine Kinases including MAP kinase cascade blockers which include blockers of Raf kinases (rafk), Mitogen or Extracellular Regulated Kinase (MEKs), and Extracellular Regulated Kinases (ERKs), and Protein kinase C family member blockers including blockers of PKCs (alpha, beta, gamma, epsilon, mu, lambda, iota, zeta) IkB kinase family (IKKa, IKKb), PKB family kinases, akt kinase family members, and TGF beta receptor kinases Such Serine/Threonine kinases and inhibitors thereof are described in Yamamoto, T, Taya, S , Kaibuchi, K , (1999), Journal of Biochemistry 126 (5) 799-803, Brodt, P, Samani, A, and Navab, R (2000), Biochemical Pharmacology, 60 1101-1107, Massague, J , Weis-Garcia, F (1996) Cancer Surveys 27 41-64, Philip, P A, and Harris, AL (1995), Cancer Treatment and Research 78 3-27, Lackey, K etal Bioorganic and Medicinal Chemistry Letters, (10), 2000, 223-226, U S Patent No 6,268,391, and Martinez-lacaci, L , et al, Int J Cancer (2000), 88(1), 44-52 -59- Inhibitors of Phosphotidyl inositol-3 Kinase family members including blockers of PI3-kinase, ATM, DNA-PK, and Ku may also be useful in the present invention Such kinases are discussed in Abraham, R T (1996), Current Opinion in Immunology 8 (3) 412-8, Canman, C E , Lim, D S (1998), Oncogene 17 (25) 3301-3308, Jackson, S P (1997), International Journal of Biochemistry and Cell Biology 29 (7) 935-8, and Zhong, H et al, Cancer res, (2000) 60(6), 1541-1545 Also of interest in the present invention are Myo-inositol signaling inhibitors such as phospholipase C blockers and Myoinositol analogues Such signal inhibitors are described in Powis, G , and Kozikowski A , (1994) New Molecular Targets for Cancer Chemotherapy ed , Paul Workman and David Kerr, CRC press 1994, London Another group of signal transduction pathway inhibitors are inhibitors of Ras Oncogene Such inhibitors include inhibitors of farnesyltransferase, geranyl-geranyl transferase, and CAAX proteases as well as anti-sense oligonucleotides, nbozymes and immunotherapy Such inhibitors have been shown to block ras activation in cells containing wild type mutant ras, thereby acting as antiproliferation agents Ras oncogene inhibition is discussed in Scharovsky, O G , Rozados, V R , Gervasoni, S I Matar, P (2000), Journal of Biomedical Science 7(4) 292-8, Ashby, M N (1998), Current Opinion in Lipidology 9 (2) 99 - 102, and BioChim Biophys Acta, (19899)1423(3)19-30 As mentioned above, antibody antagonists to receptor kinase hgand binding may also serve as signal transduction inhibitors This group of signal transduction pathway inhibitors includes the use of humanized antibodies to the extracellular hgand binding domain of receptor tyrosine kinases For example Imclone C225 EGFR specific antibody (see Green, M C et al, Monoclonal Antibody Therapy for Solid Tumors, Cancer Treat Rev , (2000), 26(4), 269-286), Herceptin ® erbB2 antibody (see Tyrosine Kinase Signalling in Breast cancer erbB Family Receptor Tyrosine Kinases, Breast Cancer Res , 2000, 2(3), 176-183), and 2CB VEGFR2 specific antibody (see Brekken, R A et al, Selective Inhibition of VEGFR2 Activity by a monoclonal Anti-VEGF antibody blocks tumor growth in mice, Cancer Res (2000)60,5117-5124) Non-receptor kinase angiogenesis inhibitors may also be useful in the present invention Inhibitors of angiogenesis related VEGFR and TIE2 are discussed above in regard to signal transduction inhibitors (both receptors are receptor tyrosine kinases) Angiogenesis in general is linked to erbB2/EGFR signaling since inhibitors of erbB2 and EGFR have been shown to inhibit angiogenesis, primarily VEGF expression Accordingly, non-receptor tyrosine kinase inhibitors may be used in combination with the compounds of the present invention For example, anti-VEGF antibodies, which do not recognize VEGFR (the receptor tyrosine kinase), but bind to the ligand, small molecule inhibitors of integnn (alphav beta3) that will inhibit angiogenesis, endostatin and angiostatin (non-RTK) may also prove useful in combination with the disclosed compounds (See Bruns CJ et al (2000), Cancer Res , 60 2926-2935, Schreiber AB, Winkler ME, and Derynck R (1986), Science, 232 1250-1253, Yen L et al (2000), Oncogene 19 3460-3469) Agents used in immunotherapeutic regimens may also be useful in combination with the compounds of formula (I) There are a number of immunologic strategies to generate an immune response These strategies are generally in the realm of tumor vaccinations The efficacy of immunologic approaches may be greatly enhanced through combined inhibition of signaling pathways using a small molecule inhibitor Discussion of the immunologic/tumor vaccine approach against erbB2/EGFR are found in Reilly RT et al (2000), Cancer Res 60 3569-3576, and Chen Y, Hu D, Ehng DJ, Robbins J, and Kipps TJ (1998), Cancer Res 58 1965-1971 Agents used in proapoptotic regimens (e g , bcl-2 antisense oligonucleotides) may also be used in the combination of the present invention Members of the Bcl-2 family of proteins block apoptosis Upregulation of bcl-2 has therefore been linked to chemoresistance Studies have shown that the epidermal growth factor (EGF) stimulates anti-apoptotic members of the bcl-2 family (i e , mcl-1) Therefore, strategies designed to downregulate the expression of bcl-2 in tumors have demonstrated clinical benefit and are now in Phase ll/lll trials, namely Genta's G3139 bcl-2 antisense oligonucleotide Such proapoptotic strategies using the antisense oligonucleotide strategy for bcl-2 are discussed in Water JS et al (2000), J Clin Oncol 18 1812-1823, and Kitada S etal (1994), Antisense Res Dev 4 71-79 Cell cycle signalling inhibitors inhibit molecules involved in the control of the cell cycle A family of protein kinases called cyclin dependent kinases (CDKs) and their interaction with a family of proteins termed cyclins controls progression through the eukaryotic cell cycle The coordinate activation and inactivation of different cyclm/CDK complexes is necessary for normal progression through the cell cycle Several inhibitors of cell cycle signalling are under development For instance, examples of cyclin dependent kinases, including CDK2, CDK4, and CDK6 and inhibitors for the same are described in, for instance, Rosania et al, Exp Opin Ther Patents (2000) 10(2) 215-230 In one embodiment, the cancer treatment method of the clarmed invention includes the co-administration a compound of Formula (I) and/or a pharmaceutically acceptable salt thereof and at least one antineoplastic agent, such as one selected from the group consisting of anti-microtubule agents, platinum coordination complexes, alkylating agents, antibiotic agents, topoisomerase II inhibitors, antimetabolites, topoisomerase I inhibitors, hormones and hormonal analogues, signal transduction pathway inhibitors, non-receptor tyrosine kinase angiogenesis inhibitors, immunotherapeutic agents, proapoptotic agents, and cell cycle signaling inhibitors Because the pharmaceutically active compounds of the present invention are active as AKT inhibitors they exhibit therapeutic utility in treating cancer and arthritis Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from brain (gliomas), glioblastomas, Bannayan-Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, inflammatory breast cancer, Wilm's tumor, Ewing's sarcoma, Rhabdomyosarcoma, ependymoma, medulloblastoma, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma, osteosarcoma, giant cell tumor of bone, thyroid, Lymphoblastic T cell leukemia, Chronic myelogenous leukemia, Chronic lymphocytic leukemia, Hairy-cell leukemia, acute lymphoblastic leukemia, acute myelogenous leukemia, Chronic neutrophilic leukemia, Acute lymphoblastic T cell leukemia, Plasmacytoma, Immunoblastic large cell leukemia, Mantle cell leukemia, Multiple myeloma Megakaryoblastic leukemia, multiple myeloma, acute megakaryocyte leukemia, promyelocytic leukemia, Erythroleukemia, malignant lymphoma, hodgkins lymphoma, non-hodgkins lymphoma, lymphoblastic T cell lymphoma, Burkitt's lymphoma, follicular lymphoma, neuroblastoma, bladder cancer, urothelial cancer, lung cancer, vulval cancer, cervical cancer, endometrial cancer, renal cancer, mesothelioma, esophageal cancer, salivary gland cancer, hepatocellular cancer, gastric cancer, nasopharangeal cancer, buccal cancer, cancer of the mouth, GIST (gastrointestinal stromal tumor) and testicular cancer Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from brain (gliomas), glioblastomas, Bannayan-Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma and thyroid Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from ovarian, breast, pancreatic and prostate Isolation and Purification of His-tagqed AKT1 (aa 136-480) Insect cells expressing His-tagged AKT1 (aa 136-480) were lysed in 25 mM HEPES, 100 mM NaCI, 20 mM imidazole, pH 7 5 using a polytron (5 mLs lysis buffer/g cells) Cell debns was removed by centnfuging at 28,000 x g for 30 minutes The supernatant was filtered through a 4 5-micron filter then loaded onto a nickel-chelating column pre-equilibrated with lysis buffer The column was washed with 5 column volumes (CV) of lysis buffer then with 5 CV of 20% buffer B, where buffer B is 25 mM HEPES, 100 mM NaCI, 300 mM imidazole, pH 7 5 His-tagged AKT1 (aa 136-480) was eluted with a 20-100% linear gradient of buffer B over 10 CV His-tagged AKT1 (136-480) eluting fractions were pooled and diluted 3-fold with buffer C, where buffer C is 25 mM HEPES, pH 7 5 The sample was then chromatographed over a Q-Sepharose HP column pre-equilibrated with buffer C The column was washed with 5 CV of buffer C then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D, where buffer D is 25 mM HEPES, 1000 mM NaCI, pH 7 5 His-tagged AKT1 (aa 136-480) containing fractions were pooled and concentrated in a 10-kDa molecular weight cutoff concentrator His-tagged AKT1 (aa 136-480) was chromatographed over a Superdex 75 gel filtration column pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 1 mM DTT, pH 7 5 His-tagged AKT1 (aa 136-480) fractions were examined using SDS-PAGE and mass spec The protein was pooled, concentrated and frozen at -80C His-tagged AKT2 (aa 138-481) and His-tagged AKT3 (aa 135-479) were isolated and purified in a similar fashion His-taqqed AKT Enzyme Assay Compounds of the present invention were tested for AKT 1, 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate The substrate phosphorylation assays use the catalytic domains of AKT 1, 2, or 3 AKT 1, 2 and 3 are also commercially available from Upstate USA, Inc The method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine residue of a biotinylated synthetic peptide SEQ ID NO 1 (Biotin-ahx-ARKRERAYSFGHHA-amide) Substrate phosphorylation was detected by the following procedure Assays were performed in 384well U-bottom white plates 10 nM activated AKT enzyme was incubated for 40 minutes at room temperature in an assay volume of 20ul containing 50mM MOPS, pH 7 5, 20mM MgCl2, 4uM ATP, 8uM peptide, 0 04 uCi [g-33P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1 ul of test compound in 100% DMSO The reaction was stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg2+ and Ca2\ 0 1% Triton X-100, 5mM EDTA, 50uM ATP, 2 5mg/ml Streptavidin-coated SPA beads ) The plate was sealed, the beads were allowed to settle overnight, and then the plate was counted in a Packard Topcount Microplate Scintillation Counter (Packard Instrument Co , Menden, CT) The data for dose responses were plotted as % Control calculated with the data reduction formula 100(U1-C2)/(C1-C2) versus concentration of compound where U is the unknown value, C1 is the average control value obtained for DMSO, and C2 is the average control value obtained for 0 1M EDTA Data are fitted to the curve described by y = ((Vmax x) / ( K + x )) where Vmax is the upper asymptote and K is the IC50 Cloning of full-length human (FU AKT1 Full-length human AKT1 gene was amplified by PCR from a plasmid containing mynstylated-AKT1-ER (gift from Robert T Abraham, Duke University under MTA, described in Khppel et al in Molecular and Cellular Biology 1998 Volume 18 p 5699) using the 5' primer SEQ ID NO 2, 5' TATATAGGATCCATGAGCGACGTGGC 3' and the 3' primer SEQ ID NO 3, AAATTTCTCGAGTCAGGCCGTGCTGCTGG 3' The 5' primer included a BamHI site and the 3'pnmer included an Xhol site for cloning purposes The resultant PCR product was subcloned in pcDNA3 as a BamHI / Xhol fragment A mutation in the sequence (TGC) coding for a Cysteine25 was converted to the wild-type AKT1 sequence (CGC) coding for an Argmine25 by site-directed mutagenesis using the QuikChange® Site Directed Mutagenesis Kit (Stratagene) The AKT1 mutagenic primer SEQ ID NO 4, 5' ACCTGGCGGCCACGCTACTTCCTCC and selection primer SEQ ID NO 5, 5' CTCGAGCATGCAACTAGAGGGCC (designed to destroy an Xbal site in the multiple cloning site of pcDNA3) were used according to manufacturer's suggestions For expression/purification purposes, AKT1 was isolated as a BamHI / Xhol fragment and cloned into the BamHI / Xhol sites of pFastbacHTb (Invitrogen) Expression of FL human AKT1 Expression was done using the BAC-to-BAC Baculovirus Expression System from Invitrogen (catalog # 10359-016) Briefly 1) the cDNA was transferred from the FastBac vector into bacmid DNA, 2) the bacmid DNA was isolated and used to transfect Sf9 insect cells, 3) the virus was produced in Sf9 cells, 4) T ni cells were infected with this virus and sent for purification Purification of FL human AKT1 For the purification of full-length AKT1, 130 g sf9 cells (batch # 41646W02) were resuspended in lysis buffer (buffer A, 1L, pH 7 5) containing 25 mM HEPES, 100 mM NaCI, and 20 mM imidazole The cell lysis was carried out by Avestm (2 passes at 15K-20K psi) Cell debris was removed by centnfuging at 16K rpm for 1 hour and the supernatant was batch bound to 10 ml Nickel Sepharose HP beads at 4 C for over night The beads were then transferred to column and the bound material was eluted with buffer B (25 mM HEPES, 100 mM NaCI, 300 mM imidazole, pH 7 5) AKT eluting fractions were pooled and diluted 3 fold using buffer C (25 mM HEPES, 5 mM DTT, pH 7 5) The sample was filtered and chromatographed over a 10 mL Q-HP column pre-equilibrated with buffer C at 2 mL/min The Q-HP column was washed with 3 column volume (CV) of buffer C, then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D, where buffer D is 25 mM HEPES, 1000 mM NaCI, 5 mM DTT, pH 7 5 5 mL fractions collected AKT containing fractions were pooled and concentrated to 5 ml The protein was next loaded to a 120 ml Superdex 75 sizing column that was pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 5 mM DTT, pH 7 5 2 5 mL fractions were collected AKT 1 eluting fractions were pooled, aliquoted (1 ml) and stored at -80C Mass spec and SDS-PAGE analysis were used to confirm purity and identity of the purified full-length AKT1 Full length AKT2 and full length AKT3 were cloned, expressed and purified in a similar fashion AKT Enzyme Assay Compounds of the present invention are tested for AKT 1, 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate The substrate phosphorylation assays use the catalytic domains of AKT 1, 2, or 3 AKT 1, 2 and 3 are also commercially available from Upstate USA, Inc The method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine residue of a biotinylated synthetic peptide SEQ ID NO 1 (Biotm-ahx-ARKRERAYSFGHHA-amide) Substrate phosphorylation is detected by the following procedure Assays are performed in 384well U-bottom white plates 10 nM activated AKT enzyme is incubated for 40 minutes at room temperature in an assay volume of 20ul containing 50mM MOPS, pH 7 5, 20mM MgCl2, 4uM ATP, 8uM peptide, 0 04 uCi [g- P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1ul of test compound in 100% DMSO The reaction is stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg2+ and Ca2\ 0 1% Triton X-100, 5mM EDTA, 50uM ATP, 2 5mg/ml Streptavidin-coated SPA beads) The plate is sealed, the beads are allowed to settle overnight, and then the plate is counted in a Packard Topcount Microplate Scintillation Counter (Packard Instrument Co , Menden, CT) The data for dose responses are plotted as % Control calculated with the data reduction formula 100(U1-C2)/(C1-C2) versus concentration of compound where U is the unknown value, C1 is the average control value obtained for DMSO, and C2 is the average control value obtained for 0 1M EDTA Data are fitted to the curve described by y = ((Vmax x) / ( K + x )) where Vmax is the upper asymptote and KisthelC50 Compounds of the invention are tested for activity against AKT1, AKT2, and AKT3 in one or more of the above assays The majority of the compounds of the Examples were tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value ^59 against full length AKT1, ^50 against full length AKT2, and > 5 0 against full length AKT3 The compounds of Examples 31, 32, 91, 95, 120, 128, 140, 161, 167, 169, 170, 190, 222, 225, 237, 249, 258 and 259 were tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value ^86 against full length AKT1, and ^75 against full length AKT2 The majority of the compounds of Examples 31, 32, 91, 95, 120, 128, 140, 161, 167, 169, 170, 190, 222, 225, 237, 249, 258 and 259 were tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value, ^76 against full length AKT3 The compound of Example 96 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 9 0 against full length AKT1, equal to 8 0 against full length AKT2, and equal to 8 8 against full length AKT3 The compound of Example 137 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 9 0 against full length AKT1, equal to 7 8 against full length AKT2, and equal to 8 4 against full length AKT3 The compound of Example 224 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 8 7 against full length AKT1, and equal to 7 8 against full length AKT2 The compound of Example 161 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 8 8 against full length AKT1, equal to 7 5 against full length AKT2, and equal to 7 6 against full length AKT3 The compound of Example 222 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 8 8 against full length AKT1, and equal to 7 9 against full length AKT2, and equal to 8 5 against full length AKT3 In the above data, plC50 is defined as -log(IC50) where the IC50 value is expressed in molar units The pharmaceutically active compounds within the scope of this invention are useful as AKT inhibitors in mammals, particularly humans, in need thereof The present invention therefore provides a method of treating cancer, arthritis and other conditions requinng AKT inhibition, which compnses administenng an effective compound of Formula (I) and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof The compounds of Formula (I) also provide for a method of treating the above indicated disease states because of their demonstrated ability to act as Akt inhibitors The drug may be administered to a patient in need thereof by any conventional route of administration, including, but not limited to, intravenous, intramuscular, oral, subcutaneous, intradermal, and parenteral The pharmaceutically active compounds of the present invention are incorporated into convenient dosage forms such as capsules, tablets, or injectable preparations Solid or liquid pharmaceutical carriers are employed Solid carriers include, starch, lactose, calcium sulfate dihydrate, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid Liquid carriers include syrup, peanut oil, olive oil, saline, and water Similarly, the carrier or diluent may include any prolonged release material, such as glyceryl monostearate or glyceryl distearate, alone or with a wax The amount of solid carrier vanes widely but, preferably, will be from about 25 mg to about 1 g per dosage unit When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion, soft gelatin capsule, sterile injectable liquid such as an ampoule, or an aqueous or nonaqueous liquid suspension The pharmaceutical preparations are made following conventional techniques of a pharmaceutical chemist involving mixing, granulating, and compressing, when necessary, for tablet forms, or mixing, filling and dissolving the ingredients, as appropriate, to give the desired oral or parenteral products Doses of the presently invented pharmaceutically active compounds in a pharmaceutical dosage unit as described above will be an efficacious, nontoxic quantity preferably selected from the range of 0 001 -100 mg/kg of active compound, preferably 0 001 - 50 mg/kg When treating a human patient in need of an Akt inhibitor, the selected dose is administered preferably from 1-6 times daily, orally or parenterally Preferred forms of parenteral administration include topically, rectally, transdermally, by injection and continuously by infusion Oral dosage units for human administration preferably contain from 0 05 to 3500 mg of active compound Oral administration, which uses lower dosages, is preferred Parenteral administration, at high dosages, however, also can be used when safe and convenient for the patient Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular Akt inhibitor in use, the strength of the preparation, the mode of administration, and the advancement of the disease condition Additional factors depending on the particular patient being treated will result in a need to adjust dosages, including patient age, weight, diet, and time of administration The method of this invention of inducing Akt inhibitory activity in mammals, including humans, comprises administering to a subject in need of such activity an effective Akt inhibiting amount of a pharmaceutically active compound of the present invention The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use as an Akt inhibitor The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in therapy The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating cancer The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating arthritis The invention also provides for a pharmaceutical composition for use as an Akt inhibitor which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier The invention also provides for a pharmaceutical composition for use in the treatment of cancer which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier The invention also provides for a pharmaceutical composition for use in treating arthritis which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier No unacceptable toxicological effects are expected when compounds of the invention are administered in accordance with the present invention In addition, the pharmaceutically active compounds of the present invention can be co-administered with further active ingredients, such as other compounds known to treat cancer or arthritis, or compounds known to have utility when used in combination with an Akt inhibitor Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent The following Examples are, therefore, to be construed as merely illustrative and not a limitation of the scope of the present invention in any way Expenmental Details The compounds of Examples 1 to 328 are readily made according to Schemes 1 to 3 or by analogous methods Preparation 1 Preparation of 1.1-dimethylethyl (2-amino-2-prtenylethy0carbamate (Formula Removed) a) 1,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate (Formula Removed) To a solution of 2-amino-1-phenylethanol (5 g, 36 4 mmol) in THF (182 mL) at 25 °C was added BoC20 (8 7 g, 40 1 mmol) in one portion After 0 5h, the solution was concentrated and the residue used directly without further purification LC-MS (ES) m/z = 238 (M+H)+ b) 1,1-dimethylethyl[2-(1,3-dioxc-1,3-dihydro-2H-isoindol-2-yl)-2- phenylethyljcarbamate (Formula Removed) o a solution of 1,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate (2 g, 8 44 mmol), phthalimide (1 g, 7 03 mmol) and priphenylphosphine (2 76 g, 10 5 mmol) in THF (35 mL) at 25 °C was added DEAD (1 7 mL, 10 5 mmol) dropwise After 0 5h, the solution was concentrated and purified via column chromatography (silica, 15 % EtOAc in hexanes) affording the title compound (2 g, 80%) as a white foam LC-MS (ES) m/z = 367 (M+H)+ c) 1,1 -dimethylethyl (2-amino-2-phenylethyl)carbamate (Formula Removed) solution of 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-2-phenylethyl]carbamate (2 g, 5 46 mmol) and either MeNH2 (40wt% in H20, 10eq ) or NH2NH2 (10eq ) in MeOH (0 5M, 10 mL) was heated to 60 °C in a sealed tube After 12h, the solution was concentrated and purified via column chromatography (silica-dry load, 2% MeOH in DCM (1% NH4OH)) affording the title compound (1 1 g, 85%) as a white solid LC-MS (ES) m/z = 237 (M+H)+ Preparation 2 (Formula Removed) reparation of 1.1-dimethylethyl (2-amino-3-phenylpropyl)carbamate a) 1-amino-3-phenyl-2-propanol (Formula Removed) solution of 2-(phenylmethyl)oxirane (7 5 g, 56 3 mmol) in NH4OH (100 mL) was stirred at 25 °C in a sealed tube After 12h, the solution was concentrated and used directly LCMS (ES) m/e 152 (M+H)+ b) 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)carbamate (Formula Removed) o a solution of 1-amino-3-phenyl-2-propanol ( 7 6 g, 50 mmole) in THF (50 mL) at RT was added (Boc)20 (12 0 g, 55 mmole) After stirnng at RT for 2 h, the reaction solution was concentrated under vacuum and the residue punfied on silica gel (5% MeOH in DCM (0 5% NH4OH)) affording the title compound (13 1 g, 91%) as a clear yellow oil LCMS (ES) m/z 252 (M+H)+ c) 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3- phenylpropyljca rbamate (Formula Removed) o a solution of 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)carbamate (10 0 g, 39 8 mmol), PPh3 (12 5 g, 47 8 mmol) and phthalimide (6 44 g, 43 8 mmol) in THF (125 mL) at RT was added DEAD (9 4 mL, 59 7 mmol) over 5 mm After 1 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAc, 2 1) to give the title compound as a white solid (12 6 g, 83%) LCMS (ES) m/z 381 (M+H)+ d) 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate NH2NH2 (12 5 mL, 394 mmol) was added to a THF/MeOH (50mL / 50mL) solution of 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (7 5 g, 19 7 mmol) and stirred at 50 °C in a sealed system After 12 hours, the solids were filtered, washing with methanol The filtrate was concentrated and punfied by column chromatography using 5% MeOH in CHCI3containing 0 5% NH4OH to give the title compound (3 75 g, 76%) as a white solid LC-MS (ES) m/z = 251 (M+H)+ Preparation 3 (Formula Removed) reparation of 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate a) 3-amino-1-phenyl-1-propanol (Formula Removed) enzoylacetonitnle (2 g, 13 8 mmol) in THF (35 mL) was added dropwise via addition funnel to a 0 °C solution of LAH (1 6 g, 41 3 mmol) in THF (35 mL) The resulting solution warmed to 25 °C and then was heated to 60 °C for an additional 2h After cooling to 0 °C, a saturated solution of sodium potassium tartrate was added dropwise and the solution was extracted several times with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica, 5-8% MeOH in DCM (1% NH4OH)) affording the amino alcohol (1 4 g, 67%) as a clear oil LCMS (ES) m/z 152 (M+H)+ b) 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)carbamate (Formula Removed) -amino-1-phenyl-1-propanol (1 4 g, 9 27 mmol) was dissolved in THF (50 mL) and BoC2O (2 4 g, 11 1 mmol) was added in one portion After 30 mm , the solution was concentrated and the residue purified through via silica (0 5-1% MeOH in DCM (1% NH4OH)) affording the title compound (1 6 g, 69%) as a pale white solid LCMS(ES)m/z152(M+H)+ c) 1,1-dimethylethyl[3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-ph en yl propyl]ca rba ma te (Formula Removed) o a solution of 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)carbamate (3 g, 11 95 mmol), PPh3 (4 g, 15 5 mmol) and phthalimide (1 8 g, 11 95 mmol) in THF (60 mL) at RT was added DEAD (2 4 mL, 15 5 mmol) over 5 mm After 1 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAc, 4 1) to give the title compound as a white solid (2 2 g, 48%) LCMS (ES) m/z 381 (M+H)+ c) 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate NH2NH2 (1 8 mL, 57 7 mmol) was added to a THF/MeOH (1 1, 30 mL) solution of 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-phenylpropyl]carbamate (2 2 g, 5 79 mmol) and stirred at 50 °C in a sealed system After 12 hours, the solids were filtered, washing with methanol The filtrate was concentrated and punfied by column chromatography using 5% MeOH in CHCI3 containing 1% NH4OH to give the title compound (1 1 g, 76%) as a white solid LC-MS (ES) m/z = 251 (M+H)+ Preparation 4 (Formula Removed) reparation of 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate a) 2-(2-phenylethyl)oxirane (Formula Removed) -chlorobenzenecarboperoxoic acid (12 1 g, 54 0 mmol) is added in one portion to a solution of 3-buten-1-ylbenzene (7 15 g, 54 1 mmol) in CH2CI2 at 0 °C followed by warming to 25 °C overnight Saturated NaHCO3 was added and the mixture separated and the resulting clear oil (8 0 g, quant) was carried forward without further purification LC-MS (ES) m/z = 149 (M+H)+ b) 1-amino-4-phenyl-2-butanol (Formula Removed) -(2-phenylethyl)oxirane (8 0 g, 54 mmol) was placed in a sealed tube with 7N NH3-MeOH (130 mL) and stirred 2 hours at 70 °C followed by concentration to a clear oil (and was used without further purification in the following step c) 1,1-dimethylethyl (2-hydroxy-4-phenylbutyl)carbamate (Formula Removed) -amino-4-pheny!-2-butanol (7 4 g, 50 0 mmol) was dissolved in THF (50 mL) and B0C2O (13 g, 59 6 mmol) was added in one portion After 30 mm , the solution was concentrated and the residue purified through a silica plug (5% MeOH in DCM (0 5% NH4OH)) affording the title compound (13 1 g, 91%) as a clear yellow oil LCMS (ES) m/z 266 (M+H)+ d) 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-4- phenylbutyljcarbamate (Formula Removed) To a solution of 1,1-dimethylethyl (2-hydroxy-4-phenylbutyl)carbamate (3 0 g, 11 4 mmol), PPh3 (3 6 g, 13 7 mmol) and phthahmide (1 84 g, 12 5 mmol) in THF (60 mL) at RT was added DEAD (1 8 mL, 11 4 mmol) over 5 mm After 0 5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2 1) to give the title compound as a white solid (3 1 g, 69%) LCMS (ES) m/z 395 (M+H)+ e) 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate NH2NH2 (2 5 mL, 79 6 mmol) was added to a THF/MeOH (40mL/40mL) solution of 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (3 1 g, 7 83 mmol) and stirred overnight After 12 hours, the solution was concentrated and punfied by column chromatography using 5% MeOH in CHCI3 containing 0 5% NH4OH to give the title compound (1 4 g, 66%) as a white solid LC-MS (ES) m/z = 265 (M+H)+ Preparation 5 (Formula Removed) Preparation of 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione a) 1,1-dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(phenylmethyl)ethyl]carbamate (Formula Removed) To a solution of (S)-(-)-2-(tert-butoxycarbonylamino)-3-phenyl-1-propanol (3 0 g, 11 9 mmole), PPh3 (3 74 g, 14 4 mmole) and phthahmide (1 93 g, 13 1 mmole) in THF (75 mL) at RT was added DEAD (2 8 mL, 17 8 mmole) over 5 mm After 1 5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2 1) to give the title compound as a white solid (4 3 g, 95%) LCMS (ES) m/z 381 (M+H)+ b) 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione To a solution of 1,1-dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(phenylmethyl)ethyl]carbamate (4 3 g, 11 3 mmole) in MeOH (100 mL) at RT was added 4M HCI in dioxane (50 mL) After stirring for 3h at RT, the reaction solution was concentrated to a white solid (quant) LCMS (ES) m/z 281 (M+H)+ Preparation 6 (Formula Removed) Preparation of 2-{(2S)-2-amino-3-[2-(trifiuoromethyl)phenyl]propyl}-1 H-isomdole-1.3(2H)-dione a) 1,1-dimethylethyl ((1S)-2-hydroxy-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)carbamate (Formula Removed) To a solution of N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine (5 g, 15 mmol) in THF (75 mL) at 0 °C stirred was added BH3-THF (45 mL, 45 mmol-1 M in THF) After 12h, the reaction was quenched with AcOH MeOH (1 5, 24 mL) and partitioned between saturated aqueous NaHCO3 and DCM The aqueous phase was then extracted several times with DCM The combined organic fractions were dned over Na2SO4 and used directly (4 2 g, 88%) LCMS (ES) m/e 320 (M+H)+ b) 1,1-dimethylethyl((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)carbamate (Formula Removed) To a solution of 1,1-dimethylethyl ((1S)-2-hydroxy-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)carbamate (4 2 g, 13 2 mmol), priphenylphosphine (4 5 g, 17 1 mmol) and phthalimide (1 9 g, 13 2 mmol) in THF (66 mL) at 25 °C was added diethyl azodicarboxylate (2 7 mL, 17 1 mmol) After stirring at RT for 1 h, the reaction solution was concentrated under vacuum and the residue purified on silica gel (1 % MeOH in DCM) affording the title compound (3 2 g, 54 %) as a white solid LCMS (ES) m/z 449 (M+H)+ c) 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione To a solution of 1,1-dimethylethyl ((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)carbamate (3 2 g, 7 1 mmol) in MeOH (35 mL) at RT was added 4M HCI in dioxane (18 mL) After 12h, the solution was concentrated affording the title compound (2 7 g, quant) as the HCI salt LCMS (ES) m/z 349 (M+H)+ Preparation 7 (Formula Removed) Preparation of 5-(5.5-dimethyl-1,3.2-dioxabonnan-2-yl)-1 -methyl-1 H-pyrazole To a solution of 1-methyl pyrazole (4 1 g, 50 mmole) in THF (100 mL) at 0°C was added n-BuLi (2 2M in THF, 55 mmole) The reaction solution was stirred for 1 hour at RT and then cooled to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (12 3 mL, 60 mmole) After 15 mm at -78°C, the reaction was allowed to warm to 0°C over 1hour The reaction was diluted with saturated NH4CI solution and extracted with DCM The organic fractions were washed with H2O (2 x 100 mL), dried over Na2SO4 and concentrated under vacuum to afford a tan solid (8 0 g, 77%) which was used without further purification LCMS (ES) m/z 127 (M+H)+ for [RB(OH)2], 1H NMR (CDCI3, 400 MHz) δ 7 57 (s, 1H), 6 75 (s, 1H), 4 16 (s, 3H), and 1 41 (s, 12H) Preparation 8 (Formula Removed) Preparation of 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate a) 3-oxo-4-phenylbutanenitnle (Formula Removed) To a solution of cyanoacetic acid (2 g, 23 5 mmol) in THF (100 mL) at -78 °C was added nBuLi (10 mL, 25 9 mmol, 2 5M in hexanes) After 30mm, phenylacetyl chloride (1 6 mL, 118 mmol) was added dropwise Following an additional 30min, the solution was partitioned between 1N HC1-Et20 and the aqueous phase was washed several times with Et20 The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 30% EtOAc in hexanes) yielding the title compound (770 mg, 40%) as a tan oil LCMS (ES) m/z 160 (M+H)+ b) 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate A solution of 3-oxo-4-phenylbutanenitnle (1 1 g, 6 92 mmol) in THF (10 mL) was added to a 0 °C solution of lithium aluminum hydnde (787 mg, 20 8 mmol) in THF (25 mL) After 12h, the solution was quenched with H2O (943 uL), 6N NaOH (716 uL) and H2O (3 5 mL) The resulting precipitate was filtered and the pad was washed several times with DCM The filtrate was concentrated then redissolved in THF (30 mL) and BoC2O (1 5 g, 6 92 mmol) was added in one portion After 30 mm, the solution was concentrated and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound (1g, 55%-2steps) as an orange solid LCMS (ES) m/z 265 (M+H)+ c) 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-4- phenylbutyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate (1 g, 3 77 mmol), PPh3 (1 3 g, 4 91 mmol) and phthalimide (555 mg, 3 77 mmol) in THF (18 mL) at RT was added DEAD (772 uL, 4 91 mmol) over 5 mm After 1 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAc, 5 1) to give the title compound as a white solid (725 mg, 49%) LCMS (ES) m/z 395 (M+H)+ d) 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate NH2NH2 (577 uL, 18 4 mmol) was added to a THF/MeOH (1 1, 10 mL) solution of 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-4- phenylbutyl]carbamate (725 mg, 1 84 mmol) and stirred at 50 °C in a sealed system After 12 hours, the solids were filtered, washing with methanol The filtrate was concentrated and punfied by column chromatography using 5% MeOH in CHCI3 containing 1% NH4OH to give the title compound (483 mg, quant) as a white solid LC-MS (ES) m/z = 264 (M+H)+ Preparation 9 (Formula Removed) Preparation of 4-bromo-5-methyl-2-thiophenecarboxylic acid A solution of bromine (725 uL, 14 1 mmol) in AcOH (2 8 mL) was added dropwise to 5-methyl-2-thiophenecarboxylic acid (2 g, 14 1 mmol) and FeCl3 (456 mg, 2 81 mmol) in AcOH (28 mL) at 25 °C After 5h, the solution was poured onto ice and the precipitate was filtered and washed with water affording the title compound (3 g, quant) as a yellow powder LCMS (ES) m/z 222 (M+H)+ Preparation 10 (Formula Removed) Preparation of methyl 4-bromo-5-methyl-2-thiophenecarboxylate A solution of 4-bromo-5-methyl-2-thiophenecarboxylic acid (3 g, 13 6 mmol) in MeOH (67 mL) and H2SO4 (3 mL) was stirred at 50 °C After 12h, the solution was added to ice-H20 and the pH was adjusted to ~11 The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly yielding the title compound (3 g, 94%) as an orange solid LCMS (ES) m/z 236 (M+H)+ Preparation 11 (Formula Removed) Preparation of 4-bromo-5-chloro-2-thioDhenecarboxylic acid A solution of bromine (634 uL, 12 3 mmol) in AcOH (2 5 mL) was added dropwise to 5-chloro-2-thiophenecarboxylic acid (2 g, 12 3 mmol) and FeCI3 (399 mg, 2 50 mmol) in AcOH (25 mL) at 25 °C The reaction mixture was warmed to reflux where additional bromine (634 uL, 12 3 mmol) and FeCI3 (399 mg, 2 50 mmol) were added After 7d, the solution was poured onto ice and the precipitate was filtered and washed with water affording the title compound (3 g, quant) as a yellow powder LCMS (ES) m/z 242 (M+H)+ Preparation 12 (Formula Removed) Preparation of 1.1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate a) 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)methylcarbamate (Formula Removed) 3-(methylamino)-1-phenyl-1-propanol (4 12 g, 24 9 mmol) was dissolved in THF (30 mL) and BoC2O (1M/THF, 30 mL, 30 mmol) was added in one portion After 30 mm , the solution was concentrated and the residue purified through a silica plug (5% MeOH in DCM (0 5% NH4OH)) affording the title compound (6 4 g, 97%) as a clear yellow oil LCMS (ES) m/z 265 (M+H)+ b) 1,1-dimethylethyl[3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3- phenylpropyl]methylcarbamate (Formula Removed) To a solution of 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)methylcarbamate (2 8 g, 10 4 mmol), PPh3 (3 3 g, 12 7 mmol) and phthalimide (1 86 g, 12 6 mmol) in THF (50 mL) at RT was added DEAD (1 98 mL, 12 6 mmol) over 5 mm After 0 5 h at RT, MeOH (10 mL) was added and the reaction solution was absorbed onto silica and purified via chromatography (hexanes/EtOAC, 2 1) to give the title compound as a white solid (2 7 g, 65%) LCMS (ES) m/z 395 (M+H)+ c) 1,1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate NH2NH2 (1 7 mL, 54 2 mmol) was added to a THF/MeOH (50mL/10mL) solution of 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-phenylpropyl]methylcarbamate (2 7 g, 6 8 mmol) and stirred overnight After 12 hours, the solution was absorbed onto silica and purified by column chromatography using 5% MeOH in CHCI3containing 0 5% NH4OH to give the title compound (1 4 mg, 77%) as a white solid LC-MS (ES) m/z = 265 (M+H)+ Preparation 13 (Formula Removed) Preparation of 1.1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate a) 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)methylcarbamate (Formula Removed) To a solution of 1-(methylamino)-3-phenyl-2-propanol (13 g, 78 mmol) [prepared according to Galons, H et al Eur J Med Chem Chim Ther 1979 14, 165-170 ] in THF (390 mL) at RT was added (Boc)20 (21 6 g, 99 mmol) After stirring at RT for 2 h, the reaction solution was absorbed onto silica and purified via chromatography (35% EtOAc/Hex) affording the title compound (11 6 g, 56%) as a clear yellow oil LCMS (ES) m/z 266 (M+H)+ b) 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3- phenylpropyljmethylcarbamate (Formula Removed) To a solution of 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)methylcarbamate (11 6 g, 43 72 mmol), PPh3 (14 3 g, 54 5 mmol) and phthahmide (8 7 g, 59 1mmol) in THF (220 mL) at RT was added DEAD (8 5 mL, 54 mmol) over 15 mm After 0 5 h at RT, MeOH (10 mL) was added and the reaction solution was absorbed onto silica and purified via chromatography (hexanes/EtOAC, 2 1) to give the title compound as a white solid (9 97 g, 57%) LCMS (ES) m/z 395 (M+H)+ c) 1,1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate NH2NH2 (7 mL, 0 2 mol) was added to a THF/MeOH (100mL/25mL) solution of 1,1 -dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-phenylpropyl]methylcarbamate (2 7 g, 6 8 mmol) and stirred overnight After 12 hours, the solution was absorbed onto silica and purified by column chromatography using 5% MeOH in CHCI3containing 0 5% NH4OH to give the title compound (5 8 mg, 88%) as a white solid LC-MS (ES) m/z = 265 (M+H)+ Preparation 14 (Formula Removed) Preparation of 2-(2-amino-3-methyl-3-phenylbutyl)-1H-isoindole-1,3(2H)-dione a) methyl 2-azido-3-methyl-3-phenylbutanoate (Formula Removed) To a solution of KHMDS (36 mL, 17 9 mmol) in THF (70 mL) at -78 °C was added methyl 3-methyl-3-phenylbutanoate (3 g, 15 6 mmol) in THF (15 mL) dropwise After 1h, trisylazide (5 g, 18 7 mmol) in THF (15 mL) was added dropwise over 10 mm After an additional 5 mm, acetic acid (4 1 mL) was added and the reaction mixture warmed to 25 °C over 1h The solution was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 20% EtOAc in hexanes) yielding the title compound (2 6 g, 71%) contaminated with 33% methyl 3-methyl-3-phenylbutanoate to be purified out in the following steps LCMS (ES) m/e 234 (M+H)+ b) methyl beta.beta-dimethylphenylalaninate (Formula Removed) A solution of methyl 2-azido-3-methyl-3-phenylbutanoate (2 6 g, 11 2 mmol) and PPh3 (4 4 g, 16 7 mmol) in H20 (400 uL) and THF (100 mL) was stirred at 25 °C over 2d then at 50 °C for 12h The solution was concentrated and punfied via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) yielding the title compound (1 4 g, quant) LCMS (ES) m/e 208 (M+H)+ c) 2-amino-3-methyl-3-phenyl-1 -butanol (Formula Removed) To a solution of methyl beta.beta-dimethylphenylalaninate (1 4 g, 6 76 mmol) in THF (20 mL) at 0 °C was added dropwise a solution of lithium aluminum hydride (384 mg, 10 1 mmol) in THF (10 mL) After warming to 25 °C over 12h, the solution was quenched by sequential addition of H20 (659 uL), 6N NaOH (500 uL) and H20 (2 4 mL) The resulting precipitate was filtered and the pad washed thoroughly with DCM The filtrate was concentrated and purified via column chromatography (silica, 2-5% MeOH in DCM (1% NH4OH)) yielding the title compound (770 mg, 64%) LCMS (ES) m/e 179 (M+H)+ d) 1,1-dimethylethyl [1-(hydroxymethyl)-2-methyl-2-phenylpropyl]carbamate (Formula Removed) BoC2O (1 g, 4 76 mmol) was added in one portion to 2-amino-3-methyl-3-phenyl-1-butanol (770 mg, 4 33 mmol) in THF (20 mL) at 25 °C After 30 mm, the solution was concentrated yielding the title compound (1 2 g, quant) as a white solid which was used without further purification LCMS (ES) m/e 279 (M+H)+ e) 1,1-dimethylethyl{1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]-2-methyl-2- phenylpropyl}carbamate (Formula Removed) To a solution of 1,1-dimethylethyl [1-(hydroxymethyl)-2-methyl-2-phenylpropyljcarbamate ( 775 mg, 2 8 mmol), priphenylphosphine (915 mg, 3 5 mmol) and phthahmide (499 mg, 3 4 mmol) in THF (15 mL) at 25 °C was added diethyl azodicarboxylate (0 54 mL, 3 4 mmol) After stirring at RT for 1 h, MeOH was added (5 mL) and the solution was adsorbed onto silica and purified via column chromatography (1 % MeOH in DCM) affording the title compound (723 mg, 64 %) as a white solid LCMS (ES) m/z 409 (M+H)+ f) 2-(2-amino-3-methyl-3-phenylbutyl)-1 H-isoindole-1,3(2H)-dione (Formula Removed) To a solution of 1,1-dimethylethyl {1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]-2-methyl-2-phenylpropyl}carbamate (723 mg, 1 77 mmol) in CHCI3 MeOH (10 1, 55 mL) at RT was added 4M HCI in dioxane (10 mL) After stirring for 3h at RT, the reaction solution was concentrated to a white solid (quant) LCMS (ES) m/z 309 (M+H)+ Preparation 15 (Formula Removed) Preparation of 5-todo-1-methyl-1H-1.2.4-triazole 1-methyl-1H-1,2,4-triazole (2 05 g, 24 7 mmol) was added slowly over 15 minutes to an Et20 solution of nBuLi at -70 °C The mixture was stirred for 60 minutes at -70 °C and allowed to warm to -30 °C A solution of l2 (6 5 g, 25 6 mmol) in THF (27 mL) was added slowly over 15 minutes and the mixture was allowed to warm to room temperature and stir for 60 minutes The mixture was partitioned with saturated Na2S203, the phases were separated and the organic solvent removed The crude iodide was used without further purification LCMS (ES) m/z 210(M+H)+ Preparation 16 (Formula Removed) Preparation of 1.1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate a) hydroxy(1-naphthalenyl)acetonitnle (Formula Removed) To a solution of potassium cyanide in ether (100 mL) at 0 °C was added dropwise a mixture of 1-naphthalenecarbaldehyde (1 56 g, 10 mmol) and acetic acid (1 41 g, 23 5 mmol) in ether (10 mL) The resulting mixture was warmed to 25 °C for 20h, where the precipitate was filtered and the filtrate was concentrated affording the title compound as a clear oil (1 67 g, 9 14 mmol, 91%) LCMS (ES) m/z 184 (M+H)+ b) 2-amino-1 -(1 -naphthalenyl)ethanol (Formula Removed) To a solution of hydroxy(1-naphthalenyl)acetonitnle (1 67 g, 9 14 mol) in THF (90 mL) at 0 °C was added dropwise a solution of LAH-THF (1M, 11 mL, 11 mmol) After 2 hrs, the solution was quenched by sequential addition of H2O (0 42 mL), 6N NaOH (6M, 0 32 mL) and H2O (1 6 mL) The resulting precipitate was filtered and the filtrate was concentrated and used directly yielding the title compound (0 897 g, 4 8 mmol, 53%) as a clear oil LCMS (ES) m/z 188 (M+H)+ c) 1,1-dimethylethyl [2-hydroxy-2-(1-naphthalenyl)ethyl]carbamate (Formula Removed) To a solution of 2-amino-1-(1-naphthalenyl)ethanol(1 38g, 4 8 mmol) in dichloromethane (50 mL) was added Boc anhydride (1 155 g, 5 3 mmole) After stirring at RTfor 12 h, the reaction solution was concentrated and partitioned between NaHCO3 sat /DCM The aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly yielding the title compound as a white solid (1 378 g, 4 8 mmol, quant) LCMS (ES) m/z 288 (M+H)+ d)1,1-dimethylethyl[2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-2-(1-naphthalenyl)ethyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl [2-hydroxy-2-(1-naphthalenyl)ethyl]carbamate (1 38 g, 4 8 mmol), priphenylphosphine (1 52 g, 5 76 mmol) and phthahmide (0 74 g, 5 04 mmol) in THF (50 mL) at 25 °C was added diethyl azodicarboxylate (0 87 mL, 5 52 mmol) After stirring at RT for 1 h, the reaction solution was concentrated under vacuum and the residue purified on silica gel (20% EtOAc in hexanes) affording the title compound (1 29 g, 3 1 mmol, 65 %) as a white solid LCMS (ES) m/z 387 (M+H)+ e) 1,1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-2-(1-naphthalenyl)ethyl]carbamate (1 29 g, 3 1 mmol) in MeOH (30 mL) was added anhydrous hydrazine (0 5 mL, 15 5 mmol) at 25 °C After 12h, the solution was partitioned between DCM/H20 The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly yielding the title compound as a white solid (491 mg, 1 72 mmole, 55%) LCMS (ES) m/z 287 (M+H)+ Preparation 17 (Formula Removed) Preparation of 1.4-dimethyl-5-(4.4.5.5-tetramethyl-1.3.2-dioxaborolan-2-yl)-1H-pyrazole To a suspension of NaH (60% in mineral oil, 3 5 g, 146 mmol, washed with 200 mL of hexane) in THF (200 mL) was added 4-methyl-1 H-pyrazole (10 g, 122 mmol) at 0 °C dropwise After stirring at RT for 1 h, to above suspension was added Mel (7 3 mL, 117 mmol) dropwise at 0 CC The reaction mixture was stirred overnight The Nal by-product was removed by filtration and the filtrate solution was used directly in the next step At 0°C, to above THF solution of 1,4-dimethyl pyrazole was added n-BuLi (2 5M in hexane, 58 5 mL, 146 mmole) The reaction solution was stirred for 2 hour at RT and then cooled to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (27 2 g, 146 mmole) After 15 mm at -78°C, the reaction was allowed to warm to 0°C and stir for 3h The reaction was diluted with saturated NH4CI solution and extracted with DCM The organics were dried over Na2SO4 and concentrated under vacuum to afford the title compound as a brown solid (21 g, 78%) which was used directly without further purification LC-MS 141 (M-C6H12)+, 223 (M+H)+ 1H NMR (CDCI3) δ 7 28 (s, 1H), 4 03 (s, 3H), 2 22 (s, 3H), and 1 32 (s, 12H) Preparation 18 (Formula Removed) Preparation of 2-[(2S)--2-amino-3-(2.6-difluorophenyl]propyl]-1 H-isoindole-1.3(2HV dione a) N-{[(1,1-dimethylethyl)oxy]carbonyl}-2,6-difluoro-L-phenylalanine (Formula Removed) 1,4-Dioxane (55 mL) and water (12 mL) was added to 2,6-difluoro-L-phenylalanine (3 00 g, 12 62 mmol) in a 200 mL round-bottomed flask The mixture was cooled to 0 °C followed by the slow addition of NaOH (12 62 mL, 31 6 mmol) and then BoC20 (3 42 g, 15 20 mmol) The mixture was allowed to warm to room temperature and monitored for completion by LC-MS Upon completion, the mixture was cooled to 0 °C and made neutral by the slow addition of 2 5M HCI (12 mL) The solvents removed under reduced pressure The resulting solid was sonicated with 20%MeOH/CHCl3 (150mL), filtered and the organic solvent removed to give the product (4 3 g, 14 4 mmol, quant) as a white solid which was used in the next step without further purification LC-MS (ES) m/z = 302 (M+H)+ b) 1,1-dimethylethyl [(1S)-2-(2,6-difluorophenyl)-1-(hydroxymethyl)ethyl]carbamate (Formula Removed) BH3 THF (64 7 ml, 64 7 mmol) was added slowly to a tetrahydrofuran (THF) (60 mL) solution of N-{[(1,1-dimethylethyl)oxy]carbonyl}-2,6-drfluoro-L-phenylalanine (4 33 g, 14 37 mmol) at 0 °C in a 200 mL round-bottomed flask The mixture was stirred for 2 hours and then placed in the freezer overnight Excess reagent was quenched by the slow addition of AcOH in MeOH at 0 °C and the mixture warmed to room temperature for 2 hours The THF volume was reduced by 1/2 and the product partitioned between CHCI3 and aqueous NaHCO3 (sat) The combined organic fractions were dried over Na2SO4 and used directly without further purification (3 4 g, 78%) LC-MS (ES) m/z = 288 (M+H)+ c) 1,1-dimethylethyl{(1S)-2-(2,6-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)methyl]ethyl}carbamate (Formula Removed) To a 200 mL round-bottomed flask was added 1,1-dimethylethyl [(1S)-2-(2,6-difluorophenyl)-1-(hydroxymethyl)ethyl]carbamate (3 38 g, 11 76 mmol), phthahmide (2 02 g, 13 73 mmol), and PS - TPP (Polymer bound TnphenylPhosphine (2 15 mmol/g, 4 92 g, 14 76 mmol) in Tetrahydrofuran (THF) (58 8 ml) DEAD (2 23 ml, 14 09 mmol) was added and the mixture stirred at ambient temperature for approximately 30 minutes at which point MeOH was added The mixture was filtered through Celite adsorbed onto silica and purified via column chromatography affording the title compound (2 7 g, 55%) LC-MS (ES) m/z = 317(M+H)+ d) 2-[(2S)-2-amino-3-(2,6-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione In a 200 mL round-bottomed flask was added 1,1-dimethylethyl {(1S)-2-(2,6-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}carbamate (2 72 g, 6 40 mmol) in Chloroform (75 ml) and Methanol (10 ml) HCI / 1,4-Dioxane (40 0 ml, 160 mmol) was added and the mixture stirred overnight The solvents were removed affording the title compound (2 4 g, quant) as the HCI salt LC-MS (ES)m/z = 317(M+H)+ Preparation 19 (Formula Removed) Preparation of 2-[(2S)-2-amino-3-(3-pyridinyl)propyl]-1 1H-isoindole-1.3(2H)-dione a) 1,1-dimethylethyl [(1S)-2-hydroxy-1-(3-pyridinylmethyl)ethyl]carbamate (Formula Removed) To a solution of Boc-L-3-pyridylanihne (1 064 g, 4 mmol) in THF (5 mL) at 0 °C was added BH3-THF (20 mL, 20 mmol-1 M in THF) dropwise After 2 h, the reaction was quenched with AcOH MeOH (1 5, 14 3 mL) at 0 °C, followed by Et3N (1 67 mL, 12 mmol) and l2 (2 03 g, 8 mmol) The resulting mixture was warmed to ambient temperature and stirred for 20h, turning from brown to colorless The solution was concentrated and partitioned between DCM and water The aqueous phase was then extracted several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated to afford the desired product as a colorless oil which was used without further purification (957 6 mg, 95%) LC-MS (ES) m/z= 253 (M+H)+ b) 1,1 -dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -(3- pyridinylmethyl)ethyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl [(1S)-2-hydroxy-1-(3-pyndinylmethyl)ethyl]carbamate (958 mg, 3 8 mmol), priphenylphosphine (1 21 g, 4 6 mmol) and phthahmide (617 mg, 4 2 mmol) in THF (40 mL) at 25 °C was added diethyl azodicarboxylate (0 72 mL, 4 6 mmol) After stirring at RT for 1 h, the reaction solution was concentrated under vacuum and the residue purified on silica gel (0-50% ethyl acetate / hexane) affording the title compound (797 mg, 55 %) as a white solid LCMS (ES) m/z 382 (M+H)+ c) 2-[(2S)-2-amino-3-(3-pyndmyl)propyl]-1 H-isomdole-1,3(2H)-dione To a solution of 1,1-dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(3-pyndinylmethyl)ethyl]carbamate (796 7 mg, 2 1 mmol) in DCM (10 mL) at RT was added 1M HCI in dioxane (10 mL) After 20h, the solution was concentrated affording the title compound (404 mg, 68%) as the HCI salt LCMS (ES) m/z 282 (M+H)+ Preparation 20 (Formula Removed) Preparation of 1-methyl-1H-1,2,3-triazole To a solution of 1,2,3-trazole (10 g, 145 mmol) in 150 ml of THF were added potassium carbonate (40 g, 290 mmol) and Mel (13 58 ml, 217 mmol) The resulting reaction mixture was stirred at rt for 3hr The reaction mixture was filtered and the filtrate was concentrated to afford the title compound (9 2 g, 78%) 1H NMR (400 MHz, CDCI3) δppm 7 71 (s, 1H), 7 55 (s, 1H), 4 14 (s, 3H) Preparation 21 Preparation of 1.4-dimethyl-5-(tributylstannanyl)-1 H-1.2.3-triazole (Formula Removed) ) 1,4-dimethyl-1 H-1,2,3-triazole (Formula Removed) solution of methylamine (25 4 ml, 50 8 mmol, 2M in MeOH) was added dropwise to a suspension of N'-(2,2-dichloro-1-methylethylidene)-4-methylbenzenesulfonohydrazide (ref Sakai, K etal, Bull Chem Soc Jpn, 1986, 59, 179-183) (3 g, 10 16 mmol) in methanol (10 ml) at 0 °C The solid went into solution The resulting dark brown mixture was stirred at 0 °C for 2h, evaporated, and the solid was filtered and rinsed with EtOAc The combined filtrates were concentrated and purified on a 25M biotage column, which was eluted with 50-75% of EA/hexane to give 0 57 g of brown liquid LC-MS (ES) m/z = 98 (M+H)\ 1H NMR (CDCI3, 400 MHz) δ 7 27 (s, 1H), 4 06 (s, 3H), 2 35 (s, 3H) b) 1,4-dimethyl-5-(tnbutylstannanyl)-1 HA ,2,3-triazole (Formula Removed) solution of 1,4-dimethyl-1,2,3-triazole (0 56 g, 5 77 mmol) in THF (5 mL) was added dropwise to a solution of BuLi (2 77 ml, 6 92 mmol, 2 5 M in hexane) in 30 mL of THF at -78 °C under N2 The resulting cloudy mixture was stirred at -70 °C for 1h Then tnbutyltinchlonde (1 711 ml, 6 34 mmol) was added The reaction mixture became clear and was stirred at this temperature for 30 mm, and gradually warmed to rt To the reaction mixture was added 10 ml of NH4CI and 10 ml of water The reaction mixture was extracted with ether The combined organic layers were washed with brine, dried over Na2SO4, and concentrated The residue was purified on FCC (20% EA/Hexane) to give 1 7 g of a clear liquid (73%) LC-MS (ES) m/z = 388 (M+H)+, 1H NMR (CDCI3> 400 MHz) δ 4 05 (s, 3H), 2 38 (s, 3H), 1 5-0 9 (m, 27H) Preparation 22 Preparation of 1.1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]aminol-3-(2,4-dichlorophenyl)propyllcarbamate A solution of 4-bromo-2-thiophenecarboxylic acid (1 29 g, 6 22 mmol), 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (2 0 g, 5 19 mmol), PyBrop (3 62 g, 7 78 mmol) and Hunig's Base (3 62 ml, 20 74 mmol) in DCM (50 ml) was stirred at RT for 30 mm The reaction mixture was washed with H20, 1N HCI, NaHCO3 (sat aq ) and brine The solvent was removed and the residue was dissolved in MeOH, hydrazine monohydrate (1 3 g, 26 mmol) was added The reaction was stirred at rt overnight The white solid formed, and was filtered and rinsed with DCM To the filtrates were added (Boc)2O (1 7g, 7 78 mmol) and NaHCO3 (sat aq , 3 ml) The reaction mixture was stirred at RT for 2 hours and was washed with NaHCO3 (sat aq ) and brine The solvent was removed and the residue was purified by biotage (50% H/E) to give the product (2 Og, 76%) LC-MS (ES) m/z = 531 0 (M+Na)+ Example 1 (Formula Removed) eparation of N-[2-amino-1-(phenylmethyl]ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide a) 1,1-dimethylethyl (2-{[(4,5-dibromo-2-furanyl)carbonyl]amino}-3-phenylpropyl)carbamate (Formula Removed) o a solution of 4,5-dibromo-2-furancarboxylic acid (2 81 g, 10 4 mmol), PyBrOP (5 6 g, 12 0 mmol) and dnsopropylethyl amine (4 2 mL, 24 0 mmol) in DCM (70 mL) at 25 °C was added 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (2 0 g, 8 0 mmol) After 16h, the solution was partitioned between H2O and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and punfied via column chromatography (silica, hexanes/EtOAc, 2 1) affording the title compound (4 3 g, 82%) as a white solid LC-MS (ES) m/z = 503 (M+H)+ b)1,1-dimethylethyl[2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) o a solution of 1,1-dimethylethyl (2-{[(4,5-dibromo-2-furanyl)carbonyl]amino}-3-phenylpropyl)carbamate (0 30 g, 0 60 mmol) in dioxane/H2O (5 1, 8 6 mL) was added K2CO3 (0 25 g, 1 8 mmol), tetrakispriphenylphosphine Pd(0) (70 mg, 0 06 mmol), and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (0 12 g, 0 60 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h The reaction solution was poured onto H2O (100 mL) and extracted with DCM The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 1 1) to give the title compound (0 20 g, 66%) as a white solid LC-MS (ES) m/z = 504 c) N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide 1,1-Dimethylethyl[2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate (0 20 g, 0 40 mmol) was dissolved in DCM (10 mL) and treated with TFA (5 mL) After 2 h, the solution was concentrated, and purified on reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) affording the TFA salt of the title compound (0 16 g, 91%) as a white powder LC-MS (ES) m/z = 405 (M+H)\ 1H NMR (d4-MeOH, 400 MHz) δ 7 59 (s, 1H), 7 33 (m, 3H), 7 30 (m, 2H), 6 85 (s, 1H), 4 57 (m, 1H), 4 03 (s, 3H), 3 25 (m, 1H), 3 14 (m, 1H), and 2 98 (m, 2H) Example 2 (Formula Removed) Preparation of N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 1,1 -dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2- phenylethyl)carbamate (Formula Removed) To a solution of 5-bromo-2-thiophenecarboxylic acid (3 2 g, 15 2 mmol), PyBrOP (8 5 g, 18 2 mmol) and dnsopropylethyl amine (10 6 mL, 60 9 mmol) in DCM (76 mL) at 25 °C was added 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate (3 6 g, 3 14 mmol)[prepared in Preparation 1] After 16h, the solution was partitioned between H20 and washed with DCM The combined organic fraction were dried (Na2SO4), concentrated and purified via column chromatography (silica, 1% MeOH in DCM) affording the title compound (4 g, 62%) as a white solid LC-MS (ES) m/z = 426 (M+H)+ b) 1,1 -dimethylethyl [2-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)- 2-thienyl]carbonyl}amino)ethyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate (1 g, 2 35 mmol) in DMF (9 mL) were added KOAc (693 mg, 7 05 mmol), bis(pmocolato)diboron (1 2 g, 4 71 mmol) and Pd(dppf)CI2 (169 mg, 0 212 mmol) The reaction contents were heated to 80°C in a sealed tube for 18 hours and were then partitioned between 6N NaOH and DCM The pH of the aqueous fraction was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated to a solid under vacuum and used directly in the next reaction LC-MS (ES) m/z = 473 (M+H)+ boronic ester, 391(M+H)+ boronic acid c) 1,1-dimethylethyl [2-({[5-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2- phenylethyljcarbamate (Formula Removed) To a solution of 1,1-dimethylethyl [2-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2-thienyl]carbonyl}amino)ethyl]carbamate (200 mg, 0 42 mmol) in dioxane/H2O (5 1,8 6 mL) was added K2CO3 (234 mg, 1 69 mmol), tetrakispriphenylphosphme Pd(0) (24 mg, 0 02 mmol), and 5-iodo-1-methyl-1H-pyrazole (97 mg, 0 47 mmol) [prepared according to Effenberger, F , et al J Org Chem 1984, 49, 24, 4687] The reaction mixture was heated to 80° C in a sealed tube for 12h The reaction solution was poured onto H2O (100 mL) and extracted with DCM The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (1% MeOH in DCM) to give the title compound (56 mg, 31%) as a yellow solid LC-MS (ES) m/z = 427 d) N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide 1,1 -dimethylethyl [2-({[5-(1 -methyl-1 H-pyrazol-5-yl}-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (56 mg, 0 131 mmol) was dissolved in MeOH (2 mL) and treated with excess 4M HCI in dioxane (656 µL, 2 62 mmol) After 4h, the solution was concentrated affording the title compound (46 mg, quant) as a yellow solid LC-MS (ES) m/z 327 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9 46 (d, J = 8 2 Hz, 1H), 8 27 (bs, 1H), 8 20 (d, J = 4 0 Hz, 1H), 7 48-7 75 (m, 3H), 7 37-7 40 (m, 2H), 7 31-7 33 (m, 1H), 6 58 (d, J = 1 9 Hz, 1H), 5 21-5 30 (m, 1H), 3 97 (s, 3H), 3 36-3 41 (m, 1H), 3 19-3 25 (m, 1H) Example 3 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl]ethyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as an tan solid according to Example 2, except substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (1 65 g, 7 97 mmol)[prepared in Preparation 2] for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z 341 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 8 74 (d, J = 8 5 Hz, 1H), 8 05 (bs, 1H), 7 89 (d, J = 3 9 Hz, 1H), 7 47 (d, J = 1 9 Hz, 1H), 7 43 (d, J = 3 9 Hz, 1H), 7 26-7 29 (m, 3H), 7 20-7 22 (m, 1H), 6 56 (d, J = 2 0 Hz, 1H), 4 31-4 42 (m, 1H), 2 98-3 01 (m, 2H), 2 91-2 93 (m, 2H) Example 4 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-([(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 2, except substituting 4-bromo-2-thiophenecarboxylic acid (1 g, 4 83 mmol) for 5-bromo-2-thiophenecarboxylic acid and 1,1-dimethylethyl (2-amino-3- phenylpropyl)carbamate (1 2 g, 4 83 mmol)[prepared in Preparation 2] for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z 441 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 8 98 (bs, 1H), 8 29 (s, 1H), 8 17 (bs, 2H), 7 98 (s, 1H), 7 46 (s, 1H), 7 27-7 29 (m, 3H), 7 19 (s, 1H), 6 46 (s, 1H), 4 35-4 37 (m, 1H), 3 51 (s, 3H), 2 75-3 12 (m, 4H) Example 5 (Formula Removed) Preparation of N-(2-amino-1-phenylethyl)-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazinolmethyl}-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 2, except substituting 4-bromo-2-thiophenecarboxylic acid (650 mg, 3 14 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 427 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9 65 (d, J = 7 3 Hz, 1H), 8 58 (s, 1H), 8 31 (br s, 2H), 7 99 (s, 1H), 7 42-7 51 (m, 2H), 7 72-7 80 (m, 2H), 7 20-7 31 (m, 1H), 6 51 (s, 1H), 3 52 (s, 1H), 5 25-5 35 (m, 1H), 3 51 (s, 3H), 3 32-3 48 (m, 1H), 3 15-3 21 (m, 1H) Example 6 (Formula Removed) Preparation of N-(2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-5-n-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of 5-bromo-2-thiophenecarboxylic acid (100 mg, 0 48 mmol) in dioxane/H2O (5 1,6 mL) was added K2CO3 (267 mg, 1 93 mmol), tetrakispriphenylphosphine Pd(0) (28 mg, 24 umol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (94 mg, 0 48 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h and was then partitioned between 6N NaOH and DCM The pH of the aqueous phase was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dned (Na2SO4), concentrated under vacuum and used directly without further purification (~100 mg, quant) LC-MS (ES) m/z = 209 (M+H)+ b) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (100 mg, 0 48 mmol), PyBrOP (270 mg, 0 58 mmol) and diisopropylethyl amine (420 uL, 2 4 mmol) in DCM (5 mL) at 25 °C was added 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI (168 mg, 0 48 mmol)[from Preparation 6] After 16h, the solution was partitioned between H2O and washed with DCM The combined organic fractions were dried (Na2SC"4), concentrated and purified via column chromatography (silica) affording the title compound (74 mg, 28%) as a white solid LC-MS (ES) m/z = 539 (M+H)+ c) N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5- yl)-2-thiophenecarboxamide To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (74 mg, 0 14 mmol) in MeOH/THF (2 mL, 1 1) at RT was added hydrazine (86 ^L, 2 75 mmol) After stirring for 18h at RT, the reaction solution was concentrated under vacuum and punfied via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound The neutral compound from above was dissolved in MeOH (2 mL), treated with excess 4M HCI in dioxane (500 nl_) and concentrated affording the HCI salt of the title compound LC-MS (ES) m/z = 409 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8 97 (d, J = 9 0 Hz, 1H), 8 17 (bs, 1H), 8 00 (d, 3 8 Hz, 1H), 7 68 (d, J = 7 8 Hz, 1H), 7 55-7 61 (m, 2H), 7 42-7 47 (m 2H), 6 56 (d, J = 2 0 Hz, 1H), 4 47-4 51 (m, 1H), 4 18 (s, 3H), 3 09-3 11 (m, 4H) Example 7 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 1, except substituting 4,5-dibromo thiophenecarboxylic acid (376 mg, 1 32 mmol) for 4,5-dibromo furancarboxylic acid LC-MS (ES) m/z = 419 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8 92 (d, J = 8 6 Hz, 1H), 8 03-8 06 (m, 2H), 7 56 (d, J = 1 9 Hz, 1H), 7 26-7 32 (m, 3H), 7 21-7 23 (m, 1H), 6 55 (d, J = 1 9 Hz, 1H), 4 32-4 42 (m, 1H), 3 77 (s, 3H), 3 00-3 01 (m, 2H), 2 89-2 91 (m, 2H) Example 8 (Formula Removed) Preparation of N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 1, except substituting 4,5-dibromo thiophenecarboxylic acid (2 2 g, 7 69 mmol) for 4,5-dibromo furancarboxylic acid and 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate (1 1 g, 4 66 mmol) for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z = 406 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9 47 (d, J = 7 9 Hz, 1H), 8 26 (s, 1H), 8 17 (bs, 1H), 7 58 (d, J = 1 6 Hz, 1H), 7 38-7 46 (m, 3H), 7 30-7 34 (m, 1H), 6 56 (d, J = 1 6 Hz, 1H), 5 28-5 37 (m, 1H), 3 81 (s, 3H), 3 35-3 41 (m, 1H), 3 21-3 28 (m, 1H) Example 9 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl)ethyl)-5-(1-methyl-1H-pyrazol-5-vh-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 5-bromo-2-furancarboxylic acid (58 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z = 393 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 7 62 (br s, 1H), 7 57 (m, 1H), 7 51 (m, 3H), 7 22(m, 1H), 6 91 (m, 1H), 6 76 (m, 1H), 4 6 (m, 1H), 4 07 (m, 3H)and 3 15 (m, 4H) Example 10 (Formula Removed) Preparation of N-((1S)-2-amino-1-([3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI (306 mg, 0 80 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione- HCI LC-MS (ES) m/z = 409 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 81 - 2 88 (m, 1H) 2 93 (td, J= 9 03, 4 93 Hz, 2H) 3 09 (dd, J= 13 89, 5 31 Hz, 1H) 4 00 (s, 3H) 4 28 - 4 35 (m, 1H) δ 53 (d, J= 2 02 Hz, 1 H) 7 32 (d, J= 4 04 Hz, 1H) 7 45 - 7 52 (m, 3H) 7 54 - 7 58 (m, 1H)7 60(s, 1H) 7 70 (d, J= 4 04 Hz, 1H) Example 11 (Formula Removed) Preparation of N-((1S)-2-amino-1 -{[2-(trifluoromethyhphenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (237 mg, 0 83 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z = 488 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δppm 2 97 - 3 10 (m, 4H) 3 78 (s, 3H) 4 42 - 4 54 (m, 1H) δ 56 (d, J=2 02 Hz, 1H) 7 45 (t, J=7 58 Hz, 1H) 7 50 - 7 54 (m, 1H) 7 56 - 7 63 (m, 2H) 7 71 (d, J=7 58 Hz, 1H) 7 92 (s, 1H) δ 76 (d, J=9 09 Hz, 1H) Example 12 (Formula Removed) Preparation of N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (237 mg, 0 83 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI (206 mg, 0 535 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H- isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 488 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ ppm 2 97 - 3 07 (m, 1H) 3 10 - 3 21 (m, 2H) 3 27 (d, J=3 54 Hz, 1H) 3 82 (s, 3H) 4 50 - 4 59 (m, 1H) δ 51 (d, J= 2 02 Hz, 1H) 7 50 - 7 60 (m, 4H) 7 62 (s, 1H) 7 71 (s, 1H) Example 13 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 5-bromo-2-furancarboxylic acid (44 mg, 0 23 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI (87 mg, 0 25 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 393 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 63 (br s, 1H), 7 57 (m, 1H), 7 51 (m, 3H), 7 22 (m, 1H), 6 91 (m, 1H), 6 77 (m, 1H), 4 6 (m, 1H), 4 07 (m, 3H) and 3 14 (m, 4H) Example 14 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-furancarboxylic acid (82 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI (115 mg, 0 3 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 472 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 61 (m, 2H), 7 53 (m, 3H), 7 30 (m, 1H), 6 84 (m, 1H), 4 59 (m, 1H), 4 03 (s, 3H), 3 28 (m, 1H), 3 17 (m, 2H) and 3 01 (m, 1H) Example 15 (Formula Removed) Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-furancarboxylic acid (82 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z = 472 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 7 71 (m, 1H), 7 60 (m, 1H), 7 53 (m, 2H), 7 44 (m, 1H), 7 33 (m, 1H), 6 88 (m, 1H), 4 7 (m, 1H), 4 06 (s, 3H), 3 25 (m, 3H) and 3 09 (m, 1H) Example 16 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 1,1-dimethylethyl [2-({[4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbarnate (Formula Removed) To a solution of 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (0 35 g, 0 67 mmol) [from Example 7] in dioxane/H20 (5 1, 25 5 mL) was added K2CO3 (0 28 mg, 2 0 mmol), tetrakistriphenylphosphine Pd(0) (77 mg, 0 06 mmol), and tnmethylboroxine (0 17 mL, 1 2 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h The reaction solution was concentrated under vacuum and punfied on silica gel (hexanes/EtOAc, 1 1) to give the title compound (0 10 g, 33%) as a white solid LC-MS (ES) m/z = 455 (M+H)+ b) N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide 1,1 -dimethylethyl [2-({[4-methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (0 10 g, 0 22 mmol) was dissolved in MeOH (10 mL) and THF (5 mL) and treated with 4 M HCI in dioxane (5 mL) After 4 h, the solution was concentrated affording the HCI salt of the title compound (68 mg, 91%) as a white powder LC-MS (ES) m/z = 355 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 79 (s, 1H), 7 68 (s, 1H), 7 31 (m, 4H), 7 25 (m, 1H), 6 56 (s, 1H), 4 54 (m, 1H), 3 87 (s, 3H), 3 69 (s, 2H), 3 34 (m, 2H), 3 03 (d, J = 7 6 Hz, 2H) and 2 21 (s, 3H) Example 17 (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-4-(3-furanyl)5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 16, except substituting 3-furan boronic acid (0 13 g, 1 2 mmole) for trimethylboroxine LC-MS (ES) m/z = 472 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8 13 (s, 1H), 7 81 (s, 1H), 7 53 (m, 2H), 7 34 (m, 4H), 7 26 (m, 1H), 6 61 (s, 1H), 6 20 (s, 1H), 4 57 (m, 1H), 3 68 (s, 2H), 3 63 (s, 3H), 3 24 (m, 2H) and 3 07 (m, 2H) Example 18 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 5-chloro-2-thiophenecarboxylate (Formula Removed) To a solution of 5-chloro-2-thiophenecarboxylic acid (2 0 g, 12 3 mmol) in dry MeOH (75 mL) was added H2SO4 (1 mL) The reaction mixture was heated to 50° C for 20h and was then concentrated under vacuum The residue was dissolved in DCM and washed several times with saturated NaHCO3 solution The organic fraction was dried (Na2SO4), concentrated under vacuum and used directly without further purification 21 3g, quant) LC-MS (ES) m/z = 177 (M+H)+ b) methyl 5-chloro-4-iodo-2-thiophenecarboxylate (Formula Removed) To a solution of 5-chloro-2-thiophenecarboxylic acid (5 0 g, 28 0 mmol) in acetic acid (150 mL) was added ZnCI2 (38g, 280 mmoles) and benzyltrimethylaminonium dichloroiodate (20 5 g, 58 8 mmole) [Bull Chem Soc Jpn 64, 2566-2568 (1991)] The reaction mixture was heated to 70° C for 48h and was then concentrated under vacuum The residue was extracted with hexanes (2 x 200 mL) and the hexane solution washed with saturated NaHCO3 solution The organic fractions were dned (Na2SO4), concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 4 1) to give the title compound (3 8 g, 45%) as a light yellow solid LC-MS (ES) m/z = 302 (M+H)+ c) methyl 5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 5-chloro-4-iodo-2-thiophenecarboxylate (1 75 g, 5 8 mmol) in dioxane/H20 (50 5 mL) was added K2CO3 (3 4 g, 24 9 mmol), tetrakispriphenylphosphine Pd(0) (0 96 g, 0 83 mmol), and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (3 4 g, 16 5 mmol) The reaction mixture was heated to 80° C in a sealed tube for 15h The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 4 1) to give the title compound (0 35 g, 24%) as a yellow oil LC-MS (ES) m/z = 257 (M+H)+ d) 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (0 30 g, 1 17 mmole) in THF (10 mL) and MeOH (10 mL) was added 6N NaOH (5 mL) The reaction solution was heated to 50°C for 2hrs The reaction solution was concentrated under vacuum, made acidic (pH ~ 2) with 3N HCI, and extracted with DCM The organic solution was dried (Na2SO4) and concentrated to a solid (0 22 g) which was used without further purification LC-MS (ES) m/z = 243 (M+H)+ e) 5-chloro-N-[(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1- (phenylmethyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (0 21 g, 0 87 mmol), PyBrOP (610 mg, 1 3mmol) and diisopropylethyl amine (0 76 mL, 4 35 mmol) in DCM (20 mL) at 25 °C was added 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione HCI (380 mg, 0 96 mmol)[prepared according to Preparation 5] After 16h, the solution was partitioned between H20 and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica) affording the title compound (200 mg, 46%) as a white solid LC-MS (ES) m/z = 505 (M+H)+ f) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a solution of 5-chloro-N-[(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(phenylmethyl)ethyl]-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (200 mg, 0 40 mmol) in MeOH/THF (10 mL, 1 1) at RT was added hydrazine hydrate (0 20 mL, 4 0 mmol) After stirring for 24h at RT, the reaction solution was concentrated under vacuum and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound as a light yellow solid The neutral compound from above was dissolved in DCM (2 mL), treated with excess 4M HCI in dioxane (1mL) and concentrated affording the HCI salt (102 mg) of the title compound LC-MS (ES) m/z = 375 (M+H)\ 7 78 (s, 1H), 7 63 (s, 1H), 7 31 (m, 4H), 7 26 (m, 1H), 6 55 (s, 1H), 4 54 (m, 1H), 3 91 (s, 3H), 3 24 (m, 2H) and 3 03 (m, 2H) Example 19 -111 - (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyl)ethyH-4-bromo-3-(methyloxv)-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 4-bromo-3-hydroxy-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (500 mg, 1 59 mmol), 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (339 mg, 1 75 mmol), Pd(PPh3)4 (92 mg, 79 4 umol) and K2CO3 (876 mg, 6 35 mmol) in dioxane (6 6 mL) and H20 (1 3 mL) were combined in a sealed tube After 12h at 80 °C, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0 5 % MeOH in DCM) affording the title compound (75 mg, 15%) as a brown residue LCMS (ES) m/z = 318 (M+H)+ b) methyl 4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-3-hydroxy-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (175 mg, 0 554 mmol), MeOH (26 ul_, 0 609 mmol), PPh3 (189 mg, 0 720 mmol) in THF (6 mL) at 25 °C was added DEAD (113 uL, 0 720 mmol) in one portion After 30 mm, the reaction was concentrated and purified via column chromatography (silica, 20% EtOAc in hexanes) affording the title compound (135 mg, 74%) as a white solid LC-MS (ES) m/z = 332 (M+H)+ c) 1,1 -dimethylethyl [2-({[4-bromo-3-(methyloxy)-5-(1 -methyl-1 H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) i) A solution of methyl 4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (135 mg, 0 410 mmol) in 6N NaOH (4 mL) and THF (4 mL) was stirred in a sealed tube at 80 °C After 2h, the solution was acidified to pH 3 using 1N HCI then extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 318 (M+H)+ II) To a solution of the crude acid, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (88 mg, 0 351 mmol)[from Preparation 2], dnsopropylethyl amine (305 uL, 1 76 mmol) in DCM (3 5 mL) was added PyBrop (196 mg, 0 422 mmol) in one portion After 12h, additional dnsopropylethyl amine (305 uL, 1 76 mmol) and PyBrop (196 mg, 0 422 mmol) were added After 2h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 550 (M+H)+ d) N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1-methyl-1H- pyrazol-5-yl)-2-thiophenecarboxamide A solution of 1,1-dimethylethyl [2-({[4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part e) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30mm, the solution was concentrated and the residue neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound as the HCI salt LC-MS (ES) m/z 450 (M+H)+, 1H NMR (400 MHz, DMSO-d6) § ppm 8 07 (br s , 3 H) 7 85 (d, J=8 84 Hz, 1 H) 7 58 (d, J=2 02 Hz, 1 H) 7 32 (d, J=7 07 Hz, 2 H) 7 26 - 7 29 (m, 2 H) 7 20 - 7 24 (m, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 4 50-4 55 (m, 1H) 3 79 (d, J=6 82 Hz, 3 H) 3 74 (d, J=6 57 Hz, 1 H) 3 17 (s, 1 H) 2 98-3 10 (m, 4 H) -113- Example 20 (Formula Removed) Preparation of N-r3-amino-1-(phenylmethy0propyll-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of 4,5-dibromo-2-thiophenecarboxylic acid (1 g, 3 5 mmol) in dioxane/H20 (5 1,18 mL) was added K2CO3 (1 9 g, 13 98 mmol), tetrakispriphenylphosphine Pd(0) (201 mg, 0 175 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (678 mg, 3 5 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h and was then partitioned between 6N NaOH and DCM The pH of the aqueous phase was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (~1 g, quant) LC-MS (ES) m/z = 288 (M+H)+ b) 1,1-dimethylethyl[3-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-4-phenylbutyl]carbamate (Formula Removed) To a solution of 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (250 mg, 0 874 mmol), PyBrOP (489 mg, 8 74 mmol) and diisopropylethyl amine (762 uL, 4 37 mmol) in DCM (8 mL) at 25 °C was added 1,1-dimethylethyl (3- amino-4-phenylbutyl)carbamate (230 mg, 0 874 mmol)[prepared according to Preparation 8] After 16h, the solution was partitioned between H20 and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica) affording the title compound (130 mg, 29%) as a white solid LC-MS (ES) m/z = 533 (M+H)+ c) N-[3-amino-1-(phenylmethyl)propyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide A solution of 1,1-dimethylethyl [3-({[4-bromo-5-( 1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-4-phenylbutyl]carbamate (130 mg, 0 24 mmol) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30min, the solution was concentrated and the residue neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (40 mg, 40%) as the HCI salt LC-MS (ES) m/z 433 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 68 (d, J=8 59 Hz, 1 H) 7 97 (s, 1 H) 7 77 (br s, 3 H) 7 57 (d, J=2 02 Hz, 1 H) 7 28 (d, J=2 27 Hz, 3 H) 7 25 -7 32 (m, 2 H) δ 55 (d, J=2 02 Hz, 1 H) 4 17 - 4 24 (m, 1 H) 3 78 (s, 3 H) 2 77 - 2 89 (m, 4 H) 1 85 -1 92 (m, 1 H) 1 81 (td, J=9 54, 4 93 Hz, 1 H) Example 21 (Formula Removed) Preparation of 4-bromo-N-[2-(methylamino)-1-ohenylethyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 1, except substituting 1,1-dimethylethyl (2-amino-2-phenylethyl)methylcarbamate (1 g, 4 02 mmol) [Prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate and substituting 4,5-dibromo-2-thiophenecarboxylic acid (1 89 g, 6 6 mmol) for 4,5- dibromo-2-furancarboxylic acid LCMS (ES) m/z 420 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 9 64 (d, J=8 34 Hz, 1 H) δ 91 (br s , 1 H) δ 33 (s, 1 H) 7 58 (d, J=2 02 Hz, 1 H) 7 42 - 7 50 (m, 2 H) 7 38 - 7 42 (m, 2 H) 7 34 (d, J=7 07 Hz, 1 H) δ 56 (d, J=2 02 Hz, 1 H) δ 37 - 5 44 (m, 1 H) 3 79 (s, 3 H) 3 47 - 3 54 (m, 1 H) 3 33 (td, J=8 46, 3 79 Hz, 1 H) 2 63 (t, J=5 31 Hz, 3 H) Example 22 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyn-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (81 mg, 0 368 mmol)[from Preparation 10] for 4,5-dibromo-2-furancarboxylic acid LC-MS (ES) m/z 355 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=8 34 Hz, 1 H) δ 15 (br s , 3 H) δ 00 (s, 1 H) 7 52 (d, J=1 77 Hz, 1 H) 7 24 - 7 31 (m, 4 H) 7 17 - 7 23 (m, 1 H) δ 36 (d, J=1 77 Hz, 1 H) 4 35 (d, J=3 03 Hz, 1 H) 3 78 (s, 3 H) 3 03 (dd, J=6 82, 2 53 Hz, 1 H) 2 93 - 2 99 (m, 2 H) 2 90 (d, J=6 06 Hz, 1 H) 2 38 (s, 3 H) Example 23 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl]ethyl]-5-chloro-4-(1-methyl-1 H-ovrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 1, except substituting 4-bromo-5-chloro-2-thiophenecarboxylic acid (250 mg, 1 04 mmol)[from Preparation 11] for 4,5-dibromo-2-furancarboxylic acid LC-MS (ES) m/z 375 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 9 09 (d, J=8 59 Hz, 1 H) δ 14 (s, 3 H) δ 10 (br s , 1 H) 7 55 (d, J=1 77 Hz, 1 H) 7 25 - 7 32 (m, 4 H) 7 21 (dd, J=6 19, 2 40 Hz, 1 H) δ 48 (d, J=2 02 Hz, 1 H) 4 35 (d, J=8 59 Hz, 1 H) 3 84 (s, 3 H) 2 99 (d, J=10 86 Hz, 1 H) 2 89 - 2 96 (m, 3 H) Example 24 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of 4-bromo-2-thiophenecarboxylic acid (1 g, 4 83 mmol) in dioxane/H20 (5 1,16 mL) was added K2CO3 (2 7 g, 19 mmol), tetrakispriphenylphosphine Pd(0) (279 mg, 0 241 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h and additional tetrakispriphenylphosphine Pd(0) (279 mg, 0 241 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) were added After 12h, the reaction was partitioned between 6N NaOH and DCM The pH of the aqueous phase was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (-1 g, quant) LCMS (ES) m/z = 209 (M+H)+ b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (600 mg, 2 88 mmol) and N-chlorosuccinimide (384 mg, 2 88 mmol) in THF (14 mL) was stirred in a sealed tube at 70 °C After 1h, the solution was partitioned between H20-DCM, the aqueous phase was adjusted to pH 3 and the aqueous phase was washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further punfication (698 mg, quant) LCMS (ES) m/z = 243 (M+H)+ c) 1,1-dimethylethyl[2-({[4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (350 mg, 1 45 mmol), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (362 mg, 1 45 mmol)[from Preparation 2] and diisopropylethyl amine (1 3 mL, 7 23 mmol) in DCM (7 mL) was added PyBrop (809 mg, 1 74 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 476 (M+H)+ d) N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide A solution of 1,1-dimethylethyl [2-({[4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part c) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30 mm, the solution was concentrated and the residue neutralized through a silica plug (4% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (90 mg, 17%-2steps) as the HCI salt LCMS (ES) m/z 476 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 75 (d, J=8 08 Hz, 1 H) δ 10 (d, J=1 52 Hz, 2 H) δ 08 (s, 3 H) 7 68 (s, 1 H) 7 26 - 7 32 (m, 4 H) 7 22 (dd, J=6 06, 2 53 Hz, 1 H) 4 39 (br s , 1 H) 3 87 (s, 3 H) 2 91 (d, J=7 33 Hz, 4 H) Example 25 (Formula Removed) Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a solution of 4-bromo-5-chloro-2-thiophenecarboxylic acid (1 3 g, 5 42 mmol), PyBrOP (3 g, 6 5 mmol) and diisopropylethyl amine (4 7 mL, 27 1 mmol) in DCM (54 mL) at 25 °C was added 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isomdole-1,3(2H)-dione (2 0 g, 5 42 mmol)[prepared in Preparation 6] After 1 h, the solution was partitioned between H20 and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and used directly LCMS (ES) m/z = 572 (M+H)+ b) 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-[2- (trifluoromethyl)phenyl)propyl}carbamate (Formula Removed) To a solution of 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (crude from part a) in THF-MeOH (1 1, 20 mL) was added hydrazine (1 59 mL, 54 2 mmol) After 12h, the solution was filtered and the filtrate concentrated, dry loaded onto silica and purified via column chromatography (2% MeOH in DCM (1% NH4OH)) affording the free base which was dissolved in THF (25 mL) and treated with BoC20 (1 2 g, 5 31 mmol) After 30 mm the solution was concentrated affording a white powder of the title compound (800 mg, 27%-3 steps) LCMS (ES) m/z = 542 (M+H)+ c) 1,1 -dimethylethyl {(2S)-2-({[5-chloro-4-( 1 -methyl-1 H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (Formula Removed) To a solution of 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamate(750mg, 1 38 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (762 mg, 5 52 mmol), tetrakistriphenylphosphine Pd(0) (80 mg, 69 umol), and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (373 mg, 1 8 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h where additional tetrakistriphenylphosphine Pd(0) (80 mg, 69 umol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (373 mg, 1 8 mmol) were added After 12h, the solution was poured onto H20 (100 mL) and extracted with DCM The organics were dried (NaaSO-O, concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 1 1) to give the title compound (194 mg, 26%) as a white solid LC-MS (ES) m/z = 544 c) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide 1,1-dimethylethyl{(2S)-2-({[5-chloro-4-(1-methyl-1H-pyrazol-5-yl)2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (194 mg, 0 357 mmol) was dissolved in TFA-DCM (3 mL, 1 2) and stirred at 25 °C After 30min, the solution was concentrated with a toluene azeotrope and the residue neutralized through a silica plug (2-5% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (134 mg, 85%) as the HCI salt LCMS (ES) m/z 444 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 9 10 (d, J=9 09 Hz, 1 H) δ 11 (s, 1 H) δ 10 (bs, 3 H) 7 70 (d, J=8 08 Hz, 1 H) 7 57 (d, J=2 02 Hz, 2 H) 7 43 (s, 1 H) δ 49 (d, J=2 02 Hz, 1 H) 4 47 (br s , 1 H) 3 85 (s, 3 H) 3 06 (d, J=8 34 Hz, 4 H) Example 26 (Formula Removed) Preparation ofN-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) The title compound was prepared as white solid according to the procedure of Example 24, except substituting 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (288 mg, 0 826 mmol)[from Preparation 6] for 1,1-dimethylethyl (2-amino-3-phenylpropylCarbamate LCMS (ES) m/z 444 (M+H)+ b)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (150 mg, 0 262 mmol) in THF-MeOH (11,2 mL) was added hydrazine (123 uL, 2 62 mmol) After 12h, the solution was filtered and the filtrate was concentrated, dry loaded onto silica and purified via column chromatography (2% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (30 mg, 26%) as the HCI salt LCMS (ES) m/z 444 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 69 (s, 1 H) δ 11 (d, J=1 26 Hz, 1 H) δ 03 (d, J=1 26 Hz, 1 H) 7 93 (bs, 3H) 7 69 (s, 2 H) 7 53 - 7 59 (m, 2 H) 7 44 (d, J=4 80 Hz, 1 H) 4 49 (br s , 1 H) 3 87 (s, 3 H) 2 99 - 3 12 (m, 4 H) Example 27 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethy0ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting NBS (325 mg, 2 43 mmol) for NCS LCMS (ES) m/z 434 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 65 (br s , 1 H) δ 01 (br s , 3 H) 7 80 (s, 1 H) 7 70 (s, 1 H) 7 25 - 7 32 (m, 4 H) 7 21 (td, J=6 19, 2 78 Hz, 1 H) 4 31 - 4 35 (m, 1 H) 3 71 (s, 3 H) 2 86 - 2 92 (m, 4 H) 2 33 (s, 3H) Example 28 (Formula Removed) Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 26, except substituting 4-bromo-5-methyl-2- thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting NBS (325 mg, 2 43 mmol) for NCS LCMS (ES) m/z 502 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 81 (br s , 1 H) δ 05 (br s , 3 H) 7 83 - 7 90 (m, 1 H) 7 67 - 7 74 (m, 2 H) 7 53 - 7 60 (m, 2 H) 7 39 - 7 47 (m, 1 H) 4 48 (d, J=5 05 Hz, 1 H) 3 68 - 3 76 (m, 3 H) 3 01 -3 08 (m, 4 H) 2 33 (s, 3 H) Example 29 (Formula Removed) Preparation of rV-(nS)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 26, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid LCMS (ES) m/z 457 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 76 (br s , 1 H) δ 03 (br s , 3 H) 7 86 (s, 1 H) 7 70 (s, 2 H) 7 53 - 7 60 (m, 2 H) 7 39 - 7 47 (m, 1 H) 4 46 (d, J=9 35 Hz, 1 H) 3 72 (s, 3 H) 3 03-3 10 (m, 4H)2 34(s, 3 H) Example 30 (Formula Removed) Preparation of AH2-amino-1-(phenylmethy0ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid LCMS (ES) m/z 389 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 67 (br s , 1 H) δ 01 (br s , 3 H) 7 82 (s, 1 H) 7 70 (s, 1 H) 7 25 - 7 32 (m, 4 H) 7 19 - 7 23 (m, 1 H) 4 31 - 4 38 (m, 1 H) 3 71 (s, 3 H) 2 97 (br s , 2 H) 2 89 (t, J=6 19 Hz, 2 H) 2 34 (s, 3 H) Example 31 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 1,1-dimethylethyl {(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (Formula Removed) A solution of 1,1-dimethylethyl {(2S)-2-({[5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (110 mg, 0 202 mmol)[prepared in Example 25] and N-chlorosuccmimide (35 mg, 0 263 mmol) in THF (2 mL) was stirred in a sealed tube at 70 °C After 1h, the solution was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification LCMS (ES) m/z = 578 (M+H)+ b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide 1,1-dimethylethyl{(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (crude from part a) was dissolved in TFA-DCM (3 mL, 1 2) and stirred at 25 °C After 30mm, the solution was concentrated and the residue neutralized through a silica plug (5% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (43 mg, 44%-2 steps) as the HCI salt LCMS (ES) m/z 478 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 9 10 (d, J=8 84 Hz, 1 H) δ 06 (s, 4 H) 7 75 (s, 1 H) 7 70 (d, J=7 83 Hz, 1 H) 7 54 - 7 61 (m, 2 H) 7 43 (t, J=7 45 Hz, 1 H) 4 47 (t, J=8 84 Hz, 1 H) 3 78 (s, 3 H) 2 98 - 3 12 (m, 4 H) Example 32 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide a) 1,1-dimethylethyl {(2S)-2-({[4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-chloro-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (Formula Removed) A solution of 1,1-dimethylethyl {(2S)-2-({[5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (121 mg, 0 22 mmol)[prepared in Example 25] and N-bromosuccinimide (52 mg, 0 290 mmol) in THF (2 mL) was stirred in a sealed tube at 70 °C After 1h, the solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried (NaaSO4), concentrated under vacuum and used directly without further purification LCMS (ES) m/z = 622 (M+H)+ b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide 1,1-dimethylethyl {(2S)-2-({[4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (crude from part a) was dissolved in TFA-DCM (3 mL, 1 2) and stirred at 25 °C After 30 mm, the solution was concentrated and the residue neutralized through a silica plug (5% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (42 mg, 44%-2 steps) as the HCI salt LCMS (ES) m/z 522 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 9 13 (d, J=9 09 Hz, 1 H) δ 17 (br s , 1 H) δ 05 (s, 3 H) 7 75 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 54 -7 61 (m, 2 H) 7 43 (t, J=7 58 Hz, 1 H) 4 46 (d, J=9 60 Hz, 1 H) 3 78 (s, 3 H) 2 99 -3 13(m, 4H) Example 33 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) The title compound was prepare as an orange oil according to Example 24, except substituting N-bromosuccinimide (1 g, 5 77 mmol) for N-chlorosuccinimide LCMS (ES) m/z 288 (M+H)+ b) 4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (688 mg, 2 41 mmol) in dioxane/H2O (5 1,12 mL) was added K2CO3 (1 3 g, 9 6 mmol), tetrakispriphenylphosphine Pd(0) (139 mg, 0 120 mmol), and 5-(5,5-dimethyl-1,3,2-dioxaborman-2-yl)-1-methyl-1H-pyrazole (293 mg, 2 41 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h where additional tetrakispriphenylphosphine Pd(0) (139 mg, 0 120 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (293 mg, 2 41 mmol) were added After 12h, the solution was poured onto H2O and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title compound white was used directly without further purification LC-MS (ES) m/z = 284 (M+H)+ c) 1,1-dimethylethyl [2-({[4-(1 -methyl-4-phenyl-1 H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of 4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (341 mg, 1 2 mmol), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (300 mg, 1 2 mmol)[from Preparation 2], diisopropylethyl amine (1 mL, 6 01 mmol) in DCM (6 mL) was added PyBrop (673 mg, 1 44 mmol) in one portion After 1 h, the reaction contents were partitioned between H2O/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES)m/z = 517(M+H)+ d) N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide A solution of 1,1-dimethylethyl [2-({[4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part c) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30mm, the solution was concentrated and the residue neutralized through a silica plug (4% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (105 mg, 21%-3steps) as the HCI salt LCMS (ES) m/z 417 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 82 (d, J=8 34 Hz, 1 H) δ 14 (br s , 3 H) 7 96 (s, 1 H) 7 90 (d, J=1 26 Hz, 1 H) 7 82 (s, 1 H) 7 29 (s, 1 H) 7 25 (t, J=8 46 Hz, 9 H) 4 34 (dd, J=7 45, 5 68 Hz, 1 H) 3 75 (s, 3 H) 2 94 -3 00 (m, 2 H) 2 89 (dd, J=6 82, 5 31 Hz, 2 H) Example 34 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazo(-5-yl)-2-thiophenecarboxamide a) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) The title compound was prepared as a white solid according to the procedure of Example 33, except substituting 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (420 mg, 1 2 mmol) [from Preparation 6] for 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate LCMS (ES)m/z615(M+H)+ b) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4- phenyl-1 H-pyrazol-5-yl)-2 -thiophenecarboxamide To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (crude from part a) in THF-MeOH (1 1,10 mL) was added hydrazine (384 uL, 12 mmol) After 12h, the solution was filtered and the filtrate was concentrated, dry loaded onto silica and purified via column chromatography (2% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (40 mg, 7%) as the HCI salt LCMS (ES) m/z 485 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 78 (d, J=9 09 Hz, 1 H) δ 05 (br s , 3 H) 7 91 (dd, J=9 09, 1 26 Hz, 2 H) 7 83 (s, 1 H) 7 69 (d, J=7 33 Hz, 1 H) 7 50 - 7 53 (m, 1 H) 7 43 (d, J=7 58 Hz, 1 H) 7 47 (t, J=6 82 Hz, 1 H) 7 23 - 7 30 (m, 4 H) 7 22 (s, 1 H) 4 47 (br s , 1 H) 3 75 (s, 3 H) 3 01 (d, J=8 08 Hz, 4 H) Example 35 (Formula Removed) Preparation ofN-fnS^-amino-Hre-ftrifluoromethyhphenyl]methyl]ethyl)-S-^-chloro-l-methyl-IH-pyrazol-S-ylM-methyl]y-thiophenecarboxamide a) methyl 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 5-bromo-4-methyl-2-thiophenecarboxylate (1 g, 4 25 mmol) in dioxane/H20 (5 1, 20 mL) was added K2CO3 (2 3 g, 17 mmol), bis(tn-t-butylphosphme)palladium(O) (108 mg, 0 213 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-y()-1-methyl-1H-pyrazole (1 2 g, 5 52 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h and additional tetrakispriphenylphosphine Pd(0) (279 mg, 0 241 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) were added After 12h, the reaction was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification LCMS (ES) m/z = 237 (M+H)+ b) 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (crude from part a) in THF (4 mL) and 6N NaOH (4 mL) was heated to 70 °C After 1h, the solution was poured onto H20 and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title compound as a white solid which was used directly without further purification LCMS (ES) m/z = 223 (M+H)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 27, except substituting 4-methyl-5-( 1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (424 mg, 1 92 mmol)for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid LCMS (ES) m/z 457 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=8 84 Hz, 1 H) δ 05 (br s , 3 H) 7 84 (s, 1 H) 7 74 (s, 1 H) 7 71 (d, J=8 08 Hz, 1 H) 7 56 - 7 63 (m, 2 H) 7 44 (t, J=7 20 Hz, 1 H) 4 47 - 4 54 (m, 1 H) 3 70 (s, 3 H) 2 93 - 3 12 (m, 4 H) 2 10 (s, 3 H) Example 36 (Formula Removed) Preparation ofN-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1-methyl-1H-pyrazol-5-vD-4-methyl-2-thiophenecarboxamide a) methyl 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thtophenecarboxylate (Formula Removed) To a solution of methyl 5-bromo-4-methyl-2-thiophenecarboxylate (1 g, 4 25 mmol) in dioxane/H20 (5 1, 20 mL) was added K2CO3 (2 3 g, 17 mmol), bis(tn-t-butylphosphine)palladium(O) (108 mg, 0 213 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 5 52 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h and additional tetrakispriphenylphosphine Pd(0) (279 mg, 0 24 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) were added After 12h, the reaction was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification LCMS (ES) m/z = 237 (M+H)+ b) 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (crude from part a) in THF (4 mL) and 6N NaOH (4 mL) was heated to 70 °C After 1h, the solution was poured onto H20 and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title compound white was used directly without further purification LCMS (ES) m/z = 223 (M+H)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1-methyl- 1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 26, except substituting 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (424 mg, 1 92 mmol) for 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting N-bromosuccimmide (376 mg, 2 11 mmol) for N-chlorosuccmimide LCMS (ES) m/z 502 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=9 09 Hz, 1 H) δ 05 (br s , 3 H) 7 83 (s, 1 H) 7 67 - 7 74 (m, 2 H) 7 60 (q, J=7 83 Hz, 2 H) 7 40 - 7 47 (m, 1 H) 4 50 (d, J=4 04 Hz, 1 H) 3 71 (s, 3 H) 2 98-3 12 (m, 4 H) 2 09 (s, 3 H) Example 37 (Formula Removed) Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl]Dhenyllmethyl)ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 4-bromo-2-thiophenecarboxylate (Formula Removed) To a solution of 4-bromo-2-thiophenecarboxylic acid (4g, 19 mmol) in MeOH (100 mL) was added H2SO4 (5 mL) dropwise at 25 °C The solution was stirred for 12 h at 50 °C and was poured into ice-H20 and the pH was adjusted to ~11 with aqueous NaOH The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly (4 27g, quant) LCMS (ES) m/z 222 (M+H)+ b) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-2-thiophenecarboxylate (1 g, 4 52 mmol) in dioxane/H20 (5 1,16 mL) was added K2CO3 (2 7 g, 19 mmol), bis(tn-t-butylphosphine)palladium(O) (116 mg, 0 226 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 5 88 mmol) The reaction mixture was heated to 80° C in a sealed tube After 1h, the reaction was partitioned between H2O-DCM and the aqueous phase was extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z 223 (M+H)+ c) methyl 4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (330 mg, 1 49 mmol) and selectfluor ® (793 mg, 2 23 mmol) in THF (7 mL) and H20 (500 uL) was stirred in a sealed tube at 70 °C After 1h, additional selectfluor (793 mg, 2 23 mmol) was added and the solution stirred an additional 12h The reaction mixture was then partitioned between H20-DCM, the aqueous phase was washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica, 20% EtOAc in hexanes) affording the title compound (126 mg, 33%) as a white solid LCMS (ES) m/z = 241 (M+H)+ d) 4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (126 mg, 0 53 mmol) in THF (1 mL) and 6N NaOH (1 mL) was heated to 70 °C After 1h, the solution was poured onto H2O and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title compound white was used directly without further purification LCMS (ES) m/z = 227 (M+H)+ e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of 4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (84 mg, 0 372 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (130 mg, 0 372 mmol)[from Preparation 6], dnsopropylethyl amine (323 uL, 1 86 mmol) in DCM (4 mL) was added PyBrop (208 mg, 0 446 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0 5 % MeOH-DCM) affording the title compound (135 mg, 65%) as a white solid LCMS (ES) m/z = 557 (M+H)+ f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxamide To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (135 mg, 0 242 mmol) in THF-MeOH (11,2 mL) was added hydrazine (75 uL, 2 42 mmol) After 12h, the solution was filtered and the filtrate was concentrated, dry loaded onto silica and purified via column chromatography (3% MeOH in DCM (1% NH4OH)) The title compound was further purified via Gilson reverse phase chromatography using 5-95% mobile phase gradient affording the TFA-salt of the title compound which was neutralized through a silica plug ((5% MeOH in DCM (1% NH4OH)) then transferred to the HCI salt using excess 4M HCI in dioxane (40 mg, 26%) LCMS (ES) m/z 427 (M+H)\ 1H NMR (400 MHz, DMSO-d6) d ppm 8 88 (d, J=8 84 Hz, 1 H) δ 13 (s, 1 H) δ 06 (bs, 3 H) 7 70 (d, J=7 83 Hz, 1 H) 7 55 - 7 62 (m, 3 H) 7 54 (br s , 1 H) 7 41 (d, J=2 53 Hz, 1 H) 4 49 (d, J=5 05 Hz, 1 H) 3 92 (s, 3 H) 2 99 - 3 11 (m, 4 H) Example 38 (Formula Removed) Preparation of /N/-((1S)-2-amino-14r2-(trifluoromethyl]phenyl]methyl)ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)--5-methyl-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 37, except substituting methyl 4-bromo-5-methyl-2-thiophenecarboxylate (1g, 4 26 mmol)[from Preparation 11] for methyl 4-bromo-2-thiophenecarboxylate LCMS (ES) m/z 441 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 78 (d, J=9 60 Hz, 1 H) δ 03 (br s, 3 H) 7 91 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 62 (d, J=4 55 Hz, 1 H) 7 52 - 7 59 (m, 2 H) 7 39 - 7 46 (m, 1 H) 4 47 (br s , 1 H) 3 74 (s, 3 H) 3 06 (br s , 4 H) 2 36 (s, 3 H) Example 39 (Formula Removed) Preparation of N-[1-(aminomethyl)-3-phenylpropyl1-4-bromo-5-n-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (2-amino-4- phenylbutyl)carbamate (0 44 g, 1 7 mmol) [from Preparation 4] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z = 435 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 1 92 - 2 22 (m, 2 H) 2 71 - 2 82 (m, 2 H) 3 02 - 3 11 (m, 1 H) 3 12 - 3 24 (m, 1 H) 3 88 (s, 3 H) 4 30 (s, 1 H) δ 59 (d, J=1 77 Hz, 1 H) 7 17 (t, J=7 07 Hz, 1 H) 7 22 - 7 29 (m, 4 H) 7 67 (d, J=1 77 Hz, 1 H) 7 85 (s, 1 H) Example 40 (Formula Removed) Preparation of N-ri-(aminomethyl)-3-phenylpropyll-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 5-(1 -methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (223 mg, 1 07 mmol) for 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (0 51 g, 1 9 mmol) [from Preparation 4] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 87 -1 99 (m, 2 H) 2 69 - 2 91 (m, 4 H) 4 00 - 4 07 (m, 3 H) 4 08 - 4 16 (m, 1 H) δ 56 (d, J=2 02 Hz, 1 H) 7 15 (t, J=6 95 Hz, 1 H) 7 20 - 7 28 (m, 4 H) 7 35 (d, J=3 79 Hz, 1 H) 7 51 (d, J=1 77 Hz, 1 H) 7 79 (d, J=3 79 Hz, 1 H) Example 41 (Formula Removed) Preparation of 4-bromo-AH3-(methylamino)-1 -phenylpropyl]-5-(1-methyl-1 H-pyrazol-5-yl)2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate (289 mg, 1 09 mmol) [from Preparation 12] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 435 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 12 - 2 23 (m, 2 H) 2 45 - 2 52 (m, 3 H) 2 64 - 2 74 (m, 1 H) 2 76 (dd, J=8 72, 5 94 Hz, 1 H) 3 77 - 3 88 (m, 3 H) δ 10 - 5 20 (m, 1 H) δ 52 (d, J=2 02 Hz, 1 H) 7 30 (d, J=6 82 Hz, 1 H) 7 35 - 7 45 (m, 4 H) 7 57 (d, J=1 77 Hz, 1 H) 7 89 (s, 1 H) Example 42 (Formula Removed) Preparation of [(1-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate (430 mg, 1 63 mmol) [from Preparation 12] for 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate and substituting 5-( 1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (224 mg, 1 08 mmol) for 4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 18 - 2 28 (m, 2 H) 2 55 (s, 3 H) 2 77 - 2 85 (m, 1 H) 2 87 (dd, J=8 84, 5 81 Hz, 1 H) 4 01 (s, 3 H) δ 19 (dd, J=8 59, 6 57 Hz, 1 H) δ 55 (d, J=2 02 Hz, 1 H) 7 31 (d, J=7 07 Hz, 1 H) 7 34 - 7 41 (m, 3 H) 7 44 - 7 47 (m, 2 H) 7 50 (d, J=2 02 Hz, 1 H) 7 85 (d, J=4 04 Hz, 1 H) Example 43 (Formula Removed) Preparation of 4-bromoN-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate (0 26 g, 1 09 mmol) [from Preparation 12] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 435 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 60 (s, 3 H) 2 90 - 3 01 (m, 2 H) 3 06 (d, J=6 57 Hz, 2 H) 3 83 (s, 3 H) 4 48 - 4 58 (m, 1 H) δ 52 (d, J=1 77 Hz, 1 H) 7 17 - 7 27 (m, 1 H) 7 27 - 7 33 (m, 4 H) 7 57 (d, J=2 02 Hz, 1 H) 7 77 (s, 1 H) Example 44 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 6, except substituting 2-{(2S)-2-amino-3-[4-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (0 22 g, 0 62 mmol) [prepared according to the procedure of Preparation 6] for_2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione-HCI The reaction mixture was absorbed onto silica and purified via column chromatography to yield the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1 %TFA)/MeCN(1 %TFA) to afford the TFA salt LC-MS (ES) m/z 489 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 04 - 3 30 (m, 4 H) 3 81 - 3 85 (m, 3 H) 4 59 (dd, J=6 32, 3 28 Hz, 1 H) δ 52 (d, J=2 02 Hz, 1 H) 7 50 (d, J=8 08 Hz, 2 H) 7 58 (d, J=2 02 Hz, 1 H) 7 64 (d, J=8 08 Hz, 2 H) 7 73 (s, 1 H) Example 45 (Formula Removed) Preparation of N-f1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (194 mg, 0 68mmol) for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2 -(2-amino-3-methyl-3-phenylbutyl)-1H-isoindole-1,3(2H)-dione (0 20 g, 0 58 mmol) [prepared according to preparation 16] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H20 (1 %TFA)/MeCN(1 %TFA) to afford the TFA salt LC-MS (ES) m/z 448 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 40 (s, 3 H) 1 47 (s, 3 H) 2 85 - 2 92 (m, 1 H)301 (d, J=11 37 Hz, 1 H) 3 83 - 3 86 (m, 3 H)4 74 (dd, J=11 37, 2 27 Hz, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 7 28 (t, J=7 33 Hz, 1 H) 7 41 (t, J=7 71 Hz, 3 H) 7 52 (d, J=7 58 Hz, 2 H) 7 59 (d, J=2 02 Hz, 1 H) 7 89 (s, 1 H) Example 46 (Formula Removed) Preparation of N-{{(1S)-2-amino-1-[(2,4-dlchlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thlophenecarboxamlde The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (135 mg, 0 47mmol) for 5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (153 mg, 0 44 mmol) [prepared according to the procedure of Preparation 6] for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H20 (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 491 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 03 (dd, J=13 89, 9 35 Hz, 1 H) 3 14 - 3 21 (m, 1 H) 3 21 - 3 29 (m, 2 H) 3 84 (s, 3 H) 4 62 - 4 70 (m, 1 H) δ 53 (d, J=2 02 Hz, 1 H) 7 28 - 7 32 (m, 1 H) 7 33 - 7 37 (m, 1 H) 7 51 (d, J=2 02 Hz, 1 H) 7 58 (d, J=2 02 Hz, 1 H) 7 73 - 7 76 (m, 1 H) Example 47 (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a pale yellow solid according to the procedure of Example 30, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (2 84 g, 9 9mmol) for 4-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 457 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 95 - 3 07 (m, 4 H) 3 75 (s, 3 H) 4 44 (dd, J=6 44, 4 93 Hz, 1 H) 7 18 - 7 24 (m, 1 H) 7 27 - 7 32 (m, 4 H) 7 59 (s, 1 H) 7 86 (s, 1 H) Example 48 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyltethyl]-4-bromo-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide a) 4,5-dibromo-1-methyl-1H-pyrrole-2-carboxylic acid (Formula Removed) NBS (6 3 g, 35 4 mmol) was added in portions over 15 minutes to a stirred solution of 1-methyl-1H-pyrrole-2-carboxylic acid (2 1 g, 16 78 mmol) in DMF (30 mL) at 0 °C Upon complete addition the mixture was slowly brought to 70°C After 1h, the solution was partitioned between H2O-CHCI3, the aqueous phase was adjusted to pH 3 and the aqueous phase was washed several times with CHCI3 The combined organic fractions were dried (Na2SO4) and concentrated under vacuum to yield a 3 4 mixture of 5-bromo-1-methyl-1H-pyrrole-2-carboxylic acid and 4,5-dibromo-1-methyl-1H-pyrrole-2-carboxylic acid (3 4g) which was used directly without further purification LCMS (ES) m/z = 206/286 (M+H)+ b) 1,1 -dimethylethyl (2-{[(4,5-dibromo-1 -methyl-1 H-pyrrol-2-yl)carbonyl]amino}-3- phenylpropyl)carbamate (Formula Removed) To a solution of 5-bromo-1-methyl-1H-pyrrole-2-carboxylic acid and 4,5-dibromo-1-methyl-1H-pyrrole-2-carboxylic acid (1 3 g), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (1 2 g, 4 8 mmol) [from Preparation 2] and PyBrop (2 6 g, 5 6 mmol) in CHCI3 (30 mL) was added dusopropylethyl amine (2 8 mL, 16 1 mmol) The reaction mixture was stirred overnight, adsorbed onto silica and purified via column chromatography [1 3 EtOAc/hexanes] to give a 1 1 mixture of 1,1-dimethylethyl (2-{[(5-bromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate and 1,1-dimethylethyl (2-{[(4,5-dibromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate (800 mg) LCMS (ES) m/z = 438/518 (M+H)+ c) 1,1-dimethylethyl [2-({[4-bromo-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of a 1 1 mixture of 1,1-dimethylethyl (2-{[(5-bromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate and 1,1-dimethylethyl (2-{[(4,5-dibromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate (307 mg) in dioxane/H2O (5 1,5 6 mL) was added Cs2CO3 (800 mg, 2 5 mmol), tetrakispriphenylphosphine Pd(0) (44 mg, 0 04 mmol) and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (157 mg, 0 75 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h after which additional tetrakispriphenylphosphine Pd(0) (20 mg, 0 02 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (177 mg, 0 85 mmol) were added After 12h, the reaction mixture was adsorbed onto silica and purified via column chromatography to give two isomers the title compound 1,1-dimethylethyl [2-({[4-bromo-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyl]carbamate (17 mg, 0 033 mmol) and 1,1-dimethylethyl [2-({[1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyljcarbamate (20 mg, 0 05 mmol) d) N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-1 -methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide 1,1 -dimethylethyl [3-{[4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]amino}-3-oxo-2-(phenylmethyl)propyl]carbamate (0 045 g, 0 09 mmol) dissolved in CHCI3 (4 mL) and MeOH (1 mL) was treated with 4 M HCI in dioxane (2 mL) After stirring for 18h at RT, the reaction solution was adsorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound as a white solid The neutral compound from above was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 (150 \iL) and concentrated affording the HCI salt of the title compound LC-MS (ES) m/z 418 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 76 - 2 98 (m, 4 H) 3 57 (d, J=2 78 Hz, 3 H) 3 71 (d, J=1 26 Hz, 3 H) 4 28 (ddd, J=8 27, 5 12, 2 78 Hz, 1 H) δ 44 (dd, J=7 58, 2 02 Hz, 1 H) δ 85 (s, 1 H) 7 18 - 7 24 (m, 1 H) 7 27 - 7 32 (m, 4 H) 7 61 (d, J=2 02 Hz, 1 H) Example 49 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1 H-pvrrole-2-carboxamide 1,1 -dimethylethyl [2-({[1 -methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1 H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyl]carbamate (20 mg, 0 05 mmol) [prepared in Example 48] in CHCI3 (4 mL) and MeOH (1 mL) was treated with 4 M HCI in dioxane (2 mL) After stirring for 18h at RT, the reaction solution was adsorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound The above compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 (150 \|iL) and concentrated affording the HCI salt of the title compound LC-MS (ES) m/z 338 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 74 -2 81 (m, 1 H) 2 83 - 2 90 (m, 2 H) 2 92 - 2 98 (m, 1 H) 3 63 (s, 3 H) 3 76 (s, 3 H) 4 29 (ddd, J=8 02, 5 12, 2 53 Hz, 1 H) δ 27 (d, J=4 04 Hz, 1 H) δ 39 (d, J=2 02 Hz, 1 H) δ 80 (d, J=4 04 Hz, 1 H) 7 20 (td, J=5 87, 2 65 Hz, 1 H) 7 26 - 7 31 (m, 4 H) 7 57 (d, J=2 02 Hz, 1 H) Example 50 (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyOethylH -methyl-4-f 1 -methyl-1 N-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide a) 1,1-dimethylethyl (2-{[(4-bromo-1-methyl-1 H-pyrrol-2-yl)carbonyl]amino}-3- phenylpropyl)carbamate (Formula Removed) To a 50 mL round-bottomed flask was added 4-bromo-1-methyl-1H-pyrrole-2-carboxylic acid (610 mg, 3 0 mmol), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (748 mg, 2 99 mmol) [prepared according to the procedure of Preparation 2] and PyBrop (1 71 g, 3 67 mmol) in Chloroform (15 mL) DIEA (1 8 mL, 10 3 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (Hex/EtOAc) affording the title compound (335 mg, 26%) LC-MS (ES) m/z = 438 (M+H)+ b) 1,1-dimethylethyl [2-({[1-methyl-4-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2- yl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl (2-{[(4-bromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate (313 mg, 0 717 mmol) in dioxane/H20 (4 1, 6 25 mL) was added Cs2CO3 (840 mg, 2 6 mmol), tetrakispriphenylphosphine Pd(0) (62 mg, 0 05 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (202 mg, 1 04 mmol) The reaction mixture was heated to 80 °C in a sealed tube for 12h and was then partitioned between H20 and CHCI3 The combined organic fractions were dried (Na2SO4), concentrated under vacuum, adsorbed onto silica gel and purified via column chromatography (35% EtOAc/Hex) affording the title compound (285 mg, 91%) LC-MS (ES) m/z = 438 (M+H)+ c) N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-4-(1-methyl-1H-pyrazol-5-yl)-1H-py rrol e-2-carboxa m id e HCI in Dioxane (4M, 2mL) was added to a solution of 1,1-dimethylethyl [2-({[1-methyl-4-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyljcarbamate (285 mg, 0 65 mmol) in CHCI3/MeOH (10 1,10 mL) affording the title compound as a white solid (71 mg, 0 21 mmol, 32%) LC-MS (ES) m/z 338 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 77 - 2 93 (m, 4 H) 3 86 (s, 3 H) 3 92 (s, 3 H) 4 29 (ddd, J=8 15, 4 74, 2 02 Hz, 1 H) δ 30 (d, J=2 02 Hz, 1 H) 6 94 (d, J=1 77 Hz, 1 H) 7 14 (d, J=1 77 Hz, 1 H) 7 19 (td, J=5 56, 3 03 Hz, 1 H) 7 25 - 7 30 (m, 4 H) 7 41 (d, J=1 77 Hz, 1 H) Example 51 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl]ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (232 mg, 1 11mmol)for5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 409 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 09 - 3 30 (m, 4 H) 3 97 - 4 00 (m, 3 H) 4 62 - 4 72 (m, 1 H) δ 48 (d, J=2 02 Hz, 1 H) 7 43 (ddd, J=8 08, 4 42, 4 17 Hz, 1 H) 7 51 - 7 56 (m, 3 H) 7 72 (d, J=7 83 Hz, 1 H) 7 89 - 7 93 (m, 2 H) Example 52 (Formula Removed) Preparation of N-[2-(methylamino)-1-(phenylmethyl]ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate (0 32 g, 1 2 mmol) [from Preparation 13] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate and substituting 4-(1-methyl-1H- pyrazol-5-yl)-2-thiophenecarboxylic acid (220 mgT 1 06 mmol) for 4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 41 (s, 3 H) 2 81 (td, J=11 81, 7 96 Hz, 2 H) 2 87 - 2 97 (m, 2 H) 3 96 (s, 3 H) 4 43 - 4 52 (m, 1 H) δ 45 (d, J=1 52 Hz, 1 H) 7 16 - 7 23 (m, 1 H) 7 25 - 7 30 (m, 4 H) 7 50 (d, J=1 52 Hz, 1 H) 7 85 (d, J=13 14 Hz, 2 H) Example 53 (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-N-methyl-4-(1 -methyl-1 H-pyrazol-5-v0-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 2-[2-(methylamino)-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 7 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI and substituting 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (150 mg, 0 72 mmol) for 4-bromo-5-( 1 -methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylic acid The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 86 (s, 3 H) 2 97 (dd, J=14 02, 8 72 Hz, 2 H) 3 12 - 3 23 (m, 2 H) 3 70 (m, 1 H) 3 97 (s, 3 H) δ 47 (d, J=2 02 Hz, 1 H) 7 30 - 7 35 (m, 1 H) 7 37 - 7 43 (m, 5 H) 7 51 (d, J=2 02 Hz, 1 H) 7 88 (d, J=1 52 Hz, 1 H) 7 94 (d, J=1 52 Hz, 1 H) Example 54 (Formula Removed) Preparation of N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (129 mg, 0 62 mmol) for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2 -(2-amino-3-methyl-3-phenylbutyl)-1H-isoindole-1,3(2H)-dione (0 20 g, 0 58 mmol) [prepared according to the procedure of Preparation 14] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 369 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 1 36 (s, 3 H) 1 41 (s, 3 H) 2 61 (d, J=6 82 Hz, 2 H) 3 99 (s, 3 H) 4 49 (t, J=6 95 Hz, 1 H) δ 49 (d, J=1 77 Hz, 1 H) 7 23 (t, J=7 33 Hz, 1 H) 7 36 (t, J=7 71 Hz, 2 H) 7 47 - 7 52 (m, 3 H) 7 89 (d, J=1 26 Hz, 1 H) δ 00 (d, J=1 52 Hz, 1 H)) Example 55 (Formula Removed) Preparation of N-K1 S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)--2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (99 mg, 0 48mmol) for 5-( 1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (155 mg, 0 44 mmol) [prepared according to procedure of Preparation 6] for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 411 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 05 - 3 28 (m, 4 H) 3 97 (s, 3 H) 4 63 - 4 72 (m, 1 H) δ 47 (d, J=2 02 Hz, 1 H) 7 26 - 7 29 (m, 1 H) 7 34 - 7 37 (m, 1 H) 7 49 (d, J=2 27 Hz, 1 H) 7 51 (d, J=2 02 Hz, 1 H) 7 86 (d, J=1 52 Hz, 1 H) 7 90 (d, J=1 52 Hz, 1 H) Example 56 (Formula Removed) Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)--methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (206 mg, 0 93 mmol) [prepared according to the procedure of Preparation 9], 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (209 mg, 0 60 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (340 mg, 0 73 mmol) in Chloroform (15 mL) DIEA (0 81 mL, 4 65 mmol) was added and the mixture stirred overnight at room temperature Upon completion, the reaction mixture was adsorbed onto silica and purified via column chromatography (25 -75% EtOAc/Hex) affording the title compound (112 mg, 0 203 mmol, 22%) LC-MS (ES) m/z = 553 (M+H)+ b)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (112 mg, 0 203 mmol) in Tetrahydrofuran (THF) (6 mL) and Methanol (1 mL) Hydrazine (40 uL, 1 3 mmol) was added and the mixture stirred overnight at room temperature Upon completion, the mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et2Oand concentrated affording the HCI salt of the title compound (43 mg, 0 102 mmol, 50 % yield) LC-MS (ES) m/z 423 (M+H)+, 'H NMR (400 MHz, DMSO-d6) δ ppm 2 38 (s, 3 H) 3 01 (m, 1 H) 3 08 (d, J=6 57 Hz, 3 H) 3 76 - 3 83 (m, 3 H) 4 47 (m, 1 H) δ 37 (d, J=2 02 Hz, 1 H) 7 41 (t, J=7 58 Hz, 1 H) 7 50 - 7 57 (m, 2 H) 7 57 - 7 63 (m, 1 H) 7 68 (d, J=7 58 Hz, 1 H) δ 04 (d, J=9 09 Hz, 1 H) δ 15 (s, 3 H) δ 96 (s, 1 H) Example 57 (Formula Removed) Preparation of N-{(S)-2-amino-1-[(3-fluoroDhenvhmethyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (222 mg, 1 07mmol)for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (357 mg, 1 2 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}- 1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 359 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 96 - 3 06 (m, 4 H) 3 92 - 3 98 (m, 3 H) 4 40 (dd, J=8 08, 5 56 Hz, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 02 (td, J=8 46, 2 02 Hz, 1 H) 7 14 (t, J=8 08 Hz, 2 H) 7 26 - 7 35 (m, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 16 - 8 27 (m, 3 H) δ 34 (d, J=1 26 Hz, 1 H) 9 08 (d, J=8 34 Hz, 1 H) Example 58 (Formula Removed) Preparation of N-((1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (138 mg, 0 66 mmol) for 5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (196 mg, 0 66 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}- 1 H-isoindole-1,3(2H)-dione-HCI The reaction mixture was adsorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further punfied by Gilson reverse phase chromatography 5-95% H2O (1 %TFA)/MeCN(1 %TFA) to afford the TFA salt LC-MS (ES) m/z 359 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 2 80 - 3 03 (m, 4 H) 3 89 - 3 97 (m, 3 H) 4 30 - 4 40 (m, 1 H) δ 45 (d, J=1 77 Hz, 1 H) 7 12 (t, J=8 84 Hz, 2 H) 7 29 (dd, J=8 34, 5 56 Hz, 2 H) 7 48 (d, J=1 77 Hz, 1 H) 7 92 (br s, 3 H) 7 96 (d, J=1 26 Hz, 1 H) δ 02 (d, J=1 26 Hz, 1 H) δ 58 (d, J=8 84 Hz, 1 H) Example 59 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (189 mg, 0 91mmol) for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (297 mg, 0 85 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 409 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 3 06 (d, J=7 07 Hz, 4 H) 3 91 - 3 98 (m, 3 H) 4 35 - 4 45 (m, 1 H) δ 46 (d, J=1 77 Hz, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 49 - 7 57 (m, 2 H) 7 58 - 7 63 (m, 1 H) 7 69 (s, 1 H) 7 98 (d, J=1 52 Hz, 1 H) δ 23 (s, 3 H) δ 32 (d, J=1 26 Hz, 1 H) 9 11 (d, J=8 84 Hz, 1 H) Example 60 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[4-(trifluoromethyl]phenyl]methyl)ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (240 mg, 0 9 mmol) for 5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[4-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (278 mg, 0 80 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 409 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 04 (m, 4 H) 3 96 (s, 3 H) 4 42 (s, 1 H) δ 44 - 6 49 (m, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 52 (d, J=7 83 Hz, 2 H) 7 66 (d, J=8 08 Hz, 2 H) δ 01 (s, 1 H) δ 05 - 8 32 (br m, 3H) δ 34 (m, 1H) δ 9 - 9 2 (br s, 1H) Example 61 (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide a)1,1-dimethylethyl[2-({[5-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl [3-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2-thienyl]carbonyl}amino)propyl]carbamate (154 mg, 0 32 mmol) [prepared according to the procedure of Example 3] in Dioxane / H2O (5 1,3 1 mL) was added Cs2CO3 (415 mg, 1 27 mmol), tetrakispriphenylphosphine Pd(0) (29 mg, 0 03 mmol), and 5-iodo-1-methyl-1 H-1,2,4-triazole (95 mg, 0 46 mmol) [prepared according to the procedure of Preparation 15] The reaction mixture was heated to 85 °C in a sealed tube for 12 hours The reaction was partitioned between H20 and CHCI3, the organic layer dned with Na2SO4, absorbed onto silica and purified via column chromatography (35-50% EtOAc/Hexanes) affording the title compound as a yellow solid (61 mg, 28%) LC-MS (ES) m/z = 521 b) N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide HCI in Dioxane (4M, 1mL) was added to a solution of 1,1-dimethylethyl [2-({[5-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thienyl]carbonyi}amino)-3-phenylpropyljcarbamate (61 mg, 0 12 mmol) in CHCl3/MeOH (10 1,10 mL) and the mixture stirred overnight Upon completion, the mixture was adsorbed onto silica gel and punfied via chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et2O and concentrated affording the HCI salt of the title compound as a white solid (30 mg, 0 09 mmol, 77%) LC-MS (ES) m/z 341 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 79 - 2 91 (m, 3 H) 2 94 (t, J=5 56 Hz, 1 H) 4 10 (s, 3 H) 4 25 - 4 34 (m, 1 H) 7 18 (ddd, J=8 27, 5 75, 3 16 Hz, 1 H) 7 24 - 7 29 (m, 4 H) 7 63 (d, J=4 04 Hz, 1 H) 7 75 (d, J=4 04 Hz, 1 H) 7 95 (s, 1 H) Example 62 (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-imidazol-5-yl)-2-thiophenecarboxamide a) 1,1-dimethylethyl [2-({[5-(1-methyl-1H-imidazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl [2-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2-thienyl]carbonyl}amino)ethyl]carbamate (72 mg, 0 15 mmol) [prepared according to the procedure of Example 3] in dioxane/H2O (5 1, 14 mL) was added Cs2CO3 (200 mg, 0 61 mmol), tetrakispriphenylphosphine Pd(0) (8 5 mg, 0 01 mmol), and 5-bromo-1-methyl-1H-imidazole (64 mg, 0 40 mmol) The reaction mixture was heated to 85 °C in a sealed tube for 12h Upon completion, the reaction mixture was partitioned between H20 (25 mL) and CHCI3 The organics were dried (Na2SO4), concentrated under vacuum, adsorbed onto silica gel and purified via column chromatography (35 - 50% EtOAc / Hexanes) to give the title compound (19 6 mg, 31%) as a yellow solid LC-MS (ES) m/z = 441 b)N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-imidazol-5-yl)-2-thiophenecarboxamide HCI in Dioxane (4M, 1mL) was added to a solution of 1,1-dimethylethyl [2-({[5-(1 -methyl-1 H-imidazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (19 6 mg, 0 04 mmol) in CHCI3/MeOH (10 1,5 mL) Upon completion of the reaction, the mixture was adsorbed onto silica gel and purified via chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et2O and concentrated affording the HCI salt of the title compound as a white solid (19 mg, 0 05 mmol, quant) LC-MS (ES) m/z 341 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 77 - 2 83 (m, 1 H) 2 85 - 2 91 (m, 2 H) 2 93 - 2 99 (m, 1 H) 3 82 (s, 3 H) 4 30 (ddd, J=8 08, 4 80, 1 77 Hz, 1 H) 7 15 - 7 31 (m, 7 H) 7 69 (d, j=4 04 Hz, 1 H) 7 76 (s, 1 H) Example 63 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl]ethyl)-3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (253 mg, 0 69mmol) for 5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid The reaction mixture was adsorbed onto silica and punfied via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 569 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 14 - 3 30 (m, 4 H) 3 82 (s, 3 H) 4 73 (dd, J=9 47, 4 67 Hz, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 7 44 - 7 50 (m, 1 H) 7 56 - 7 62 (m, 3 H) 7 74 (d, J=7 83 Hz, 1 H) Example 64 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]Dhenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (143 mg, 0 50 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 488 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 15 (s, 2 H) 3 23 (s, 2 H) 3 84 (s, 3 H) 4 65 (s, 1 H) δ 52 - 6 57 (m, 1 H) 7 46 (s, 1 H) 7 52 - 7 61 (m, 3 H) 7 72 (s, 1 H) 7 81 (s, 1 H) Example 65 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (143 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(157mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{{2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 455 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 3 11 (s, 1 H) 3 22 (s, 1 H) 3 27 (s, 2 H) 3 85 (s, 3 H) 4 70 (s, 1 H) δ 57 (s, 1 H) 7 26 (s, 2 H) 7 41 (s, 2 H) 7 66 (s, 1 H) 7 88 (s, 1 H) Example 66 (Formula Removed) Preparation of N-{(S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thlophenecarboxamlde The title compound was prepared as a light yellow solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (143 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-fluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione-HCI (149 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 438 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 00 (s, 1 H) 3 09 (s, 1 H) 3 15 (dd, J=3 41, 1 64 Hz, 2 H) 3 83 (s, 4 H) 4 58 (s, 1 H) δ 52 (d, J=2 02 Hz, 1 H) 7 08 - 7 17 (m, 3 H) 7 27 - 7 37 (m, 3 H) 7 59 (d, J=2 02 Hz, 1 H) 7 74 (d, J=3 54 Hz, 1 H) Example 67 (Formula Removed) Preparation of N-(1S)-2-amino-1 -(1 H-indol-3-ylmethyl)ethyl]-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4,5-dibromc~2-thiophenecarboxylic acid (143 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(1 H-indol-3-yl)propyl]-1 H-isoindole-1,3(2H)-dione-dione-HCI (160 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 459 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 15 (dt, J=10 42, 6 79 Hz, 3 H) 3 27 (dd, J=4 04, 2 27 Hz, 1 H) 3 84 (s, 3 H) 4 63 (d, J=6 82 Hz, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 7 05 (t, J=7 45 Hz, 1 H) 7 13 (t, J=7 07 Hz, 1 H) 7 19 (s, 1 H) 7 37 (d, J=8 08 Hz, 1 H) 7 64 - 7 73 (m, 2 H) 7 77 (s, 1 H) Example 68 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl)--4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(157mg, 0 5 mmol) [prepared according to Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 AV-isomdole-1,3(2H)-dione-HCI LC-MS (ES) m/z 375 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 11 - 3 20 (m, 1 H) 3 22 - 3 31 (m, 3 H) 4 23 (s, 3 H) 4 75 (s, 1 H) δ 96 (s, 1 H) 7 18 - 7 26 (m, 2 H) 7 38 (d, J=6 06 Hz, 1 H) 7 46 (d, J=4 55 Hz, 1 H) δ 22 (s, 2 H) δ 32 (s, 1 H) Example 69 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(149mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2- amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 359 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 3 06 - 3 17 (m, 2 H) 3 25 - 3 31 (m, 2 H) 4 18 (s, 3 H) 4 59 - 4 67 (m, 1 H) δ 88 (s, 1 H) 7 05 - 7 12 (m, 2 H) 7 23 - 7 30 (m, 1 H) 7 36 - 7 42 (m, 1 H) δ 12 (d, J=1 01 Hz, 1 H) δ 17 (s, 1 H) δ 21 (s, 1 H) Example 70 (Formula Removed) Preparation of N-[2-amino-1-(1-naphthalenyl)ethyl]-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)--2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate (143 mg, 0 5 mmol) [from Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 456 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 60 (s, 1 H) 3 72 (s, 1 H) 3 84 (s, 3 H) δ 33 (d, J=10 11 Hz, 1 H) δ 55 (s, 1 H) 7 55 - 7 61 (m, 3 H) 7 64 (d, J=8 34 Hz, 1 H) 7 74 (s, 1 H) 7 92 - 7 99 (m, 2 H) δ 09 (s, 1 H) δ 26 (s, 1 H) Example 71 (Formula Removed) Preparation of N-[2-amino-1 -(1 -naphthalenv0ethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate (143 mg, 0 5 mmol) [from Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 377 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 62 (d, J=4 04 Hz, 1 H) 3 67 - 3 78 (m, 1 H) 4 08 - 4 10 (m, 3 H) δ 35 (s, 1 H) δ 73 (d, J=2 27 Hz, 1 H) 7 55 - 7 60 (m, 2 H) 7 62 - 7 67 (m, 1 H) 7 76 (d, J=7 33 Hz, 1 H) 7 88 (d, J=2 53 Hz, 1 H) 7 93 - 7 99 (m, 2 H) δ 10 (d, J=1 52 Hz, 1 H) δ 23 - 8 27 (m, 2 H) Example 72 (Formula Removed) Preparation of N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl {2-amino-2-[2-(trifluoromethyl)phenyl]ethyl}carbamate (152 mg, 0 5 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 36 - 3 39 (m, 1 H) 3 46 - 3 53 (m, 1 H) 3 98 (s, 3 H) δ 86 - 5 91 (m, 1 H) δ 48 (s, 1 H) 7 51 (d, J=2 02 Hz, 1 H) 7 60 (s, 1 H) 7 76 (s, 1 H) 7 83 (d, J=8 08 Hz, 2 H) 7 94 (s, 1 H) δ 05 (s, 1 H) Example 73 (Formula Removed) Preparation of N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl {2-amino-2-[2-(trifluoromethyl)phenyl]ethyl}carbamate (152 mg, 0 5 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 474 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 37 (s, 1 H) 3 65 (s, 1 H) 3 89 - 4 00 (m, 3 H) δ 88 (s, 1 H) δ 76 (d, J=2 27 Hz, 1 H) 7 58 (s, 1 H) 7 77 (d, J=9 60 Hz, 2 H) 7 91 - 8 03 (m, 2 H) δ 26 (d, J=2 27 Hz, 1 H) Example 74 (Formula Removed) Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 24, except substituting NBS (194 mg, 1 09 mmol) for NCS LC-MS (ES) m/z 418 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 3 03 (d, J=7 33 Hz, 2 H) 3 23 (s, 2 H) 3 90 (s, 3 H) 4 56 (d, J=1 77 Hz, 1 H) 7 20 - 7 27 (m, 1 H) 7 28 - 7 34 (m, 4 H) 7 58 (s, 1 H) 7 96 (s, 2 H) Example 75 (Formula Removed) Preparation of N-((1S)-2-amino-14r2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-trnophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 25, except substituting NBS (67 mg, 0 5 mmol) for NCS LC-MS (ES) m/z488 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 10-3 19 (m, 1 H) 3 20 - 3 28 (m, 3 H) 3 91 (s, 3 H) 4 66 (dd, J=8 59, 3 03 Hz, 1 H) 7 39 - 7 47 (m, 1 H) 7 51 - 7 58 (m, 2 H) 7 59 (s, 1 H) 7 72 (d, J=8 08 Hz, 1 H) 7 98 (s, 2 H) Example 76 (Formula Removed) Preparation of A/4(1S)-2-amino-1-[(3.5-difluorophenyl]methyl]ethyl)-4-(1-methyl-1H-pyrazol-5-yl)2-thiophenecarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(158 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 94 - 3 06 (m, 4 H) 3 95 (s, 3 H) 4 40 (d, J=6 06 Hz, 1 H) δ 46 (d, J=1 77 Hz, 1 H) 7 00 - 7 10 (m, 3 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 10 (s, 2 H) δ 21 (s, 1H) δ 92 (d, J=8 0 Hz, 1H) Example 77 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-chlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (157 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 92 - 3 04 (m, 4 H) 3 92 - 3 98 (m, 3 H) 4 36 (d, J=5 56 Hz, 1 H) δ 47 (s, 1H) 7 19 - 7 29 (m, 2 H) 7 29 - 7 35 (m, 1 H) 7 37-7 42 (m, 1 H)7 47(s, 1H) δ 17 (s, 3 H) δ 85-9 07 (m, 1H) Example 78 (Formula Removed) Preparation of N-K1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(4-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (157 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 92 - 2 97 (m, 2 H) 2 99 - 3 04 (m, 2 H) 4 01 (s, 3 H) 4 32 - 4 42 (m, 1 H) δ 43 - 6 50 (m, 1 H) 7 27 - 7 37 (m, 4 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 21 (s, 3 H) δ 94-9 10 (m, 1H) Example 79 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-brorrio-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-furancarboxylic acid (135 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 472 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 3 11 (d, J=9 85 Hz, 1 H) 3 21 - 3 31 (m, 3 H) 4 06 (s, 3 H) 4 70 (s, 1 H) δ 87 (d, J=2 02 Hz, 1 H) 7 33 (s, 1 H) 7 41 - 7 48 (m, 1 H) 7 50 - 7 57 (m, 2 H) 7 60 (d, J=2 02 Hz, 1 H) 7 71 (d, J=7 83 Hz, 1 H) Example 80 (Formula Removed) Preparation of N-(3-amino-1-phenylpropyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 20 except substituting 1,1-dimethylethyl [3-(methylamino)-3- phenylpropyljcarbamate (125 mg, 0 5 mmoles) [from Preparation 3] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 420 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 25 - 2 37 (m, 2 H) 2 96 (d, J=8 08 Hz, 1 H) 3 04 -3 13 (m, 1 H) 3 84 (s, 3 H) δ 22 (t, J=7 58 Hz, 1 H) δ 53 (d, J=1 52 Hz, 1 H) 7 35 (d, J=6 57 Hz, 1 H) 7 44 (dt, J=15 09, 7 48 Hz, 4 H) 7 58 Example 81 Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-ethyl-1 f/-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (Formula Removed) To a suspension of NaH (60% in mineral oil, 2 2 g, 55 mmol) in THF (50 mL) was added pyrazole (3 4 g, 50 mmol) in THF (10 mL) at room temperature After 30 mm, to above suspension was added Etl (7 75 g, 50 mmol) dropwise After the reaction was complete (20 h), the suspension was filtered, and the resulting solution was used directly with further purification At 0°C, to above solution of 4-methyl pyrazole (-50 mmol) was added n-BuLi (2 5M in hexane, 22 mL, 55 mmol) The reaction solution was stirred for 1 hour at RT and then cooled to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (10 2 g, 55 mmol) After 15 mm at -78°C, the reaction was allowed to warm to 0°C over 1hour The reaction was diluted with saturated NH4CI solution and extracted with DCM The organics were dned over Na2SO4 and concentrated under vacuum to afford a tan solid (9 8 g, 89%) which was used without further purification LCMS (ES) m/z 141 (M+H)+ for [RB(OH)2], 1H NMR (CDCI3, 400 MHz) δ ppm 7 52 (d, J = 2 Hz, 1H), 6 36 (d, J = 2 Hz, 1H), 4 48 (q, J = 7 2 Hz, 2H), 1 44 (t, J = 7 2Hz, 3H), 1 36 (s, 12 H) b) 1,1-dimethylethyl [2-({[5-(1-ethyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3- phenylpropyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (100 mg, 0 23 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (100 mg, 0 72 mmol), tetrakispriphenylphosphine Pd(0) (30 mg, 26 umol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (64 mg, 0 29 mmol) The reaction mixture was heated to 70° C in a sealed tube After 12h, the reaction mixture was concentrated under vacuum and purified on silica (hex/EtOAc, 40-60%) to afford the title compound (0 074 g, 71%) as a light yellow solid LC-MS (ES) m/z 455 (M+H)+ c) N-[2-aminc-1 -(phenylmethyl)ethyl]-5-(1 -ethyl-1 H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) 1,1 -Dimethylethyl [2-({[5-(1 -ethyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (74 mg, 0 16 mmol) was dissolved in DCM (2 mL) and treated with TFA (1 mL) After 1 h, the solution was concentrated and neutralized through silica using 4% MeOH in DCM (1% NH4OH) The title compound was further punfied using reverse-phase HPLC (C18 column H20/CH3CN, 40-10%) affording the bis-TFA salt of the title compound (47 mg, 50%) as a white solid LCMS (ES) m/z 355 (M+H)+, 1H NMR (d -MeOD, 400 MHz) δ ppm 7 71 (d, J = 3 8 Hz, 1H), 7 55 (d, J = 2 0 Hz, 1H), 7 34-7 22 (m, 6H), 6 51 (d J = 1 8 Hz, 1H), 4 55 (m, 1H), 4 34 (q, J = 7 1 Hz, 2H), 3 22 (dd, J = 3 5, 13 1 Hz, 1H), 3 13 (dd, J = 10 1, 13 1 Hz, 1H), 3 00 (m, 2H), and 1 42 (t, J = 7 1 Hz, 3H) Example 82 Preparation of A^-[2-amino-1-(phenylmethyl)ethyl]-3.4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,1-dimethylethyl (3-phenyl-2-{[(3,4,5-tnbromo-2-thienyl)carbonyl]amino}propyl)carbamate (120 mg, 0 20 mmol)for 1,1-dimethylethyl [2-({[4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z 499 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 59 (d, J = 2 0 Hz, 1H), 7 37-7 24 (m, 5H), 6 53 (d, J = 2 0 Hz, 1H), 4 62(m, 1H), 3 27 (d, J = 13 1,4 3 Hz, 1H), 3 21 (dd, J = 13 1, 9 4 Hz, 1H), 3 09 (dd, J = 14 2, 6 1 Hz, 1H), 3 02 (dd, J = 13 9, 9 1 Hz, 1H), and 1 96 (s, 3H) Example 83 N-[2-aminc-1-(phenylmethyl)ethyl]-5-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)-1H-pyrazole (64 0 mg, 0 23 mmol) [from Preparation 17] for 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate, and substituting 1,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (110 mg, 0 25 mmol) for 1,1-dimethylethyl (2-{[(5-bromo-3-thienyl)carbonyl]amino}-2-phenylethyl)carbamate LC-MS (ES) m/z 355 (M+H)+ , 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 75 (d, J= 3 8 Hz, 1H), 7 40 (br s, 1H), 7 32-7 23 (m, 5H), 7 21 (d, J = 3 8 Hz, 1H), 4 56 (m, 1H), 3 86 (s, 3H), 3 23 (dd, J = 13 1, 3 8 Hz, 1H), 3 15 (dd, J = 12 9, 10 1 Hz,1H), 3 01 (m, 2H) and 2 10 (s, 3H) Example 84 N-[2-amino-1-(phenylmethyl]ethyl]-4-bromo-5-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (77 mg, 0 23 mmol) [from Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole, and substituting 1,1-dimethylethyl (2-{[(4,5-dibromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (150 mg, 0 29 mmol) for 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z 434 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 77 (s, 1H), 7 43 (s, 1H), 7 35-7 23 (m, 5H), 4 55 (m, 1H), 3 72 (s, 3H), 3 23 (dd, J = 3 5 Hz, 1H), 3 13 (dd, J = 10 6, 13 1 Hz, 1H), 3 02 -2 95 (m, 2H), and 1 99 (s, 3H) Example 85 N-[2-amino-1-(phenylmethyl)ethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (220 mg, 1 0 mmol) [from Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole, and substituting 1,1-dimethylethyl (2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (150 mg, 0 34 mmol) for 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z = 355 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 14-813 (m, 3H), 7 35-7 20 (m, 5H), 4 58 (m, 1H), 4 07 (s, 3H), 3 36-3 22 (m, 2H), 3 12-3 01 (m, 2H), and 2 21 (s, 3H) Example 86 N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxv-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) 1,1-dimethylethyl {2-[[(4-bromo-2-thienyl)carbonyl](hydroxy)amino]-3-phenylpropyl}carbamate (Formula Removed) To a solution of 4-bromo-2-thiophenecarboxylic acid (1 0 g, 4 83 mmol) in DCM (10 mL) was added PyBrop (3 4 g, 7 24 mmol) and Hunig's base (2 mL, 12 6 mmol) After 15 mm, 1,1-dimethylethyl [2-(hydroxyamino)-3-phenylpropyl]carbamate (641 mg, 2 41 mmol) was added to the reaction mixture in DCM (2 mL) and stirred for 2h at RT The reaction solution was concentrated to give crude 1,1-dimethylethyl [2-([(4-bromo-2-thienyl)carbonyl]{[(4-bromo-2-thienyl)carbonyl]oxy}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z = 645 (M+H)+ To a solution of 1,1-dimethylethyl [2-([(4-bromo-2-thienyl)carbonyl]{[(4-bromo-2-thienyl)carbonyl]oxy}amino)-3-phenylpropyl]carbamate in MeOH (5 mL) was added K2CO3 (1 0 g, 7 3 mmol) The mixture was stirred at RT for 2h The mixture was concentrated under vacuum and purified on silica gel (EtOAc/Hexane, 30%) to give the the title compound (410 mg, 37 % for two steps) as an off white solid LC-MS (ES) m/z = 456 (M+H)+ b) 1,1-dimethylethyl [2-(hydroxy{[4-(1-methyl-1H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl {2-[[(4-bromo-2-thienyl)carbonyl](hydroxy)amino]-3-phenylpropyl}carbamate (100 mg, 0 22 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (91 mg, 0 66 mmol), tetrakispriphenylphosphme Pd(0) (23 mg, 0 022 mmol) and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (68 mg, 0 33 mmol) The reaction mixture was heated to 75° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-40%) to afford the title compound (87 mg, 87%) LC-MS (ES) m/z = 456 (M+H)+ c) N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxy-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) 1,1 -Dimethylethyl [2-(hydroxy{[4-(1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (84 mg, 0 19 mmol) was dissolved in DCM (2 mL) and treated with TFA (1 mL) The reaction was stirred over 1h, and concentrated, and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 40 -10%), and concentrated to afford the bis-TFA salt of the title compound (51 2 mg, 64 8%) LC-MS (ES) m/z 357 (M+H)+, H NMR (d4-MeOD, 400 MHz) δ ppm 8 03 (s, 1H), 7 94 (d, J = 1 8Hz, 1H), 7 52 (d, J = 1 8 Hz, 1H), 6 46 (d, J = 1 8 Hz, 1H), 7 34-7 18 (m, 5H), 5 16 (m, 1H), 3 95 (s, 3H), 3 38 (dd, J = 13 1, 10 6 Hz, 1H), 3 17-3 11 (m, 2H), and 2 95 (dd, J = 13 6, 6 6 Hz, 1H) Example 87 N-((1S)--2-amino-1-fr2-(trifluoromethyl]phenyl]methyl]ethyl)-4-(1.4-dimethyH H-pyrazol-5-yl)-2-thioDhenecarboxamide (Formula Removed) a) 4-bromo-N-((1S)-2-(1,3-d 10x0-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) Ta a solution of 4-bromo-2-thiophenecarboxylic acid (80 mg, 0 39 mmol) in DCM (2 mL) at 25 °C was added bromo-tns-pyrrohdino phosphoniumhexafluorophosphate (PyBrOP) (218 mg, 0 47 mmol) in one portion, followed by addition of DIPEA (0 2 mL, 1 14 mmol) After stirring for 10 mm, diamine 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H>-dione (165mg, 0 43 mmol) was added to above solution After 2h, the solution was concentrated and purified via column chromatography (silica, 10% MeOH in CH3CI) affording the title compound (206 mg, 99%) as a white solid LC-MS (ES) m/z 538 (M+H)+ b) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a solution of 4-bromo-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (200 mg, 0 37 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (0 17g, 1 23 mmol), tetrakispriphenylphosphine Pd(0) (42 mg, 0 036mmol) and 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (413 mg, 1 86 mmol) [from Preparation 17] The reaction mixture was heated to 80° C in a sealed tube for 2h The reaction solution was concentrated under vacuum, and punfied on silica gel (10-50% EtOAc/Hex) to give the title compound (192 mg, 94%) as a white solid LC-MS (ES) m/z 553 (M+H)+ c)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-py razol-5-y I )-2-th loph en eca rboxa m i de (Formula Removed) 4-(1,4-Dimethyl-1 tf-pyrazol-5-yl)-/v"-((1S)-2-(1,3-dioxo-1,3-dihydro-2W-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (110 mg, 0 198 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (0 5 mL, 15 93 mmol) The reaction was stirred over 10 h, concentrated and the residue in DCM (2 mL) was treated with TFA (1 0 mL) After stirring for 2 h, the solvent was removed and the residue was punfied by reverse-phase HPLC (C18 column H20/CH3CN, 40-10%), and concentrated to afford the bis-TFA salt of the title compound The bis-TFA salt was neutralized through a silica plug (90 9 1 CHCI3/MeOH/NH4OH) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (62 mg, 34 6%) as the HCI salt LC-MS (ES) m/z 423 (M+H)\ 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 27 (s, 1H), 8 22 (s, 1H), 8 18 (s, 1H), 7 70 (d, 78Hz,1H), 764(d, J = 76Hz,1H), 7 51 (dd, J = 7 3, 7 3 Hz, 1H), 7 41 (dd, J = 7 6, 7 3 Hz, 1H), 4 69 (m, 1H), 4 12 (s, 3H), 3 41-3 19 (m, 4H), and 2 24 (s, 3H) Example 88 N-((1S)-2-amino-1-f[2-(trifluoromethyl]phenyl]methyl)ethyl]-4-(1-ethyl-1H-pyrazol-5-vl)-2-thiophenecarboxamide (Formula Removed) The title compound was prepared as a white solid according to the procedure of Example 87, except substituting 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1f/-pyrazole (104 mg, 0 47 mmol) for 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 35-8 31 (m, 2H), 8 21 (br s, 1H), 7 70 (d, J = 7 8 Hz, 1H), 7 64 (d, J = 7 3 Hz, 1H), 7 51 (dd, J = 7 3, 7 3 Hz, 1H), 7 42 (dd J = 7 6, 7 3 Hz, 1H), 7 00 (m, 1H), 4 70-4 61 (m, 3H), 3 40-3 17 (m, 4H), and 1 57 (t, J = 6 8 Hz, 3H) Example 89 N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) 5-chloro-4-methyl-2-thiophenecarboxylic acid (Formula Removed) To a solution of 4-bromo-2-thiophenecarboxylic acid (2 07 g, 10 mmol) in DMF (5 mL) was added NCS (2 7 g, 15 mmol) in one portion The reaction mixture was stirred at 50 °C for 10 h, and then cooled to room temperature The desired product precipitated after water (5 mL) was added The white solid was filtered and dried under high vacuum to give 1 9 g (79%) LC-MS (ES) m/z =242 (M+H)b) 1,1-dimethylethyl (2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate (Formula Removed) o a solution of 5-chloro-4-methyl-2-thiophenecarboxylic acid (242 mg, 1 0 mmol) and dnsopropylethyl amine (2 5 mL, 14 60 mmol) in DCM (50 mL) at 25 °C was added PyBrOP (2 5 g, 5 30 mmol) in one portion After 30 mm, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (250 mg, 1 0 mmol) was added at one portion After 2h, the solution was concentrated and purified via column chromatography (silica, 10-40% EtOAc in Hexane) affording the title compound (460 mg, 97%) as a white solid LC-MS (ES) m/z = 474 (M+Hf c) 1,1-dimethylethyl [2-({[5-chloro4-(1-ethyl-1H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) o a solution of 1,1-dimethylethyl (2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (100 mg, 0 21 mmol) in THF (5 mL) was added Na2CO3 (2N, 0 3 mL, 0 6 mmol), Pd(dppf)CI2 (20 mg, 24 umol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (92 mg, 0 42 mmol) The reaction mixture was heated to 80 °C in a sealed tube under N2 After 2h, the reaction mixture was concentrated under vacuum and punfied on silica (hex/EtOAc, 20-50%) to afford the title compound (74 mg, 72%) as a light yellow solid LC-MS (ES) m/z 489 (M+H)+ d) N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1A7-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) ,1 -dimethylethyl [2-({[5-chloro-4-(1 -ethyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (61 mg, 0 12 mmol) was dissolved in DCM (2 mL) and treated with TFA (1 mL) After 0 5h, the solution was concentrated and neutralized through silica using 4% MeOH in DCM (1% NH4OH) The title compound was further purified using reverse-phase HPLC (C18 column H2O/CH3CN, 40-10%) affording the bis-TFA salt of the title compound (41 mg, 53%) as a white solid LC-MS (ES) m/z = 389 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 61 (d, J = 2 0Hz, 1H), 7 59 (s, 1H), 7 33-7 21 (m, 5H), 6 41 (d, J = 2 0Hz, 1H), 4 52(m, 1H), 4 10(q, J = 7 1 Hz, 2H), 3 22 (dd, J = 12 9, 3 5 Hz, 1H), 3 12 (dd, J = 12 6, 10 1 Hz, 1H), 2 98 (m, 2H), and 1 35 (t, J = 7 1Hz, 3H) Example 90 N-(H S)--2-amino-1-([2-(trifluoromethyl]phenyl]methyl]ethyl)-5-chloro-4-M -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) The title compound was prepared as an off-white solid according to the procedure of Example 89(c), except substituting 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (150 mg, 0 26 mmol)for 1,1-dimethylethyl (2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LC-MS (ES) m/z 587 (M+H)+ b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1 -ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (110 mg, 0 19 mmol) in MeOH/THF(5 mL/0 5 mL) was added hydrazine (0 5 mL, 15 9 mmol) After stirnng overnight at RT, the reaction mixture was concentrated, and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 40-10%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water, and neutralized by aminonium hydroxide The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4, and concentrated to give a free base of the title compound, which was dissolved in MeOH (2 mL), and treated with HCI (aq, 37%) After stirring overnight, the reaction solution was concentrated to give the title compound (26 mg, 26 %) as a di-HCI salt LC-MS (ES) m/z = 457 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 28 (d, J = 2 5Hz, 1H), 8 07 (s, 1H), 7 70 (d, J = 7 6 Hz, 1H), 7 62 (d, J = 7 6 Hz, 1H), 7 53 (dd, J = 7 3, 7 6 Hz, 1H), 7 43 (dd, J = 7 6, 7 6 Hz, 1H), 6 90 (d, J = 2 5 Hz, 1H), 4 66 (m, 1H), 4 43 (q, J = 7 3 Hz, 2H), 3 37-3 16 (m, 4H), and 1 50 (t, J = 7 3 Hz, 3H) Example 91 N-((1S)-2-amino-1-f[2-(trifluoromethyl]phenyl]methyl)ethyl)-5-chloro-4-n.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a)5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a solution of 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (260 mg, 0 46 mmol) in THF (5 mL) was added Na2CO3 (2N, 0 7 mL, 1 4 mmol), Pd(dppf)CI2 (40 mg, 48 umol) and 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (303 mg, 1 38 mmol) The reaction mixture was heated to 75 °C in a sealed tube under N2 After 8h, the reaction mixture was concentrated under vacuum and punfied on silica (101 CHCI3/MeOH) to afford the title compound (196 mg, 73 4%) LC-MS (ES) m/z = 587 (M+H)+ b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (196 mg, 0 34 mmol) in MeOH/THF(2 mL/0 5 mL) was added hydrazine (0 5 mL, 15 9 mmol) After stirring overnight at RT, the reaction mixture was concentrated, and purified on silica (50% MeOH in CHCI3 (0 5% NH4OH) to give a free base of the tile compound, which was dissolved in MeOH (2 mL), and treated with HCI (aq, 37%) After stirring overnight, the reaction solution was concentrated to give the title compound (107 mg, 51 %) as a di-HCI salt LC-MS (ES) m/z = 457 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 96 (s, 1H), 7 90 (m, 1H), 7 70 (d, J =7 6 Hz, 1H), 7 60 (d, J = 7 6 Hz, 1H), 7 53 (t, J = 7 3 Hz, 1H), 7 43 (t, J = 73 Hz, 1H), 4 66 (m, 1H), 3 91 (s, 3H), 3 33-3 14 (m, 4H), and 2 10 (s, 3H) Example 92 (Formula Removed) N-(( 1 S)-2-amino-1 -{[2-(trifluoromethyl]phenyl]methyltethyl)-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-thioDhenecarboxamide (Formula Removed) a) methyl 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-2-thiophenecarboxylate (1 0 g, 4 52 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (1 86 g, 13 5 mmol), tetrakistriphenylphosphine Pd(0) (260 mg, 0 23 mmol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole(1 3 g, 5 85 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and punfied on silica (hex/EtOAc, 20-40%) to afford methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 7 g, 66%) as a light yellow solid LC-MS (ES) m/z = 237 (M+H)+ To a solution of the above compound (0 5 g, 2 11 mmol) in THF (10 mL) was added NCS (0 364g, 2 74 mmol) The reaction mixture was heated to 70° C under nitrogen After 2h, the reaction mixture was concentrated under vacuum and purified on silica (Hexanes/EtOAc, 10-20%) to afford the title compound (0 45 g, 78%) as a light yellow solid LC-MS (ES) m/z 271 (M+H)+ (b) 4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a solution of methyl 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 3 g, 1 1 mmol) in THF/H20 (5 mL/0 5 mL) was added KOH (0 2 g, 3 4 mmol) The reaction mixture was heated to 50° C for 4 h and then concentrated and diluted with H20 (2 mL) The pH was adjusted to 3 with aqueous HCI The mixture was extracted with DCM (3x5 mL) and the collected organic fractions were concentrated under vacuum to give crude 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (260 mg) which was used directly without further punfication LC-MS (ES) m/z = 256 (M+H)+ To a solution of 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (0 26 g, 1 0 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (0 35 g, 1 1 mmol) and DIPEA (0 5 mL, 2 86 mmol) in DCM (5 mL) at 25 °C was added PyBrOP (0 6 g, 1 2 mmol) in one portion After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/hexane) affording the title compound (0 54 g, 91%) as a white solid LC-MS (ES) m/z = 588 (M+H)+ c)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) 4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (350 mg, 0 60 mmol) was dissolved in MeOH (5 mL) and treated with NH2NH2 (0 5 mL,15 93 mmol) The mixture was stirred at RT overnight, and concentrated The residue was purified by column chromatography (silica, 2-5% MeOH in CHCI3 (0 5% NH4OH) affording the free base of the title compound, which was treated with HCI(aq) in MeOH to give title compound (0 16 g, 51%) as a off white solid LC-MS (ES) m/z = 457 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 97- 7 94 (m, 2H), 7 71 (d, J = 7 8 Hz, 1H), 7 61 (s, 1H), 7 56-7 51 (m, 2H), 7 43 (dd, J = 7 6, 7 6 Hz, 1H), 4 67 (m, 1H), 4 22 (q, J = 7 1 Hz, 2H), 3 36-3 12 (m, 4H), and 1 38 (t, J = 7 1 Hz, 3H) Example 93 N-(nS)--2-amino-1-f[2-(trifluoromethyl)phenyl]methyl)ethylM-^4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) methyl 4-(4-bromo-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 45 g, 1 9 mmol) [see example 92(a)] in THF (5 mL) was added NBS (0 33 g, 2 5 mmol) The reaction mixture was heated to 70° C under nitrogen After 2h, the reaction mixture was concentrated under vacuum and punfied on silica (EtOAc/hexanes, 10-30%) to afford the title compound (0 47 g, 78%) LC-MS (ES) m/z = 316(M+H)+ b)4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a solution of methyl 4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 2 g, 0 63 mmol) in THF/H20 (5 mL/1 mL) was added KOH (0 15 g, 2 4 mmol) The reaction mixture was heated to 50° C for 10h and then concentrated and diluted with H20 (2 mL) The pH was adjusted to 6 with aqueous HCI The mixture was extracted with DCM (3x5 mL) and the collected organic fractions were concentrated under vacuum to give crude 4-(4-bromo-1 -ethyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, which was used directly without further punfication LC-MS (ES) m/z = 302 (M+H)+ To a solution of 4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid 156 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (0 18 g, 0 52 mmol) and DIPEA (0 5 mL, 2 86 mmol) in DCM (5 mL) at 25 °C was added PyBrOP (0 29g, 0 62 mmol) in one portion After 2h, the solution was concentrated and punfied via column chromatography (silica, 20-60 % EtOAc/hexane) affording the title compound (0 281 g, 86%) LC-MS (ES) m/z = 632 (M+H)+ c) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) 4-(4-bromo-1-ethyl-1H-pyrazol-5-y^N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (250 mg, 0 39 mmol) was dissolved in MeOH (5 mL) and treated with NH2NH2 (0 5 mL, 15 93 mmol) The mixture was stirred at RT overnight, and concentrated The residue was purified by column chromatography [silica, 2-10% MeOH in CHCI3 (0 5% NH4OH)] affording the free base of the title compound, which was treated with HCI(aq) in MeOH to give the title compound (144 mg, 51%) as an off white solid LC-MS (ES) m/z 502 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 93-7 87 (m, 2H), 7 72 (d, J = 8 1 Hz, 1H), 7 62 (s, 1H), 7 57-7 51 (m, 2H), 7 43 (t, J = 6 6 Hz, 1H), 4 67 (m, 1H), 4 25 (q, J = 7 3 Hz, 2H), 3 37-3 11 (m, 4H), and 1 37 (t, J = 7 1 Hz, 3H) Example 94 (Formula Removed) Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-3-(methyloxv)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 3-(methyloxy)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) Methyl 4-bromo-3-(methyloxy)-2-thiophenecarboxylate (250 mg, 0 10 mmol) [prepared according to Corral, C , El-Ashmawy, M B , Lissavetzky, J , Basilio, A, Giraldez, A, Eur J Med Chem Chim Ther 22, 1987, 251-254 ], 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (250 mg, 1 20 mmol), Pd(PPh3)4 (58 mg, 49 8 umol) and K2CO3 (550 mg, 3 98 mmol) in dioxane (5 mL) and H20 (1 mL) were combined in a sealed tube After 12h at 80 °C, the reaction contents were partitioned between H2O/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 0 5 % MeOH in DCM) affording the title compound (215 mg, 86%) as a brown residue LCMS (ES) m/z = 253 (M+H)+ b) 1,1 -dimethylethyl [2-({[3-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) i) A solution of methyl 3-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (215 mg, 0 853 mmol) in 6N NaOH (4 mL) and THF (4 mL) was stirred in a sealed tube at 70 °C After 2h, the solution was acidified to pH 3 using 1N HCI then extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 239 (M+H)+ n) To a solution of the crude acid, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (210 mg, 0 844 mmol) [from Preparation 2] and diisopropylethyl amine (735 uL, 4 22 mmol) in DCM (8 mL) was added PyBrop (472 mg, 1 01 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 471 (M+H)+ c) N-^-amino-llyphenylmethyl)ethyU-S^methyloxyH-C1-methyl-IH-pyrazol-S-ylly-thiophenecarboxamide A solution of 1,1-dimethylethyl [2-({[3-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part b) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30min, the solution was concentrated with a toluene azeotrope and the residue neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (270 mg, 86%-2steps) as the HCI salt LCMS (ES) m/z 371 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 06 (br s , 3 H) 7 91 (s, 1 H) 7 72 (d, J=8 59 Hz, 1 H) 7 52 (d, J=1 77 Hz, 1 H) 7 25 - 7 31 (m, 4 H) 7 18 - 7 23 (m, 1 H) δ 39 (d, J=2 02 Hz, 1 H) 4 52 (br s , 1 H) 3 78 (s, 3 H) 3 41 (s, 3 H) 2 97-3 05 (m, 4 H) Example 95 (Formula Removed) Preparation of N-{C\ S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) methyl 5-chloro-2-thiophenecarboxylate To a solution of 5-chloro-2-thiophenecarboxylic acid (20 g, 123 mmoles) in MeOH (200 mL) was added cone H2SO4 (5 mL) After heating to 55°C for 12 h, the reaction solution was concentrated and diluted with DCM (250 mL) The DCM solution was washed with aqueous NaHCO3, then H20 and dned over Na2SO4 Concentration under vacuum gave the title compound as a yellow oil (21 5 g, 99%) LCMS(ES)m/z178(M+H)+ b) methyl 4-bromo-5-chloro-2-thiophenecarboxylate (Formula Removed) To a 1 L round bottom flask was added aluminum chloride (11 32 g, 85 mmol) and methyl 5-chloro-2-thiophenecarboxylate (10 g, 56 6 mmol) dissolved in CHCI3 (250 mL) Br2 (4 08 ml, 79 mmol) was added dropwise over 10 minutes After stirring for 6 h at 25 °C, the light orange reaction solution was washed with sat NaHCO3 The organic layer was dned Na2SO4, filtered and concentrated The residue was purified on silica gel [hexanes/EtOAc, 9 1 ] to give the product [12 g, 80%] as a white solid LCMS (ES) m/z 256 (M+H)+ c) methyl 5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a 300 mL sealed flask was added 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (8 14 g, 39 1 mmol) potassium carbonate (12 98 g, 94 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (8 g, 31 3 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 40 g, 0 78 mmol) in 1,4-dioxane (50 ml) and H20 (6 ml) After stirring for 90 mm at 75 °C, the reaction solution was diluted with DCM (100 mL) and washed with H20 The organic layer was dried Na2SO4, filtered and concentrated The reaction residue was purified on silica gel [hexanes/EtOAc, 2 1 ] to give the product [5 7 g, 70%] as a tan solid LCMS (ES) m/z 258 (M+H)+ d) 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a 250 mL round-bottomed flask was added methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (4 4 g, 17 14 mmol) and sodium hydroxide (28 6 ml, 171 mmol) in tetrahydrofuran (THF) (50 ml) and MeOH (50 mL) The reaction solution was stirred at RT for 12h and then made acidic (pH ~ 2) with 2 5 M HCI and extracted with DCM The organic layer was separated, dried (Na2SO4) and concentrated to an off-white solid (4 2 g, 94%) which was used directly without further punfication LCMS (ES) m/z 243 (M+H)+ e) 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3- fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 500 mL round-bottomed flask was added 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (4 2 g, 17 31 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (6 37 g, 19 04 mmol) [prepared according to the procedure of Preparation 6], N,N-dnsopropyl ethylamine (4 53 ml, 26 0 mmol) and Pybrop (12 05 g, 26 0 mmol) in dichloromethane (DCM) (150 ml) After stirring at RT for 12 h, the reaction solution was washed with H20 (2 x 100mL) and the organic layer was dried Na2SO4, filtered and concentrated The crude product was added to a silica gel column and was eluted with [EtOAc/hexanes, 1 1] to give the product [7 8 g, 86%] as a white solid LCMS (ES) m/z 524 (M+H)+ f)N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 250 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (7 8g, 14 91 mmol) and hydrazine (14 50 ml, 298 mmol) in tetrahydrofuran (THF) (75 ml) and methanol (75 mL) After 24 h at RT, the precipitate was filtered, the filtrate was concentrated The crude product was purified on a silica gel column [CHCIa/MeOH/NhUOH, 90 9 1 ] to give the title compound as a white solid The free base product was treated with 4M HCI in dioxane (15 mL) After 5 mm, the solution was concentrated and dried under vacuum to afford the product (6 8 g, 95%) as an HCI salt LCMS (ES) m/z 467 (M+H)+, 1H NMR (400 MHz, CD30D) δ ppm 7 97 (s, 2H), 7 31 (s, 1H), 7 14 (m, 2H), 6 98 (m, 1H), 6 75 (s, 1H), 4 54 (m, 1H), 3 98 (s, 3H), 3 24 (m, 2H), 3 04 (m, 2H) Example 96 (Formula Removed) Preparation of N-{(1 Sy2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-chloro-4-(4-chloro-1-methyl-1^/-pyrazol-5-yl)2-thiophenecarboxamtde a) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a 500 mL flask was added methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (5 g, 19 48 mmol) [from Example 95] and NCS (3 12 g, 23 37 mmol) in tetrahydrofuran (THF) (100 ml) (50 mL) After stirring for 4 h at 70 °C, the yellow reaction solution was treated with 6M NaOH (32 mL, 195 mmole) and stirred an additional 2 hours The reaction solution was diluted with H20 (50 mL) and DCM (200 mL) The organic layer was separated and the aqueous layer made acidic with 6N HCI The acidic aqueous solution was extracted with DCM (3 x 200 mL), dried over Na2SO4, and concentrated to give the crude product [2 6 g, 48%] as a tan solid LCMS (ES) m/z 277 (M+H)+ b) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-/v-{(1S)-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 500 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (6 g, 21 65 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (7 25 g, 21 65 mmol) [prepared according to the procedure of Preparation 6], N,N-diisopropyl ethylamine (5 67 ml, 32 5 mmol) and Pybrop (15 08 g, 32 5 mmol) in Dichloromethane (DCM) (150 ml) After stirring at RT for 12 h, the reaction solution was washed with H20 (2 x 100mL) and the organic layer was dried Na2SO4, filtered and concentrated The crude product was added to a silica gel column and was eluted with [EtOAc/hexanes, 1 1] to give the product [9 Og, 74%] as a white solid LCMS (ES) m/z 558 (M+H)+ c) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 250 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (9 g, 16 15 mmol) and hydrazine (15 69 ml, 323 mmol) in tetrahydrofuran (THF) (75 ml) and methanol (75 mL) After 24 h at RT, the precipitate was filtered, the filtrate was concentrated, and the crude product was punfied on a silica gel column [CHCl3/MeOH/NH4OH, 90 9 1 ] to give the title compound as a white solid The free base product was treated with 4M HCI in dioxane (15 mL) After 5 mm, the product solution was concentrated and dned under vacuum to afford the product (6 5 g, 91%) as an HCI salt LCMS (ES) m/z 428 (M+H)+, 1H NMR (400 MHz, CD3OD) δ ppm 7 75 (s, 1 H), 7 60 (s, 1H), 7 32 (m, 1H) 7 14 (m, 2H), 6 98 (m, 1H), 4 54 (m, 1H), 3 78 (s, 3H), 3 24 (m, 2H), 3 02 (m, 2H) Example 97 (Formula Removed) Preparation of N-((1S)-2-amino-Mr2-ftrifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 0 974 mmol)[prepared according to the procedure in Example 95] in acetonitnle (4 864 ml) and H20 (486 ul) was added selectfluor (449 mg, 1 27 mmol) The resulting solution was stirred at 70 °C in a sealed tube for 1 h after which additional selectfluor (449 mg, 1 266 mmol) was added in one portion After stirnng 12h, the solution was partitioned between H20-DCM The aqueous phase was washed several times with DCM-THF and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 10% EtOAc in hexanes) affording methyl 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (65 mg, 0 237 mmol, 24 30 % yield) as a yellow solid, LCMS (ES) m/z 274, 276 (M, M+H) b) 5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (65 mg, 0 237 mmol) in 6N sodium hydroxide (0 39 ml, 2 37 mmol) and tetrahydrofuran (2 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (54 mg, 0 17 mmol, 72 % yield) as a yellow oil, LCMS (ES) m/e 261, 263 (M, M2)+ c) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (53 mg, 0 203 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (78 mg, 0 203 mmol)[prepared according to Preparation 6] and diisopropylethylamine (0 18 ml, 1 02 mmol) in DCM at 25 °C was added bromo-tris-pyrrohdino-phosphonium hexafluorophosphate (95 mg, 0 203 mmol) in one portion The solution stirred at 25 °C over 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 40% EtOAc in hexanes) yielding 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)- 2-thiophenecarboxamide (106 mg, 0 129 mmol, 63 5 % yield) as a clear oil, LCMS (ES) m/e 591, 593 (M, M+H)+ d) N-((1S)-2-aminc-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1l3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fIuoro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (106 mg, 0 179 mmol) in tetrahydrofuran (1 095 ml) and methanol (1 095 ml) at 25 °C was added hydrazine (0 056 ml, 1 79 mmol) dropwise After 48h, the solution was concentrated, dry loaded (silica, 5% MeOH in DCM (1% NH4OH)) and purified initially by column chromatography The residue was then further punfied via gilson reverse phase chromatography using 2%-95% mobile phase affording the TFA salt of the title compound This compound was neutralized through a plug of silica (5% MeOH in DCM (1% NH4OH)) concentrated and transferred to the HCI salt adding excess 4M HCI in dioxane (500 ul) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (17 mg, 0 029 mmol, 16 16 % yield) as a white solid LCMS (ES) m/z = 461, 463 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 9 11 (s,1 H) δ 11 (s, 1 H) 7 71 (br s , 3 H) 7 66 - 7 70 (m, 2H) 7 54 - 7 61 (m, 2H) 7 41 -7 44 (m, 1 H) 4 47 (br s , 1 H) 3 79 (s, 3 H) 3 07 - 3 16 (m, 4 H) Example 98 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)Dhenyl]methyl}ethyl)-5-ethyl-4-(1 -methyl-1 H-pyrazol-5-yl V-2-thiophenecarboxamide a) methyl 4-bromo-5-ethyl-2-thiophenecarboxylate (Formula Removed) To a solution of 4-bromo-5-ethyl-2-thiophenecarboxylic acid (1 g, 4 25 mmol) in methanol (21 27 ml) was added sulfunc acid (0 23 mL, 4 25 mmol) The resulting solution was stirred at 50 °C for 48h H20 (50 mL) was added and the reaction was cooled to 0 °C in an ice-bath The pH was adjusted to -12 and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SC"4, concentrated and used directly without further purification providing methyl 4-bromo-5-ethyl-2-thiophenecarboxylate (1 060 g, 4 25 mmol, 100 % yield) LCMS (ES) m/e 248, 250 (M, M2)+ b) methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-bromo-5-ethyl-2-thiophenecarboxylate (300 mg, 1 204 mmol), potassium carbonate (832 mg, 6 02 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (326 mg, 1 565 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (30 8 mg, 0 060 mmol) were combined in a sealed tube and stirred at 80 °C for 1 h The reaction contents were then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (301 mg, 1 204 mmol, 100 % yield) as a brown oil LCMS (ES) m/e 251 (M+H)+ c) 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 198 mmol) in 6N sodium hydroxide (2 397 ml, 1 198 mmol) and tetrahydrofuran (5 992 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (283 mg, 1 2 mmol, 100 % yield) as a yellow oil, LCMS (ES) m/z = 236 (M+H)+ d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (283 mg, 1 2 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (461 mg, 1 2 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (1 043 ml, 5 99 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (615 mg, 1 317 mmol) in one portion The solution was stirred at 25 °C over 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 50% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (486 mg, 0 86 mmol, 71 6 % yield) as a clear oil LCMS (ES) m/e 567 (M+H)+ e) N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (486 mg, 0 86 mmol) in tetrahydrofuran (2 144 ml) and methanol (2 14 ml) at 25 °C was added hydrazine (0 269 ml, 8 58 mmol) dropwise After 12h, the solution was concentrated, dry loaded and purified via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) The free base was then converted to the HCI salt by adding excess 4M HCI in dioxane (500 ul) to the residue in MeOH (2 ml) affording N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (250 mg, 0 491 mmol, 57 2 % yield)-2 HCI as a white solid LCMS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=8 84 Hz, 1 H) δ 08 (br s , 3 H) 7 93 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 51-7 61 (m, 3 H) 7 39 - 7 46 (m, 1 H) δ 34 (d, J=2 02 Hz, 1 H) 4 48 (br s , 1 H) 3 77 (s, 3 H) 2 99-3 11 (m, 4 H) 2 74 (q, J=7 49 Hz, 2 H) 1 16 (t, J=7 45 Hz, 3 H) Example 99 (Formula Removed) Preparation of N-((1S)-2-amino-1-/[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-n .4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-bromo-5-methyl-2-thiophenecarboxylate (2g, 8 51 mmol)[prepared in Preparation 10], potassium carbonate (5 88 g, 42 5 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 124 g, 10 21 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(O) (0 217 g, 0 425 mmol) in 1,4-Dioxane (35 4 ml) and H20 (7 09 ml) was stirred at 80 °C in a sealed tube for 1 h The reaction mixture was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 25% EtOAc in hexanes) affording methyl 5-methyl-4-( 1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate This reaction was run in several batches (1g, 3 x 2g) which were combined for workup and purification affording the title compound (5 5 g, 78% combined yield) as a viscous yellow oil LCMS (ES) m/e 236 (M+H)+ b) methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (580 mg, 2 45 mmol) and n-bromosuccinimide (437 mg, 2 45 mmol) in tetrahydrofuran (12 300 ml) was stirred in a sealed tube for 1h at 70 °C The solution was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAc in hexanes) yielding methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (600 mg, 1 90 mmol, 78 % yield) as a yellow oil LCMS (ES) m/e 314, 316 (M, M+H)+ c) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (420 mg, 1 33 mmol), potassium carbonate (921 mg, 6 66 mmol), PdCI2(dppf) (98 mg, 0 13 mmol) and tnmethylboroxine (0 371 ml, 2 67 mmol) in N,N-dimethylformamide (6 663 ml) was stirred at 110 °C in a sealed tube for 2h This reaction was run in two batches (100 mg and 420 mg) which were combined and partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (240 mg, 58%) as a yellow oil LCMS (ES) m/e 251 (M+H)+ d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (240 mg, 0 96 mmol) in 6N sodium hydroxide (3 20 ml, 19 18 mmol) and tetrahydrofuran (4 79 ml) was stirred at 70 °C in a sealed tube for 1 h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (217 mg, 0 92 mmol, 96 % yield) as a yellow oil LCMS (ES) m/e 236 (M+H)+ e) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide (Formula Removed) To a solution of methyl 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (217 mg, 0 918 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (353 mg, 0 92 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 800 ml, 4 59 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (472 mg, 1 01 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide (373 mg, 0 66 mmol, 71 7 % yield) as a yellow foam LCMS (ES) m/e 567 (M+H)+ f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethylH-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide (373 mg, 0 66 mmol) in tetrahydrofuran (1 65 ml) and methanol (1 65 ml) at 25 °C was added hydrazine (0 21 ml, 6 58 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2- thiophenecarboxamide (253 mg, 0 497 mmol, 75 % yield) as a yellow solid LCMS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 80 (d, J=8 59 Hz, 1 H) δ 09 (br s , 3 H) 7 82 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 58 (t, J=8 08 Hz, 1 H) 7 43 (t, J=7 33 Hz, 1 H) 7 38 (s, 1 H) 4 47 (br s , 1 H) 3 64 (s, 3 H) 2 99 - 3 07 (m, 4 H) 2 27 (s, 3 H) 1 89 (s, 3 H) Example 100 (Formula Removed) Preparation of N-((1S)-2-amino-Hr2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiopheriecarboxamide a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 2 mmol)[Prepared in Example 98] and N-chlorosuccinimide (160 mg, 1 2 mmol) in tetrahydrofuran (6 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (1 ml, 5 99 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAC in hexanes) yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (325 mg, 1 20 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 271, 273 (M, M2)+ b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2- thiophenecarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (200 mg, 0 74 mmol), N,N-dnsopropylethylamine (0 64 ml, 3 69 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (284 mg, 0 74 mmol)[prepared according to Preparation 6] in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (414 mg, 0 886 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SC"4, concentrated and punfied via column chromatography (silica, 50% EtOAc in hexanes) yielding 4-(4-chloro-1-methyM H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (316 mg, 0 526 mmol, 71 % yield) as a white foam LCMS (ES) m/e 601, 603 (M, M2)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H -pyrazol-5-yl )-5-ethyl-2-th lophenecarboxa mide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (316 mg, 0 53 mmol) in tetrahydrofuran (1 314 ml) and methanol (1 3 ml) at 25 °C was added hydrazine (0 16 ml, 5 26 mmol) dropwise After 12h, the solution was concentrated, purified via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) and converted to the HCI salt by adding excess 2M HCI in Et20 (2 ml) to the residue in MeOH (5 ml) affording the HCI salt of N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (163 mg, 0 30 mmol, 57 % yield) as a white solid LCMS (ES) m/z = 471, 473 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 82 (br s , 1 H) δ 04 (bs, 3 H) 7 85 (s, 1 H) 7 65 - 7 72 (m, 2 H) 7 52-7 59 (m, 2 H) 7 39 - 7 46 (m, 1 H) 4 41-4 47 (m, 1 H) 3 71 (s, 3 H) 2 98-3 07 (m, 4H) 2 67 (q, J=7 58 Hz, 2 H) 1 16 (t, J=7 58 Hz, 3 H) Example 101 (Formula Removed) Preparation of N-((1S)-2-amino-1-l[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 2 mmol)[Prepared in Example 98] and N-bromosuccinimide (213 mg, 1 2 mmol) in Tetrahydrofuran (5 99 ml) was stirred in a sealed tube for 1h at 70 °C Aqueous sodium hydroxide (4 0 ml, 23 97 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAC in hexanes) yielding 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (378 mg, 1 2 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 314, 316 (M, M2)+ b) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2- thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (200 mg, 0 57 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (181 mg, 0 57 mmol)[Prepared according to Preparation 6] and N,N-dnsopropylethylamine (0 50 ml, 2 87 mmol) in Dichloromethane (4 23 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (295 mg, 0 632 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 50% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (240 mg, 0 37 mmol, 64 8 % yield) as a white foam LCMS (ES) m/e 645, 647 (M, M2)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl- 1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (240 mg, 0 37 mmol) in tetrahydrofuran (1 31 ml) and methanol (1 31 ml) at 25 °C was added hydrazine (0 12 ml, 3 72 mmol) dropwise After 12h, the solution was concentrated, purified via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) and converted to the HCI salt by adding excess 4M HCI in dioxane (2 ml) to the residue in MeOH (5 ml) affording the HCI salt of N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (167 mg, 0 28 mmol, 76 % yield) as a white solid LCMS (ES) m/z = 515, 517 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 77 (dd, J=15 66, 9 09 Hz, 1 H) δ 02 (br s , 3 H) 7 80 (s, 1 H) 7 66 - 7 72 (m, 2 H) 7 54 - 7 61 (m, 2 H) 7 41 - 7 48 (m, 1 H) 4 42 - 4 47 (m, 1 H) 3 71 (s, 3 H) 2 98 - 3 06 (m, 4 H) 2 66 (dd, J=7 45, 3 16 Hz, 2 H) 1 15 (t, J=7 45 Hz, 3H) Example 102 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 75 g, 11 64 mmol)[Prepared in Example 99] and N-chlorosuccinimide (1 55 g, 11 64 mmol) in tetrahydrofuran (58 ml) was stirred in a sealed tube for 1h at 70 °C Sodium hydroxide (9 70 ml, 58 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (2 3 g, 8 96 mmol, 77 % yield) as a yellow oil LCMS (ES) m/e 257, 259 (M, M2)+ b) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3- dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (159 mg, 0 62 mmol), N,N-dnsopropylethylamine (0 54 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 62 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 45% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (231 mg, 0 44 mmol, 71 % yield) as a clear oil LCMS (ES) m/e 525, 527 (M, M2)+ c) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5- yl)-5-methyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (231 mg, 0 44 mmol) in tetrahydrofuran (2 20 ml) and methanol (2 20 ml) at 25 °C was added hydrazine (0 14 ml, 4 40 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was then transferred to the HCI salt adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (124 mg, 0 27 mmol, 60 % yield) as a yellow solid LCMS (ES) m/z = 394, 396 (M, M2)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 8 51 (br s , 1 H) 7 97 (br s , 3 H) 7 86 (s, 1 H) 7 70 (s, 1 H) 4 24 - 4 26 (m, 1 H) 3 71 (s, 3 H) 2 90 - 2 99 (m, 2 H) 2 36 (s, 3 H) 1 75 -1 79 (m, 1 H) 1 61 1 64 (m, 4 H) 1 48 -1 51 (m, 1 H) 1 31 -1 36 (m, 2 H) 1 10 -1 14 (m, 2 H) 0 91 - 0 94 (m, 2 H) Example 103 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexylmethyl]ethyl]-5-methyl-4-n-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 1 06 mmol)[Prepared in Example 99] in 6N sodium hydroxide (1 76 ml, 10 6 mmol) and tetrahydrofuran (5 290 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (151 mg, 0 68 mmol, 64 % yield) as a white solid, LCMS (ES) m/z = 223 (M+H)+ b) N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5- methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (138 mg, 0 62 mmol), N,N-dnsopropylethylamine (0 541 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 62 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 50% EtOAc in hexanes) yielding N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (285 mg, 0 581 mmol, 94 % yield) as a white foam LCMS (ES) m/e 491, 493 (M, M2)+ c) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5- yl)-2-thiophenecarboxamide (Formula Removed) To a solution of N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl )methyl]ethyl}-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (285 mg, 0 581 mmol) in tetrahydrofuran (2 905 ml) and methanol (2 91 ml) at 25 °C was added hydrazine (0 18 ml, 5 81 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1 % NH4OH)) The free base was then transferred to the HCI salt by adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (173 mg, 0 40 mmol, 69 % yield) as a yellow solid LCMS (ES) m/z = 360 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 55 (d, J=8 59 Hz, 1 H) δ 01 (br s , 3 ) 7 94 (s, 1 H) 7 52 (d, J=2 02 Hz, 1 H) δ 35 (d, J=1 77 Hz, 1 H) 4 24 - 4 27 (m, 1 H) 3 77 (s, 3 H) 2 91 - 2 94 (m, 2 H) 2 39 (s, 3 H) 1 72 -1 77 (m, 1 H) 1 60 - 1 64 (m, 4 H) 1 49 - 1 52 (m, 1 H) 1 21 - 1 29 (m, 2 H) 1 15 -1 25 (m, 2 H) 0 89 - 0 94 (m, 2 H) Example 104 (Formula Removed) Preparation of N-[(1S)-2-amino-1-^cyclohexvlmethyl)ethyl)-5-chloro-4-n-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (150 mg, 0 62 mmol)[Prepared in Example 95], N,N-dnsopropylethylamme (0 54 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 62 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L- phenylalanine] in DCM at 25 °C was added bromotris-pyrrolidino-phosphomum hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 45% EtOAc in hexanes) yielding 5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (168 mg, 0 33 mmol, 53 % yield) as a clear oil LCMS (ES) m/e 511, 513 (M, M2)+ b) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (168 mg, 0 33 mmol) in tetrahydrofuran (1 644 ml) and methanol (1 644 ml) at 25 °C was added hydrazine (0 10 ml, 3 29 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) The free base was then transferred to the HCI salt adding excess 4M HCI in dioxane (1 mL) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (79 mg, 017 mmol, 53 % yield) as a yellow solid LCMS (ES) m/z = 380, 382 (M, M2)+, 1H NMR (400 MHz, DMSO-d) d ppm 8 82 (d, J=8 59 Hz, 1 H) δ 10 (s, 1 H) 7 99 (br s , 3 H) 7 55 (d, J=1 77 Hz, 1 H) δ 48 (d, J=2 02 Hz, 1 H) 4 22 - 4 28 (m, 1 H) 3 81 (s, 3 H) 2 90 -2 95 (m, 2 H) 1 74 -1 78 (m, 1 H) 1 62 -1 65 (m, 4 H) 1 48-1 51 (m, 1 H) 1 37 -1 39 (m, 2 H) 1 09 -1 13 (m, 2 H) 0 92 - 0 96 (m, 2 H) Example 105 (Formula Removed) Preparation of N-[(1S)--2-amino-1-(cyclohexvlmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 1 058 mmol)[prepared in Example 99] and N-bromosuccinimide (188 mg, 1 06 mmol) in tetrahydrofuran (5 29 ml) was stirred in a sealed tube for 1h at 70 °C Sodium hydroxide (3 53 ml, 21 16 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated yielding 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (289 mg, 0 96 mmol, 91 % yield) as a yellow oil LCMS (ES) m/e 301, 303 (M, M2)+ b) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3- dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (187 mg, 0 62 mmol), N,N-dnsopropylethylamine (0 54 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 62 mmol) )[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-([(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1 h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over iv^SC^, concentrated and purified via column chromatography (silica, 50% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (226 mg, 0 40 mmol, 64 % yield) as a white foam LCMS (ES) m/e 569, 571 (M, M2)+ c) N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (226 mg, 0 40 mmol) in tetrahydrofuran (1 98 ml) and methanol (1 98 ml) at 25 °C was added hydrazine (0 13 ml, 3 97 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography The free base was then transferred to the HCI salt adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (153 mg, 0 30 mmol, 75 % yield) as a yellow solid LCMS (ES) m/z =439, 441 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 51 (br s , 1 H) 7 96 (br s , 3 H) 7 83 (br s , 1 H) 7 70 (s, 1 H) 4 21 - 4 25 (m, 1 H) 3 94 (s, 3H) 2 89 - 2 92 (m, 2 H) 2 35 (s, 3 H) 1 76 - 1 79 (m, 1 H) 1 60 -1 64 (m, 4 H) 1 48 - 1 54 (m, 1 H) 1 26 - 1 32 (m, 2 H) 1 09 -1 16 (m, 2 H) 0 92 -0 95 (m, 1 H) 0 82 - 0 86 (m, 1 H) Example 106 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1)3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (216 mg, 0 78 mmol)[prepared according to Example 96], N.N-diisopropylethylamme (0 68 ml, 3 90 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (252 mg, 0 78 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (401 mg, 0 86 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 40% EtOAc in hexanes) yielding 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (303 mg, 0 55 mmol, 71 % yield) as a clear oil LCMS (ES) m/e 545, 547 (M, M2)+ b) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (303 mg, 0 55 mmol) in tetrahydrofuran (2 78 ml) and methanol (2 78 ml) at 25 °C was added hydrazine (0 17 ml, 5 55 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was then converted to the HCI salt by adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (190 mg, 0 389 mmol, 70 0 % yield) as a yellow solid LCMS (ES) m/z =415, 417 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 84 (br s , 1 H) δ 06 (s, 4 H) 7 74 (s, 1 H) 4 25 (dd, J=8 84, 4 29 Hz, 1 H) 3 77 (s, 3 H) 2 87 - 2 93 (m, 2 H) 1 71 -1 79 (m, 1H) 1 64 (d, J=9 85 Hz, 3 H) 1 54 (br s , 1 H) 1 48 (br s , 1 H) 1 37 (dd, J=13 26, 4 93 Hz, 1 H) 1 14 (br s , 1 H) 1 17 (d, J=7 33 Hz, 2 H) 0 93 (d, J=10 86 Hz, 1 H) 0 82 - 0 89 (m, 1 H) Example 107 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-p vrazol-5-yl V5-ch loro-2-th ipph en eca rboxa m id e a) 4-(4-bromo-1-methy\|-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (Formula Removed) A solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (50 mg, 0 21 mmol)[prepared in Example 95] and NBS (36 7 mg, 0 21 mmol) in tetrahydrofuran (2 06 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (82 mg, 016 mmol, 79 % yield) as a yellow oil LCMS (ES) m/e 257, 259 (M, M2)+ b) 4-(4'bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3- dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (81 mg, 0 252 mmol), n,n-dnsopropylethylamine (0 22 ml, 1 26 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (81 mg, 0 25 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (141 mg, 0 302 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 40% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (47 mg, 0 080 mmol, 31 6 % yield) as a clear oil LCMS (ES) m/e 589, 591 (M, M2)+ c) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5- yl)-5-chloro-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (48 mg, 0 08 mmol) in tetrahydrofuran (0 41 ml) and methanol (0 41 ml) at 25 °C was added hydrazine (0 03 ml, 0 81 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was then converted to the HCI salt by adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide (11 mg, 0 02 mmol, 24 % yield) as a yellow solid LCMS (ES) m/z =459, 461 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 73 (br s , 1 H) 7 96 (br s , 4 H) 7 74 (s, 1 H) 4 21 - 4 26 (m, 1 H) 3 77 (s, 3 H) 2 92 - 2 99 (m, 2 H) 1 73 - 1 79 (m, 1 H) 1 62 -1 67 (m, 4 H) 1 49 -1 51 (m, 1 H) 1 25 (br s , 2 H) 1 06 -1 13 (m, 2 H) 0 95 (d, J=6 82 Hz, 1 H) 0 82 - 0 89 (m, 1 H) Example 108 (Formula Removed) Preparation of N-((1S)-2-amino-Hr2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide a) methyl 4,5-dibromo-2-furancarboxylate (Formula Removed) To a solution of 4,5-dibromo-2-furancarboxylic acid (5 7 g, 21 1 mmol) in methanol (106 ml) was added sulfuric acid (113 ml, 211 mmol) The resulting solution stirred at 50 °C over 4days The reaction mixture was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and used directly without further punfication providing methyl 4,5-dibromo-2-furancarboxylate (5 5 g, 19 4 mmol, 92 % yield) LCMS (ES) m/e 283 (M+H)+ b) methyl 4-bromo-2-furancarboxylate (Formula Removed) To a solution of methyl 4,5-dibromo-2-furancarboxylate (1 g, 3 52 mmol) in tetrahydrofuran (14 1 ml) at -40 °C was added isopropylmagnesium chlonde (1 85 ml, 3 70 mmol) After 2h, H2O (3 52 ml) was added and the solution warmed to 25 °C The reaction mixture was then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SC"4, concentrated and purified by column chromatography (3% EtOAc in hexanes) affording methyl 4-bromo-2-furancarboxylate (470 mg, 2 04 mmol, 58 % yield) as a white solid LCMS (ES) m/e 204, 206 (M, M2)+ c) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) A solution of methyl 4-bromo-2-furancarboxylate (470 mg, 2 29 mmol), potassium carbonate (1 58 g, 11 46 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (525 mg, 2 52 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (58 6 mg, 0 115 mmol) in 1,4-Dioxane (9 5 ml) and water (1 9 ml) was stirred at 80 °C in a sealed tube for 1h The solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (30% EtOAc in hexanes) affording methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (124 mg, 0 60 mmol, 26 % yield) as a white powder LCMS (ES) m/e 206 (M+H)+ d) 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (Formula Removed) A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (124 mg, 0 60 mmol) in 6N sodium hydroxide (2 0 ml, 12 0 mmol) and tetrahydrofuran (3 0 ml) was stirred at 70 °C in a sealed tube for 2h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over IS^SC^ and concentrated affording 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (54 mg, 0 28 mmol, 47 % yield) as a white solid LCMS (ES) m/e 192 (M+H)+ e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2- furancarboxamide (Formula Removed) To a solution of 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (54 mg, 0 28 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (108 mg, 0 28 mmol)[prepared in Preparation 6] and N,N-dnsopropylethylamine (0 24 ml, 1 40 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (158 mg, 0 34 mmol) in one portion The solution stirred at 25 °C for 1 h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purfied via column chromatography (silica, 50% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (100 mg, 0 14 mmol, 50 % yield) as a white solid LCMS (ES) m/e 523 (M+H)+ f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (100 mg, 0 19 mmol) in tetrahydrofuran (1 ml) and methanol (1 ml) at 25 °C was added hydrazine (0 06 ml, 1 91 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (56 mg, 0 12 mmol, 62 % yield) as a yellow solid LCMS (ES) m/z = 393 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 70 (d, J=9 09 Hz, 1 H) δ 28 (s, 1 H) δ 07 (br s , 3 H) 7 69 (d, J=8 08 Hz, 1 H) 7 56 (d, J=8 08 Hz, 2 H) 7 50 (s, 1 H) 7 45 (d, J=1 77 Hz, 2 H) δ 51 (d, J=1 77 Hz, 1 H) 4 50 - 4 57 (m, 1 H) 3 93 (s, 3 H) 3 02-3 16 (m, 4 H) Example 109 (Formula Removed) Preparation of N-((1S)-2-amino-1-l[2-(trifluoromethyl)phenynmethyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (200 mg, 0 64 mmol)[prepared in Example 99], potassium carbonate (438 mg, 3 17 mmol), bis(tn-t-butylphosphine)palladium(0) (324 mg, 0 64 mmol) and 2,4,6-tnvinylcycloboroxane-pyridine complex (77 mg, 0 32 mmol) in 1,4-dioxane (5 3 ml) and H20 (1 ml) was stirred at 80 °C in a sealed tube for 12h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (135 mg, 0 515 mmol, 81 % yield) as a yellow oil LCMS (ES) m/z = 250 (M+H)+ b) methyl 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (135 mg, 0 52 mmol) in methanol (2 6 ml) was added Pd-C (21 9 mg, 0 21 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Celite and concentrated affording methyl 4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2- thiophenecarboxylate (145 mg, 0 51 mmol, 99 % yield) as a yellow oil which was used without further purification LCMS (ES) m/e 265 (M+H)+ c) 4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (145 mg, 0 55 mmol) in 6N sodium hydroxide (1 8 ml, 10 97 mmol) and tetrahydrofuran (4 8 ml) was stirred at 60 °C in a sealed tube for 12h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (137 mg, 0 55 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 250 (M+H)+ d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl- 2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (137 mg, 0 55 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (211 mg, 0 55 mmol)[prepared in Preparation 6] and diisopropylethylamme (0 48 ml, 2 74 mmol) in Dichloromethane (5 47 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (281 mg, 0 60 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SC4, concentrated and purified via column chromatography (silica, 40-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)- 1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (262 mg, 0 45 mmol, 82 % yield) as a clear oil LCMS (ES) m/e 581 (M+H)+ e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (Formula Removed) To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)^-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (262 mg, 0 45 mmol) in tetrahydrofuran (2 256 ml) and methanol (2 256 ml) at 25 °C was added hydrazine (0 14 ml, 4 51 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (170 mg, 0 32 mmol, 72 % yield) as a yellow solid LCMS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 72 (br s , 1 H) δ 05 (br s , 2 H) 7 76 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 49 - 7 52 (m, 2 H) 7 40 -7 45 (m, 2 H) 4 42 - 4 47 (m, 1 H) 3 61 (br s , 3 H) 3 01 - 3 07 (m, 4 H) 2 52 - 2 59 (m, 2 H) 2 26 (s, 3 H) 1 02 -1 09 (m, 3 H) Example 110 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-Dvrazol-5-yl)-5-ethyl-2-thiophenecarboxamide a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (980 mg, 3 92 mmol)[prepared in Example 98] and N-bromosuccinimide (697 mg, 3 92 mmol) in tetrahydrofuran (19 6 ml) was stirred in a sealed tube for 1h at 70 °C The reaction mixture was then partitioned between h^O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 10-40% EtOAC in hexanes) yielding methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (1 1 g, 3 34 mmol, 85 % yield) as a yellow oil LCMS (ES) m/e 329, 331 (M, M2)+ b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (300 mg, 0 911 mmol), potassium carbonate (630 mg, 4 56 mmol), PdCI2(dppf) (66 7 mg, 0 091 mmol) and tnmethylboroxm (0 25 ml, 1 82 mmol) in N,N-dimethylformamide (9 1 ml) was stirred at 110 °C in a sealed tube for 2h The reaction mixture was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (143 mg, 0 51 mmol, 56 % yield) as a yellow oil LCMS (ES) m/z = 265 (M+H)+ c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (143 mg, 0 54 mmol) in 6N sodium hydroxide (0 90 ml, 5 41 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1 h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (136 mg, 0 54 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 251 (M+H)+ d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (130 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (267 mg, 0 57 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (278 mg, 0 43 mmol, 82 % yield) as a yellow oil LCMS (ES) m/e 581 (M+H)+ e) N-((1S)-2-amino-1 -([2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1 H- pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (278 mg, 0 48 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 15 ml, 4 79 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (3-15% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 2M HCI in Et20 (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (196 mg, 0 36 mmol, 76 % yield) as a yellow solid LCMS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 86 - 8 93 (m, 1 H) δ 15 (br s , 3 H) 7 83 (s, 1 H) 7 69 (d, J=7 58 Hz, 1 H) 7 55 (br s , 1 H) 7 52 (t, J=7 45 Hz, 1 H) 7 42 (t, J=7 45 Hz, 1 H) 7 38 (s, 1 H) 4 22 - 4 27 (m,1 H) 3 62 (s, 3 H) 2 97 - 3 09 (m, 4 H) 2 60 (q, J=7 49 Hz, 2 H) 1 88 (s, 3 H) 1 13 (t, J=7 58 Hz, 3 H) Example 111 (Formula Removed) Preparation of N-((1S)-2-amino-1 -ir2-(trifluoromethyl]phenyl]methyl}ethyl)-5-methyl-4-n-methyl-4-n-methylethyl)-1H-pyrazol-5-vH-2-th)ophenecarboxam>de a) methyl 5-methyl-4-[1-methyl-4-(1-methylethenyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (300 mg, 0 95 mmol), potassium carbonate (658 mg, 4 76 mmol), bis(tn-t-butylphosphine)palladium(0) (24 32 mg, 0 05 mmol) and 4,4,5,5-tetramethyl-2-(1-methylethenyl)-1,3,2-dioxaborolane (0 18 ml, 0 95 mmol) in 1,4-dioxane (5 3 ml) and H20 (1 0 ml) was stirred at 80 °C in a sealed tube for 12h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-methyl-4-[1-methyl-4-(1-methylethenyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (171 mg, 0 58 mmol, 61 % yield) as a yellow oil LCMS (ES) m/z = 276 (M+H)+ b) methyl 5-methyl-4-[1-methyl-4-(1-methylethyl)-1 H-pyrazol-5-yl]-2- thiophenecarboxylate (Formula Removed) To a solution of methyl 5-methyl-4-[1-methyl-4-(1-methylethenyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (171 mg, 0 62 mmol) in methanol (3 ml) was added PdOH2 (34 8 mg, 0 25 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Cehte and concentrated affording methyl 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (173 mg, 0 62 mmol, 100 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+ c) 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (173 mg, 0 62 mmol) in 6N sodium hydroxide (1 ml, 6 21 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylic acid (148 mg, 0 49 mmol, 79 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+ d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H- pyrazol-5-yl]-2-thiophenecarboxamide (Formula Removed) To a solution of 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylic acid (137 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[Prepared in Preparation 6] and dusopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (267 mg, 0 572 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxamide (211 mg, 0 334 mmol, 64 2 % yield) as a yellow oil LCMS (ES) m/e 595 (M+H)+ e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1 -methyl-4-(1 -methylethyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxamide (Formula Removed) To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H- pyrazol-5-yl]-2-thiophenecarboxamide (211 mg, 0 36 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 11 ml, 3 55 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1 -methyl-4-(1 -methylethyl)-1 H- pyrazol-5-yl]-2-thiophenecarboxamide (108 mg, 0 20 mmol, 57 % yield) as a yellow solid LCMS (ES) m/z = 465 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 71 (d, J=8 59 Hz, 1 H) δ 07 (br s , 3 H) 7 74 (s, 1 H) 7 65 - 7 68 (m, 1 H) 7 55 - 7 60 (m, 1 H) 7 46 - 7 49 (m, 1 H) 7 39 - 7 46 (m, 2 H) 4 47 (br s , 1 H) 3 57 (s, 3 H) 2 99 - 3 05 (m, 4 H) 2 49 - 2 52 (m, 1 H) 2 25 (s, 3 H) 1 07 -1 14 (m, 6 H) Example 112 (Formula Removed) Preparation of N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide a) methyl 4-bromo-5-propyl-2-thiophenecarboxylate (Formula Removed) To a solution of 4-bromo-5-propyi-2-thiopnenecarboxylic acid (5 0 g, 20 07 mmol) in methanol (100 ml) was added sulfunc acid (5 35 ml, 100 mmol) The resulting solution stirred at 50 °C for 36h H20 (50 mL) was added the aqueous phase was washed several times with DCM The combined organic fractions were washed with saturated NaHCO3, dried over Na2SO4, concentrated and used directly without further punfication providing methyl 4-bromo-5-propyl-2-thiophenecarboxylate (5 1 g, 18 61 mmol, 93 % yield) as a yellow oil LCMS (ES) m/e 262, 264 (M, M2)+ b) methyl 4-(1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-bromo-5-propyl-2-thiophenecarboxylate (1 0 g, 3 80 mmol), potassium carbonate (2 63 g, 19 00 mmol), 1-methyl-5-(4,4,5,5-tetramethyl- 1,3,2-dioxaborolan-2-yl)-1H-pyrazole (0 949 g, 4 56 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (0 097 g, 0 19 mmol) were combined in a sealed tube and stirred at 80 °C for 1 h The reaction contents were then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated and punfied by column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (1 07 g, 3 76 mmol, 99 % yield) as a yellow oil LCMS (ES) m/e 265 (M+H)+ c) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (356 mg, 1 35 mmol) and N-chlorosuccmimide (180 mg, 1 35 mmol) in tetrahydrofuran (6 7 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (2 2 ml, 13 47 mmol) was added in one portion and the solution stirred an additional 12h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and used directly without further purification yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (357 mg, 1 25 mmol, 93 % yield) as a yellow oil LCMS (ES) m/e 271, 273 (M, M2)+ d) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2- thiophenecarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (148 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[Prepared according to Preparation 6] and diisopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (267 mg, 0 57 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (245 mg, 0 39 mmol, 75 % yield) as a yellow oil LCMS (ES) m/e 615, 617 (M, M2)+ e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (245 mg, 0 40 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 12 ml, 3 98 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2- (trifluoromethyl)phenyl]methyl}ethylH-(4-ch,or°-',-metnyl-'H-Pyra2o\|-5-y\|)-5-Propy\|-2-thiophenecarboxamide (178 mg, 0 32 mmol, 80 % yield) as a yellow solid LCMS (ES) m/z = 485, 487 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 96 (br s , 1 H) δ 13 (br s , 3 H) 7 93 (s, 1 H) 7 66 - 7 73 (m, 2 H) 7 62 (br s , 1 H) 7 55 (t, J=7 45 Hz, 1 H) 7 42 (t, J=7 45 Hz, 1 H) 4 48 (br s , 1 H) 3 71 (s, 3 H) 2 99 - 3 08 (m, 4 H) 2 63 (t, J=7 20 Hz, 2 H) 1 53 - 1 57 (m, 2 H) 0 83 (t, J=7 33 Hz, 3 H) Example 113 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl]ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (714 mg, 2 70 mmol)[prepared in Example 112] and N-bromosuccinimide (481 mg, 2 70 mmol) in tetrahydrofuran (12 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half of the solution was treated with 6N sodium hydroxide (2 251 ml, 13 51 mmol) The reaction mixture stirred at 70 °C in a sealed tube for 12h and was partitioned between H2O-DCM The pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly affording 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (445 mg, 1 35 mmol, 50 % yield) LCMS (ES) m/e 329, 331 (M, M2)+ b)4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2- thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (171 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[prepared according to Preparation 6] and diisopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (267 mg, 0 57 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2- (trifluoromethyl)phenyl]methy!}ethy!)-5-propyl-2-thiophenecarboxanude (251 mg, 0 37 mmol, 72 % yield) as a yellow oil LCMS (ES) m/e 659,661 (M, M2)+ c) N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (251 mg, 0 38 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 12 ml, 3 81 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide (178 mg, 0 30 mmol, 78 % yield) as a yellow solid LCMS (ES) m/z = 529, 531 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 94 (d, J=8 84 Hz, 1 H) δ 10 (br s , 3 H) 7 87 (d, J=1 77 Hz, 1 H) 7 65 - 7 72 (m, 2 H) 7 58 (dd, J=14 78, 7 71 Hz, 2 H) 7 43 (t, J=7 45 Hz, 1 H) 4 48 (br s , 1 H) 3 71 (s, 3 H) 2 99 - 3 08 (m, 4 H) 2 58 - 2 66 (m, 2 H) 1 53 (ddd, J=13 89, 6 82, 6 57 Hz, 2 H) 0 83 (dd, J=7 33, 2 02 Hz, 3 H) Example 114 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenvi1methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (714 mg, 2 70 mmol) and N-bromosuccinimide (481 mg, 2 70 mmol) in tetrahydrofuran (12 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half was partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly yielding methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (464 mg, 1 35 mmol, 50 % yield) as an orange oil LCMS (ES) m/e 343, 345 (M, M2)+ b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-propylthiophene-2-carboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (242 mg, 0 71 mmol), PdCI2(dppf) (52 mg, 0 07 mmol), potassium carbonate (487 mg, 3 53 mmol) and tnmethylboroxine (0 20 ml, 1 41 mmol) in N,N-Dimethylformamide (3 5 ml) was stirred at 110 °C in a sealed tube for 2h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Is^SC^, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (184 mg, 0 60 mmol, 84 % yield) as a yellow oil LCMS (ES) m/z = 279 (M+H)+ c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-propylthiophene-2-carboxylic acid (Formula Removed) A solution of methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (0 184 g, 0 66 mmol) in 6N sodium hydroxide (2 2 ml, 13 22 mmol) and tetrahydrofuran (6 6 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (180 mg, 0 66 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 265 (M+H)+ d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)-1-[2-(trifluoromethyl)benzyl]ethyl}-5-propylthiophene-2-carboxamide (Formula Removed) To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (180 mg, 0 68 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (262 mg, 0 68 mmol)[prepared in Preparation 6] and dnsopropylethylamine (0 59 ml, 3 40 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (350 mg, 0 75 mmol) in one portion The solution stirred at 25 °C for 2h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{t2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (243 mg, 0 41 mmol, 60 % yield) as a yellow oil LCMS (ES) m/e 595 (M+H)+ e) N-{(1S)-2-amino-1 -[2-(trifluoromethyl)benzyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5- yl)-5-propylthiophene-2-carboxamide (Formula Removed) To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (243 mg, 0 41 mmol) in tetrahydrofuran (2 ml) and methanol (2 ml) at 25 °C was added hydrazine (0 13 ml, 4 09 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide (172 mg, 0 30 mmol, 74 % yield) as a yellow solid LCMS (ES) m/z = 465 (M+H)+, 1H NMR (400 MHz, DMSO-ofe) δ ppm 8 80 (br s , 1 H) δ 08 (br s , 3 H) 7 78 (s, 1 H) 7 69 (d, J=7 58 Hz, 1 H) 7 50 - 7 55 (m, 2 H) 7 43 (t, J=7 71 Hz, 1 H) 7 37 (s, 1 H) 4 49 (d, J=10 36 Hz, 1 H) 3 61 (s, 3 H) 2 99 - 3 06 (m, 4 H) 2 54 - 2 59 (m, 2 H) 1 87 (s, 3 H) 1 48 - 1 55 (m, 2 H) 0 81 (t, J=7 33 Hz, 3 H) Example 115 (Formula Removed) Preparation of N-((1S)-2-amino-1-[2-(trifluoromethyl]benzvllethyl]-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)thiophene-2-carboxamide a) methyl 5-metriyl-4-{1-methyl-4-[(1 E)-prop-1-en-1-yl]-1 H-pyrazol-5-yl}thiophene-2-carboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (320 mg, 1 015 mmol)[prepared in Example 99], potassium carbonate (702 mg, 5 08 mmol), bis(tn-t-butylphosphine)palladium(0) (25 9 mg, 0 05 mmol) and(1Z)-1-propen-1-ylboronic acid (87 mg, 1 01 mmol) in 1,4-dioxane (5 3 ml) and water (1 3 ml) was stirred at 80 °C in a sealed tube for 12h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-methyl-4-{1-methyl-4-[(1Z)-1-propen-1-yl]-1H-pyrazol-5-yl}-2-thiophenecarboxylate (243 mg, 0 88 mmol, 87 % yield) as a yellow oil LCMS (ES) m/z = 277 (M+H)+ b) methyl 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 5-methyl-4-{1-methyl-4-[(1Z)-1-propen-1-yl]-1H-pyrazol-5-yl}-2-thiophenecarboxylate (243 mg, 0 88 mmol) in methanol (6 8 ml) was added Pd(OH)2 (49 mg, 0 35 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Cehte and concentrated affording methyl 5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (217 mg, 0 69 mmol, 78 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+ c) 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (217 mg, 0 78 mmol) in 6N sodium hydroxide (2 60 ml, 15 59 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (242 mg, 0 78 mmol, 100 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+ d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5- yl )-2-th tophenecarboxamide (Formula Removed) To a solution of 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (206 mg, 0 78 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (300 mg, 0 78 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 68 ml, 3 90 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (400 mg, 0 86 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (283 mg, 0 46 mmol, 60 % yield) as a yellow oil LCMS (ES) m/e 595 (M+H)+ e) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1- methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (283 mg, 0 48 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 15 ml, 4 76 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (186 mg, 0 35 mmol, 73 % yield) as a yellow solid LCMS (ES) m/z = 465 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 81 (br s , 1 H) δ 13 (br s , 3 H) 7 79 (s, 1 H) 7 68 (d, J=7 58 Hz, 1 H) 7 59 (d, J=7 07 Hz, 1 H) 7 42 - 7 51 (m, 1 H) 7 38 - 7 45 (m, 2 H) 4 47 (br s , 1 H) 3 61 (d, J=2 78 Hz, 3 H) 2 99 - 3 08 (m, 4 H) 2 25 (s, 3 H) 2 11 - 2 21 (m, 2 H) 1 41 - 1 48 (m, 2 H) 0 83 (br s,3H) Example 116 (Formula Removed) Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide a) methyl 4-bromo-5-methyl-2-furancarboxylate (Formula Removed) To a solution of methyl 5-methyl-2-furancarboxylate (1 5 g, 10 70 mmol) and aluminum tnchlonde (2 14 g, 16 06 mmol) in chloroform (21 ml) at 0 °C was added bromine (0 77 ml, 14 99 mmol) The resulting solution stirred at 0 °C and warmed to RT over 12h This reaction was run in batches (1 5g and 1g) and the batches were combined, added to ice and partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified by column chromatography (0 5-10% EtOAc in hexanes) affording the title compound (2 1 g, 54%) as a white solid, LCMS (ES) m/z = 219, 221 (M, M2)+ b) methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) A solution of methyl 4-bromo-5-methyl-2-furancarboxylate (2 1 g, 9 59 mmol), potassium carbonate (6 63 g, 47 9 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 19 g, 10 55 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (0 24 g, 0 48 mmol) in 1,4-dioxane (40 ml) and water (8 ml) was stirred at 80 °C in a sealed tube for 1h 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 19 g, 10 55 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 245 g, 0 48 mmol) were added and the reaction stirred an additional 1h and was partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (10-40% EtOAc in hexanes) affording methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (1 7 g, 7 72 mmol, 81 % yield) as a yellow oil LCMS (ES) m/e 221 (M+H)+ c) 5-methyl-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (200 mg, 0 91 mmol) in 6N sodium hydroxide (2 3 ml, 13 62 mmol) and tetrahydrofuran (4 5 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 5-methyl-4-(1-methyl-1H-pyra2ol-5-yl)-2-furancarboxylic acid (130 mg, 0 57 mmol, 63 % yield) as a yellow oil LCMS (ES) m/e 207 (M+H)+ d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2- furancarboxamide (Formula Removed) To a solution of 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (130 mg, 0 63 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (243 mg, 0 63 mmol)[prepared in Preparation 6] and dnsopropylethylamine (0 55 ml, 3 15 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (324 mg, 0 69 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (190 mg, 0 23 mmol, 37 % yield) as a clear oil LCMS (ES) m/e 537 (M+H)+ e) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1- methyl-1H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) To a solution of N-((1S)-2-(113-dioxo-1)3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-( 1 -methyl- 1H-pyrazol-5-yl)-2-furancarboxamide (190 mg, 0 35 mmol) in tetrahydrofuran (1 5 ml) and methanol (1 5 ml) at 25 °C was added hydrazine (0 11 ml, 3 54 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (71 mg, 0 15 mmol, 42 % yield) as a yellow solid LCMS (ES) m/z 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 60 (d, J=9 60 Hz, 1 H) δ 04 (br s , 3 H) 7 70 (d, J=7 83 Hz, 1 H) 7 53 - 7 59 (m, 2 H) 7 49 (d, J=1 77 Hz, 1 H) 7 38 - 7 45 (m, 2 H) δ 33 (br s , 1 H) 4 52 (br s , 1 H) 3 80 (s, 3 H) 2 98 - 3 09 (m, 4 H) 2 38 (s, 3 H) Example 117 (Formula Removed) Preparation of N-((1S)-2-amino-1-[[2-(trifluoromethy0phenyl]methyl)ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (600 mg, 2 72 mmol)[prepared in Example 116] and n-bromosuccinimide (485 mg, 2 72 mmol) in tetrahydrofuran (13 6 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half of the solution was treated with 6N sodium hydroxide (4 54 ml, 27 2 mmol) which stirred at 70 °C in a sealed tube for 4h The solution was partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly affording 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (369 mg, 1 29 mmol, 48 % yield) as an orange oil LCMS (ES) m/e 285, 287 (M, M2)+ b) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2- furancarboxamide (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (200 mg, 0 70 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (270 mg, 0 70 mmol)[prepared according to Preparation 6] and dusopropylethylamine (0 61 ml, 3 51 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphomum hexafluorophosphate (361 mg, 0 77 mmol) in one portion The solution stirred at 25 °C for 1h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (232 mg, 0 32 mmol, 46 % yield) as a clear oil LCMS (ES) m/e 615, 617 (M+H)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl- 1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (Formula Removed) To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(113-dioxo-1,3-dihydro-2HHsoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (232 mg, 0 38 mmol) in tetrahydrofuran (2 ml) and methanol (2 ml) at 25 °C was added hydrazine (0 12 ml, 3 77 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (106 mg, 0 19 mmol, 50 % yield) as a yellow solid LCMS (ES) m/z = 485, 487 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 60 (d, J=9 60 Hz, 1 H) 7 99 (br s , 3 H) 7 68 (s, 2 H) 7 71 (d, J=8 08 Hz, 1 H) 7 59 (d, J=7 33 Hz, 1 H) 7 44 - 7 56 (m, 1 H) 7 25 - 7 33 (m, 1 H) 4 50 - 4 57 (m, 1 H) 3 74 (s, 3 H) 2 99 - 3 07 (m, 4 H) 2 32 (s, 3 H) Example 118 (Formula Removed) Preparation of N-((1S)-2-amino-H[2-arifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 36 mmol) and N-chlorosuccinimide (182 mg, 1 36 mmol) in tetrahydrofuran (6 7 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (3 4 ml, 20 4 mmol) was added in one portion and the solution stirred an additional 12h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (275 mg, 1 14 mmol, 84 % yield) as a orange oil LCMS (ES) m/e 241, 243 (M, M2)+ b) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2- furancarboxamide (Formula Removed) To a solution of 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (200 mg, 0 83 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (320 mg, 0 83 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 72 ml, 4 16 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (427 mg, 0 91 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (246 mg, 0 40 mmol, 49 % yield) as a clear oil LCMS (ES) m/e 571, 573 (M, M2)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl- 1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (246 mg, 0 43 mmol) in tetrahydrofuran (2 1 ml) and methanol (2 1 ml) at 25 °C was added hydrazine (135 ul, 4 31 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (125 mg, 0 24 mmol, 56 % yield) as a yellow solid LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 63 (d, J=9 09 Hz, 1 H) δ 04 (br s , 3 H) 7 65 - 7 72 (m, 2 H) 7 59 (d, J=7 33 Hz, 1 H) 7 57 (br s , 1 H) 7 39 - 7 47 (m, 1 H) 7 29 - 7 37 (m, 1 H) 4 54 (br s , 1 H) 3 73 (s, 3 H) 2 98 - 3 09 (m, 4 H) 2 33 (s, 3 H) Example 119 (Formula Removed) Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (600 mg, 2 72 mmol)[prepared in Example 116] and N-bromosuccinimide (485 mg, 2 72 mmol) in tetrahydrofuran (13 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half of the solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified by column chromatography (5-15% EtOAc in hexanes yielding methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (130 mg, 0 41 mmol, 15 % yield) as an orange oil LCMS (ES) m/e 299, 301 (M, M2)+ b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (130 mg, 0 43 mmol), potassium carbonate (300 mg, 2 17 mmol), PdCI2(dppf) (15 9 mg, 0 02 mmol) and tnmethylboroxine (0 12 ml, 0 87 mmol) in N,N-Dimethylformamide (3 5 ml) was stirred at 110 °C in a sealed tube for 2h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (60 mg, 0 26 mmol, 59 % yield) as a yellow oil LCMS (ES) m/z = 235 (M+H)+ c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (Formula Removed) A solution of methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-rnethyl-2-furancarboxylate (60 mg, 0 26 mmol) in 6N sodium hydroxide (0 8 ml, 5 1 mmol) and tetrahydrofuran (2 5 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (53 mg, 0 24 mmol, 94 % yield) as a white foam LCMS (ES) m/e 221(M+H)+ d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (Formula Removed) To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (53 mg, 0 24 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (93 mg, 0 24 mmol)[prepared according to Preparation 6] and N,N-dnsopropylethylamine (0 21 ml, 1 20 mmol) in dichloromethane (2 4 ml) at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (124 mg, 0 26 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (113 mg, 0 21 mmol, 85 % yield) as a white foam LCMS (ES) m/e 551 (M+H)+ e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1 H- pyrazol-5-yl)-5-methyl-2-furancarboxamide (Formula Removed) To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]rnethyl}ethyl)-5-methyl-2-furancarboxamide (113 mg, 0 21 mmol) in tetrahydrofuran (1 mL) and methanol (1 mL) at 25 °C was added hydrazine (64 ul, 2 05 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (32 mg, 0 06 mmol, 32 % yield) as a yellow solid LCMS (ES) m/z = 421 (M+H)+, 1H NMR (400 MHz, DMSO-ofe) δ ppm 8 60 (d, J=9 09 Hz, 1 H) δ 05 (br s , 3 H) 7 70 (d, J=7 58 Hz, 1 H) 7 54 - 7 61 (m, 2 H) 7 40 - 7 47 (m, 1 H) 7 35 (s, 1 H) 7 27 (s, 1 H) 4 54 (br s , 1 H) 3 65 (s, 3 H) 2 98 - 3 07 (m, 4 H) 2 26 (s, 3 H) 1 90 (s, 3 H) Example 120 (Formula Removed) Preparation of N-K1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)5-ethyl-2-thiophenecarboxarrude The title compound was prepared as a yellow solid according to the procedure of Example 100, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (155 mg, 0 46 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 421, 423 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 76 (br s , 1 H) δ 06 (br s, 3 H) 7 85 (s, 1 H) 7 69 (s, 1 H) 7 28 - 7 36 (m, 1 H) 7 12 (d, J=7 07 Hz, 2 H) 7 03 (dd, J=17 05, 2 15 Hz, 1 H) 4 36 (br s , 1 H) 3 69 (s, 3 H) 2 93 - 3 02 (m, 4 H) 2 67 (q, J=7 33 Hz, 2 H) 1 16 (t, J=7 45 Hz, 3 H) Example 121 (Formula Removed) N-[(1S)-2-amino-1-R3-fluoroDhenyl]methyi1etrivlM-n .4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 110, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (241 mg, 0 72 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 401 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 76 (br S , 1 H) δ 11 (br S , 3 H) 7 79 (s, 1 H) 7 37 (s, 1 H) 7 28 - 7 36 (m, 1 H) 7 12 (d, J=6 82 Hz, 2 H) 7 03 (td, J=8 65, 1 64 Hz, 1 H) 4 41 - 4 43 (m, 1 H, obscured) 3 60 (br S , 3 H) 2 99 - 3 02 (m, 4 H) 2 60 (q, J=7 33 Hz, 2 H) 1 86 (s, 3 H)1 13 (t, J=7 45Hz, 3H) Example 122 (Formula Removed) Preparation of N-((1S)-2-amino-1-f[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 110, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (277 mg, 0 72 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 8 70 (br s , 1 H) δ 06 (br s , 3 H) 7 68 - 7 75 (m, 1 H) 7 52 (s, 1 H) 7 50 - 7 56 (m, 3 H) 7 37 (s, 1 H) 4 36 (d, J=8 84 Hz, 1 H) 3 58 (br s , 3 H) 2 98 -3 02 (m, 4 H) 2 55 - 2 61 (m, 2 H) 1 86 (s, 3 H) 1 12 (t, J=7 58 Hz, 3 H) Example 123 (Formula Removed) Preparation of N-((1S)-2-amino-1-ir2-(trifluoromethyBphenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 g, 3 99 mmol)[prepared in Example 98] and N-bromosuccinimide (0 711 g, 3 99 mmol) in tetrahydrofuran (8 ml) was stirred in a sealed tube for 1h at 70 °C The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and purified by column chromatography (10-50% EtOAc in hexanes yielding methyl 4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (1 2 g, 3 54 mmol, 89 % yield) as an orange oil LCMS (ES) m/e 329, 331 (M, M2)+ b) methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (300 mg, 0 911 mmol), potassium carbonate (630 mg, 4 56 mmol), bis(tn-t-butylphosphine)palladium(0) (23 29 mg, 0 05 mmol) and 2,4,6-tnvinylcycloboroxane-pyndine complex (110 mg, 0 45 mmol) in 1,4-dioxane (5 ml) and Water (1 ml) was stirred at 80 °C in a sealed tube for 2h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over IS^SC^, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (187 mg, 0 66 mmol, 73 % yield) as a clear oil LCMS (ES) m/z = 277 (M+H)+ c) methyl 5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (187 mg, 0 68 mmol) in methanol (2 5 ml) was added Pd-C (7 20 mg, 0 07 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1 h The solution was then purged with N£, filtered through Celite and concentrated affording methyl 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (187 mg, 0 64 mmol, 95 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+ d) 5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (181 mg, 0 65 mmol) in 6N sodium hydroxide (2 16 ml, 13 0 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (175 mg, 0 65 mmol, 100 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+ e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (175 mg, 0 66 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (255 mg, 0 66 mmol)[prepared according to Procedure 6] and N,N-dnsopropylethylamine (0 58 ml, 3 31 mmol) in Dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (340 mg, 0 73 mmol) in one portion The solution stirred at 25 °C for 1h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (232 mg, 0 38 mmol, 57 % yield) as a clear oil LCMS (ES) m/e 595 (M+H)+ f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1- methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (232 mg, 0 39 mmol) in tetrahydrofuran (2 mL) and methanol (2 mL) at 25 °C was added hydrazine (122 pi, 3 90 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (176 mg, 0 38 mmol, 97 % yield) as a yellow solid LCMS (ES) m/z = 529, 531 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 64 (br s , 1 H) 7 97 (br s , 3 H) 7 65 - 7 73 (m, 3 H) 7 57 (d, J=5 05 Hz, 2 H) 7 59 (br s , 1 H) 7 44 (br s , 1 H) 4 48 (br s , 1 H) 3 69 (s, 3 H) 2 98 - 3 12 (m, 4 H) 1 24 (dd, J=6 82, 2 27 Hz, 3 H) 1 16 (dd, J=6 82, 2 53 Hz, 3 H) Example 124 (Formula Removed) Preparation of N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 123, except substituting (1Z)-1-propen-1-ylboronic acid (78 mg, 0 91 mmol) for 2,4,6-trivinylcycloboroxane-pyndine complex LCMS (ES) m/z = 479 (M+H)+, ^ H NMR (400 MHz, DMSO-d6) δ ppm 8 63 (s, 1 H) δ 01 (br s , 3 H) 7 67 (s, 2 H) 7 56 (d, J=5 05 Hz, 2 H) 7 38 - 7 46 (m, 2 H) 4 42 - 4 47 (m, 1 H) 3 59 (s, 3 H) 2 98 -3 02 (m, 4 H) 2 66 - 2 71 (m, 2 H) 1 40 -1 47 (m, 2 H) 1 13 (t, J=7 52 Hz, 3 H) 0 83 (t, J=7 26 Hz, 3 H) Example 125 (Formula Removed) Preparation of N-((1S)-2-amino-14r2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 4-bromo-2-thiophenecarboxylate (Formula Removed) To a solution of 4-bromo-2-thiophenecarboxylic acid (25 g, 121 mmol) in methanol (241 ml) was added sulfuric acid (32 ml, 604 mmol) The resulting solution stirred at 50 °C over 4d The solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further punfication providing methyl 4-bromo-2-thiophenecarboxylate (26 g, 118 mmol, 97 % yield), LCMS (ES) m/e 222 (M+H)+ b) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-bromo-2-thiophenecarboxylate (2 5 g, 11 31 mmol), potassium carbonate (7 81 g, 56 5 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)-1 H-pyrazole (2 59 g, 12 44 mmol)[prepared according to Preparation 7] and bis(tri-t-butylphosphine)palladium(0) (0 289 g, 0 56 mmol) in 1,4-dioxane (47 ml) and water (9 ml) was stirred at 80 °C in a sealed tube for 1h 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 59 g, 12 44 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 289 g, 0 56 mmol) were added and the reaction stirred an additional 1 h The mixture was partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-40% EtOAc in hexanes) affording methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 5 g, 11 25 mmol, 99 % yield) as a yellow solid LCMS (ES) m/e 223 (M+H)+ c) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 5 g, 11 25 mmol) and n-bromosuccinimide (2 002 g, 11 25 mmol) in tetrahydrofuran (56 2 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied by column chromatography (10-50% EtOAc in hexanes yielding methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 7 g, 8 97 mmol, 80 % yield) as a yellow solid LCMS (ES) m/e 301, 303 (M, M2)+ d) methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (300 mg, 0 91 mmol), potassium carbonate (630 mg, 4 56 mmol), bis(tn-t-butylphosphine)palladium(0) (23 mg, 0 05 mmol) and 2,4,6-tnvinylcycloboroxane-pyndine complex (110 mg, 0 46 mmol) in 1,4-dioxane (5 ml) and water (1 ml) was stirred at 80 °C in a sealed tube for 2h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl}-5-ethyl-2-thiophenecarboxylate (187 mg, 0 66 mmol, 73 % yield) as a clear oil LCMS (ES) m/z = 277 (M+H)+ e) methyl 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (187 mg, 0 68 mmol) in methanol (2 5 ml) was added Pd-C (7 20 mg, 0 07 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1 h The solution was then purged with N2, filtered through Cehte and concentrated affording methyl 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (187 mg, 0 64 mmol, 95 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+ f) methyl 4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(4-ethyl-1-methyM H-pyrazol-5-yl)-2-thiophenecarboxylate (202 mg, 0 81 mmol) and NCS (108 mg, 0 81 mmol) in N,N-dimethylformamide (4 ml) was stirred in a sealed tube for 1h at 100 °C Additional NCS (108 mg, 0 81 mmol) was added and the solution stirred 1h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (2-30% EtOAc in hexanes) affording methyl 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxylate (135 mg, 0 45 mmol, 56 % yield) as a yellow oil LCMS (ES) m/e 285 (M+H)+ g) 4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (135 mg, 0 47 mmol) in 6N sodium hydroxide (1 6 ml, 9 48 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 12h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (120 mg, 0 41 mmol, 87 % yield) as a white foam LCMS (ES) m/e 270, 272 (M, M2)+ h) 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2- thiophenecarboxamide (Formula Removed) To a solution of 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (120 mg, 0 44 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (171 mg, 0 44 mmol)[prepared according to Preparation 6] and n,n-dnsopropylethylamine (0 39 ml, 2 22 mmol) in Dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (228 mg, 0 49 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(3-chloro-4- ethyl-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (190 mg, 0 30 mmol, 68 % yield) as a white solid LCMS (ES) m/e 601, 603 (M, M2)+ i) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (190 mg, 0 32 mmol) in tetrahydrofuran (1 58 ml) and methanol (1 58 ml) at 25 °C was added hydrazine (0 08 ml, 2 53 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in Ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (145 mg, 0 26 mmol, 83 % yield) as a yellow solid LCMS (ES) m/z = 471, 473 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 80 (br s , 1 H) 7 87 - 7 99 (m, 6 H) 7 69 (d, J=7 71 Hz, 1H)) 7 57 (d, J=7 83 Hz, 1 H) 7 40 -7 44 (m, 1 H) 4 43 - 4 48 (m, 1 H) 3 74 (s, 3 H) 2 99 - 3 06 (m, 4 H) 2 40 (d, J=7 58 Hz, 2 H) 1 04 (t, J=7 58 Hz, 3 H) Example 126 (Formula Removed) Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(3-chloro-1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to Example 125, except substituting (1Z)-1-propen-1-ylboronic acid (125 mg, 1 46 mmol) for 2,4,6-tnvinylcycloboroxane-pyndine complex LCMS (ES) m/z = 485, 487 (M, M2)+, 1H NMR (400 MHz, DMSO-Oe) δ ppm 8 94 (d, J=9 09 Hz, 1 H) δ 05 (s, 4 H) 7 98 (s, 1 H) 7 69 (d, J=7 58 Hz, 1 H) 7 55 - 7 63 (m, 1 H) 7 52 (t, J=7 58 Hz, 1 H) 7 42 (t, J=7 33 Hz, 1 H) 4 49 (d, J=4 29 Hz, 1 H) 3 74 (s, 3 H) 2 98 - 3 09 (m, 4 H) 2 37 (q, J=7 07 Hz, 2 H) 1 37 - 1 45 (m, 2 H) 0 80 (t, J=7 33 Hz, 3 H) Example 127 (Formula Removed) Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide a) methyl 4,5-dibromo-2-furancarboxylate (Formula Removed) To a solution of 4,5-dibromo-2-furancarboxylic acid (25 g, 93 mmol) in methanol (185 ml) was added sulfuric acid (24 7 ml, 463 mmol) The resulting solution stirred at 50 °C over 12h The solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification providing methyl 4,5-dibromo-2-furancarboxylate (23 67 g, 83 mmol, 90 % yield), LCMS (ES) m/e 283, 285, 287 (M, M2, M+4)+ b) methyl 4-bromo-2-furancarboxylate (Formula Removed) To a solution of methyl 4,5-dibromo-2-furancarboxylate (3 3 g, 11 62 mmol) in tetrahydrofuran (46 ml) at -40 °C was added isopropylmagnesium chloride (6 97 ml, 13 95 mmol) After 1h, Water (11 ml) was added and the solution warmed to 25 °C The reaction mixture was then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified by column chromatography (3% EtOAc in hexanes) affording methyl 4-bromo-2-furancarboxylate (1 4 g, 6 49 mmol, 56 % yield) as a yellow solid LCMS (ES) m/e 205, 207 (M, M2)+ c) methyl 4-bromo-5-chloro-2-furancarboxylate (Formula Removed) A solution of methyl 4-bromo-2-furancarboxylate (1 4 g, 6 83 mmol) and NCS (0 912 g, 6 83 mmol) in N,N-dimethylformamide (13 7 ml) was stirred in a sealed tube for 1h at 100 °C After 1h, the solution was partitioned between DCM-H2O and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (2-10% EtOAc in hexanes) affording methyl 4-bromo-5-chloro-2-furancarboxylate (1 348 g, 5 12 mmol, 75 % yield) as a white solid LCMS (ES) m/e 238, 240, 242 (M, M2, M+4)+ d) methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) A solution of methyl 4-bromo-5-chloro-2-furancarboxylate (1 1 g, 4 59 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 05 g, 5 05 mmol)[prepared according to Preparation 7], potassium carbonate (3 17 g, 22 97 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 117 g, 0 23 mmol) in 1,4-dioxane (19 14 ml) and water (3 83 ml) was stirred at 80 °C in a sealed tube for 1h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 4-25% EtOAc in hexanes) yielding methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (800 mg, 2 53 mmol, 55 % yield) as a yellow oil LCMS m/e ES 240, 242 (M, M2)+ e) 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid (Formula Removed) A solution of methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 25 mmol) in 6N sodium hydroxide (4 16 ml, 24 93 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH -4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (267 mg, 0 59 mmol, 47 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+ f)5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2- furancarboxamide (Formula Removed) To a solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (134 mg, 0 59 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (228 mg, 0 59 mmol)[prepared according to Preparation 6] and N,N-dnsopropylethylamme (0 52 ml, 2 96 mmol) in Dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (304 mg, 0 65 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yllyHP^trifluoromethyl)phenyl]methylJethylH-C-methyl-IH-pyrazol-S-ylly- furancarboxamide (202 mg, 0 33 mmol, 55 8 % yield) as a yellow oil LCMS (ES) m/e 557, 559 (M, M2)+ g)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2~furancarboxamide (Formula Removed) To a solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (202 mg, 0 36 mmol) in tetrahydrofuran (1 8 ml) and methanol (1 8 ml) at 25 °C was added hydrazine (0 08 ml, 2 54 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (2% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 2M HCI in diethyl ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (120 mg, 0 24 mmol, 66 % yield) as a yellow solid LCMS (ES) m/z = 427, 429 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 87 (d, J=9 09 Hz, 1 H) δ 11 (br s , 3 H) 7 66 - 7 73 (m, 2 H) 7 57 (t, J=7 45 Hz, 2 H) 7 53 (d, J=1 52 Hz, 1 H) 7 44 (d, J=6 82 Hz, 1 H) δ 50 (d, J=1 52 Hz, 1 H) 4 43 - 4 51 (m, 1 H) 3 86 (s, 3 H) 2 99 - 3 17 (m, 4H) Example 128 (Formula Removed) Preparation of N-((1S)-2-amino-1-f[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide i a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (Formula Removed) A solution of methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 25 mmol)[prepared according to Example 127] and n-chlorosuccinimide (166 mg, 1 25 mmol) in tetrahydrofuran (6 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (4 1 ml, 24 94 mmol) was added in one portion and the solution stirred an additional 12h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification yielding 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (232 mg, 0 44 mmol, 36 % yield) as a yellow oil LCMS (ES) m/e 261, 263 (M, M2)+ bJS-chloro^^-chloro-l-methyl-IH-pyrazol-S-ylJ-N-^IS^^I.S-dioxo-I.S-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-furancarboxamide (Formula Removed) To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (116 mg, 0 44 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (171 mg, 0 44 mmol)[prepared according to Preparation 6] and n,n-dnsopropylethylamme (0 39 ml, 2 22 mmol) in dichloromethane (4 6 ml) at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (228 mg, 0 49 mmol) in one portion The solution stirred at 25 °C for 1h and was then dry loaded onto silica and punfied via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-furancarboxamide (116 mg, 0 19 mmol, 42 % yield) as a yellow oil LCMS (ES) m/e 591, 593 (M, M2)+ c) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-furancarboxamide (116 mg, 0 20 mmol) in tetrahydrofuran (1 ml) and methanol (1 ml) at 25 °C was added hydrazine (0 04 ml, 1 37 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (2% MeOH in DCM (1 % NH4OH)) The free base was transferred to the HCI salt by addition of excess 2M HCI in Ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (68 mg, 0 13 mmol, 65 % yield) as a yellow solid LCMS (ES) m/z = 461, 463 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 80 (d, J=9 09 Hz, 1 H) δ 03 (br s , 3 H) 7 66 - 7 73 (m, 2 H) 7 58 - 7 61 (m, 1 H) 7 52 - 7 59 (m, 2 H) 7 40 - 7 48 (m, 1 H) 4 5 - 4 57 (m, 1 H) 3 77 (s, 3 H) 2 98 - 3 09 (m, 4 H) Example 129 (Formula Removed) Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a yellow solid according to Example 125, except substituting methyl 4-bromo-2-furancarboxylate (5 g, 24 39 mmol) for methyl 4-bromo-2-thiophenecarboxylate LCMS (ES) m/z = 455, 457 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 75 (d, J=9 09 Hz, 1 H) δ 23 (s, 1 H) δ 05 (br s , 3 H) 7 70 (d, J=7 83 Hz, 1 H) 7 53 - 7 60 (m, 2 H) 7 42=0 - 7 43 (m, 2 H) 4 50 - 4 55 (m, 1 H) 3 74 (s, 3 H) 2 99 - 3 08 (m, 4 H) 2 39 (q, J=7 33 Hz, 2 H) 1 03 (t, J=7 45 Hz, 3 H) Example 130 (Formula Removed) Preparation of N-(nS)-2-amino-H-[2-(trifluoromethy0phenyl]methyltethyl)-4-(3-chloro-1.4-dimethyl-1 H-pyrazol-5-vD-2-furancarboxamide The title compound was prepared as a yellow solid according to Example 125, except substituting trimethylboroxine (0 78 ml, 5 61 mmol) for 2,4,6-trivinylcycloboroxane-pyndine complex and methyl 4-bromo-2-furancarboxylate (5 g, 24 39 mmol) for methyl 4-bromo-2-thiophenecarboxylate LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 71 (d, J=9 35 Hz, 1 H) δ 27 (s, 1 H) δ 01 (br s , 3 H) 7 70 (d, J=7 58 Hz, 1 H) 7 55 (t, J=6 06 Hz, 2 H) 7 40 -7 47 (m, 2 H) 4 50 - 4 57 (m, 1 H) 3 78 (s, 3 H) 2 99 - 3 08 (m, 4 H) 1 98 (s, 3 H) Example 131 (Formula Removed) Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl]phenyl]methyl)ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide a) methyl 5-ethenyl-2-furancarboxylate (Formula Removed) A solution of methyl 5-bromo-2-furancarboxylate (2 5 g, 12 19 mmol), potassium carbonate (8 43 g, 61 0 mmol), bis(tn-t-butylphosphme)palladium(0) (0 312 g, 0 61 mmol) and 2,4,6-tnvinylcycloboroxane-pyndine complex (1 47 g, 6 10 mmol) in 1,4-dioxane (50 ml) and water (10 ml) was stirred at 80 °C in a sealed tube for 2h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-ethenyl-2-furancarboxylate (1 3 g, 7 09 mmol, 58 % yield) as a yellow oil LCMS (ES) m/z = 153 (M+H)+ b) methyl 5-ethyl-2-furancarboxylate (Formula Removed) To a solution of methyl 5-ethenyl-2-furancarboxylate (1 3 g, 8 54 mmol) in methanol (15 ml) was added PdOH2 (0 240 g, 1 71 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Celite and concentrated affording methyl 5-ethyl-2-furancarboxylate (1 2 g, 7 16 mmol, 84 % yield) as a clear oil which was used without further purification LCMS (ES) m/e 155 (M+H)+ c) methyl 4-bromo-5-ethyl-2-furancarboxylate (Formula Removed) To a solution of methyl 5-ethyl-2-furancarboxylate (1 2 g, 7 78 mmol) and aluminum trichloride (1 56 g, 11 68 mmol) in chloroform (15 ml) at 25 °C was added bromine (0 56 ml, 10 90 mmol) The resulting solution stirred at 70 °C in a sealed tube for 2h and the solution was cooled, concentrated and purified via column chromatograpy (silica, 5% EtOAc in hexanes) affording methyl 4-bromo-5-ethyl-2-furancarboxylate (1 1 g, 3 26 mmol, 41 8 % yield) as a white solid, LCMS (ES) m/z = 233, 235 (M, M2)+ d) methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) A solution of methyl 4-bromo-5-ethyl-2-furancarboxylate (1 1 g, 4 72 mmol), potassium carbonate (3 26 g, 23 60 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 178 g, 5 66 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (0 121 g, 0 24 mmol) were combined in a sealed tube and stirred at 80 °C for 1h LCMS showed 4 1 pdt/sm Additional 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 178 g, 5 66 mmol) and bis(tri-t-butylphosphme)palladium(0) (0 121 g, 0 24 mmol) were added and the solution stirred an additional 2h where crude LCMS showed nearly complete conversion to product The reaction contents were then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (950 mg, 3 37 mmol, 71 3 % yield) as a yellow oil LCMS (ES) m/e 235 (M+H)+ e) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxylic acid (Formula Removed) A solution of methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (950 mg, 4 06 mmol) and N-chlorosuccinimide (542 mg, 4 06 mmol) in tetrahydrofuran (20 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (13 5 ml, 81 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SC"4, concentrated and used directly without further purification yielding 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxylic acid (683 mg, 2 55 mmol, 62 8 % yield) as a yellow oil LCMS (ES) m/e 254, 256 (M, M2)+ f) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-furancarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxylic acid (145 mg, 0 57 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (219 mg, 0 57 mmol)[prepared according to Preparation 6] and N,N-diisopropylethylamine (0 50 ml, 2 85 mmol) in dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (292 mg, 0 63 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and punfied via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-furancarboxamide (250 mg, 0 41 mmol, 71 % yield) as a white solid LCMS (ES) m/e 585, 587 (M, M2)+ g) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl- 1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide (Formula Removed) To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-furancarboxamide (250 mg, 0 43 mmol) in tetrahydrofuran (1 8 ml) and methanol (1 8 ml) at 25 °C was added hydrazine (0 13 ml, 4 27 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (2% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 2M HCI in Ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-[[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl- 2-furancarboxamide (166 mg, 0 30 mmol, 70 % yield) as a yellow solid LCMS (ES) m/z = 455, 457 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 59 (br s , 1 H) δ 06 (br s , 3 H) 7 67 (s, 1 H) 7 70 (d, J=7 83 Hz, 1 H) 7 59 (d, J=4 29 Hz, 2 H) 7 44 (d, J=4 04 Hz, 1 H) 7 31 (d, J=5 81 Hz, 1 H) 4 50 - 4 57 (m, 1 H) 3 72 (s, 3 H) 2 99 -3 12 (m, 4 H) 2 63 (q, J=7 33 Hz, 2 H) 1 21 (t, J=7 45 Hz, 3 H) Example 132 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(4-fluorophenvhmethyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide The title compound was prepared as a yellow solid according to Example 131, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (170 mg, 0 57 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 405, 407(M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 56 (d, J=8 59 Hz, 1 H) δ 09 (br s , 3 H) 7 67 (s, 1 H) 7 33 (s, 1 H) 7 31 (dd, J=8 34, 5 81 Hz, 2 H) 7 12 (t, J=8 72 Hz, 2 H) 4 36 - 4 39 (m, 1 H) 3 71 (s, 3 H) 2 91 - 3 03 (m, 4 H) 2 62 (q, J=7 58 Hz, 2 H) 1 20 (t, J=7 45 Hz, 3 H) Example 133 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamtde The title compound was prepared as a yellow solid according to Example 131, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (170 mg, 0 57 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 405, 407 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 62 (d, J=8 59 Hz, 1 H) δ 13 (br s , 3 H) 7 67 (s, 1 H) 7 30 - 7 37 (m, 2 H) 7 12 (d, J=6 32 Hz, 2 H) 7 04 (t, J=8 59 Hz, 1 H) 4 40 - 4 47 (m, 1 H) 3 71 (s, 3 H) 2 95 - 3 09 (m, 4 H) 2 62 (q, J=7 07 Hz, 2 H) 1 20 (t, J=7 33 Hz, 3 H) Example 134 (Formula Removed) Preparation of NM(1S)-2-amino-14(3-fluorophenv0methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white foam according to the procedure of Example 127, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (295 mg, 0 88 mmol)[prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 377, 379 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 87 (d, J=8 84 Hz, 1 H) δ 16 (br s , 3 H) 7 70 - 7 77 (m, 1 H) 7 53 (d, J=1 77 Hz, 1 H) 7 32 (t, J=7 20 Hz, 1 H) 7 09 - 7 14 (m, 1 H) 7 11 (d, J=6 57 Hz, 2 H) 7 04 (t, J=8 59 Hz, 1 H) δ 49 (d, J=1 77 Hz, 1 H) 4 41 - 4 44 (m, 1 H) 3 86 (s, 3 H) 2 95 - 3 00 (m, 4 H) Example 135 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white foam according to the procedure of Example 127, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (295 mg, 0 88 mmol)[prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 377, 379 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 80 (d, J=8 84 Hz, 1 H) δ 11 (br s , 3 H) 7 71 (s, 1 H) 7 53 (d, J=1 77 Hz, 1 H) 7 29 (dd, J=8 59, 5 56 Hz, 2 H) 7 12 (t, J=8 84 Hz, 2 H) δ 49 (d, J=1 77 Hz, 1 H) 4 32 - 4 38 (m, 1 H) 3 86 (s, 3 H) 2 99-3 01 (m, 4 H) Example 136 (Formula Removed) Preparation of N-((1S)-2-amino-Hf3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white foam according to the procedure of Example 127, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (340 mg, 0 88 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LCMS (ES) m/z = 427, 429 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 83 (d, J=8 84 Hz, 1 H) δ 11 (br s , 3 H) 7 62 - 7 69 (m, 2 H) 7 51 - 7 59 (m, 4 H) δ 48 (d, J=1 77 Hz, 1 H) 4 39 - 4 44 (m, 1 H) 3 85 (s, 3 H) 2 97 - 3 05 (m, 4 H) Example 137 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white foam according to the procedure of Example 128, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (321 mg, 0 96 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 411, 413 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 77 (d, J=8 84 Hz, 1 H) δ 04 (br s , 3 H) 7 72 (s, 1 H) 7 59 (s, 1 H) 7 30 - 7 38 (m, 1 H) 7 11 (d, J=7 58 Hz, 2 H) 7 05 (t, J=8 59 Hz, 1 H) 4 39 - 4 43 (m, 1 H) 3 77 (s, 3 H) 2 97 - 3 03 (m, 4 H) Example 138 (Formula Removed) Preparation of N-((1S)-2-amino-H[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white foam according to the procedure of Example 128, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (221 mg, 0 58 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 461, 463 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 83 (d, J=8 84 Hz, 1 H) 8 10 (br s , 3 H) 7 72 (s, 1 H) 7 64 (s, 1 H) 7 52 - 7 60 (m, 4 H) 4 39 - 4 41 (m, 1 H) 3 76 (s, 3 H) 2 98 - 3 05 (m, 4 H) Example 139 (Formula Removed) Preparation of N-{(1 S^-amino-H-[2-fluorophenvhmethyl]ethyl]-S-chloro-chloro-l-methyl-IH-pyrazol-S-yl)^-furancarboxamide The title compound was prepared as a white foam according to the procedure of Example 128, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (256 mg, 0 77 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 411, 413 (M, M2)+, 1H NMR (400 MHz, DMSO-c/6) δ ppm 8 78 (d, J=8 59 Hz, 1 H) δ 06 (br s , 3 H) 7 72 (s, 1 H) 7 60 (s, 1 H) 7 30 (dd, J=8 59, 5 56 Hz, 2 H) 7 13 (t, J=8 84 Hz, 2 H) 4 35 - 4 42 (m, 1 H) 3 77 (s, 3 H) 2 99 (br s , 2 H) 2 86 - 2 93 (m, 2 H) Example 140 (Formula Removed) Preparation of N-l(1S)-2-amino-1-[(3-fluorophenv0methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 02 g, 4 59 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H- pyrazole and 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (132 mg, 0 39 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 391, 393 (M, M2)+ , 1H NMR (400 MHz, DMSO-d) δ ppm 8 75 (d, J=8 84 Hz, 1 H) δ 04 (br s , 3 H) 7 55 (s, 1 H) 7 37 (s, 1 H) 7 30 - 7 36 (m, 1 H) 7 11-7 15 (m, 2 H) 7 05-7 10 (m, 1 H)4 42(br s, 1 H) 3 70 (s, 3 H) 2 97 (br s,2 H) 2 92 - 2 96 (m, 2 H) 1 94 (s, 3 H) Example 141 (Formula Removed) Preparation of N-[(1S)-2-amino-1-[(4-fluorophenv0methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 06 g, 13 78 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole and 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (174 mg, 0 52 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 391, 393 (M, M2)+ , 1H NMR (400 MHz, DMSO-d) δ ppm 8 81 (d, J=8 59 Hz, 1 H) δ 14 (br s , 3 H) 7 59 (s, 1 H) 7 37 (s, 1 H) 7 30 (dd, J=8 59, 5 56 Hz, 2 H) 7 12 (t, J=8 84 Hz, 2 H) 4 32 - 4 38 (m, 1 H) 3 70 (s, 3 H) 2 98 (d, J=5 81 Hz, 2 H) 2 91 (d, J=6 32 Hz, 2 H) 1 94 (s, 3 H) Example 142 Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl]ethyl)-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 06 g, 13 78 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole and 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (200 mg, 0 52 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 83 (br s , 1 H) δ 15 (br s , 2 H) 7 63 (br s , 1 H) 7 52 - 7 58 (m, 4 H) 7 37 (s, 1 H) 4 38 - 4 42 (m, 1 H) 3 68 (s, 3 H) 2 97 - 3 08 (m, 4 H) 1 93 (s, 3 H) Example 143 (Formula Removed) Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl)phenyl]methyl)ethyl)-5-chloro-4-(1.4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 06 g, 13 78 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole- 1,3(2H)-dione (200 mg, 0 52 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 87 (d, J=9 35 Hz, 1 H) δ 11 (br s , 3 H) 7 70 (d, J=7 83 Hz, 1 H) 7 52 - 7 57 (m, 3 H) 7 41 - 7 47 (m, 1 H) 7 38 (s, 1 H) 4 39 - 4 43 (m, 1 H) 3 71 (s, 3 H) 2 98 - 3 09 (m, 4 H) 1 95 (s, 3 H) Example 144 (Formula Removed) Preparation of N-((1 S>2-amino-1-{r2-(trifluoromethyl)phenyl]methyltethyl)-4-bromo-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of 4,5-dibromo-2-thiophenecarboxylic acid (3 30 g, 11 54 mmol) in dioxane/H20 (4 1, 100 mL) was added K2CO3 (5 5 g, 40 0 mmol), tetrakispriphenylphosphine Pd(0) (671 mg, 0 58 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (2 66 g, 13 71 mmol) The reaction mixture was heated to 80 °C in a sealed tube for 12 hours The reaction mixture was partitioned between H20 and CHCI3 The pH of the aqueous phase was adjusted to ~3 with 6N HCI and washed several times with CHCI3 The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (3 3 g, quant) LC-MS (ES) m/z = 289 (M+H)+ b) 4-bromo-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) N-chlorosuccinimide (NCS) (299 mg, 2 194 mmol) was added in portions to a 30 mL sealed tube reactor containing 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (503 mg, 1 23 mmol) in tetrahydrofuran (THF) (6 mL) at room temperature The mixture was heated to 70 °C for 2 hours Upon completion, the reaction mixture was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4, solvents removed by vacuum distillation affording the title compound (0 54 mg, quant) which was used without further punfication LC-MS (ES) m/z = 321 (M+H)+ c) 4-bromo-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-/v-((1 S>-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-bromo-5-(4-chlorc-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (224 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (201 mg, 0 52 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (295 mg, 0 63 mmol) in chloroform (4 mL) DIEA (0 46 mL, 2 63 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (hexanes/EtOAc) affording the title compound (153 mg, 43%) LC-MS (ES) m/z = 651 (M+H)+ d) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-chloro- 1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-bromo-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (153 mg, 0 223 mmol) in tetrahydrofuran (THF) (2 5 mL) and Methanol (0 5 mL) Hydrazine (50 uL, 1 59 mmol) was added and the mixture stirred overnight at room temperature Upon completion, the mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (68 mg, 0 11 mmol, 48 7 % yield) LC-MS (ES) m/z = 523 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 02 - 3 14 (m, 4 H) 3 73 (s, 3 H) 4 50 (s, 1 H) 7 40 - 7 48 (m, 1 H) 7 56 - 7 64 (m, 2 H) 7 71 (d, J=7 83 Hz, 1 H) 7 77 (s, 1 H) δ 14 (s, 3 H) δ 21 (s, 1 H) 9 24 (d, J=9 09 Hz, 1 H) Example 145 (Formula Removed) Preparation of N-((1S)-2-amino-1-ir2-(trifluoromethy0phenyl]methyl}ethylM-bromo-5-(4-bromo-1 -methyl-1 A7-pyrazol-5-yl)-2-thiophenecarboxamide a)4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) The title compound was prepared according to the procedure of Example 144 except substituting N-bromosuccinimide (NBS) (287 mg, 1 596 mmol) for NCS LC-MS (ES) m/z = 364 (M+H)+ b) 4-bromo-5-(4-bromo-1-methyl-1 W-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (238 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (209 mg, 0 54 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (293 mg, 0 63 mmol) in chloroform (4 mL) DIEA (0 46 mL, 2 62 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (silica) (3 1 hex/EtOAc) affording the title compound (229 mg, 60%) LC-MS (ES) m/z = 695 (M+H)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-bromo- 1 -methyl-1 H-pyrazol-5-yl )-2-th lophenecarboxa mide To a 50 mL round-bottomed flask was added 4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (229 mg, 0 312 mmol) in Tetrahydrofuran (THF) (2 5 mL) and methanol (0 5 mL) Hydrazine (60 uL, 1 91 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica gel and purified by column chromatography (90 10 1 CHCI3/MeOH/NH4OH, 12g column) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 (500 mL) and concentrated affording the HCI salt of the title compound(104 mg, 0 15 mmol, 49 % yield) LC-MS (ES) m/z = 567 (M+H)+, 1H NMR (400 MHz, DMSO-c/6) δ ppm 3 10 (s, 4 H) 3 74 (s, 3 H) 4 50 (s, 1 H) 7 45 (ddd, J=7 96, 4 17, 4 04 Hz, 1 H) 7 60 (d, J=4 04 Hz, 2 H) 7 71 (d, J=7 58 Hz, 1 H) 7 76 (s, 1 H) δ 11 (s, 3 H) δ 19 (s, 1 H) 9 19 (d, J=8 84 Hz, 1 H) Example 146 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl\|-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of 4-bromo-2-thiophenecarboxylic acid (3 91 g, 18 9 mmol) in dioxane/H20 (4 1, 100 mL) was added Cs2CO3 (21 7 g, 66 6 mmol), tetrakispriphenylphosphine Pd(0) (1 1 g, 0 95 mmol) and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 94 g, 18 94 mmol) [prepared according to the procedure of Preparation 7] The reaction mixture was heated to 85 °C in a sealed tube for 12 hours and partitioned between H20 and CHCI3 The pH of the aqueous phase was adjusted to ~3 with 6N HCI and washed several times with CHCI3 The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (2 84 g, 13 64 mmol, 72%) LC-MS (ES) m/z = 209 (M+H)+ b) N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)methylJethyl}-4-(1-methyl-1^/-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (183 mg, 0 88 mmol), 2-[(2S)-2-amino-3-(3,4-dichlorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (0 3 g, 0 85 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3,4-difluoro-L-phenylalanine (2 03 g, 6 74 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (528 mg, 113 mmol) in chloroform (5 mL) DIEA (0 77 mL, 4 41 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and punfied via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (149 mg, 30%) LC-MS (ES) m/z = 507 (M+H)+ c) N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-0 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (149 mg, 0 265 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (60 uL, 1 91 mmol) was added and the mixture stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (71 mg, 0 15 mmol, 57 % yield) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (400 MHz, DMSO-c/e) δ ppm 2 96 (d, J=6 06 Hz, 2 H) 3 00 - 3 06 (m, 2 H) 3 97 (s, 3 H) 4 33 -4 42 (m, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 14 (s, 1 H) 7 30 - 7 42 (m, 2 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 22 (s, 3 H) δ 35 (d, J=1 26 Hz, 1 H) 9 09 (d, J=8 59 Hz, 1 H) Example 147 (Formula Removed) Preparation of N-iC\S)-2-amino-1-[(3,4-dichlorophenyl)methyl]ethyl)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) N-{(1S)-2-(3,4-dichlorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (160 mg, 0 62 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(3,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (0 26 g, 0 67 mmol) [prepared according to the procedure of Preparation 6 except substituting 3,4-dichloro-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-phenylalanine (2 03 g, 6 07 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (376 mg, 0 80 mmol) in chloroform (4 mL) DIEA (0 55 mL, 3 15 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (149 mg, 30%) LC-MS (ES) m/z = 539 (M+H)+ b) N-{(1S)-2-amino-1 -[(3,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(3,4-dichlorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (211 mg, 0 34 mmol) in Tetrahydrofuran (THF) (4 5 mL) and Methanol (0 45 mL) Hydrazine (75 uL, 2 390 mmol) was added and the mixture stirred overnight at room temperature Upon completion the mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (83 mg, 0 16 mmol, 48 % yield) LC-MS (ES) m/z = 411 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 95 - 3 07 (m, 4 H) 3 97 (s, 3 H) 4 32 - 4 43 (m, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 29 (dd, J=8 21, 1 89 Hz, 1 H) 7 47 (d, J=2 02 Hz, 1 H) 7 54 (d, J=8 08 Hz, 1 H) 7 60 (d, J=1 77 Hz, 1 H) δ 00 (d, J=1 26 Hz, 1 H) δ 22 (s, 3 H) δ 35 (d, J=1 01 Hz, 1 H) 9 11 (d, J=8 59 Hz, 1 H) Example 148 (Formula Removed) Preparation of N-iH S)-2-amino-1-rf2.6-difluorophenyl]methyl]ethyl)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) ^-{(IS^^.e-difluorophenylJ-l-KI.S-dioxo-l.a-dihydro^H-isoindolly- yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (160 mg, 0 62 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(2,6-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (231 mg, 0 69 mmol) [prepared according to the procedure of Preparation 18] and PyBrop (353 mg, 0 75 mmol) in chloroform (8 mL) DIEA (0 64 mL, 3 66 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (149 mg, 0 21 mmol, 30%) LC-MS (ES) m/z = 507 (M+H)+ b) N-{(1S)-2-amino-1 -[(2,6-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5- yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,6-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (168 mg, 0 32 mmol) in Tetrahydrofuran (THF) (3 6 mL) and Methanol (0 4 mL) Hydrazine (70 uL, 2 23 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (101 mg, 0 214 mmol, 68%) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (400 MHz, DMSO- d6) δ ppm 2 92 - 3 03 (m, 3 H) 3 17 (m, 1 H) 3 97 (s, 3 H) 4 46 (m, 1 H) δ 47 (d, J=1 77 Hz, 1 H) 7 05 (t, J=7 83 Hz, 2 H) 7 27 - 7 38 (m, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 23 (d, J=1 26 Hz, 4 H) δ 92 (d, J=8 59 Hz, 1 H) Example 149 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2.5-difluorophenyl]methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (257 mg, 0 93 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (476 mg, 0 81 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanme (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (535 mg, 1 14 mmol) in Chloroform (15 mL) DIEA (0 808 mL, 4 63 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (225 mg, 34%) LC-MS (ES) m/z = 507 (M+H)+ b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (225 mg, 0 31 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (0 8 mL) Hydrazine (60 uL, 1 91 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The compound was further punfied on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCl3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (90 5 mg, 0 19 mmol, 63%) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 95 - 3 01 (m, 2 H) 3 03 - 3 10 (m, 2 H) 3 92 - 3 98 (m, 3 H) 4 41 - 4 51 (m, 1 H) δ 47 (d, J=1 77 Hz, 1 H) 7 05 - 7 13 (m, 1 H) 7 20 (td, J=9 09, 4 55 Hz, 1 H) 7 27 (ddd, J=9 09, 5 81, 3 28 Hz, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 52 Hz, 1 H) δ 18 (s, 3 H) δ 29 (d, J=1 26 Hz, 1 H) 9 03 (d, J=8 84 Hz, 1 H) Example 150 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2,4-difluorophenyl)methyl]ethyl)--4-(1 -methyl-1 H-pyrazol-5-yl)-2-trnophenecarboxamide a) N-{(1 S>-2-(2,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (222 mg, 0 80 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (331 mg, 0 78 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (1 0 g, 4 97 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (448 mg, 0 96 mmol) in chloroform (10 mL) DIEA (700 uL, 4 01 mmol) was added and the reaction stirred overnight at room temperature The reaction mixture was adsorbed onto silica and punfied via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (249 mg, 0 36 mmol, 46%) LC-MS (ES) m/z = 507 (M+H)+ b) N-{(1S)-2-amino-1 -[(2,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5- yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (249 mg, 0 36 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (1 mL) Hydrazine (80 uL, 2 55 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/NH^OH) The compound was further punfied on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (81 mg, 0 18 mmol, 50%) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR Example 151 (Formula Removed) Preparation of N-((^ S)-2-amino-1-(f3-(trifluoromethyl)phenyl]methyltethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxarnide a) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a 125 mL sealed flask was added methyl 4-bromo-5-methyl-2-thiophenecarboxylate (1 56 g, 6 64 mmol) [Prepared according to the procedure of Preparation 10], 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 67 g, 8 03 mmol) [prepared according to the procedure of Preparation 7], K2CO3 (2 76 g, 19 97 mmol) and Pd(PtBu3)2 (170 mg, 0 33 mmol) in 1,4-Dioxane (27 ml) and water (7 ml) The reaction mixture was heated to 85 °C in a sealed tube for 3 hours, cooled to room temperature and partitioned between H20 and CHCl3 The organic fraction was dried (Na2SO4), adsorbed onto silica and purified via column chromatography (0-15%EtOAc/Hexane) (385 mg, 1 4 mmol, 30%) LC-MS (ES) m/z = 237 (M+H)+ b) 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a 100 mL round-bottomed flask was added methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 34 g, 5 67 mmol) in Tetrahydrofuran (THF) (31 ml) 6N NaOH (31 ml, 186 mmol) was added and the reaction mixture stirred at 70 °C overnight The reaction mixture was neutralized by slow addition of 6N HCI and partitioned between CHCI3 and H2O The layers were separated, the organic layer dried with Na2SO4 and solvent removed The resulting solid was used without further purification (0 71 g, 2 81 mmol, 96%) LC-MS (ES) m/z = 223 (M+H)+ c) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3- (trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (201 mg, 0 91 mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (301 mg, 0 87 mmol) [Prepared according to Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 14 95 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalan!ne] and PyBrop (519 mg, 1 11 mmol) in chloroform (9 mL) DIEA (790 uL, 4 52 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and punfied via column chromatography (25 -70% EtOAc/Hex) affording the title compound (247 mg, 45%) LC-MS (ES) m/z = 553 (M+H)+ d)/S/-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (374 mg, 0 64 mmol) in Tetrahydrofuran (THF) (6 mL) and Methanol (600 uL) Hydrazine (125 uL, 3 98 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (135 mg, 0 27 mmol, 42 % yield) LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (400 MHz, DMSO-c/e) δ ppm 2 37 (s, 3 H) 2 95 - 3 11 (m, 4 H) 3 78 (s, 3 H) 4 32 - 4 42 (m, 1 H) δ 34 (d, J=1 77 Hz, 1 H) 7 48 - 7 56 (m, 3 H) 7 58 - 7 61 (m, 1 H) 7 67 (s, 1 H) δ 04 (s, 1 H) δ 21 (s, 3 H) δ 98 (d, J=8 59 Hz, 1 H) Example 152 (Formula Removed) Preparation of N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4- fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyra2ol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (201 mg, 0 91 mmol) [prepared according to the procedure of Example 95], 2-{(2S)-2-amino-3-[3- (trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (301 mg, 0 87 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (519 mg, 1 11 mmol) in Chloroform (9 mL) DIEA (790 uL, 4 52 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (186 mg, 32%) LC-MS (ES) m/z = 553 (M+H)+ b) N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H- pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -[(4-fluorophenyl)methyl]ethylH-0 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (185 mg, 0 34 mmol) in Tetrahydrofuran (THF) (10 mL) and Methanol (1 mL) Hydrazine (63 uL, 2 0 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (101 mg, 0 24 mmol, 72%) LC-MS (ES) m/z = 393 (M+H)+, 1H NMR (400 MHz, DMSO- of6) δ ppm 2 90 - 3 1 (m, 4 H) 3 85 (s, 3 H) 4 33 (s, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 10 (t, J=8 84 Hz, 2 H) 7 32 (dd, J=8 46, 5 68 Hz, 2 H) 7 55 (d, J=2 02 Hz, 1 H) 8 19 (s, 3 H) δ 23 - 8 28 (m, 1 H) 9 25 (d, J=8 59 Hz, 1 H) Example 153 (Formula Removed) Preparation of N-((1S)-2-amino-1-lf3-(trifluoromethyl)phenyl]methyl)ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (226 mg, 0 93 mmol) [prepared according to the procedure of Example 95], 2-{(2S)-2-amino-3-[3- (trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (519 mg, 1 349 mmol) [prepared according to Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop ' (515 mg, 1 1 mmol) in chloroform (10 mL) DIEA (820 uL, 4 70 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (379 mg, 69%) LC-MS (ES) m/z = 573 (M+H)+ b) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 5-chloro-N-((1S)-2-(1,3-dioxo- 1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-fnetny\|-1H-pyrazol-5-yl)-2-thiophenecarboxamide (378 mg, 0 64 mmol) in Tetrahydrofuran (THF) (10 mL) and Methanol (1 mL) Hydrazine (122 uL, 3 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (222 mg, 0 41 mmol, 64%) LC-MS (ES) m/z = 443 (M+H)\ 1H NMR (400 MHz, DMSO-cfe) δ ppm 3 05 (d, J=6 82 Hz, 4 H) 3 84 (s, 3 H) 4.37 (d, J=5 05 Hz, 1 H) δ 46 (d, J=1 77 Hz, 1 H) 7 49 - 7 57 (m, 3 H) 7 58 - 7 61 (m, 1 H) 7 67 (s, 1 H) δ 20 (s, 3 H) δ 24 (s, 1 H) 9 31 (d, J=8 84 Hz, 1 H) Example 154 (Formula Removed) reparation of /SM(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-5-methyl-4-(1 -methyl-1/Y-pyrazol-5-yl)-2-thiophenecarboxarmde a) N-{(1 S>2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4- fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (200 mg, 0 90 mmol) [Prepared according to the procedure of Example 151], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (288 mg, 0 86 mmol) [Prepared according to Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (512 mg, 1 09 mmol) in Chloroform (9 mL) DIEA (790 uL, 4 52 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 -70% EtOAc/Hex) affording the title compound (162 mg, 32%) LC-MS (ES) m/z = 503 (M+H)+ b)N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(4-fluorophenyl)methyl]ethyl}-5-rnethyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (162 mg, 0 29 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (300 uL) Hydrazine (58 uL, 1 85 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The compound was further purified on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (222 mg, 0 41 mmol, 64%) LC-MS (ES) m/z = 373 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 2 38 (s, 3 H) 2 89 - 3 02 (m, 4 H) 3 79 (s, 3 H) 4 26 - 4 48 (m, 1 H) δ 36 (d, J=1 77 Hz, 1 H) 7 10 (t, J=8 72 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 52 (d, J=1 77 Hz, 1 H) δ 02 (s, 1 H) δ 17 (s, 3 H) δ 88 (d, J=8 59 Hz, 1 H) Example 155 (Formula Removed) eparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3- fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (200 mg, 0 90 mmol) [Prepared according to the procedure of Example 151], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H- - isomdole-1,3(2H)-dione (291 mg, 0 87 mmol) [Prepared according to the procedure of preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenyla!anine] and PyBrop (512 mg, 1 09 mmol) in Chloroform (9 mL) DIEA (790 uL, 4 52 mmol) was added and the mixture stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (250 mg, 50%) LC-MS (ES) m/z = 503 (M+H)+ b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (250 mg, 0 45 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (400 uL) Hydrazine (66 uL, 2 10 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The compound was further punfied on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (142 mg, 0 31 mmol, 70%) LC-MS (ES) m/z = 373 (M+Hf, 1H NMR (400 MHz, DMSO-d8) δ ppm 2 38 (s, 3 H) 2 92 - 3 04 (m, 4 H) 3 79 (s, 3 H) 4 30 -4 43 (m, 1 H) δ 36 (d, J=1 77 Hz, 1 H) 7 02 (td, J=8 53, 2 15 Hz, 1 H) 7 13 (t, J=7 83 Hz, 2 H) 7 26 - 7 35 (m, 1 H) 7 52 (d, J=2 02 Hz, 1 H) δ 04 (s, 1 H) δ 19 (s, 3 H) δ 93 (d, J=8 34 Hz, 1 H) Example 156 (Formula Removed) reparation of N-((1S)-2-amino-1-{[2-(trifluoromethylbhenyllmethyl)ethyl)-4-(4-cycloDropyl-1-rnethyl-1H-pyrazol-5-yl)-2-tr>tophenecarboxamicle a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) BS (747 mg, 4 20 mmol) was added in portions to a 50 mi_ sealed tube reactor containing methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (860 mg, 3 48 mmol) [prepared according to the procedure of Example 37] in Tetrahydrofuran (THF) (17 mL) at room temperature The mixture was heated to 70 °C for 1 5 hours, cooled to room temperature and partitioned between CHCI3 and H2O The organic layer was dned with is^SC^, adsorbed onto silica and purified via column chromatography (20 - 40% EtOAc / hexanes) affording the title compound (867 mg, 83%) LC-MS (ES) m/z = 303 (M+H)+ b) methyl 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) o a 20 mL sealed tube reactor was added methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (505 mg, 1 68 mmol), cyclopropylboronic acid (447 mg, 5 20 mmol), Cesium Carbonate (1 90 g, 5 84 mmol) and PdCI2(dppf)-CH2CI2Adduct (43 6 mg, 0 05 mmol) in Tetrahydrofuran (THF) (8 5 mL) The ( reaction was heated to 70 °C for 1 5 hours, cooled and partitioned between CHCI3 and H20 The organic layer was dned with Na2SO4, adsorbed onto silica and punfied via column chromatography (20 - 40% EtOAc / Hexane) affording the title compound (0 42 g, 1 60 mmol, 95%) LC-MS (ES) m/z = 251 (M+Hf c) 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) o a 100 mL round-bottomed flask was added methyl 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (0 42 g, 1 60 mmol) in Tetrahydrofuran (THF) (8 ml) 6N NaOH (8 ml, 48 0 mmol) was added slowly and the reaction stirred at 70 °C overnight The reaction was cooled and partitioned between CHCI3 and H2O The pH of the aqueous layer was adjusted to - 3 by the addition of 6N HCI The layers were separated, the organic layer dried with Na2SO4 and solvent removed affording the title compound (0 42 g, 1 60 mmol, 95%) which was used without further purification LC-MS (ES) m/z = 249 (M+H)+ d) 4-(4-cyclopropyl-1 -methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (105 mg, 0 42 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (152 mg, 0 39 mmol) [prepared according to Preparation 6] and PyBrop (246 mg, 0 52 mmol) in Chloroform (6 mL) DIEA (370 uL, 2 19 mmol) was added and the mixture stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (171 mg, 66%) LC-MS (ES) m/z = 579 (M+H)+ e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-cyclopropyl-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-cyclopropyl-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (102 mg, 0 18 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (2 mL) Hydrazine (40 uL, 1 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (65 mg, 0 12 mmol, 66 % yield) LC-MS (ES) m/z = 449 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 0 45 - 0 54 (m, 2 H) 0 76 - 0 83 (m, 2 H) 1 62 -1 71 (m, 1 H) 3 03 - 3 21 (m, 4 H) 3 82 (s, 3 H) 4 46 - 4 56 (m, 1 H) 7 21 (s, 1 H) 7 42 (t, J=7 45 Hz, 1 H) 7 53 (t, J=7 45 Hz, 1 H) 7 66 (dd, J=19 96, 7 58 Hz, 2 H) 7 95 (d, J=1 26 Hz, 1 H) δ 18 (s, 3 H) δ 24 (d, J=1 26 Hz, 1 H) 9 11 (d, J=9 09 Hz, 1 H) Example 157 (Formula Removed) reparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxarnide a) methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) o a 5 mL sealed tube reactor was added methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (473 mg, 1 57 mmol) [prepared according to the procedure of Example 156], pyridine - tnethenylboroxine (1 1) (666 mg, 2 77 mmol), Pd(PtBu3)2 (16 8 mg, 0 03 mmol) and Cs2CO3 (1 72 g, 5 28 mmol) in 1,4-Dioxane (6 3 ml.) and water (1 6 mL) The reaction was heated at 70 °C for 2 hours and partitioned between CHCI3 (75 mL) / H2O (75 mL) The organic layer was dried with Na2SO4, adsorbed onto silica and punfied via column chromatography (25-70% EtOAc/Hexane) affording the desired product LC-MS (ES) m/z = 249 (M+H)+ b) methyl 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) o a 100 mL round-bottomed flask was added methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate and 10% Pd/C in ethyl acetate (15 mL) The mixture was evacuated slightly, refilled with H2 from a balloon and stirred vigorously under an atmosphere of H2 for 1 hour The reaction was filtered through a 0 2 urn PTFE membrane filter and used without further punfication (153 mg, 0 60 mmol, 87%) LC-MS (ES) m/z = 251 (M+H)+ c) 4-(4-ethyl-1-methyl-1 W-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) o a 100 mL round-bottomed flask was added methyl 4-(4-ethyl-1 -methyl-1H-pyrazol-5-yl}-2-thiophenecarboxylate (192 mg, 0 77 mmol) in Tetrahydrofuran (THF) (4 mL) 6N NaOH (4 mL, 24 0 mmol) was added slowly, the reaction stirred at 70 °C overnight The reaction was cooled to room temperature, partitioned between CHCI3 and H20 and the pH of the aqueous layer adjusted to pH 3 by the addition of 6N HCI The layers were separated, the organic layer dried with Na2SO4 and solvent removed affording the title compound (181 mg, quant) used without further purification LC-MS (ES) m/z = 237 (M+H)+ d) A/~((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (106 mg, 0 45 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (164 mg, 0 43 mmol) [prepared according to Preparation 6] and PyBrop (254 mg, 0 54 mmol) in Chloroform (6 mL) DIEA (400 uL, 2 29 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (182 mg, 0 32 mmol, 71%) LC-MS (ES) m/z = 567 (M+H)+ e) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methy!-1H-pyrazol-5-yl)-2-thiophenecarboxamide (101 mg, 0 18 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (2 mL) Hydrazine (40 uL, 1 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (65 mg, 0 12 mmol, 68%) LC-MS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 10 (t, J=7 45 Hz, 3 H) 2 44 (q, J=7 41 Hz, 2 H) 2 94 - 3 17 (m, 4 H) 3 80 (s, 3 H) 4 41 - 4 57 (m, 1 H) 7 37 - 7 45 (m, 2 H) 7 53 (t, J=7 45 Hz, 1 H) 7 66 (dd, J=19 96, 7 58 Hz, 2 H) 7 88 (d, J=1 01 Hz, 1 H) δ 16 (s, 4 H) 9 10 (d, J=8 84 Hz, 1 H) Example 158 (Formula Removed) reparation of N-((1S)-2-amino-H[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (Formula Removed) CS (1 355 g, 10 15 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (2 0 g, 8 46 mmol) [prepared according to the procedure of Preparation 10] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 70 °C for 2h 6N NaOH (28 ml, 168 mmol) was added and the mixture stirred at 70 °C for an additional 2h The mixture was cooled to room temperature and partitioned between CHCI3 and H20 The pH of the aqueous layer was adjusted to ~ 3 by the addition of 6N HCI The aqueous phase was washed several times with DCM and the combined organic fractions were dried with Na2SO4 and concentrated affording the title compound (2 36 g, 9 19 mmol, quant) LC-MS (ES) m/z = 257 (M+H)+ b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2- thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (181 mg, 0 70 mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (250 mg, 0 65 mmol) [Prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (399 mg, 0 85 mmol) in chloroform (8 mL) DIEA (620 uL, 3 55 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 -70% EtOAc/Hex) affording the title compound (319 mg, 0 50 mmol, 71%) LC-MS (ES) m/z = 587 (M+H)+ c) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl- 1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-ch!oro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-H[3-(trifluoromethyl)phenyl}methyl}ethyl)-5-methyl-2-thiophenecarboxamide (319 mg, 0 50 mmol) in Tetrahydrofuran (THF) (4 9 mL) and Methanol (0 5 mL) Hydrazine (119 uL, 3 79 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (204 mg, 0 39 mmol, 79%) LC-MS (ES) m/z = 457 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 33 (s, 3 H) 2 95 - 3 10 (m, 4 H) 3 71 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 49 -7 61 (m, 3 H) 7 66 (s, 1 H) 7 69 (s, 1 H) 7 94 (s, 1 H) δ 16 (s, 3 H) δ 90 (s, 1 H) Example 159 (Formula Removed) reparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (Formula Removed) S (1 84 g, 10 33 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (2 g, 8 46 mmol) [prepared according to the procedure of Preparation 10] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 70 °C for 1h 6N NaOH (28 ml, 168 mmol) was then added and the mixture stirred at 70 °C for 2h The mixture was partitioned between CHCI3 and H2O and the aqueous layer was made acidic with 6N HCI The aqueous phase was washed several times with CHCI3 and the organic fractions were combined, dried over Na2SO4 and concentrated affording the title compound (2 68 g, 8 9mmol, quant) LC-MS (ES) m/z = 302 (M+H)+ b) 4-(4-bromo-1 -methyl-1 tf-pyrazol-5-yl)-/v"-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-bromo-1 -methyl- 1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (256 mg, 0 85 mmol), 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (1272 mg, 3 80 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine]and PyBrop (485 mg, 1 03 mmol) in Chloroform (8 5 mL) DIEA (750 uL, 4 29 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (319 mg, 0 50 mmol, 71%) LC-MS (ES) m/z = 583 (M+H)+ c) N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H- pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (133 mg, 0 21 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (50 uL, 1 59 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (90 mg, 0 17 mmole, 83%) LC-MS (ES) m/z = 453 (M+H)+, 1H NMR (400 MHz, DMSO-de) δ ppm 2 33 (s, 3 H) 2 82 - 3 08 (m, 4 H) 3 72 (s, 3 H) 4 24 - 4 39 (m, 1 H) 7 11 (t, J=8 84 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 69 (s, 1 H) 7 89 (s, 1 H) δ 03 - 8 25 (m, 3 H) δ 73 - 8 90 (m, 1 H) Example 160 (Formula Removed) reparation of N-{(1S)-2-amino-1-[(4-fluorophenv0methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (276 mg, 1 08 mmol) [Prepared according to the procedure of Example 158], 2-[(2S)-2-amino-3-(4- fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (317 mg, 0 95 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (612 mg, 1 31 mmol) in Chloroform (14 mL) DIEA (940 uL, 5 38 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (319 mg, 0 50 mmol, 71%) LC-MS (ES) m/z = 537 (M+H)+ c) AV-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (145 mg, 0 25 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (60 uL, 1 91 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (88 mg, 0 19 mmol, 77%) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-cfe) δ ppm 2 34 (s, 3 H) 2 81 - 3 10 (m, 4 H) 3 72 (s, 3 H) 4 25 - 4 40 (m, 1 H) 7 10 (t, J=8 84 Hz, 2 H) 7 31 (dd, J=8 21, 5 68 Hz, 2 H) 7 69 (s, 1 H) 7 94 (s, 1 H) δ 15 (s, 3 H)8 85(s, 1 H) Example 161 (Formula Removed) reparation of N-[(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-f4-chloro-1-methyl-1H-Dvrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-N-{(1 S>-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (187 mg, 0 73 mmol) [prepared according to the procedure of Example 158], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (233 mg, 0 70 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine]and PyBrop (412 mg, 0 88 mmol) in Chloroform (9 mL) DIEA (640 uL, 3 66 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (180 mg, 0 30 mmol, 42%) LC-MS (ES) m/z = 537 (M+H)+ b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H- pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -[(3-fiuorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (186 mg, 0 31 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (76 uL, 2 42 mmol) was added and the reaction starred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (108 mg, 0 231, 74%) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 34 (s, 3 H) 2 91 - 3 03 (m, 4 H) 3 71 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 02 (td, J=8 59, 2 02 Hz, 1 H) 7 13 (t, J=7 07 Hz, 2 H) 7 26 - 7 36 (m, 1 H) 7 69 (s, 1 H) 7 95 (s, 1 H) δ 15 (s, 3 H) δ 88 (d, J=6 32 Hz, 1 H) Example 162 (Formula Removed) reparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (191 mg, 0 63 mmol) [prepared according to the procedure of Example 159], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (209 mg, 0 62 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (359 mg, 0 77 mmol) in chloroform (7 mL) DIEA (560 pL, 3 21 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (171 mg, 0 29 mmol, 46%) LC-MS (ES) m/z = 583 (M+H)+ b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (171 mg, 0 29 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (66 uL, 2 10 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (123 mg, 0 26 mmol, 88%) LC-MS (ES) m/z = 453 (M+H)+, 1H NMR (400 MHz, DMSO-cfe) S ppm 2 33 (s, 3 H) 2 91 - 3 03 (m, 4 H) 3 72 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 02 (td, J=8 46, 2 02 Hz, 1 H) 7 12 (d, J=7 33 Hz, 2 H) 7 27 - 7 35 (m, 1 H) 7 64 - 7 71 (m, 1 H) 7 92 (s, 1 H) δ 14 (s, 3 H) δ 79 - 8 93 (m, 1 H) Example 163 (Formula Removed) reparation of N-(( 1 S)-2-amino-Hf3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1I3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[3-(trifiuoromethyl)phenyl]methyl}ethyl)-5-methyl-2- thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (180 mg, 0 60 mmol) [prepared according to the procedure of Example 159], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (203 mg, 0 58 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (340 mg, 0 72 mmol) in Chloroform (6 mL) DIEA (530 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (259 mg, 0 41 mmol, 69%) LC-MS (ES) m/z = 633 (M+H)+ b) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide(259 mg, 0 41 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (90 uL, 2 87 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (172 mg, 0 33 mmol, 80%) LC-MS (ES) m/z = 503 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 32 (s, 3 H) 3 03 (d, J=6 06 Hz, 4 H) 3 71 (d, J=5 81 Hz, 3 H) 4 31 - 4 41 (m, 1 H) 7 49 - 7 56 (m, 2 H) 7 60 (d, J=6 82 Hz, 1 H) 7 64 - 7 71 (m, 2 H) 7 93 (d, J=12 88 Hz, 1 H) δ 18 (s, 3 H) δ 88 - 8 99 (m, 1 H) Example 164 (Formula Removed) reparation of N-((1S)-2-amino-1-(r3-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (Formula Removed) BS (2 03 g, 11 41 mmol) was added in portions to a 75 mL sealed tube reactor containing methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 1 g, 8 89 mmol) [prepared according to the procedure of Preparation 10] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 70 °C for 1 hour The reaction mixture was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4, the reaction mixture adsorbed onto silica and punfied via column chromatography (15 - 40% EtOAc/Hex) affording the title compound (2 57 g, 8 15 mmol, 92%) LC-MS (ES) m/z = 316(M+H)+ b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (Formula Removed) o a 350 mL sealed flask reactor was added methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (2 57 g, 8 15 mmol), tnmethylboroxine (2 27 ml, 16 31 mmol), K2CO3 (3 47 g, 25 1 mmol) and Pd(dppf)CI2 (426 mg, 0 83 mmol) in N,N-Dimethylformamide (DMF) (41 ml) The reaction was heated at 110 °C for 1 hour The mixture was partitioned between CHCU / H20, organic layer separated and dried with Na2SO4 The resulting material was adsorbed onto silica and purified via column chromatography (0-15% EtOAc/Hexane) affording the title compound (1 3 g, 4 76 mmol, 58%) LC-MS (ES) m/z = 251 (M+H)+ c)4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thtophenecarboxylic acid (Formula Removed) o a 100 mL round-bottomed flask was added methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (1 31 g, 5 23 mmol) in Tetrahydrofuran (THF) (25 mL) 6N NaOH (30 mL, 180 mmol) was added slowly and the reaction stirred at 70 °C overnight The reaction was cooled to room temperature, partitioned between CHCI3 and H2O and the pH of the aqueous layer adjusted to pH 3 by the addition of 6N HCI The layers were separated, the organic layer was dried with Na2SO4 and the solvent was removed affording the title compound (1 3 g, 5 5 mmol, quant) which was used without further purification LC-MS (ES) m/z = 237 (M+H)+ d) 4-(1,4-dimethyl-1 tf-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (170 mg, 0 68 mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (256 mg, 0 67 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (387 mg, 0 83 mmol) in chloroform (7 mL) DIEA (600 uL, 3 44 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (311 mg, 0 55 mmol, 80%) LC-MS (ES) m/z = 567 (M+H)+ e) ^-((IS^-amino-HfS-^rifluoromethyl)phenylJmethylJethylH^I^-dimethyl-IH- pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxarnide (311 mg, 0 55 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 4 mL) Hydrazine (122 uL, 3 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto siUca gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (234 mg, 0 44 mmol, 79%) LC-MS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 87 (s, 3 H) 2 26 (s, 3 H) 3 03 (d, J=6 82 Hz, 4 H) 3 62 (s, 3 H) 4 31 -4 41 (m, 1 H) 7 38 (s, 1 H) 7 49 - 7 56 (m, 2 H) 7 58 - 7 61 (m, 1 H) 7 65 (s, 1 H) 7 87 (s, 1 H) δ 20 (s, 3 H) δ 89 (d, J=8 59 Hz, 1 H) Example 165 (Formula Removed) reparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (207 mg, 0 83 mmol) [prepared according to the procedure of Example 164], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (279 mg, 0 83 mmol) [Prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (469 mg, 1 00 mmol) in chloroform (8 mL) DIEA (730 uL, 4 18 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (209 mg, 0 36 mmol, 43%) LC-MS (ES) m/z =517 (M+H)+ b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (201 mg, 0 39 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (86 uL, 2 74 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (163 mg, 0 34 mmol, 87%) LC-MS (ES) m/z = 387 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 88 (s, 3 H) 2 27 (s, 3 H) 2 87 - 3 09 (m, 4 H) 3 17 3 63 (s, 3 H) 4 28 - 4 45 (m, 1 H) δ 97 - 7 06 (m, 1 H) 7 13 (t, J=7 20 Hz, 2 H) 7 27 - 7 35 (m, 1 H) 7 38 (s, 1 H) 7 89 (s, 1 H) δ 20 (s, 3 H) δ 88 (d, J=7 58 Hz, 1 H) Example 166 (Formula Removed) reparation of N-{(1S)2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (253 mg, 1 02 mmol) [prepared according to the procedure of Example 164], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (335 mg, 1 00 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dirnethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (574 mg, 1 23 mmol) in chloroform (10 mL) DIEA (930 uL, 5 32 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (132 mg, 0 25 mmol, 24%) LC-MS (ES) m/z = 517 (M+H)+ b) N-{(1 S>2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (132 mg, 0 26 mmol) in Tetrahydrofuran (THF) (2 mL) and Methanol (1 mL) Hydrazine (57 uL, 1 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (104 mg, 0 22 mmol, 84%) LC-MS (ES) m/z = 387 (M+Hf, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 88 (s, 3 H) 2 27 (s, 3 H) 2 84 - 3 11 (m, 4 H) 3 63 (s, 3 H) 4 24 - 4 39 (m, 1 H) 7 10 (t, J=8 72 Hz, 2 H) 7 31 (dd, J=8 21, 5 68 Hz, 2 H) 7 38 (s, 1 H) 7 87 (s, 1 H)8 18(s, 3H)8 83(s, 1 H) Example 167 (Formula Removed) reparation of /vW(1S)-2-amino-1-[(3-fluorophenv0methyflethylM-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thioprienecarboxarnide a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (Formula Removed) BS (1 243 g, 6 98 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 47 g, 5 73 mmol) [Prepared according to the procedure of Example 151] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 70 °C for 1h 6N NaOH (20 ml, 120 mmol) was then added and the mixture stirred at 70 °C for an additional 2h The mixture was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4 and concentrated affording the title compound which was used without further purification (385 mg, 1 4 mmol, 30%) LC-MS (ES) m/z = 302 (M+H)+ b) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1>3-dioxo-1,3-dihydro-2H-isoindol-2-yi)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 4-(4-bromo-1 -methyl- 1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (204 mg, 0 60 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (215 mg, 0 64 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 7 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (380 mg, 0 81 mmol) in chloroform (6 mL) DIEA (570 uL, 3 26 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (247 mg, 45%) LC-MS (ES) m/z = 603 (M+H)+ c)N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (133 mg, 0 22 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 2 mL) Hydrazine (50 uL, 1 59 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (145 mg, 0 30 mmol, 66 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 91 - 3 03 (m, 4 H) 3 77 (s, 3 H) 4 30 - 4 41 (m, 1 H) 7 04 (td, J=8 53, 2 15 Hz, 1 H) 7 12 (d, J=7 07 Hz, 2 H) 7 28 - 7 36 (m, 1 H) 7 74 (s, 1 H) δ 02-8 14 (m, 4H)9 06(s, 1 H) Example 168 (Formula Removed) reparation of N-((1S)-2-amino-1-{[3-(trifluoromethyltohenyl]methyltethyiy5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro- 2W-isomdol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2- thiophenecarboxamide (Formula Removed) o a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (264 mg, 0 95 mmol) [prepared according to the procedure of Example 96], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (306 mg, 0 80 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (450 mg, 0 96 mmol) in chloroform (7 mL) DIEA (660 pi, 3 78 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (303 mg, 0 44 mmol, 56%) LC-MS (ES) m/z = 607 (M+H)+ b) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl )-2-th lophenecarboxa mide To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (303 mg, 0 50 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 5 mL) Hydrazine (120 uL, 3 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (177 mg, 0 31 mmol, 61 % yield) LC-MS (ES) m/z = 479 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 97 - 3 08 (m, 4 H) 3 76 (s, 3 H) 4 28 - 4 44 (m, 1 H) 7 50 - 7 61 (m, 3 H) 7 66 (s, 1 H) 7 71 - 7 75 (m, 1 H) δ 10 (s, 4 H) 9 16 (d, J=8 59 Hz, 1 H) Example 169 (Formula Removed) eparation of N-(((S)-2-aminch14f3-(trifluoromethyQphenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide a) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)pheriyl]methyl}ethyl)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (183 mg, 0 54 mmol) [prepared according to the procedure of Example 167], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (201 mg, 0 52 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanme] and PyBrop (298 mg, 0 64 mmol) in chloroform (5 mL) DIEA (470 pL, 2 69 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (246 mg, 0 36 mmol, 69%) LC-MS (ES) m/z = 653 (M+H)+ d) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (246 mg, 0 38 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (0 083 mL, 2 64 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (134 mg, 0 22 mmol, 57 % yield) LC-MS (ES) m/z = 523 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 3 04 (d, J=4 55 Hz, 4 H) 3 76 (s, 3 H) 4 29 - 443 (m, 1 H) 7 50 -7 61 (m, 3 H) 7 66 (s, 1 H) 7 70 - 7 75 (m, 1 H) δ 06 - 8 18 (m, 4 H) 9 17 (s, 1 H) Example 170 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethylM-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide a) 4-(4-bromo-1 -methyl- 1tf-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (340 mg, 1 00 mmol) [prepared according to the procedure of Example 1671, 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (374 mg, 1 12 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (626 mg, 1 34 mmol) in chloroform (10 mL) DIEA (980 uL, 5 61 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (229 mg, 0 35 mmol, 31%) LC-MS (ES) m/z = 603 (M+H)+ b)N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (229 mg, 0 38 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 2 mL) Hydrazine (90 uL, 2 87 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (99 mg, 0 17 mmol, 45 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-c(6) δ ppm 2 90 (d, J=6 82 Hz, 2 H) 2 95 - 3 06 (m, 2 H) 3 77 (s, 3 H) 4 27 -4 39 (m, 1 H) 7 11 (t, J=8 72 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 74 (s, 1 H) δ 01 - 8 21 (m, 4 H) 9 06 (s, 1 H) Example 171 (Formula Removed) Preparation of N-K1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (320 mg, 1 16 mmol) [prepared according to the procedure of Example 168], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (318 mg, 0 95 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (535 mg, 1 14 mmol) in Chloroform (9 5 mL) DIEA (840 pi, 4 81 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (106 mg, 0 16 mmol, 17%) LC-MS (ES) m/z = 557 (M+H)+ b)N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (106 mg, 0 19 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 5 mL) Hydrazine (45 uL, 1 43 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (65 mg, 0 12 mmol, 65 % yield) LC-MS (ES) m/z = 429 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 82 - 3 10 (m, 4 H) 3 77 (s, 3 H) 4 27 - 4 38 (m, 1 H) 7 11 (t, J=8 72 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 68 - 7 76 (m, 1 H) δ 10 (s, 4 H) 9 11 (d, J=7 33 Hz, 1 H) Example 172 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2.5-difluoroDhenyl]methyl]ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thtophenecarboxamide a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3- dioxc^1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (219 mg, 0 85 mmol) [prepared according to the procedure of Example 158], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (290 mg, 0 82 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (481 mg, 1 03 mmol) in chloroform (8 5 mL) DIEA (750 uL, 4 29 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (246 mg, 0 44 mmol, 52%) LC-MS (ES) m/z = 555 (M+H)+ b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyi-1 H- pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (246 mg, 0 44 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (100 uL, 3 19 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (147 mg, 0 28 mmol, 64 % yield) LC-MS (ES) m/z = 425 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 2 34 (s, 3 H) 2 93 - 3 07 (m, 4 H) 3 71 (s, 3 H) 4 34 - 4 50 (m, 1 H) 7 04 - 7 14 (m, 1 H) 7 19 (td, J=9 03, 4 67 Hz, 2 H) 7 69 (s, 1 H) 7 93 (s, 1 H) δ 14 (s, 3 H) δ 87 (d, J=8 59 Hz, 1 H) Example 173 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl)-5-methyl-4-(1-methyl-1N-pyrazol-5-yl)-2-triiophenecarboxamide a) N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (171 mg, 0 77 mmol) [prepared according to the procedure of Example 151], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (270 mg, 0 77 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (436 mg, 0 93 mmol) in chloroform (7 5 mL) DIEA (680 uL, 3 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (246 mg, 0 44 mmol, 52%) LC-MS (ES) m/z = 521 (M+H)+ b)N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (243 mg, 0 47 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (0 103 mL, 3 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (132 mg, 0 27 mmol, 58 % yield) LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 2 38 (s, 3 H) 2 87 - 3 10 (m, 4 H) 3 78 (s, 3 H) 4 36 - 4 47 (m, 1 H) δ 35 (d, J=1 77 Hz, 1 H) 7 05 - 7 13 (m, 1 H) 7 16 - 7 28 (m, 2 H) 7 52 (d, J=1 52 Hz, 1 H) δ 00 (s, 1 H) δ 16 (s, 3 H) δ 88 (d, J=8 59 Hz, 1 H) Example 174 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a) N-{(1S)-2-(2,5-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (208 mg, 0 88 mmol) [prepared according to the procedure of Example 164], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (288 mg, 0 82 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (503 mg, 1 07 mmol) in Chloroform (8 5 mL) DIEA (770 uL, 4 41 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (292 mg, 0 55 mmol, 62%) LC-MS (ES) m/z = 535 (M+H)+ b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyM H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (292 mg, 0 55 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (1 mL) Hydrazine (120 uL, 3 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (163 mg, 0 32 mmol, 59 % yield) LC-MS (ES) m/z = 405 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 88 (s, 3 H) 2 27 (s, 3 H) 2 94 - 3 06 (m, 4 H) 3 63 (s, 3 H)4 35 -4 49 (m, 1 H) 7 05 - 7 12 (m, 1 H) 7 16 - 7 27 (m, 2 H) 7 38 (s, 1 H) 7 86 (s, 1 H) δ 16 (s, 3 H) δ 83 (d, J=8 84 Hz, 1 H) Example 175 (Formula Removed) Preparation of N-[(1S)-2-amino-1-[(2,5-difluorophenyl]methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1- [(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (235 mg, 0 85 mmol) [prepared according to the procedure of Example 96], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (290 mg, 0 82 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (479 mg, 1 02 mmol) in chloroform (8 5 mL) DIEA (742 uL, 4 25 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (174 mg, 0 30 mmol, 36%) LC-MS (ES) m/z = 575 (M+H)+ b) N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1- methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (174 mg, 0 30 mmol) in Tetrahydrofuran (THF) (3 6 mL) and Methanol (1 mL) Hydrazine (70 uL, 2 23 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (115 mg, 0 21 mmol, 70 % yield) LC-MS (ES) m/z = 445 (M+Hf, 1H NMR (400 MHz, DMSO-Oe) δ ppm 2 88 - 3 09 (m, 4 H) 3 76 (s, 3 H) 4 33 - 4 48 (m, 1 H) 7 06 - 7 15 (m, 1 H) 7 20 (td, J=9 09, 4 55 Hz, 2 H) 7 74 (s, 1 H) δ 10 (s, 1 H) δ 13 (s, 3 H) 9 14 (d, J=8 84 Hz, 1 H) Example 176 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a 350 mL sealed flask reactor was added methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (3 45 g, 11 46 mmol) [prepared according to the procedure of Example 156], tnmethylboroxme (2 7 ml, 19 40 mmol), K2CO3 (4 75 g, 34 4 mmol) and Pd(dppf)CI2 (599 mg, 1 17 mmol) in N,N-Dimethylformamide (DMF) (57 mL) The reaction was heated at 110 °C for 1 hour, cooled to room temperature and partitioned between CHCI3 / H2O The organic layer was separated, dned with Na2SO4, adsorbed onto silica and punfied via column chromatography (0-30%EtOAc/Hexane) affording the title compound (2 07 g, 8 76 mmol, 76%) LC-MS (ES) m/z = 251 (M+H)+ b) methyl 4-(3-chloro-1,4-dimethyl-1 A7-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) NCS (1 78 g, 13 09 mmol) was added in portions to a 125 mt_ sealed tube reactor containing methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 07 g, 8 76 mmol) in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 100 °C for 1 hour Upon completion the product was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4, solvents removed by vacuum distillation affording the title compound (2 18 g, 7 97 mmol, 91%) which was used without further purification LC-MS (ES) m/z = 271 (M+H)+ c)4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a 100 mL round-bottomed flask was added methyl 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 15 g, 7 94 mmol) in Tetrahydrofuran (THF) (30 ml) 6N NaOH (30 mL, 180 mmol) was added slowly and the reaction stirred at 70 °C overnight The reaction was cooled to room temperature, partitioned between CHCI3 and H2O and the pH of the aqueous layer adjusted to - 3 by the addition of 6N HCI The layers were separated, the organic layer dried with Na2SO4 and solvent removed affording the title compound (1 35 g, 5 26 mmol, 66%) which was used in the next step without further punfication LC-MS (ES) m/z = 257 (M+H)+ d) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-/S/-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (294 mg, 114 mmol), 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (409 mg, 1 22 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine]and PyBrop (645 mg, 1 38 mmol) in chloroform (10 mL) DIEA (1 mL, 5 73 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (534 mg, 0 92 mmol, 81%) LC-MS (ES) m/z = 537 (M+H)+ c) N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (534 mg, 0 994 mmol) in Tetrahydrofuran (THF) (9 mL) and Methanol (1 mL) Hydrazine (220 uL, 7 01 mmol) was added and the reaction stirred overnight at room temperature The jfeaction mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (354 mg, 0 70 mmol, 70 % yield) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 99 (s, 3 H) 2 91 - 3 02 (m, 4 H) 3 79 (s, 3 H) 4 30 - 4 41 (m, 1 H) 7 10 (t, J=8 84 Hz, 2 H) 7 27 - 7 36 (m, 2 H) δ 01 (d, J=1 26 Hz, 1 H) δ 15 (s, 3 H) 8 21 (d, J=1 26 Hz, 1 H) 9 04 (d, J=8 34 Hz, 1 H) Example 177 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methynethyl}-4-(3-chloro-1,4-dtmethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2tf-isomdol-2-yl)-1-[(3-fiuorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (291 mg, 1 13 mmol) [prepared according to the procedure of Example 176], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (409 mg, 1 22 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl]-2-(trifluoromethyl)-l_-phenylalanine] and PyBrop (654 mg, 1 39 mmol) in chloroform (10 mL) DIEA (1 mL, 5 73 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (427 mg, 0 76 mmol, 67%) LC-MS (ES) m/z = 537 (M+H)+ b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (427 mg, 0 79 mmol) in Tetrahydrofuran (THF) (7 5 mL) and Methanol (1 mL) Hydrazine (175 uL, 5 58 mmol) was added and the solution stirred at 25 °C overnight The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (296 mg, 0 59 mmol, 74 % yield) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 99 (s, 3 H) 2 95 - 3 06 (m, 4 H) 3 79 (s, 3 H) 4 33 - 4 45 (m, 1 H) 7 02 (td, J=8 59, 2 02 Hz, 1 H) 7 09 - 7 18 (m, 2 H) 7 26 - 7 36 (m, 1 H) δ 01 (d, J=1 01 Hz, 1 H) δ 16 (s, 3 H) δ 22 (s, 1 H) 9 07 (d, J=8 34 Hz, 1 H) Example 178 (Formula Removed) Preparation of N-U1 S)-2-amino-1-(cvdohexvlmethyl)ethyri-4-(3-chloro-1.4-dimethyl-1H-pyrazol-5-vD-2-thiophenecarboxamide a) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3- dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (150 mg, 0 58 mmol) [prepared according to the procedure of Example 176], 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (176 mg, 0 54 mmol) [prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (336 mg, 0 72 mmol) in chloroform (6 mL) DIEA (520 pL, 2 98 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (336 mg, 0 61 mmol, quant) LC-MS (ES) m/z = 526 (M+H)+ b) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(3-chloro-1,4-dimethyl-1H-pyrazol- 5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (366 mg, 0 697 mmol) in Tetrahydrofuran (THF) (6 5 mL) and Methanol (1 mL) Hydrazine (155 uL, 4 94 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (173 mg, 0 35 mmol, 50 % yield) LC-MS (ES) m/z = 395 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 0 80 - 0 92 (m, 1 H) 0 92 - 1 01 (m, 1 H) 1 13 (d, J=6 57 Hz, 2 H) 1 22 (d, J=12 88 Hz, 1 H) 1 29 (s, 1 H) 1 32 -1 43 (m, 1 H) 1 48 -1 56 (m, 1 H) 1 58 (d, J=5 05 Hz, 1 H) 1 63 (s, 3 H) 1 73 -1 84 (m, 1 H) 1 99 (s, 3 H) 2 94 (d, J=5 31 Hz, 2 H) 3 78 (s, 3 H) 4 22 - 4 36 (m, 1 H) δ 03 (s, 1 H) δ 05 (s, 3 H) δ 19 (s, 1 H) δ 80 (d, J=8 59 Hz, 1 H) Example 179 (Formula Removed) Preparation of N-((1S)-2-amino-1-[[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (238 mg, 0 93 mmol) [prepared according to the procedure of Example 176], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (355 mg, 0 92 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (5 0 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (532 mg, 1 13 mmol) in chloroform (9 5 mL) DIEA (820 uL, 4 70 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (448 mg, 0 72 mmol, 78%) LC-MS (ES) m/z = 587 (M+H)+ b) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (468 mg, 0 80 mmol) in Tetrahydrofuran (THF) (7 5 mL) and Methanol (1 mL) Hydrazine (175 uL, 5 58 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (321 mg, 0 58 mmol, 72 % yield) LC-MS (ES) m/z = 457 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 98 (s, 3 H) 3 05 (d, J=7 07 Hz, 4 H) 3 77 (s, 3 H) 4 33 - 4 44 (m, 1 H) 7 49 - 7 57 (m, 2 H) 7 58 - 7 62 (m, 1 H) 7 66 (s, 1 H) δ 01 (d, J=1 26 Hz, 1 H) δ 11 (s, 3 H) δ 17 (d, J=1 26 Hz, 1 H) 9 02 (d, J=8 59 Hz, 1 H) Example 180 (Formula Removed) Preparation of A/4(1S)-2-amino-1-[(2,5-difluorophenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (147 mg, 0 61 mmol), 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (216 mg, 0 61 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (341 4 mg, 0 73 mmol) in chloroform (6 mL) DIEA (530 ul_, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (233 mg, 0 43 mmol, 71%) LC-MS (ES) m/z = 541 (M+H)+ b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (233 mg, 0 43 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (1 mL) Hydrazine (95 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (165 mg, 0 32 mmol, 75 % yield) LC-MS (ES) m/z = 411 (M+HV\ 1H NMR (400 MHz, DMSO-d6) δ ppm 2 88 - 3 14 (m, 4 H) 3 85 (s, 3 H) 4 37 - 4 50 (m, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 09 (t, J=8 34 Hz, 1 H) 7 19 (dt, J=9 09, 4 55 Hz, 1 H) 7 29 (ddd, J=8 84, 5 68, 3 16 Hz, 1 H) 7 55 (d, J=1 52 Hz, 1 H) δ 22 (s, 3 H) δ 27 (s, 1 H) 9 32 (d, J=8 84 Hz, 1 H) Example 181 (Formula Removed) Preparation of N-K1 S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-rnethyl-2-thiophenecarboxarnide The title compound was prepared according to the procedure of Example 109, except substituting 2-[(2S)-2-amino-3-(3-fiuorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (184 mg, 0 55 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione [prepared according to Preparation 6] LC-MS (ES) m/z = 401 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 1 04 (t, J=7 33 Hz, 3 H) 2 13 - 2 33 (m, 5 H) 2 86 - 3 08 (m, 4 H) 3 60 (s, 3 H) 4 27 - 4 43 (m, 1 H) δ 96 - 7 07 (m, 1 H) 7 11 (d, J=6 32 Hz, 2 H) 7 30 (s, 1 H) 7 43 (s, 1 H) 7 85 (s, 1 H) δ 19 (s, 3 H) δ 85 (s, 1 H) Example 182 (Formula Removed) Preparation of N-\|(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl\|-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared according to the procedure of Example 109, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (207 mg, 0 62 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione [prepared according to Preparation 6] LC-MS (ES) m/z = 401 (M+H)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 1 04 (t, J=7 20 Hz, 3 H) 2 25 (s, 5 H) 2 88 - 3 00 (m, 4 H) 3 61 (s, 3 H) 4 25 - 4 40 (m, 1 H) 7 01 - 7 17 (m, 2 H) 7 26 - 7 35 (m, 2 H) 7 42 (s, 1 H) 7 82 (s, 1 H) δ 17 (s, 3 H) δ 81 (s, 1 H) Example 183 (Formula Removed) Preparation of N-(C\ S)-2-amincM-{r3-(trifluoromethyl)phenyl]methyltethyiy4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared according to the procedure of Example 109, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (158 mg, 0 41 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione [prepared according to Preparation 6] LC-MS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 04 (t, J=l 33 Hz, 3 H) 2 24 (s, 5 H) 3 03 (d, J=6 32 Hz, 4 H) 3 59 (s, 3 H) 4 35 (s, 1 H) 7 42 (s, 1 H) 7 46 - 7 57 (m, 2 H) 7 59 (d, J=6 57 Hz, 1 H) 7 64 (s, 1 H) 7 84 (s, 1 H) δ 20 (s, 3 H) δ 88 (s, 1 H) Example 184 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) methyl 5-methyl-2-furancarboxylate (Formula Removed) To a 200 mL round-bottomed flask with condenser was added 5-methyl-2-furancarboxylic acid (2 5 g, 19 82 mmol) in Methanol (100 mL) H2SO4 (10 5 mL, 197 mmol) was added slowly at room temperature The reaction mixture was heated to 50 °C overnight The reaction mixture was cooled to 0 °C and a saturated solution of NaHCO3 was added to neutral pH followed by 5N NaOH to pH 10 CHCI3 was added and the organic phase was separated, dned with Na2SO4 and concentrated affording the title compound (2 3 g, 16 3 mmol, 82%) LC-MS (ES) m/z = 141 (M+H)+ b) methyl 4-bromo-5-methyl-2-furancarboxylate (Formula Removed) To a solution of methyl 5-methyl-2-furancarboxylate (2 33 g, 16 29 mmol) and aluminum chloride (3 3 g, 24 75 mmol) in chloroform (50 ml) at room temperature was added Br2 (1 1 ml, 21 35 mmol) The resulting solution was stirred at room temperature in a 150 mL sealed tube reactor for 2 hours Upon completion, the solution was cooled in an ice bath, H2O added and reaction partitioned between CHCI3 / H2O The organic layer was washed with NaHCC^ and then Na2S2O3 The organic layer was dried with Na2SO4, concentrated, adsorbed onto silica and purified via column chromatography (0-20% EtOAc/Hexanes) affording the title compound (2 13 g, 9 72 mmol, 60%) LC-MS (ES) m/z = 221 (M+H)+ c) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) To a 5 mL sealed flask reactor was added methyl 4-bromo-5-methyl-2-furancarboxylate (1 13 g, 5 16 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 31 g, 6 30 mmol) [prepared according to the procedure of Preparation 7], K3PO4 (3 87 g, 18 23 mmol) and Pd2(dba)3 (153 mg, 0 17 mmol) and P(OMe)3 (32 uL, 0 27 mmol) in 1,4-Dioxane (23 mL) The reaction was heated at 95 °C for 4 hours, cooled to room temperature and partitioned between CHCI3 / H20 The organic layer was separated, dned with Na2SO4, adsorbed onto silica and purified via column chromatography (0-15%EtOAc/Hexanes) affording the title compound (967 mg, 4 39 mmol, 85%) LC-MS (ES) m/z = 271 (M+H)+ d) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (Formula Removed) NCS (709 mg, 5 31 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (967 mg, 4 39 mmol) in Tetrahydrofuran (THF) (20 mL) at room temperature The mixture was heated to 70 °C for 1 hour 6N NaOH (20 mL, 120 mmol) was then added and the mixture stirred at 70 °C for an additional 2h The mixture was partitioned between CHCI3 and H2O and the pH of the aqueous phase was adjusted to -3 with 6N HCI The organic layer was separated, dried with Na2SO4 and concentrated affording the title compound (1 13 g, 4 41 mmol, quant) which was used without further purification LC-MS (ES) m/z = 241 (M+H)+ e) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (244 mg, 0 95 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (320 mg, 0 95 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[{ 1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 0 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (533 mg, 1 14 mmol) in chloroform (9 mL) DIEA (830 uL, 4 75 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (242 mg, 0 465 mmol, 49%) LC-MS (ES) m/z = 521 (M+H)+ f) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide (238 mg, 0 46 mmol) in Tetrahydrofuran (THF) (3 6 mL) and Methanol (1 mL) Hydrazine (100 uL, 3 19 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (157 mg, 0 32 mmol, 71 % yield) LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 31 (s, 3 H) 2 91 - 3 03 (m, 4 H) 3 73 (s, 3 H) 4 36 - 4 49 (m, 1 H) 7 03 (t, J=7 71 Hz, 1 H) 7 07 - 7 14 (m, 2 H) 7 29 - 7 37 (m, 1 H) 7 39 (s, 1 H) 7 67 (s, 1 H) δ 14 (s, 3 H) δ 65 (d, J=8 59 Hz, 1 H) Example 185 (Formula Removed) Preparation of N-(C\ S)-2-amino1-{[2-(trifluoromethyDphenyl]methyltethyl)-5-(methyloxv)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 5-(methyloxy)-2-thiophenecarboxylic acid (Formula Removed) 2-(methyloxy)thiophene (1 01 g, 8 85 mmol) was added slowly over 15 mm to a 100 mL round-bottomed flask containing 2 5M nBuLi in hexanes (3 8 mL, 9 50 mmol) in Tetrahydrofuran (THF) (40 mL) at -78 °C After warming to room temperature and stirring for 2h, the mixture was cooled to -35 °C and crushed solid CO2 was added The mixture warmed to room temperature over 3 hours and was cooled in an ice bath and quenched with NH4CI(sat) The cold reaction mixture was partitioned between CHCU / H20, the aqueous layer was made acidic with 6N HCI The separated organic layer was dned with Na2SO4 and concentrated affording the title compound (1 3 g, 8 05 mmol, 91%) which was used without further purification LC-MS (ES) m/z = 159 (M+H)+ b) methyl 5-(methyloxy)-2-thiophenecarboxylate (Formula Removed) To a 200 mL round-bottomed flask fitted with a condenser was added 5-(methyloxy)-2-thiophenecarboxylic acid (1 3 g, 8 22 mmol) in Methanol (40 mL) H2SO4 (5 mL, 94 mmol) was added slowly at room temperature and the reaction stirred at 50 °C overnight The mixture was cooled to 0 °C and sat NaHCO3 was added to neutral pH followed by 5N NaOH to pH 10 The mixture was partitioned between H20 / CHCI3 and the organic phase was separated and dried over Na2SO4 The solution was adsorbed onto silica and punfied via column chromatography (5-50% EtOAc/Hexanes) affording the title compound (827 mg, 4 56 mmol, 56%) LC-MS (ES) m/z = 173 (M+H)+ c) methyl 4-bromo-5-(methyloxy)-2-thiophenecarboxylate (Formula Removed) NBS (903 mg, 5 07 mmol) was added in portions to a 5 mL sealed tube reactor containing methyl 5-(methyloxy)-2-thiophenecarboxylate (0 73 g, 4 23 mmol) in N,N-Dimethylformamide (DMF) (20 mL) at room temperature and the reaction stirred for 1 hour Additional NBS (249 mg) was added and after 1h at room temperature the product was partitioned between CHCI3 and H2O The organic layer was dned with Na2SO4, adsorbed onto silica and purified via column chromatography (0-25% EtOAc/Hexanes) affording the title compound (825 mg, 3 19 mmol, 75%) LC-MS (ES) m/z = 252 (M+H)+ d) methyl 5-(methyloxy)-4-(1 -methyl-1 f/-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a 350 mL sealed flask reactor was added methyl 4-bromo-5-(methyloxy)-2-thiophenecarboxylate (772 mg, 3 07 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (773 mg, 3 72 mmol) [prepared according to the procedure of Preparation 7], K2CO3 (1 419 g, 10 27 mmol) and Pd(Pt-Bu3)2 (103 mg, 0 20 mmol) in 1,4-Dioxane (12 mL) and Water (3 mL) The reaction was heated at 85 °C for 2 hours The mixture was partitioned between CHCI3 / H20 and the aqueous layer made acidic with 6N HCI The separated organic layer was dried over Na2SO4 and evaporated The resulting material was adsorbed onto silica and purified via column chromatography (0-50%EtOAc/Hexane) affording the title compound (967 mg, 4 39 mmol, 85%) LC-MS (ES) m/z = 253 (M+H)+ e) 5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a 100 mL round-bottomed flask was added methyl 5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (203 mg, 0 805 mmol) in Tetrahydrofuran (THF) (4 mL) 6N NaOH (4 mL, 24 0 mmol) was added slowly, the reaction mixture stirred overnight at 70 °C The mixture was neutralized by addition of 6N HCI and partitioned between CHCI3 and H2O The layers were separated, the organic layer dried over Na2SO4 and concentrated affording the title compound (152 mg, 0 64 mmol, 79%), which was used in the next step without further purification LC-MS (ES) m/z = 239 (M+Hf f) /v-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (148 mg, 0 62 mmol), 2-{(2S)-2-amino-3- [2-(trifluoromethyl)phenyl]propylMH-isomdole-1,3(2H)-dione (242 mg, 0 63 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (356 mg, 0 76 mmol) in Chloroform (6 mL) DIEA (550 uL, 3 15 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (303 mg, 0 51 mmol, 82%) LC-MS (ES) m/z = 569 (M+H)+ g) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1- methyl-1f/-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3- dihydro-2Hnsomdol-2-yl)-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(rnethyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (303 mg, 0 51 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (110 uL, 3 50 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (122 mg, 0 23 mmol, 45 % yield) LC-MS (ES) m/z = 439 (M+H)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 2 93 - 3 02 (m, 1 H) 3 03 - 3 14 (m, 3 H) 3 82 (s, 3 H) 3 98 (s, 3 H) 4 41 - 4 53 (m, 1 H) δ 32 (s, 1 H) 7 38 - 7 49 (m, 2 H) 7 52 - 7 63 (m, 2 H) 7 68 (d, J=7 58 Hz, 1 H) δ 01 (s, 1 H) δ 17 (s, 3 H) δ 93 (d, J=8 84 Hz, 1 H) Example 186 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-/v'-{(1S^2-(1,3-dloxo-1,3-dlhydro-2W-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (248 mg, 0 97 mmol) [prepared according to the procedure of Example 184], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (321 mg, 0 96 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (557 mg, 1 19 mmol) in chloroform (9 5 mL) DIEA (840 uL, 4 81 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (167 mg, 0 26 mmol, 67%) LC-MS (ES) m/z = 521 (M+H)+ b) N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-py razol-5-yl )-5-methy l-2-f u ra nca rboxa m id e To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide (144 mg, 0 27 mmol) in Tetrahydrofuran (THF) (2 5 mL) and Methanol (1 mL) Hydrazine (60 uL, 1 91 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (100 mg, 0 21 mmol, 74 % yield) LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 31 (s, 3 H) 2 83 - 2 93 (m, 2 H) 2 94 - 3 04 (m, 2 H) 3 73 (s, 3 H) 4 32 - 4 44 (m, 1 H) 7 12 (t, J=8 59 Hz, 2 H) 7 25 - 7 33 (m, 2 H) 7 35 (s, 1 H) 7 67 (s, 1 H) δ 07 (s, 3 H) δ 57 (d, J=8 59 Hz, 1 H) Example 187 (Formula Removed) Preparation of N-((1S)-2-amincM4f3-(trifluoromethy0phenyl]methyl}ethyl)-4-(4-chloro-1-methyHH-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2- furancarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (230 mg, 0 90 mmol) [prepared according to the procedure of Example 184], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (348 mg, 0 90 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (502 mg, 1 07 mmol) in chloroform (8 5 mL) DIEA (790 uL, 4 52 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (247 mg, 0 43 mmol, 48%) LC-MS (ES) m/z = 571 (M+H)+ b) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (247 mg, 0 433 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (95 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (206 mg, 0 38 mmol, 88 % yield) LC-MS (ES) m/z = 441 (M+H)+, 1H NMR (400 MHz, DMSO-d) § ppm 2 30 (s, 3 H) 2 97 - 3 08 (m, 4 H) 3 71 (s, 3 H) 4 35 - 4 49 (m, 1 H) 7 36 (s, 1 H) 7 54 (dt, J=19 20, 7 20 Hz, 3 H) 7 62 - 7 68 (m, 2 H) δ 14 (s, 3 H) δ 65 (d, J=8 84 Hz, 1 H) Example 188 (Formula Removed) Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxvV2-thiophenecarboxamide a) 4-(4-chloro-1 -methyl-1 W-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (Formula Removed) NCS (382 mg, 2 80 mmol) was added in portions to a 50 mL sealed tube reactor containing methyl 5-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (642 mg, 2 54 mmol) [prepared according to the procedure of Example 185] in Tetrahydrofuran (THF) (12 mL) at room temperature The mixture was heated to 70 °C for 1 hour The reaction was cooled to room temperature, 6N NaOH (10 mL, 60 0 mmol) was added and the mixture stirred an additional 3h at 70 °C The mixture was partitioned between CHCI3 and H2O and the aqueous layer was made acidic with 6N HCI The organic layer was dried over Na2SO4 and concentrated affording the title compound (759 mg, 2 51 mmol, 98%) which was used without further purification LC-MS (ES) m/z = 273 (M+H)+ b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (85 mg, 0 31 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (119 mg, 0 31 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (180 mg, 0 384 mmol) in chloroform (3 5 mL) DIEA (270 uL, 1 54 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (94 mg, 0 14 mmol, 45%) LC-MS (ES) m/z = 603 (M+H)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-criloro-1 -methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1 S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-2-thiophenecarboxamide(94 mg, 0 16 mmol) in Tetrahydrofuran (THF) (2 mL) and Methanol (1 mL) Hydrazine (35 uL, 1 12 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (27 mg, 0 05 mmol, 31 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 93 - 3 14 (m, 4 H) 3 73 (s, 3 H) 4 00 (s, 3 H) 4 41 - 4 54 (m, 1 H) 7 43 (t, J=7 45 Hz, 1 H) 7 57 (ddd, J=14 59, 7 58, 7 39 Hz, 2 H) 7 62 - 7 65 (m, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 82 - 7 89 (m, 1 H) δ 12 (s, 3 H) δ 80 (d, J=9 09 Hz, 1 H) Example 189 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2,5-difluorophenyl]methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) methyl 5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a 350 mL sealed flask reactor was added methyl 4-bromo-5-chloro-2-thiophenecarboxylate (409 mg, 1 60 mmol) [prepared according to the procedure of Example 95], 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (388 mg, 1 75 mmol) [prepared according to the procedure of Preparation 17], K2CO3 (676 mg, 4 89 mmol) and Pd(PtBu3)2 (32 mg, 0 06 mmol) in 1,4-Dioxane (6 mL) and water (1 5 mL) The reaction was heated at 85 °C for 3 hours The reaction was partitioned between CHCI3 / H20 and the pH of the aqueous layer was adjusted to -3 with 6N HCI The separated organic layer was dried with Na2SO4, adsorbed onto silica and purified via column chromatography (10-65% EtOAc/Hexanes) affording the title compound (106 mg, 0 39 mmol, %), LC-MS (ES) m/z = 271 (M+H)+ b) 5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a 100 mL round-bottomed flask was added methyl 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (106 mg, 0 39 mmol) in Tetrahydrofuran (THF) (2 mL) 6N NaOH (2 mL, 12 00 mmol) was added slowly and the reaction mixture stirred overnight at 70 °C The reaction was cooled to room temperature, partitioned between CHCI3 and H2O and the pH of the aqueous layer was adjusted to ~ 3 by the addition of 6N HCI The layers were separated, the organic layer dried over Na2SO4 and concentrated affording the desired compound (96 mg, 0 37 mmol, 95%) LC-MS (ES) m/z = 257 (M+H)+ c) 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2- yl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (96 mg, 0 37 mmol), 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindo!e-1,3(2H)-dione (125 mg, 0 40 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (225 mg, 0 48 mmol) in chloroform (4 mL) DIEA (330 uL, 1 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (98 mg, 0 13 mmol, 34%) LC-MS (ES) m/z = 535 (M+H)+ d) N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (98 mg, 0 18 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (40 uL, 1 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH40H) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (52 mg, 0 10 mmol, 56 % yield) LC-MS (ES) m/z = 425 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 94 (s, 3 H) 2 87 - 3 09 (m, 4 H) 3 69 (s, 3 H) 4 42 (d, J=6 32 Hz, 1 H) 7 10 (ddd, J=12 00, 8 34, 3 41 Hz, 1 H) 7 20 (td, J=9 16, 4 67 Hz, 1 H) 7 27 (ddd, J=8 97, 5 56, 3 16 Hz, 1 H) 7 39 (s, 1 H) δ 06 (s, 1 H) δ 13 (s, 3 H) 9 13 (d, J=8 84 Hz, 1 H) Example 190 (Formula Removed) Preparation of N-{(1S)-2-amlno-H(3-fluorophenv0methyl]yethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxvV2-thlopheneca^^boxamlde a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-(methyloxy)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (220 mg, 0 81 mmol) [prepared according to the procedure of Example 188], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (281 mg, 0 84 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (472 mg, 1 0 mmol) in Chloroform (8 mL) DIEA (710 uL, 4 07 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (281 mg, 0 51 mmol, 63%) LC-MS (ES) m/z = 553 (M+H)+ b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-iso/ndol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-(methyloxy)-2-thiophenecarboxamide (281 mg, 0 51 mmol) in Tetrahydrofuran (THF) (4 5 mL) and Methanol (1 mL) Hydrazine (120 uL, 3 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (145 mg, 0 28 mmol, 55 % yield) LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 86 - 3 04 (m, 4 H) 3 71 (s, 3 H) 4 02 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 00 - 7 07 (m, 1 H) 7 11 (d, J=7 58 Hz, 2 H) 7 28 - 7 36 (m, 1 H) 7 64 (s, 1 H) 7 73 - 7 78 (m, 1 H) 7 98 (s, 3 H) δ 54 (s, 1 H) Example 191 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyI}-5-(methyloxy)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (208 mg, 0 76 mmol) [prepared according to the procedure of Example 188], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (257 mg, 0 77 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (435 mg, 0 93 mmol) in chloroform (7 6 mL) DIEA (670 uL, 3 84 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (238 mg, 0 43 mmol, 56%) LC-MS (ES) m/z = 553 (M+H)+ b) N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H- pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-(methyloxy)-2-thiophenecarboxamide (238 mg, 0 43 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (95 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (113 mg, 0 22 mmol, 50 % yield) LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 82 - 2 92 (m, 2 H) 2 93 - 3 03 (m, 2 H) 3 71 (s, 3 H) 4 02 (s, 3 H) 4 26 - 4 37 (m, 1 H) 7 11 (t, J=8 46 Hz, 2 H) 7 26 - 7 32 (m, 2 H) 7 64 (s, 1 H) 7 69 -7 84 (m, 1H) 7 95 (s, 3 H) δ 45 - 8 52 (m, 1H) Example 192 (Formula Removed) Preparation of N-((1 S>2-amino-1-lf3-(trifluoromethyl)phenyl]methyltethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxv)-2-thiophenecarboxamide a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1)3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl3methyl}ethyl)-5-(methyloxy)-2- thiophenecarboxamide (Formula Removed) To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (210 mg, 0 77 mmol) [prepared according to the procedure of Example 188], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (294 mg, 0 764 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[( 1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (442 mg, 0 94 mmol) in chloroform (7 6 mL) DIEA (670 uL, 3 84 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (238 mg, 0 43 mmol, 56%) LC-MS (ES) m/z = 603 (M+H)+ b) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-2-thiophenecarboxamide (203 mg, 0 34 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (80 uL, 2 55 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (86 mg, 0 15 mmol, 44 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 92 - 3 08 (m, 4 H) 3 70 (s, 3 H) 4 01 (s, 3 H) 4 30 - 4 42 (m, 1 H) 7 50 - 7 60 (m, 3 H) 7 61 - 7 66 (m, 2 H) 7 73 - 7 81 (m, 1H) δ 00 (s, 3 H) δ 52 - 8 68(m, 1H) Example 193 (Formula Removed) Preparation of N-(C\ S)-2-amino-1-fr2-(trifluoromethyl]phenyl]methyl\|ethyl)--4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 4-chloro-5-(1-methyi-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of 5-bromo-4-chloro-2-thiophenecarboxylic acid (482 mg, 2 mmol) in dioxane/H20 (4 1, 10 mL) was added 1,1'- bis(diphenylphosphino)ferrocenedichloro Palladium (II) dichloromethane complex (16 3 mg, 0 02 mmol), potassium carbonate (828 mg, 6 mmol) and 5-(5,5-dimethyl-1,3,2-dooxabonnan-2-yl)-1-methyl-1H-pyrazole (832 mg, 4 mmol)[prepared according to Preparation 7] The reaction mixture was heated to 80 °C in a sealed tube for 20 hrs The reaction mixture was poured into H2O (100 mL) and extracted with DCM The organic layer was dried over Na2SO4, concentrated and purified using silica (EtOAc / hexane (0 - 45% gradient)) affording the title compound as a white solid (401 7 mg, 83%) LC-MS (ES) m/z= 243 (M+H)+ b) 4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of 4-chloro-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (121 mg, 0 5 mmol) and N-chlorosuccinimide (67mg, 0 5 mmol) in THF (5 mL) was stirred in a sealed tube at 70 °C After 4 hrs, the solution was concentrated and partitioned between DCM and H20 The aqueous layer was extracted several times with DCM The organic fractions were combined, concentrated and azeotropically dried with toluene to give the title compound as a brown oil (136 mg, 98%) LC-MS (ES) m/z= 278 (M+H)+ c) 4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-rV-((1S)-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2- thiophenecarboxamide (Formula Removed) To a solution of 4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (136 1 mg, 0 49 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (179 mg, 0 51 mmol)[prepared according to Preparation 6], dnsopropylethyl amine (260 uL, 1 5 mmol) in DCM (5 mL) was added PyBrop (341 mg, 0 75 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, gradient 0- 50% ethyl acetate / hexane) affording the title compound (242 mg, 82%) as a white solid LCMS (ES) m/z = 607 (M+H)+ d) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a solution of 4-chloro-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (242 mg, 0 4 mmol) in THF-MeOH (11,4 mL) was added hydrazine (75 uL, 2 42 mmol) After 12h, the solution was concentrated The resulting residue was partitioned between DCM and H2O The organics were washed three times with water and acidified to pH ~ 1 with 6N aqueous HCI solution The resulting mixture was extracted with water The aqueous fractions were combined and concentrated to afford the di-HCI salt of the desired product as a light yellow solid (77 mg, 40%) LCMS (ES) m/z 477 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 08-3 11 (m, 4 H) 3 75 (s, 3 H) 4 50 (br s , 1 H) 7 45 (t, J=6 95 Hz, 1H)7 55-7 63(m, 2H) 7 71 (d, J=7 83 Hz, 1 H) 7 78 (s, 1 H) δ 02 - 8 10 (m, 3 H) δ 12 (s, 1 H) 9 12 (d, J=9 09 Hz, 1 H) Example 194 (Formula Removed) Preparation of N-(C\ S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-chloro-5-M-bromo-1-methyl-1H-pyrazol-5-yl)-2-triioprienecarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 193, except substituting N-bromosuccinimide (89 mg, 0 5 mmol) for and N-chlorosuccinimide LCMS (ES) m/z 522 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 0-3 13 (m, 4 H) 3 76 (s, 3 H) 4 50 (br s , 1 H) 7 46 (d, J=7 58 Hz, 1 H) 7 55 - 7 66 (m, 2 H) 7 71 (d, J=7 83 Hz, 1 H) 7 78 (s, 1 H) δ 04 (br s,4H) Example 195 (Formula Removed) Preparation of N-\C\ S)-2-amino-1-(3-pyridinylmethyl)ethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a light yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (62 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3-pyndinyl)propyl]-1H-isoindole-1,3(2H)-dione -HCI (84 mg, 0 3 mmol)[prepared according to Preparation 19] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 342 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 17 (dd, J=13 89, 10 86 Hz, 1 H) 3 33 - 3 36 (m, 2 H) 3 36 - 3 44 (m, 1 H) 3 96 (s, 3 H) 4 70 (dd, J=14 02, 6 19 Hz, 1 H) δ 47 (s, 1 H) 7 51 (s, 1 H) 7 88 (d, J=1 26 Hz, 1 H) 7 94 (s, 1 H) δ 02 (t, J=6 32 Hz, 1 H) δ 61 (d, J=7 83 Hz, 1 H) δ 76 (br s , 1 H) δ 89 (br s , 1 H) Example 196 (Formula Removed) Preparation of N-[(1/?)-2-amino-1-phenylethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (83 mg, 0 4 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl [(2R)-2-amino-2-phenylethyl]carbamate (94 mg, 0 4 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z = 327 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 44 (d, J=4 29 Hz, 1 H) 3 63 (br s , 1 H) 4 18 (s, 3 H) δ 47 (dd, J=10 36, 4 55 Hz, 1 H) δ 88 (d, J=2 78 Hz, 1 H) 7 38 (d, J=7 07 Hz, 1 H) 7 44 (t, J=7 33 Hz, 2 H) 7 55 (d, J=7 83 Hz, 2 H) δ 08 (d, J=2 53 Hz, 1 H) δ 18 (d, J=1 26 Hz,1 H) δ 42 (d, J=1 26 Hz, 1 H) Example 197 (Formula Removed) Preparation of N-[(1S)-2-amino-1-phenylethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (83 mg, 0 4 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (94 mg, 0 4 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 327 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 3 44 (d, J=2 78 Hz, 1 H) 3 60 (br s , 1 H) 4 06 (br s , 3 H) δ 47 (dd, J=10 36, 4 29 Hz, 1 H) δ 70 (br s , 1 H) 7 38 (d, J=6 82 Hz, 1 H) 7 44 (t, J=7 20 Hz, 2 H) 7 53 (d, J=7 58 Hz, 2 H) 7 79 (br s , 1 H) δ 04 (br s ,1 H) δ 32 (br s , 1 H) Example 198 (Formula Removed) Preparation of N-[(1S)-2-amino-1-phenylethyl]-5-methyl-4-n-methyl-1H-Dvrazol-5-vl)-2-thiophenecarboxamide a) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-bromo-5-methyl-2-thiophenecarboxylate (2g, 8 51 mmol)[prepared in Preparation 10], potassium carbonate (5 88 g, 42 5 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 12 g, 10 21 mmol)[prepared according to Preparation 7] and bis(tn-t- butylphosphme)palladium(O) (0 22 g, 0 43 mmol) in 1,4-Dioxane (35 ml) and H20 (7 ml) was stirred at 80 °C in a sealed tube for 1h The reaction mixture was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 25% EtOAc in hexanes) affording methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate This reaction was run in several batches (1g, 3 x 2g) which were combined for workup and purification affording the title compound (5 5 g, 78% combined yield) as a viscous yellow oil LC-MS (ES) m/e 236 (M+H)+ b) 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (94 mg, 0 4 mmol) in 6N sodium hydroxide (0 67 ml, 4 mmol) and tetrahydrofuran (4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~3 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording the desired product (67 mg, 0 3 mmol, 75 % yield) as a yellow oil LC-MS (ES) m/e 223 (M+H)+ c) 1,1 -dimethylethyl [(2S)-2-({[5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-2-phenylethyl]carbamate (Formula Removed) To a solution of 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (67 mg, 0 3 mmol), 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (71 mg, 0 3 mmol) [prepared according to the procedure of Preparation 1] and diisopropylethylamine (0 16 ml, 0 9 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (210 mg, 0 45 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound (87 mg, 0 2 mmol, 65 % yield) as a yellow foam LC-MS (ES) m/e 441 (M+H)+ d) N-[(1S)-2-amino-1-phenylethyl]-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide To a solution of 1,1 -dimethylethyl [(2S)-2-({[4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (87 mg, 0 2 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 5 mL, 2 mmol) which stirred at ambient temperature for 15 h The solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (26 mg, 0 06 mmol, 32%) LC-MS (ES) m/z 341 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 49 (br s , 3 H) 3 43 (d, J=4 80 Hz, 1 H) 3 55 (d, J=10 36 Hz, 1 H) 3 95 (s, 3 H) δ 41-5 43 (m, 1 H) δ 66 (d, J=2 27 Hz, 1 H) 7 38 (d, J=7 07 Hz, 1 H) 7 44 (t, J=7 33 Hz, 2 H) 7 48 - 7 53 (m, 2 H) 7 94 - 8 02 (m, 2 H) Example 199 (Formula Removed) Preparation of N-[(1S)-2-amino-1 -phenylethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-vlV5-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (89 mg, 0 4 mmol) [prepared according to Example 198] for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (94 mg, 0 4 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 375 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 38-2 41 (m, 1H), 3 38 (d, J=1 52 Hz, 1 H) 3 49 (d, J=10 86 Hz, 1 H) 3 73 (br s , 3 H) δ 41 (d, J=3 54 Hz, 1 H) 7 30 - 7 50 (m, 5 H) 7 54 - 7 62 (m, 1 H) 7 81 (br s,1H) Example 200 (Formula Removed) Preparation of N-\( 1 S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-vlV5-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (168 mg, 0 5 mmol) [prepared according to Example 198] for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, N-bromosuccinimide (88 5 mg, 0 5 mmol) for N-chlorosuccmimide and 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (71 mg, 0 3 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 341 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 39 (d, J=4 04 Hz, 3 H) 3 42 (br s , 1 H) 3 55 (br s , 1 H) 3 75-3 78 (m, 3 H) δ 45 (m, 1 H) 7 37 (d, J=7 07 Hz, 1 H) 7 40 - 7 46 (m, 2 H) 7 49 (br s , 2 H) 7 59 -7 68 (m, 1 H) 7 80 - 7 88 (m, 1 H) Example 201 (Formula Removed) Preparation of N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-vl)-2-thiophenecarboxamide a) methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (2 56 g, 10 00 mmol)[prepared according to Example 95], 5-(5,5-dimethyl)-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (3 88 g, 20 0 mmol)[prepared according to Preparation 7], potassium carbonate (4 15 g, 30 0 mmol) and 1,1'-bis(diphenylphosphino)ferrocenedichloro palladium (II) dichloromethane complex (0 073 g, 0 1 mmol) in 1,4-Dioxane (12 mL) and water (3 00 mL) were heated at 80 °C in a sealed tube After 3 hrs, another batch of 5-(5,5-dimethyl)-1,3,2- dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 94 g, 10 0 mmol) and 1,1'-bis(diphenylphosphino)ferrocenedichloro palladium (II) dichloromethane complex (0 073 g, 0 1 mmol) were added After 2 hr, the mixture was concentrated and punfied by silica gel eluting with 0-35% ethyl acetate / hexane affording the title compound as a yellow solid (1 74 g, 3 35 mmol, 34%) LC-MS (ES) m/z 257 (M+H)+ b) 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (304 mg, 118 mmol) in 6N sodium hydroxide (2 ml, 12 mmol) and Tetrahydrofuran (10 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~3 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording the desired product (276 mg, 1 14 mmol, 96 % yield) as a yellow oil LC-MS (ES) m/e 244 (M+H)+ c) 1,1 -dimethylethyl [(2S)-2-({[5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2- thienyl]carbonyl}amino)-2-phenylethyl]carbamate (Formula Removed) To a solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (60 mg, 0 25 mmol), 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (58 mg, 0 25 mmol) [prepared according to the procedure of Preparation 1] and dnsopropylethylamine (0 12 ml, 0 75 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (190 mg, 0 41 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound (90 mg, 0 20 mmol, 79 % yield) as a colorless oil LC-MS (ES) m/e 461 (M+H)+ d) N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a solution of 1,1-dimethylethyl [(2S)-2-({[5-chloro-4-( 1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (90 mg, 0 20 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 5 mL, 2 mmol) After 15 h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (63 mg, 0 14 mmol, 74%) LC-MS (ES) m/z 361 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 41 (dd, J=13 01, 4 17 Hz, 1 H) 3 63 (d, J=10 86 Hz, 1 H) 4 08 (s, 3 H) δ 45 (dd, J=10 48, 4 17 Hz, 1 H) δ 87 (d, J=2 27 Hz, 1 H) 7 36 (d, J=7 33 Hz, 1 H) 7 42 (t, J=7 33 Hz, 2 H) 7 54 (d, J=7 07 Hz, 2 H) δ 14 (d, J=2 27 Hz, 1 H) δ 27 (s, 1 H) Example 202 (Formula Removed) Preparation of N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate (63 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyljcarbamate LC-MS (ES) m/z = 379 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 40 (dd, J=13 01, 4 42 Hz, 1 H) 3 66 (d, J=2 02 Hz, 1 H) 4 03 - 4 15 (m, 3 H) δ 46 (dd, J=10 36, 4 29 Hz, 1 H) δ 84 (d, J=2 53 Hz, 1H) 7 15 (t, J=8 72 Hz, 2 H) 7 60 (dd, J=8 59, 5 05 Hz, 2 H) δ 10 (d, J=2 53 Hz, 1 H) δ 29 (s, 1 H) Example 203 (Formula Removed) Preparation of N-[2-arrnno-1-(4-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(4-chlorophenyl)ethyl]carbamate (45 mg, 0 17 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyljcarbamate LC-MS (ES) m/z = 396 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 40 (d, J=4 55 Hz, 1 H) 3 58 (d, J=10 36 Hz, 1 H) 3 98 (s, 3 H) δ 41 (d, J=4 55 Hz, 1 H) 6 71 (s, 1 H) 7 43 (dt, J=4 74, 2 31 Hz, 2 H) 7 47 - 7 56 (m, 2 H) 7 92 (or s, 1 H)8 13(s, 1 H) Example 204 (Formula Removed) Preparation of N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(3-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate LC-MS (ES) m/z = 396 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 41 (dd, J=12 76, 4 93 Hz, 5 H) 3 36 - 3 47 (m, 3 H) 3 63 (s, 2 H) 3 59 (d, J=10 61 Hz, 6 H) 3 95 (s, 9 H) 4 02 (d, J=3 03 Hz, 15 H) δ 41 (dd, J=9 09, 3 79 Hz, 8 H) δ 67 (d, J=2 27 Hz, 3 H) 6 78 (br s , 4 H) 7 33 - 7 49 (m, 23 H) 7 56 (br s , 7 H) δ 06 (br s , 8 H) δ 16 (d, J=16 93 Hz, 6 H) Example 205 (Formula Removed) Preparation of N-[2-amino-1-(2-chlorophenyl]ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(2-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate LC-MS (ES) m/z = 396 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ ppm 3 39 (br s , 1 H) 3 56 (d, J=10 86 Hz, 1 H) 4 05 (d, J=3 03 Hz, 3 H) δ 87 (dd, J=10 74, 3 41 Hz, 1 H) 6 81 (br s , 1 H) 7 39 (br s , 2 H) 7 50 (d, J=6 57 Hz, 1 H) 7 70 (d, J=7 07 Hz, 1 H) δ 04 (br s , 1 H) δ 26 (br s , 1 H) Example 206 (Formula Removed) Preparation of Ay-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazel-5-yl)-2-thiophenecarboxamide a) 1,1-dimethylethyl [2-({[4-chloro-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-(4-fluorophenyl)ethyl]carbamate (Formula Removed) To a solution of 4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (67 mg, 0 24 mmol) [prepared according to Example 193], 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate (61 mg, 0 24 mmol) [prepared according to the procedure of Preparation 16], dnsopropylethyl amine (126 uL, 0 72 mmol) in DCM (5 mL) was added PyBrop (168 mg, 0 36 mmol) in one portion After 1 h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SC"4, concentrated and purified via column chromatography (silica, gradient 0- 50% ethyl acetate / hexane) affording the title compound (93 mg, 0 18 mmol, 76%) as a white solid LCMS (ES) m/z = 514 (M+H)+ b) N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide To a solution of 1,1-dimethylethyl [2-({[4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-(4-fluorophenyl)ethyl]carbamate (90 mg, 0 17 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 43 mL, 1 75 mmol) After 15h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (39 6 mg, 0 09 mmol, 52%) LC-MS (ES) m/z 414 (M+H)+, 1HNMR (400 MHz, MeOD) δ ppm 3 42 (d, J=2 78 Hz, 1 H) 3 56 (br s , 1 H) 3 79 (s, 3 H) δ 43 (dd, J=10 23, 4 67 Hz, 1 H) 7 11 - 7 22 (m, 2 H) 7 49 - 7 57 (m, 2 H) 7 60 (s, 1 H) 7 93 (br s , 1 H) Example 207 (Formula Removed) Preparation of N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (57 mg, 0 24 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 396 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 3 42 (br s , 1 H) 3 57 (d, J=11 12 Hz, 1H) 3 80 (s, 3 H) δ 44 (dd, J=10 36, 4 29 Hz, 1 H) 7 37 (d, J=2 53 Hz, 1 H) 7 40 - 7 47 (m, 2 H) 7 48 - 7 55 (m, 2 H) 7 60 (s, 1 H) 7 95 (br s , 1 H) Example 208 (Formula Removed) Preparation N-[(1S)-2-amino-1-phenylethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (Formula Removed) o a solution of methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 169 mmol)[prepared according to the procedure of Example 193] in THF (10 ml) was added N-bromosuccinimide (212 mg, 1 19 mmol) The mixture was sealed and heated at 70 °C After 2h, a solution of 6N NaOH (2 0 ml, 6 0 M, 11 84 mmol) was added in one portion The resulting mixture stirred for an additional 2h and was partitioned between DCM-H2O The pH of the aqueous phase was adjusted to ~3 and extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated affording the title compound as a colorless oil (105 mg, 28%) LC-MS (ES) m/z= 322 (M+H)+ b) 1,1 -dimethylethyl [(2S)-2-({[4-(4-bromo-1 -methyl-1 N-pyrazol-5-yl)-5-chloro-2- thienyl]carbonyl}amino)-2-phenylethyl]carbamate (Formula Removed) o a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (80 mg, 0 25 mmol), 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyljcarbamate (59 mg, 0 25 mmol) [prepared according to the procedure of Preparation 1], dnsopropylethyl amine (128 uL, 0 75 mmol) in DCM (5 mL) was added PyBrop (168 mg, 0 36 mmol) in one portion After 3h, the reaction contents were partitioned between H2O/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, gradient 0- 50% ethyl acetate / hexane) affording the title compound (110 mg, 0 18 mmol, 73%) as a white solid LCMS (ES) m/z = 540 (M+H)+ c) N-[(1S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro- 2-thiophenecarboxamide To a solution of 1,1-dimethylethyl [(2S)-2-({[4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (81 mg, 0 15 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 38 mL, 1 5 mmol) After 15h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (18 3 mg, 0 04 mmol, 26%) LC-MS (ES) m/z 440 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 40 (d, J=13 89 Hz, 1H) 3 60 (br s , 1 H) 3 80 (br s , 3 H) 5 38 - 5 50 (m, 1 H) 7 37 (d, J=7 33 Hz, 1 H) 7 43 (t, J=7 45 Hz, 2 H) 7 52 (d, J=7 58 Hz, 2 H) 7 61 (s, 1 H) δ 02 (br s , 1 H) Example 209 (Formula Removed) reparation N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [2-amino-2-(3-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 430 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 45 (d, J=5 56 Hz, 2 H) 3 72 - 3 81 (m, 3 H) δ 86 (dd, J=9 22, 4 42 Hz, 1H) 7 41 (d, J=2 02 Hz, 2 H) 7 48 - 7 55 (m, 1 H) 7 58 (br s , 2 H) 7 83 (s, 1 H) Example 210 (Formula Removed) reparation N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [2-amino-2-(3-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 430 (M+H)+, 1HNMR (400 MHz, MeOD) δ ppm 3 44 (d, J=3 54 Hz, 1 H) 3 55 (d, J=10 61 Hz, 1 H) 3 80 (s, 3 H) δ 42 (dd, J=10 36, 4 29 Hz, 1 H) 7 35 - 7 49 (m, 3 H) 7 55 (s, 1 H) 7 59 (s, 1 H) 7 95 (d, J=14 40 Hz, 1 H) Example 211 (Formula Removed) reparation N-(2-aminoethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl (2-aminoethyl)carbamate (58 mg, 0 36 mmol)for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 320 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 3 17 (d, J=5 81 Hz, 2 H) 3 66 (br s , 2 H) 3 78 (s, 3 H) 7 60 (s, 1 H) 7 66(s, 1H) Example 212 (Formula Removed) reparation rV-[2-amino-1-(4-chlorophenyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [2-amino-2-(4-chlorophenyl)ethyl]carbamate (65 mg, 0 24 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 431 (M+H)+, 1HNMR (400 MHz, MeOD) δ ppm 3 43 (d, J=4 55 Hz, 1 H) 3 53 (d, J=10 11 Hz, 1 H) 3 79 (s, 3 H) δ 43 (dd, J=10 36, 4 55 Hz, 1H) 7 43 - 7 47 (m, 2 H) 7 48 - 7 53 (m, 2 H) 7 60 (s, 1 H) 7 94(s,1 H) Example 213 (Formula Removed) reparation N-IY1 S)-2-amino-1 -(cyclohexvlmethyl)ethyl]-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thioprienecarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 99, except substituting 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (73 mg, 0 25 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z375 (M+H)+,1H NMR (400 MHz, MeOD) δ ppm 0 91- 0 99 (m, 1H), 1 01-1 10 (m , 1 H) 1 39-1 47 (m , 3 H) 1 37-1 48 (m, 2H) 1 65-1 77 (m, 5 H) 1 89 (br s, 1 H)2 10 (s, 3 H)2 45 (s, 3 H) 3 07 -3 16 (m, 2 H) 3 91 - 3 98 (m, 3 H) 4 42 (br s , 1 H) 7 91 (br s , 1 H) δ 24 (s, 1 H) Example 214 (Formula Removed) reparation N-[(1S)-2-amino-1-phenylethyl]-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide a)1,1-dimethylethyl[(2S)-2-({[4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (Formula Removed) o a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thtophenecarboxylic acid (110 mg, 0 4 mmol) [prepared in Experiment 99], 2-[(2S)-2-amino-4-methylpentyl]-1H-isoindole-1,3(2H)-dione (99 mg, 0 4mmol) [prepared according to the procedure of Preparation 1] and dnsopropylethylamine (0 2 ml, 1 2 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (280 mg, 0 6 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound (113 mg, 0 22 mmol, 56 % yield) as a colorless oil LC-MS (ES) m/e 506 (M+H)+ d) N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide To a solution of 1,1-dimethylethyl [(2S)-2-({[4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (99 mg, 0 22 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 5 mL, 2 mmol) After 15 h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as an off-white solid (40 mg, 0 11 mmol, 52%) LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 99 - 2 14 (m, 3 H) 2 43 (s, 3 H) 3 39 (d, J=9 85 Hz, 1 H)) 3 60 (d, J=9 85 Hz, 1 H) 3 92 (br s , 3 H) δ 44 (d, J=8 84 Hz, 1 H) 7 36 (d, J=2 53 Hz, 1 H) 7 43 (t, J=5 94 Hz, 2 H) 7 49 - 7 57 (m, 2 H) δ 03 (br s , 1 H) δ 14 (br s , 1H) Example 215 (Formula Removed) reparation N-[(1S)-2-amino-1 -methylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamicle The title compound was prepared as an off-white solid according to the procedure of Example 106, except substituting 2-[(2S)-2-aminopropyl]-1H-isoindole-1,3(2H)-dione (74 mg, 0 36 mmol)for2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 333 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 1 37 (d, J=6 82 Hz, 3 H) 3 11 - 3 14 (m, 2 H) 3 79 (s, 3 H) 4 38 - 4 40 (m, 1 H) 7 60 (br s , 1 H) 7 83 (d, J=2 27 Hz, 1 H) Example 216 (Formula Removed) reparation N-{(1S)-2-amino-1-f3-(trifluoromethyl)phenyl]ethyl)--4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 100, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (348 mg, 1 0 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 471 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 24 (t, J=7 33 Hz, 3 H) 2 54 (d, J=8 84 Hz, 2 H) 2 74 (q, J=7 24 Hz, 2 H) 3 05 - 3 16 (m, 1 H) 3 26 (d, J=4 80 Hz, 1 H) 3 66 - 3 79 (m, 3 H) 4 54 (br s , 1 H) 7 47 - 7 56 (m, 2 H) 7 57 - 7 76 (m, 4 H) Example 217 (Formula Removed) reparation N-[(1S)--1-(aminomethyl)-3-methylbutyll-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)--2-thiophenecarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 106, except substituting 2-[(2S)-2-amino-4-methylpentyl]-1H-isoindole-1,3(2H)-dione (99 mg, 0 4 mmol) for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 376 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 0 99 (t, J=6 44 Hz, 6 H) 1 42 (s, 1 H) 1 63 -1 80 (m, 2 H) 3 04 (br s , 1 H) 3 14 (d, J=3 54 Hz, 1 H) 3 80 (s, 3 H) 4 42 (br s , 1 H) 7 59 (s, 1 H) 7 84 (d, J=6 06 Hz, 1 H) Experiment 218 (Formula Removed) reparation N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide a) methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (Formula Removed) o a solution of methyl 5-ethyl-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (600 mg, 2 40 mmol) [prepared according to Example 98] in Tetrahydrofuran (THF) (10 ml) was added N-bromosuccinimide (512 mg, 2 88 mmol) The mixture stirred in a sealed tube at 70 °C for 2h The reaction mixture was then concentrated and purified with silica gel using a 0-5% gradient (ethyl acetate / hexane) to afford the title compound as an off-white solid LC-MS (ES) m/z 330 (M+H)+ b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (Formula Removed) solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (635 mg, 1 93 mmol), potassium carbonate (1 33 g, 9 64 mmol), PdCI2(dppf) (141 mg, 0 19 mmol) and tnmethylboroxine (0 54 ml, 3 86 mmol) in N.N-dimethylformamide (3 ml) was stirred at 110 °C in a sealed tube for 2h This reaction mixture was concentrated and partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording the title compound (488 mg, 96%) as a yellow oil LCMS (ES) m/e 265 (M+H)+ c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (Formula Removed) solution of methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (488 mg, 1 85 mmol) in 6N sodium hydroxide (3 08 ml, 18 5 mmol) and Tetrahydrofuran (10 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH -4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording the title compound as a yellow foam (448 mg, 1 79 mmol, 96 % yield) as a yellow oil LCMS (ES) m/e 251 (M+H)+ d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2- yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-ethyl-2-thiophenecarboxamide (Formula Removed) o a solution of 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (250 mg, 1 0 mmol), 2-{(2S)-2-amino-3-[4-(fluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (313 mg, 1 05 mmol)[prepared according to the procedure of Preparation 6] and dusopropylethylamine (0 52 ml, 3 mmol) in DCM at 25 °C was added bromo-tris-pyrrohdino-phosphonium hexafluorophosphate (746 mg, 1 6 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over NaaSCU, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound as a yellow solid (490 mg, 0 92 mmol, 92 % yield) as a yellow foam LCMS (ES) m/e 531 (M+H)+ e) N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-ethyl-2-thiophenecarboxamide (400 mg, 0 75 mmol) in methanol (8 ml) at 25 °C was added hydrazine (0 12 ml, 3 77 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as a yellow solid LC-MS (ES) m/z 401 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 28 (t, J=7 58 Hz, 3 H) 2 07 (s, 3 H) 2 75 (m, 2 H) 3 02 (d, J=6 32 Hz, 2 H) 3 22 (br s , 2 H) 3 92 (d, J=2 27 Hz, 3 H) 4 53 (br s , 1 H) 7 02 (t, J=8 59 Hz, 2 H) 7 34 (m, 2H), 7 80 (s, 1 H) δ 13 - 8 25 (m, 1 H) Example 219 (Formula Removed) reparation N-[(1S)-2-amino-1-[(3.4-difluorophenyl)methyi1ethyl)--5-methyl-4-(1-methy[-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 103, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 391 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 44 (s, 3 H) 2 91 - 3 02 (m, 2 H) 3 16 (d, J=10 11 Hz, 1 H) 3 24 (dd, J=13 14, 3 54 Hz, 1H) 3 82 (s, 3 H) 4 50 (d, J=3 54 Hz, 1 H) δ 44 (d, J=2 02 Hz, 1H) 7 05 - 7 13 (m, 1 H)7 15-7 25 (m, 2H), 7 67-7 70 (m, 2 H) Example 220 (Formula Removed) reparation N-{(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 102, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 425 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 40 (s, 3 H) 2 95 - 3 03 (m, 2 H) 3 23 - 3 26 (m, 2 H) 3 76 (br, s, 3H) 4 96 - 4 52 (m, 1H), 7 07-7 15 (m, 2H) 7 22 -7 28 (m, 1H)7 55-7 77(m, 2H) Example 221 (Formula Removed) reparation N-\|(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 104, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isomdole-1,3(2H)-dione LC-MS (ES)m/z411 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 02 (d, J=7 33 Hz, 2 H) 3 24 (d, J=6 82 Hz, 2 H) 4 01 (d, J=7 58 Hz, 3 H) 4 52 (d, J=7 07 Hz, 1 H) δ 78 (d, J=11 87 Hz, 1 H) 7 08 -7 21 (m, 1 H) 7 26 - 7 28 (m, 1 H) 7 94 - 8 08 (m, 2 H) Example 222 (Formula Removed) reparation N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 106, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 446 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 95 - 3 05 (m, 2 H) 3 22 - 3 23 (m, 2 H) 3 79 (s, 3 H) 4 52 (br s , 1 H) 7 08 - 7 21 (m, 2 H) 7 27 - 7 26 (m, 2 H) 7 60 (s, 1 H) 7 83 (br s,1H) Example 223 (Formula Removed) reparation N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 99, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [prepared according to Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 405 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 2 09 (s, 15 H) 2 42 (s, 3 H) 3 04 (d, J=7 07 Hz, 2 H) 3 27 (d, J=4 80 Hz, 2 H) 3 88 - 4 01 (m, 3H) 4 54 (br s , 1 H) 7 08 - 7 21 (m, 2 H) 7 29 (d, J=7 58 Hz, 1 H) 7 92 (br s , 1H) δ 15 - 8 26 (m, 1 H) Example 224 (Formula Removed) reparation N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide a) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) solution of methyl 4-bromo-2-furancarboxylate (470 mg, 2 29 mmol), potassium carbonate (1584 mg, 11 46 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (525 mg, 2 52 mmol)[prepared according to Preparation 7] and bis-(tn-t-butylphosphine)Palladium (0) (58 6 mg, 0 12 mmol) in 1,4-dioxane (9 55 ml) and water (1 9 ml) was stirred at 80 °C After 1 hr, the solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (30% EtOAc in hexanes) affording the title compound (124 mg, 0 60 mmol, 26 % yield) as a white powder LCMS (ES) m/e 206 (M+H)+ b) methyl 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) solution of methyl 4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (412 mg, 2 0 mmol) and N-chlorosuccinimide (267 mg, 2 0 mmol) in DMF (10 mL) was heated at 75 °C for 30 minutes Another batch of N-chlorosuccinimide (267 mg, 2 0 mmol) was added After 1 hr, the mixture was concentrated and purified using silica gel and elutmg with 0-55% ethyl acetate / hexane to afford the title compound as a white solid (225 mg, 0 82 mmol, 71 % yield) LCMS (ES) m/e 276 (M+H)+ c) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid (Formula Removed) solution of methyl 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (224 mg, 0 82 mmol) in 6N sodium hydroxide (1 36 ml, 8 2 mmol) and tetrahydrofuran (5 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording the title compound (201 mg, 0 77 mmol, 94 % yield) as a yellow oil LCMS (ES) m/e 262 (M+H)+ d)5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S>-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-furancarboxamide (Formula Removed) o a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (200 mg, 0 77 mmol)[prepared according to the procedure of Preparation 6], 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione (254 mg, 0 80 mmol) and N,N-diisopropylethylamine (0 40 ml, 2 30 mmol) in DCM (10 ml) was added bromo-tris-pyrrohdino-phosphonium hexafluorophosphate (536 mg, 115 mmol) After stirring at ambient temperature for 20 hrs, the mixture was concentrated and purified with silica gel column elutmg with gradient (0-50% ethyl acetate/hexanes) to afford the title compounds as an off-white foamy solid (304 mg, 0 54 mmol, 71% yield) LCMS (ES) m/e 560(M+H)+ e) /S/-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-furancarboxamide (304 mg, 0 54 mmol) in methanol (5 ml) at 25 °C was added hydrazine (0 08 ml, 2 7 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as a yellow solid LC-MS (ES) m/z 430(M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 91 - 3 05 (m, 2 H) 3 17 - 3 28 (m, 2 H) 3 81 (s, 3 H) 4 57 (d, J=9 60 Hz, 1 H) 7 12 (br s , 1 H) 7 18-7 28 (m , 2 H) 7 36-7 39 (m, 1 H) 7 58 (s, 1 H) Example 225 (Formula Removed) reparation N-[(1S)-2-amino-1-[(3,4-difluoroDhenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 127, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (147 mg, 0 46 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z395 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 90 - 3 06 (m, 2 H) 3 18-3 24 (m, 2 H) 3 98 (d, J=17 68 Hz, 3 H) 4 52 - 4 64 (m, 1 H) δ 67 (d, J=1 77 Hz, 1 H) 7 19 (dd, J=10 11, 8 59 Hz, 2 H) 7 26 (td, J=9 73, 2 27 Hz, 1 H) 7 51 (d, J=19 96 Hz, 1 H) 7 93 (br s , 1 H) Example 226 (Formula Removed) reparation A/4(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide a) methyl 4-bromo-5-methyl-2-furancarboxylate (Formula Removed) ethyl 4,5-dibromo-2-furancarboxylate (3 7 g, 13 03 mmol) [prepared according to Example 127] and trans-dichlorobis(priphenylphosphine)Palladium (II) (0 46 g, 0 65 mmol) were combined in THF (50ml) to give a yellow suspension A THF solution of methylzinc chlonde (11 40 ml, 22 81 mmol) was added dropwise at room temperature After stirring at ambient temperature for 20h, the solution was concentrated and punfied using silica gel and eluting with 0-30% ethyl acetate / hexane to generate the title compound as a white solid (1 45 g, 6 61 mmol, 51% yield) LC-MS (ES) m/z 220 (M+H)+ b) 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (Formula Removed) o a solution of methyl 4-bromo-5-methyl-2-furancarboxylate (500 mg, 2 28 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (950 mg, 4 57 mmol)[prepared according to Preparation 7] and potassium carbonate (315 mg, 2 28 mmol) in 1,4-dioxane (8 mL) and water (2 0 mL) was added bis(tn-t-butylphosphine)Palladium (0) (117 mg, 0 23 mmol) The mixture was heated to 80 °C and after 15h the reaction mixture was concentrated The residue was partitioned between DCM and water The organic layer was concentrated and dissolved in tetrahydrofuran (THF) (8 0 mL) The solution was treated with 6N aqueous solution of sodium hydroxide (3 80 mL, 22 83 mmol) and heated to 75 °C After 15h, the reaction mixture was concentrated and partitioned between DCM and water The aqueous layer was acidified to pH ~ 3 with 2N HCI aqueous solution and extracted several times with DCM The organic fractions were combined and concentrated to afford the title compound as a yellow solid (401 mg, 1 95 mmol, 85% yield) LC-MS (ES) m/z 207 (M+H)+ c)N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) o a solution of 5-methyl-4-( 1 -methyl- 1H-pyrazol-5-yl)-2-furancarboxylic acid (200 mg, 0 97 mmol), 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (322 mg, 1 02 mmol)[prepared according to the procedure of Preparation 6] and N,N-dnsopropylethylamine (0 51 ml, 2 91 mmol) in DCM (10 ml) was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (678 mg, 1 46 mmol) After stirring at ambient temperature for 20h, the mixture was concentrated and purified using silica gel and eluting with a 0-50% ethyl acetate/hexane gradient to afford the title compound as an off-white foamy solid (181 mg, 0 36 mmol, 37% yield) LCMS (ES) m/e 505 (M+H)+ e)N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide To a solution of N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (176 mg, 0 35 mmol) in methanol (5 ml) at 25 °C was added hydrazine (0 22 ml, 0 7 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1 % NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as an off-white solid LC-MS (ES) m/z 430(M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 91 - 3 05 (m, 2 H) 3 17 - 3 28 (m, 2 H) 3 81 (s, 3 H) 4 57 (d, J=9 60 Hz, 1 H) 7 12 (br s , 1 H) 7 18-7 28 (m , 2 H) 7 36-7 39 (m, 1 H) 7 58 (s, 1 H) Example 227 (Formula Removed) reparation N-K1S)-2-amino-1-[(3.4-drfluorophenyl]methyl]ethylM-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (Formula Removed) o a solution of 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid (150 mg, 0 73 mmol)[prepared in Example 126] in THF (10 ml) was added N-chlorosuccinimide (97 mg, 0 73 mmol) After stirring at 70 °C for 20h in a sealed tube, the mixture was partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4 and concentrated affording the title compound as an off-white foamy solid (152 mg, 0 63 mmol, 87% yield) LC-MS (ES) m/z 241 (M+H)+ b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3- dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-furancarboxamide (Formula Removed) o a solution of 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (150 mg, 0 62 mmol), 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (207 mg, 0 65 mmol)[prepared according to the procedure of Preparation 6] and N,N-dnsopropylethyl amine (0 33 ml, 1 87 mmol) in DCM (10 ml) was added bromo-tris-pyrrohdino-phosphonium hexafluorophosphate (436 mg, 0 94 mmol) After stirring at ambient temperature for 20h, the mixture was concentrated and punfied using silica gel and eluting with a gradient of 0-50% ethyl acetate/hexane to afford the title compound as an off-white foam (200 mg, 0 35 mmol, 57% yield) LC-MS (ES) m/z 539 (M+H)+ c) AK(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-{(1S}-2-(3,4-dlfluorophenyl)-1-[(1,3-dlOxo-1,3-dlhydro-2H-lsolndol-2-yl)methyl]eth^^ furancarboxamide (210 mg, 0 39 mmol) in methanol (5 ml) at 25 °C was added hydrazine (0 02 ml, 0 78 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as an off-white solid LC-MS (ES) m/z 409(M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 38 (s, 3 H) 2 98 (d, J=9 35 Hz, 1 H) 3 01 (d, J=5 56 Hz, 1 H) 3 23 (dd, J=13 01, 8 97 Hz, 2 H) 3 73 - 3 83 (m, 3 H) 4 56 (d, J=9 35 Hz, 1H) 7 17 (s, 1 H) 7 18 - 7 32 (m, 3 H) 7 57 (s, 1 H) Example 228 (Formula Removed) reparation of N-[(1S)-2-amino-1-[(3,4-difluorophenv0methyl]ethyl}-5-chloro-4-(1.4-dimethyl-1H-pyrazol-5-vn-2-furancarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 118, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (253 mg, 0 8 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H>-dione LC-MS (ES) m/z 409 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 05 - 2 15 (m, 3H) 2 91 - 3 07 (m, 2 H) 3 16 - 3 26 m , 2 H) 3 91 (br s , 3 H) 4 57 - 4 59 (m , 1 H) 7 09 - 7 31 (m, 3 H) 7 51 (br s , 1 H) δ 07 (br s , 1 H) Example 229 (Formula Removed) reparation of N-{(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl}-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide The title compound was prepared as a yellow solid according to the procedure of Example 119, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (302 mg, 0 95 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 389 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 04 - 2 15 (m, 3 H) 2 35 - 2 47 (m, 3 H) 2 99 - 3 02 (m„ 2 H) 3 18 - 3 24 (m, 2 H) 3 86 - 3 96 (m, 3 H) 4 56 - 4 62 (m, 1H) 7 16-7 26 (m, 4H)8 07(s, 1 H) Example 230 N-inS)-2-amino-1-[(3-f1uorophenyl)methyl]ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-ylV2-thiophenecarboxamide (Formula Removed) ) 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) o a solution of 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (220 mg, 0 857 mmol) [from Example 92] in DCM (5 mL) at 25 °C was added PyBrOP (440 mg, 0 857 mmol) in one portion, followed by addition of DIPEA (1 5 mL, 8 59 mmol) After 10 mm, diamine 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (256 mg, 0 857 mmol) was added to above solution After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (0 39 g, 81%) as a white solid LC-MS (ES) m/z = 537 (M+H)+ b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) t RT, NH2NH2 (0 11 mL, 3 54 mmol) was added to 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (380 mg, 0 708 mmol) in MeOH (4 mL) After 10h, the solvent was removed under vaccum to give a residue, which was dissolved in DCM (15 mL), and washed with H20 (10 mL x 3) To the above DCM solution was added aqueous HCI (12 N, 2 95 mL, 35 4 mmol) After 1h, the aqueous phase was separated, and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (160 mg, 47%) as a white solid LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 9 18-8 8(m, 1H), 8 28-8 08 (m, 4H), 8 04 (s, 1H), 7 27-7 43 (m, 1), 7 08-7 24 (m, 2H), 6 91-7 08 (m, 1H), 4 4-4 34 (m, 1H), 4 14 (q, J = 7 3 Hz, 2H), 3 15-2 80 (m, 4H), and 1 29 (t, J = 7 3 Hz, 3H) Example 231 N-(nS)-2-amino-1-ff3-(trifluoromethyl]phenyl]methyl)ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) he title compound was prepared as an off-white solid according to the procedure of Example 230, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (339 mg, 0 97 mmol)for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 457 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 92 (br s, 1H), 7 89-7 80 (m, 1H), 7 63-7 59 (m, 3H), 7 56-7 48 (m, 2H), 4 61-4 53 (m, 1H), 4 21-4 15 (m, 2H), 3 46-3 21 (m, 2H), 3 18-3 02 (m, 2H), and 1 35 (t, J = 7 3 Hz, 3H) Example 232 rV-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-vl)-2-thiophenecarboxamide (Formula Removed) he title compound was prepared as an off-white solid according to the procedure of Example 230, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (584 mg, 1 95 mmol) for 2-[(2S)-2- amino-3-(3-fluoropheny:)oropyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 93 (d, J = 1 3 Hz, 1H), 7 85 (d, J = 1 3 Hz, 1H), 7 59 (s, 1H), 7 34-7 31 (m, 2H), 7 05-7 01 (m, 2H), 4 52 (m, 1H), 4 19 (q, J = 7 3 Hz, 2H), 3 26-3 12 (m, 2H), 3 05-2 94 (m, 2H), and 1 36 (t, J = 7 3 Hz, 3H) Example 233 A/4(1S>-2-amino-1-[(3.4-difluorophenyl]fnethyl]ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) he title compound was prepared as an off-white solid according to the procedure of Example 230, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isomdole-1,3(2tf)-dione (200m g, 0 63 mmol) for 2-[(2S>-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 425(M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 8 88 (d, J = 8 3 Hz, 1H), 8 16-8 06 (m, 4H), 7 71 (s, 1H), 7 39-7 30 (m, 2H), 7 12 (m, 1H), 4 35 (m, 1H), 4 14 (q, J = 7 1 Hz, 2H), 3 08-2 87 (m, 4H), and 1 29 (t, J = 7 1 Hz, 3H) Example 234 N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-(4-bromo-1-ethyl-1H-pyrazol-5-vlV2-thiophenecarboxamide (Formula Removed) 4-(4-bromo-1 -ethyl-1 W-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) he title compound was prepared as an off-white solid according to the procedure of Example 93, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2W)-dione (149 mg, 0 50 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 582 (M+H)+ b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-ethyl-1H-pyrazol- 5-yl)-2-thiophenecarboxamide (Formula Removed) he title compound was prepared as an off-white solid according to the procedure of Example 230(b), except substituting A/~{(1S)-2-amino-1-[{3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (240 mg, 0 41 mmol) for 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide LC-MS (ES) m/z = 452(M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 9 24-8 85 (m, 1H), 8 26-8 13 (m, 4H), 8 03 (s, 1H), 7 03 (s, 1H), 7 34 -7 29 (m, 1H), 7 16-7 13 (m, 2H), 7 05-7 00 (m, 1H), 4 39 (m, 1H), 4 14 (q, J = 7 3 Hz, 2H), 3 06-2 96 (m, 4H), and 1 28 (t, J = 7 3 Hz, 3H) Example 235 N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) Methyl 5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) o a solution of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (300 mg, 1 17 mmol) in THF (2 mL) was added Na2CO3 (2M, 1 76 mL, 3 52 mmol), Pd(dppf)CI2 (86, 0 117 mmol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (313 mg, 1 41 mmol) The reaction mixture was heated to 80 °C in a sealed tube under N2 After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-50%) to afford the title compound (0 272 g, 82%) as a light yellow syrup LC-MS (ES) m/z = 271 (M+H)+ b) Methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) ethyl 5-chloro-4-[(1Z)-1-(1-ethyl-2-methylidenehydrazino)-1-propen-1-yl]-2-thiophenecarboxylate (260 mg, 0 96 mmol) and 1-chloro-2,5-pyrrolidmedione (154 mg, 1 15 mmol) in THF (4 mL) were heated at 70 °C under N2 for 2 h, concentrated and punfied on silica (EtOAc/Hex, 10-30%) to afford the title compound (0 281g, 83%) as a syrup LC-MS (ES) m/z = 305 (M+H)+ c)5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) a solution of methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (260 mg, 0 85 mmol) in THF/H2O (4 mL/1 mL) was added KOH (478 mg, 8 52 mmol) The reaction mixture was heated to 50° C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly without further purification d) 5-chloro-4-(4-chloro-1-ethyl-1 tf-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2- thiophenecarboxamide (Formula Removed) o a solution of 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (~0 85 mmol) in DCM (5 mL) at 25 °C was added bromo-tns-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (477 mg, 1 02 mmol) in one portion, followed by the addition of DIPEA (0 744 mL, 4 26 mmol) After stirring for 10 mm, diamine 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1 3(2H)-dione (356 mg, 1 02 mmol) was added to the above solution After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (0 416 g, 79%) as a white solid LC-MS (ES) m/z = 621 (M+H)+ e)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) -Chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (410 mg, 0 66 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (1 04mL, 33 mmol) The reaction was stirred over 5h at RT, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 95 -5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water and neutralized by aminonium hydroxide The mixture was extracted with DCM (5 mL x 3), dned over Na2SO4 and concentrated to give a free base of the title compound, which was dissolved in MeOH (2 mL), and treated with HCI (4 M in dioxane, 1 6 mL) After stirring overnight, the reaction solution was concentrated to give the title compound (160 mg, 42 %) as a di-HCI salt LC-MS m/z = 491 (M+H)+,1H NMR (d6-DMSO, 400 MHz) δ ppm 9 34 (J = 8 8 Hz, 1H), 8 38-8 03 (m, 3H), 7 77 (s, 1H), 7 69-7 59 (m, 2H), 7 53 (dd, J = 7 3, 7 3 Hz, 1H), 7 42(dd, J = 7 6, 7 6 Hz, 1H), 4 48 (m, 1H), 4 13-4 00 (m, 2H), 3 17-2 90 (m, 4H), and 1 29 (m, 3H) Example 236 N-((1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) ) 5-chloro4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro- 2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyljethyl}-2-thiophenecarboxamide (Formula Removed) o a solution of 5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (180 mg, 0 618 mmol) [from Example 235(c)] in DCM (5 mL) at 25 °C was added PyBrOP in one portion, followed by addition of DIPEA (0 54 mL, 3 09 mmol) After stirring for 10 mm, 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (203 mg, 0 68 mmol) was added to above solution in one portion After stirring for 2h, the solution was concentrated and punfied via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (285 mg, 77%) as a white solid LC-MS (ES) m/z = 571 (M+H)+ b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -ethyl-1 H- pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) At RT, NH2NH2(0 15 ml, 4 78 mmol) was added to 5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (280 mg, 0 49 mmol) in MeOH (5 mL) After 10h the solvent was removed under vaccum The resulting residue was dissolved in DCM (15 mL), and washed with H20 (10 mL x 3) To the DCM solution was added HCI (12 N, 1 0 mL) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the tilte compound (179 mg, 67 5%) as an off-white solid LC-MS (ES) m/z = 441 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 72-7 67 (m, 1H), 7 62 (s, 1H), 7 35-7 29 (m, 1H), 7 14-7 17 (m, 2H), 7 00-6 96 (m, 1H), 4 53 (m, 1H), 4 14-3 97 (m, 2H), 3 37-3 15 (m, 2H), 3 07-2 97 (m, 2H), and 1 33 (t, J = 7 1 Hz, 3H) Example 237 /N/-K1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-Dvrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound (190 mg, 70%) was prepared as an off-white solid according to the procedure of Example 236, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2f/)-dione (231 mg, 0 77 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 441(M+H)\ 1H NMR (d4-MeOD, 400 MHz, no calibration of chemical shift of MeOD solvent peak) δ ppm 6 09 (s, 1H), 6 08 (s, 1H), 5 78-5 75 (m, 2H), 5 53-5 48 (m, 2H), 2 96 (m, 1H), 2 51 (m, 2H), 1 71-1 67 (m, 1H), 1 62-1 54 (m, 1H), 1 49-1 38 (m, 2H), and -0 21 (t, J = 7 3 Hz, 3H) Example 238 N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound (228 mg, 58 2%) was prepared as an off-white solid according to the procedure of Example 236, excepv substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (156 mg, 0 45 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 491(M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 66-7 49 (m, 6H), 4 60-4 47 (m, 1H), 4 09-4 01 (m, 2H), 3 36-3 18 (m, 2H), 3 16-3 01 (m, 2H), and 1 33 (t, J = 7 1 Hz, 3H) Example 239 N-((1S)-2-amino-1 -f[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1 -methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide (Formula Removed) a) methyl 4-bromo-5-iodo-2-thiophenecarboxylate (Formula Removed) At -78 °C, nBuLi (2 05 mL, 5 13 mmol) was added to a solution of methyl 4,5-dibromo-2-thiophenecarboxylate (1 4 g, 4 67 mmol) in THF (10 mL) After the mixture was stirred for 30 mm, l2 (1 185 g, 4 67 mmol) was added in 3 mL THF After the resulting solution was stirred at -78 °C for 1 h, it was quenched with Na2S203 at -78 °C, and warmed to RT The reaction mixture was extracted with DCM, dried over Na2SO4, and concentrated The crude product was purified on silica (EtOAc/Hex, 0-10%) to give the title compound (1 3 g, 56 %) as a yellow solid LC-MS (ES) m/z 348(M+H)+ b) methyl 4-bromo-5-(trifluoromethyl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-5-iodo-2-thiophenecarboxylate (500 mg, 1 44 mmol), copper (I) iodide (137 mg, 0 72 mmol) and potassium fluoride (251 mg, 4 32 mmol) in DMF/HMPA (5 ml/5 mL) was added methyl difluoro(fluorosulfonyl)acetate (1 1g, 5 76 mmol) The mixture was heated at 70 °C under N2 in a sealed tube After 1h, the reaction was quenched with NH4CI (sat'd) (2 mL), extracted with ether (5 mL x 5) and washed with distilled water (5 mL x 5) The combined organic phase was dried over Mg2SO4 and purified on silica (EtOAc/Hex, 20-50%) to afford the title compound (0 82 g) containing a 60% inseparable impurity LC-MS m/z (ES) 290 (M+H)+ c) methyl 4-(1 -methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylate (Formula Removed) A mixture of methyl 4-bromo-5-(trifluoromethyl)-2-thiophenecarboxylate (0 8 g, 40% purity, 1 11 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (0 299 g, 1 434 mmol), tetrakis (0 128 g, 0 11 mmol) and K2CO3 (0 459 g, 3 32 mmol) in dioxane/H20 (5 mL/1 mL) was heated to 70° C in a sealed tube After 12h, the reaction mixture was concentrated under vacuum and punfied on silica (EtOAc/Hex, 40-60%) to afford the title compound (0 25 g, 70%) as a light yellow solid LC-MS (ES) m/z 291 (M+H)+ d)4-(1-methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylate (250 mg, 0 77 mmol), in THF/H20 (3 mL/0 3 mL), was added KOH (217 mg, 3 88 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were concentrated under vacuum to give crude acid (235 mg, 80% pure) which was used directly in the next step without further purification LC-MS (ES) 277 (M+H)+ e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-( 1 -methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide (Formula Removed) At room temperature, a mixture of 4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylic acid (235 mg, 80% punty, 0 68 mmol), phosphoniumhexafluorophosphate (PyBrOP) (381 mg, 0 19 mmol), DIPEA (0 59 mL, 3 4 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyi]propyl}-1H-isoindole-1,3(2H)-dione (261 mg, 0 75 mmol) in DCM (5 mL) was stirred for 2h The reaction solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (386 mg, 86%) as a white solid LC-MS (ES) 607 (M+H)+ f)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide (Formula Removed) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2/y-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide (150 mg, 0 25 mmol) was dissolved in MeOH (5 mL) and was treated with NH2NH2 (0 76 mL, 24 2 mmol) The reaction was stirred over 5 h, concentrated and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 95 -5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water, and aminonium hydroxide (0 32 mL, 30% wt%, 2 46 mmol) was added The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4 and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH (2 mL), and treated with HCI (4 M in dioxane, 0 62 mL, 2 48 mmol) After stirnng overnight, the reaction solution was concentrated to give the title compound (90 mg, 66%) as a white solid LC-MS (ES) m/z 477 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 8 00 (d, J = 1 1 Hz, 1H), 7 77 (d, J = 1 8 Hz, 1H), 7 72 (d, J = 7 8 Hz, 1H), 7 59-7 52 (m, 2H), 7 44 (d, J = 7 4 Hz, 1H), 6 57 (d, J = 2 0 Hz, 1H), 4 67 (m, 1H), 3 87 (s, 3H), and 3 37-3 14 (m, 4H) Example 240 N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (Formula Removed) To a suspension of NaH (4 3 g, 60%, 108 mmol) in THF (200 mL) at RT was added 4-methyl-1 H-pyrazole (6 8 g, 83 mmol) dropwise After 30 mm, Etl (8 03 mL, 99 mmol) was added dropwise After the reaction was complete (2h), the reaction solution was diluted with saturated aqueous NH4CI and extracted with ether The ether fractions, were washed with water (3 x 100 mL), and dried over MgSO4 At 0°C, to the above ether solution of 4-methyl pyrazole was added n-BuLi (36 4 mL, 2 5 M in Hexane, 91 mmol) dropwise The reaction solution was stirred for 1 hour at RT and then cooled to -78 °C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (18 49 g, 99 mmol) After 15 mm at -78°C, the reaction was allowed to warm to 0°C over 1hour The reaction was diluted with saturated NH4CI solution and extracted with DCM The organics were dried over Na2SO4 and concentrated under vacuum to afford 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (16 g, 80% purity) as a syrup which was used without further purification LC-MS (ES) m/z 155 (M+H)+ for [RB(OH)2] b) methyl 4-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A mixture of methyl 4-bromo-2-thiophenecarboxylate (300 mg, 1 36 mmol), 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (449 mg, 1 9 mmol), Pd(Ph3P)4 (157mg, 0 136 mmol), and K2CO3 (536 mg, 4 07 mmol) was heated at 70 °C for 2h, concentrated and purified on silica (EtOAc/Hex, 10-30%) to afford the title compound (0 27 g, 79%) as a syrup LC-MS m/z = 251 (M+H)+ c) 4-(1-ethyl-4-methyl-1 H-pyrazoI-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of methyl 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (270 mg, 1 08 mmol) in THF/H20 (2 mL/0 4 mL) was added KOH (303 mg, 1 79 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid (240 mg), which was used directly in the next step without further purification LC-MS m/z = 237 (M+H)+ d)N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a mixture of 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (240 mg, 1 02 mmol) and bromo-tris-pyrrohdino phosphoniumhexafluorophosphate (Pybrop) (568 mg, 1 22 mmol) was added DIPEA (1 77 ml, 10 16 mmol) After 10 mm, 2-{(2S,4Z)-2-amino-4-[(1E)-1-(trifluoromethyl)-1-propen-1-yl]-4,6-heptadien-1-yl}-1H-isoindole-1,3(2H)-dione (425 mg, 1 22 mmol) was added After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (365 mg, 63%) as a white solid LC-MS (ES) m/z 567 (M+H)+ e)N-((1S)-2-amin(>H[2Hi:t.fluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl}-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazo!-5-yl)-2-thiophenecarboxamide (365 mg, 0 64 mmol) was dissolved in MeOH (8 mL) and was treated with NH2NH2 (0 1 mL, 3 22 mmol) The reaction was stirred over 5 h, concentrated and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water, and aminonium hydroxide (4 18 mL, 30% wt%, 32 2 mmol) was added The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4 and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH (2 mL) and treated with HCI (4 M in dioxane, 3 22 mL, 12 88 mml) After stirring overnight, the reaction solution was concentrated to give the title compound (190 mg, 56 7%) as a white solid LC-MS (ES) m/z 437 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 8 96 (m, 1H), 8 17-8 04 (m, 4H), 7 87 (s, 1H), 7 69 (d, J = 7 6 Hz, 1H), 7 62 (m, 1H), 7 53 (dd, J = 7 3, 7 3 Hz, 1H), 7 42 (d, J = 7 6 Hz, 1H), 7 38 (s, 1H), 4 50 (m, 1H), 4 09 (q, J = 7 3 Hz, 2H), 3 18-2 98 (m, 4H), 2 00 (s, 3H), and 1 27 (t, J = 7 3 Hz, 3H) Example 241 (N-{(1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-vl)-2-thiophenecarboxamide (Formula Removed) a) N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3- fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (125 mg, 0 53 mmol) [from Example 240(c)] in DCM (5 mL) at 25 °C was added bromo-tris-pyrrohdino phosphoniumhexafluorophosphate(PyBrOP) in one portion (350 mg, 0 75 mmol), followed by addition of DIPEA (0 7 ml, 4 0 mmol) After 10 mm, 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (180 mg, 0 60 mmol) was added to above solution After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (258 mg, 94%) as a white solid LC-MS(ES)m/z 517(M+H)+ b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1 H-pyrazol- 5-yl)-2-thiophenecarboxamide (Formula Removed) At RT, NH2NH2 (0 1 mL, 3 19 mmol) was added to N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (252 mg, 0 49 mmol) in MeOH (5 ml) After 10h, the solvent was removed under vacuum The resulting residue was dissolved in DCM (10 mL) and washed with H2O (10 mL x 3) To the above DCM solution was added HCI (36%, 2 mL) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (170 mg, 72%) as an off-white solid LC-MS(ES) m/z 387 (M+H)+ NMR (de-DMSO, 400 MHz) S ppm 8 87 (d, J = 8 9 Hz, 1H), 8 08 (br s, 2H), 8 01 (s, 1H), 7 08 (s, 1H), 7 37 (s, 1H), 7 35- 7 29 (m, 1H), 7 16-7 10 (m, 2H), 7 05-7 00 (m, 1H), 4 38 (m, 1H), 4 07 (q, J = 7 3 Hz, 2H), 3 04-2 94 (m, 4H), 2 00 (s, 3H), and 1 26 (t, J = 7 3 Hz, 3H) Example 242 N-((1S)-2-amino-1-^3-(trifluoromethyl]Dhenyl]methyltethyl)-4-M-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenev,3rboxamide (Formula Removed) The title compound (180 mg, 67%) was prepared as an off-white solid according to the procedure of Example 241, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (220 mg, 0 63 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 437 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 8 96 (d, J = 8 84 Hz, 1H), 8 15 (m, 2H), 8 04 (d, J =1 3 Hz, 1H), 7 86 (d, J = 1 3 Hz, 1H), 7 69-7 49 (m, 4H), 7 36 (s, 1H), 4 39 (m, 1H), 4 09 (q, J = 7 1 Hz, 2H), 3 11-3 00 (m, 4H), 1 99 (s, 3H), and 1 25 (t, J = 7 1 Hz, 3H) Example 243 A/4(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-vl V-2-thiophenecarboxa mide (Formula Removed) The title compound was prepared as an off-white solid according to the procedure of Example 241, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (160 mg, 0 536 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 387 (M+H;+ NMR (d6-DMSO, 400 MHz) δ ppm 8 90 (d, J = 8 6 Hz, 1H), 8 13 (m, 2H), 8 03 (d, J =1 3 Hz, 1H), 7 87 (d, J = 1 3 Hz, 1H), 7 38-7 30 (m, 3H), 7 12-7 08 (m, 2H), 4 36 (m, 1H), 4 07 (q, J = 7 1 Hz, 2H), 3 07-2 97 (m, 2H), 2 96-2 88 (m, 2H), 2 00 (s, 3H), and 1 25 (t, J = 7 1 Hz, 3H) Example 244 /\/4(1S)-2-amino-1-[(3,4-difluorophenyl]methyl]ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound (210 mg, 72%) was prepared as an off-white solid according to the procedure of Example 241, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (240 mg, 0 76 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 405 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 8 99 (d, J = 8 34 Hz, 1H), 8 16 (m, 2H), 8 09 (d, J =1 0 Hz, 1H), 7 87 (d, J = 1 0 Hz, 1H), 7 40-7 30 (m, 3H), 7 13 (br s, 1H), 4 36 (m, 1H), 4 08 (q, J = 7 3 Hz, 2H), 3 06-2 99 (m, 2H), 2 96-2 33 (m, 2H), 2 00 (s, 3H), and 1 26 (t, J = 7 3 Hz, 3H) Example 245 N-(( 1 S)-2-amino-1 -n2-(trifluorc>i-nethyltohenyl]methyl)ethyl)-5-chloro-4-( 1 -ethyl-4-methyl-1H-pyrazol-5-yl)--2-thioDhen3carboxamide (Formula Removed) a) Methyl 5-chloro-4-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A mixture of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (230 mg, 0 9 mmol), 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (425 mg, 1 8 mmol), PdCI2(dppf) (65 9 mg, 0 09 mmol), and sodium carbonate (2N aq, 1 35 mL, 2 7 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube Afte 5h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 40-60%) to afford the title compound (241 mg, 92%) as a light yellow solid LC-MS (ES) m/z = 285 (M+H)+ b) 5-chloro-4-(1 -ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of methyl 5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (260 mg, 0 90 mmol) in THF/H20 (2 mL/2 mL) was added KOH (201 mg, 3 6 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were concentrated under vacuum to give crude 5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, which was used directly without further punfication LC-MS (ES) m/z 271 (M+Hf c) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To the above acid in DCM (5 mL) at 25 °C was added bromo-tns-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (542 mg, 1 16 mmol) in one portion, followed by addition of DIPEA (0 16 mL, 0 90 mmol) After 10 mm, 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (312 mg, 0 90 mmol) was added in one portion After 2h, the reaction solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (278 mg, 49 % for two steps) as a white solid LC-MS (ES) m/z 601 (M+H)+ d)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) 5-Chloro-/S/-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (255 mg, 0 42 mmol) was dissolved in MeOH (2mL) and was treated with NH2NH2 (0 13 mL, 4 2 mmol) The reaction was stirred over 5 h, concentrated and purified by reverse-phase HPLC (C18 column H20/CH3CN, 95- 5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water and aminonium hydroxide was added The mixture was extracted with DCM (5 mL x 3), dned over Na2SCv and coi.oentrated to give a free base of the title compound The free base compound was dissolved in MeOH (1 mL) and treated with HCI (4 M in dioxane, 2 1 mL) After stirring overnight, the mixture was concentrated to give 120 mrj of the title compound (120 mg, 49%) as an off-white solid LC-MS (ES) m/z 471 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 91 (br s, 2h), 7 71 (m, 1H), 7 59 (m, 1H), 7 53 (m, 1H), 7 44 (m, 1H), 4 65 (m, 1H), 4 21 (m, 2H), 3 37-3 14 (m, 4H), 2 07 (s, 3H), and 1 40 (m, 3H) Example 246 A/4nS)-2-amino-1-[(3-fluoroDhenyl]methyl]ethyl)-5-chloro-4-n-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a)5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3- fluorophenyl)methylJethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of 5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (130 mg, 0 48 mmol) [from Example 245(b)] in DCM (5 mL) at 25 °C was added PyBrOP (250 mg, 0 54 mmol) in one portion, followed by addition of DIPEA (0 7 mL, 4 01 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3- fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (150 mg, 0 50 mmol) was added to above solution After 2h, the reaction mixture was concentrated and punfied via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (210 mg, 79%) as a white solid LC-MS m/z (ES) 551 (M+H)+ b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyi}-5-chloro-4-(1 -ethyl-4-methyl-1H-pyrazol-5-y!)-2-thiophenecarboxamide (Formula Removed) At RT, NH2NH2 (0 1 mL, 3 19 mmol) was added to 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethylH-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (201 mg, 0 36 mmol) in MeOH (3 mL) After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (10 mL) and washed with H2O (10 mL x 3) To the DCM solution was added HCI (36%, 2 mL) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (101 mg, 53%) as an off-white solid LC-MS (ES) m/z 421 (M+H)+, 1H NMR (dg-DMSO, 400 MHz) S ppm 9 02 (d, J = 8 3 Hz, 1H), 8 08 (s, 2H), 7 97 (s, 1H),7 42(s, 1H), 7 32(m, 1H), 7 15-7 09 (m, 1H), 7 06-7 01 (m, 1H), 4 35 (m, 1H), 3 95 (m, 2H), 3 05-2 98 (m, 2H), 2 96-2 88 (m, 2H), and 1 92 (s, 3H), and 1 24 (t, J = 6 6 Hz, 3H) Example 247 N-{(1S)-2-amino-1-[(3.4-difluorophenyl]methyl]ethyl]-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound (95 mg, 50 2%) was prepared according to the procedure of Example 246, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (152 mg, 0 48 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H}-dione LC-MS (ES) m/z 439 (M+H)+,1H NMR (d6-DMSO, 400 MHz) δ ppm 9 10 (d, J = 8 6 Hz, 1H), 8 13 (s, 2H), 8 03 (s, 1H), 7 42 (s, 1H), 7 39-7 30 (m, 2H), 7 15-710 (m, 1H), 4 33 (m, 1H), 3 95 (m, 2H), 3 05-2 99 (m, 2H), 2 96-2 88 (m, 2H), 1 92, and 1 24 (t, J = 6 3 Hz, 3H) Example 248 N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl]ethyl)-4-(1,4-diethyl-1H-pyrazol-5-yl)-2-trnophenecarpoxamide (Formula Removed) a) Methyl 4-(4-ethenyl-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A mixture of methyl 4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (200 mg, 0 64 mmol), Pd(Ph3P)4 (73 3 mg, 0 06 mmol), and tnbutyl(ethenyl)stannane (302 mg, 0 95 mmol) was heated at 90 °C for 1 h under N2 in a sealed tube The mixture was purified on Silica (10%-20% EtOAc in Hex) to give the title compound (151 mg, 76%) LC-MS (ES) m/z 263 (M+H)+ b) Methyl 4-(1,4-diethyl-1H-pyrazo1-5-yl)-2-thiophenecarboxylate (Formula Removed) Pd/C (12 mg, 10%) was added to a solution of ethyl 4-(4-ethenyl-1 -ethyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylate (150 mg, 0 57 mmol) in EtOH The air in the system was removed by vacuum The reaction mixture was stirred for 10h under a balloon of hydrogen gas The reaction was diluted with MeOH (2 mL) and filtered through Celite Concentration of the reaction solution gave the title compound (149 mg, 94%) as a yellow oil LC-MS (ES) m/z 265 (M+H)+ c) 4-(1,4-diethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)- 1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a solution of methyl 4-(1,4-diethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (149 mg, 0 56 mmol) in THF/H2O (5 mL/5 mL) was added KOH (158 mg, 2 82 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly without of further purification LC-MS (ES) m/z 251 (M+H)+ To the above acid in DCM (5 mL) at 25 °C was added bromo-tris-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (315 mg, 0 68 mmol) in one portion, followed by the addition of DIPEA (0 98 mL, 5 64 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (196 mg, 0 56 mmol) After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (0 315 g, 94%) as a white solid LC-MS (ES) m/z 581 (M+Hf d) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-diethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) 4-(1,4-diethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (310 mg, 0 53 mmol) was dissolved in MeOH (1 mL) and was treated with NH2NH2 (0 34 mL, 10 68 mmol) The reaction was stirred over 5 h, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water (2 mL) and aminonium hydroxide (3 47 mL, 30%, 26 7 mmol) was added The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4 and concentrated to give a free base of the tile compound The free base was dissolved in MeOH (1 mL) and treated with HCI (4 M in dioxane, 2 1 mL) After stirring overnight, the reaction solution was concentrated to give the title compound (140 mg, 48%) as an off-white solid LC-MS (ES) m/z 451 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 8 25-8 23(m, 1H), 8 16-8 14 (m, 1H), 8 10-8 08 (m, 1H), 7 71-7 67 (m, 1H), 7 65-7 61 (m, 1H), 7 52-7 47 (m, 1H), 7 44-7 39 (m, 1H), 4 69 (m, 1H), 4 45-4 37 (m, 2H), 3 39-3 18 (m, 4H), 2 63-2 55 (m, 2H), 1 49-1 44 (m, 3H), and 1 24-1 19 (m, 3H) Example 249 N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-{1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) methyl 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) Method A To a solution of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (500 mg, 1 96 mmol) in THF(10 mL) was added aqueous Na2CO3(2N, 3mL, 6 0 mmol), PdCI2(dppf) (143 mg, 0 196 mmol) and 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (522 mg, 2 35 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 10-20%) to afford the title compound (410 mg,77%) as a tan solid LC-MS (ES) m/z 271 (M+H)+ Method B To a 250 mL sealed flask was added 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (10 43 g, 47 0 mmol), potassium carbonate (16 23 g, 117 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (10 g, 39 1 mmol) and bis(tn-t-butylphosphine)palladium(0) (1 6 g, 3 13 mmol) in 1,4-dioxane (120 mL) and H20 (20ml) After stirring for 90 mm at 70 °C, the reaction solution was diluted with DCM (100 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was purified on silica gel (hexanes/EtOAC, 10-30%) to give the title compound (7 6 g, 72%) as a tan solid LC-MS (ES) m/z 271 (M+H)+ b) 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) To a solution of methyl 5-chloro-4-(1,4-omethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (7 6 g, 28 1 mmol) in THF/H2O (30 mL/5 mL) was added KOH (4 72 g, 84 mmol) The reaction mixture was heated to 50 °C for 1 h After the mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (50 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid (6 8 g, 94%), which was used directly in the next step without further purification LCMS (ES) m/z 257 (M+H)+ c) 5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{( 1 S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) To a 500 mL round-bottomed flask was added 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (6 8 g, 26 5 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (8 69 g, 29 1 mmol), N,N-drisopropyl ethylamine (14 mL, 80 mmol) and Pybrop (18 52 g, 39 7 mmol) in dichloromethane (DCM) (100 mL) After stirring at RT for 1h, the reaction solution was washed with H2O (2 x 100mL) and the organic layer was dried Na2SO4, filtered and concentrated The crude product was added to a silica gel column and was eluted with (EtOAc/hexanes, 1 1) to give the title compound (6 1g, 42 9%) as a white solid LCMS (ES) m/z 537 (M+H)+ d) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H- pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) At RT, NH2NH2(4 mL, 127 mmol) was added to 5-ch.oro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (5 2 g, 9 68 mmol) in MeOH (30 ml) After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (200 mL) and washed with H2O (50 mL x 5) To the above DCM solution was added HCI (36%, 50 mL, 600 mmol) After 1h, the aqueous phase was separated and washed with DCM (50 ml x 5) Water was removed under high vacuum to give the title compound (3 8 g 79%) as a white solid LC-MS (ES) m/z 407 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 8 75 (d, J = 8 8 Hz, 1H), 7 88 (s, 1H), 7 85 (m, 1H), 7 34-7 29 (m, 1H), 7 15-7 09 (m, 2H), 7 00-6 95 (m, 1H), 4 54 (m, 1H), 3 88 (s, 3H), 3 26-3 18 (m, 2H), 3 09-2 98 (m, 2H), and 2 08 (s, 3H) Example 250 N-((1S)-2-amino-1-{[3-(trifluoromethyl]phenyl]methyl}ethyl)-5-chloro-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound was prepared as a white solid (180 mg, 68%) according to the procedure of Example 249, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (209 mg, 0 6 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/7 457 (M+H), NMR (d4-MeOD, 400 MHz) δ ppm 7 94 (s, 1H), 7 90 (s, 1H), 7 65- 7 60 (m, 2H), 7 55-7 48 (m, 2H), 4 55 (m, 1), 3 89 (s, 3H), 3 37-3 27 (m, 2H), 3 16-3 06 (m, 2H), and 2 08 (s, 3H) Example 251 N-{(1S)-2-amino-1-[(4-fluorophenyl]methyl]ethyl)-5-chloro-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) The title compound was prepared as white solid (95 mg, 39%) according to the procedure of Example 249, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (584 mg, 1 96 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z407 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 81 (s, 2H), 7 35-7 31 (m, 2H), 7 06-7 01 (m, 2H), 4 51 (m, 1H), 3 89 (s, 3H), 3 25-3 16 (m, 2H), 3 05-2 94 ( m, 2H), and 2 07 (s, 3H) Example 252 N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) a) methyl 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) To a solution of methyl 4-biomo-2-furancarboxylate (500 mg, 2 439 mmol) in THF (5 mL) was added aqueous Na2CO3 (2N, 3 6 mL, 7 2 mmol), PdCI2(dppf) (160 mg, 0 22 mmol), and 1-ethyl-4-methyl-5-(4,4,3,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (700 mg, 2 96 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-40%) to afford the title compound (460 mg, 76 %) as a light yellow solid LC-MS (ES) m/z 235 (M+H)+ b) N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) To a solution of methyl 4-(1-ethyl~4-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (210 mg, 0 90 mmol) in THF/H2O (5mL/0 5 mL) was added KOH (200 mg, 3 56 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H2O (2 mL), the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly in the next step without further purification LC-MS (ES) m/z 221 (M+H)+ To the crude 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid in DCM (5 mL) at 25 °C was added PyBrOP (370 mg, 0 79 mmol) in one portion, followed by the addition of DIPEA (0 8 mL, 4 58 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (220 mg, 0 74 mmol) was added to the reaction solution After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (164 mg, 54%) as a white solid LC-MS (ES) m/z 501 (M+H)+ c) N-[(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1 -ethyl-4-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) At RT, NH2NH2 (0 1 mL, 3 19 mmol) was added to a solution of N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (150 mg, 0 3 mmol) in MeOH (5 mL) After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (10 mL) and washed with H2O (10 mL x 3) To the DCM solution was added HCI (36%, 1 mL, 12 mmol) After 1h, the aqueous phase was separated, and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (80 mg, 57%) as an off-white solid LC-MS (ES) m/z 371 (M+H)+, NMR (d4-MeOD, 400 MHz) S ppm 8 19 (s, 1H), 8 05 (s, 1H), 7 44 (s, 1H), 7 32 (m, 1H), 7 16-7 08 (m, 2H), 6 97 (m, 1H), 4 62 (m, 1H), 4 37 (q, J = 7 1 Hz, 2H), 3 38-3 18 (m, 2H), 3 10-2 99 (m, 2H), 2 15 (s, 3H), and 1 46 (t, J = 7 1 Hz, 3H) Example 253 N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}--4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) a) methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) To a solution of methyl 4-brcmo-2-furancarboxylate (1 0 g, 4 88 mmol) in THF (20 mL) was added aqueous Na2CO3(2N, 8 mL, 16 mmoL), PdCI2(dppf) (0 35 g, 0 49 mmol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 3 g, 5 85 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-40%) to afford the title compound (0 8 g, 74 5%) as a light yellow solid LC-MS (ES) m/z = 221 (M+H)+ b) methyl 4-(4-chloro-1-ethyl-1N-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) A mixture of methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 36 mmol) and NCS (218 mg, 1 63 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube After 5h, the reaction mixture was concentrated and purified via column chromatography (silica, 10-20% EtOAc/Hexane) affording the title compound (260 mg, 75%) as a white solid LC-MS (ES) m/z 255 (M+H)+ c) 4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol- 2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-furancarboxamide (Formula Removed) To a solution of methyl 4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-furancarboxylate (250 mg, 0 98 mmol) in THF/H2O (5mL/0 5 mL) was added KOH (200 mg, 3 56 mmol) The reaction mixture was heated to 50° C for 4 h After the mixture was concentrated and diluted with H2O (2 mL), the pH was adjusted to 3 The mixture was extracted with DCM (5mL x3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly without further punfication LC-MS (ES) m/z 241 (M+H)+ To the above crude acid in DCM (5 mL) at 25 °C was added PyBrOP (550 mg, 1 18 mmol) in one portion, followed by the addition of DIPEA (0 7 mL, 4 01 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (322 mg, 1 08 mmol) was added to the reaction solution After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (360 mg, 70 %) as a white solid LC-MS (ES) m/z 521 (M+H)+ d) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl)-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) At RT, NH2NH2 (0 15 mL, 4 78 mmol) was added to a solution of 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-furancarboxamide (350 mg, 0 67 mmol) in MeOH (5 mL) After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (15 mL) and washed with H2O (10 mL x 3) To the above DCM solution was added HCI (36%, 2 mL, 23 7 mmol)) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (260 mg, 78%) as an off-white solid LC-MS (ES) m/z 391 (M+H)+ NMR (d6-DMSO, 400 MHz) δ ppm 8 70 (m, 1H), 8 29 (s, 1H), 8 02 (m, 2H), 7 70 (s, 1H), 7 50-7 45 (m, 1H), 7 36-7 30 (m, 1H), 7 14-7 08 (m, 2H), 7 06-7 01 (m, 1H), 4 43 (m, 1H), 4 16 (q, J = 7 3 Hz, 2H), 3 04-2 88 (m, 4H), and 1 30 (t, J = 7 3 Hz, 3H) Example 254 (Formula Removed) N-[2-amino-1-(phenylmethyl)ethyl]-3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) methyl 4-bromo-3-([(trifluoromethyl)sulfonyl]oxy}-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-3-{[(trifluoromethyl)sulfonyl]oxy}-2-thiophenecarboxylate (0 948 g, 4 0 mmol) in CH2CI2 (5 mL) and pyridine (1 mL) at 0 °C was added Tf20 (1 0 mL, 6 0 mmol) The mixture was stirred for 1 h, poured onto ice water (10 mL) and extracted with CH2CI2 (5 mL x 3) The collected organic layers were dried (Na2SO4) and concentrated to give a red syrup which was used directly in the next step without further purification LC-MS (ES) m/z 370 (M+H)+ b) methyl 4-bromo-3-methyl-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-3-{[(trifluoromethyl)sulfonyl]oxy}-2-thiophenecarboxylate (825 mg, 2 25 mmol) in dioxane/H2O (5 mL/1 mL) was added K2CO3 (930 mg, 6 75 mmol), tetrakispriphenylphosphine Pd(0) (260 mg, 0 22 mmol), and methylboronic acid (175 mg, 2 91 mmol) The reaction mixture was heated to 70° C in a sealed tube for 12h The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 9 1) to give the title compound (441 mg, 84%) as a brown solid LC-MS (ES) m/z 236 (M+H)+ c) methyl 4-[1-(dimethylamino)ethenyl]-3-methyl-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-3-methyl-2-thiophenecarboxylate (300 mg, 1 27 mmol) in dioxane/H2O (5 mL/1 mL) was added K2CO3 (525 mg, 3 80 mmol), tetrakispriphenylphosphme Pd(0) (15 mg, 0 01 mmol), and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (345 mg,1 7 mmol) The reaction mixture was heated to 70 °C in a sealed tube for 2h The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 9 1 to 4 1) to give the title compound (270mg, 90%) LC-MS (ES) m/z 237 (M+Hf d) 1,1-dimethylethyl [2-({[3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of methyl 4-[1-(dimethylamino)ethenyl]-3-methyl-2-thiophenecarboxylate (50 mg, 0 21 mmol) in THF/H2O (2 mL/0 5 mL) was added KOH (122 mg, 2 1 mmol) The resulting mixture was heated to 50 °C for 2h The THF was removed under vacuum and the aqueous layer was acidified with 6 N HCI to pH 3 and extracted with CH2CI2 (5 mL x 3) The organic fractions was dried over Na2SO4 and concentrated to give the crude 3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, which was used directly in the next step To a solution of the crude 3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid in DCM (2 mL) was added PyBrop (0 14 g, 0 3 mmol) and DIPEA (0 1 mL, 0 57 mmol) After 15 mm, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate was added to the reaction in one portion and stirred for 2h at RT The reaction solution was concentrated under vacuum and purified on silica gel (EtOAc /Hexane, 20-50%) to give the title compound (51 mg, 49 % for two steps) as a solid LC-MS (ES) m/z 455 (M+H)+ e) N-[2-amino-1 -(phenylmethyl)ethyl]-3-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) To a solution of 1,1-dimethylethyl [2-({[3-methy!-4-(1 -methyl-1 H-pyrazol-5-ylV2-thienyl]carbonyl}amino) 3-phenylpropyl]carbamate (51 mg, 0 11 mmol) in DCM (1 mL) was added TFA (1 mL) The reaction was stirred over 5h, concentrated and punfied by reverse-phase HPLC (C18 column H2O/CH3CN, 40-10 %) to afford the bis-TFA salt of the title compound (1S mg, 41%) LC-MS (ES) m/z 355 (M+H)+ NMR (d4-MeOD, 400 MHz) δ ppm 7 64 (s, 1H) 7 56 (d, J = 1 8 Hz, 1H), 7 36-7 30 (m, 4H), 7 28-7 21 (m, 1H), 6 30 (d, J = 2 0 Hz, 1H), 4 58 (m, 1H), 3 69 (s, 3H), 3 27-3 13 (m, 2H), 3 07-2 93 (m, 2H), and 2 13 (s, 3H) Example 255 N-((1S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide (Formula Removed) a) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-2-thiophenecarboxylate (1 0 g, 4 5 mmol) in dioxane/H2O (5 1,12 mL) was added K2CO3 (1 86 mg, 13 5 mmol), tetrakispriphenylphosphine Pd(0) (300 mg, 0 25 mmol), and 1-methyl-5-(4,4,5,5- tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 23 g, 5 9 mmol) The reaction mixture was heated to 75° C in a sealed tube for 2h The reaction mixture was concentrated and punfied on silica gel (EtOAc/Hex 10-40%) to give the title compound (701 mg, 70%) as a white solid LC-MS (ES) m/z 223 (M+H)+ b) methyl 4-(4-iodo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (700 m g, 3 15 mmol) in THF (5 mL) was added NIS (922 mg, 4 09 mmol) in one portion The reaction mixture was stirred at 75 °C for 10 h, and then cooled to room temperature The reaction mixture was concentrated and punfied on silica gel (EtOAc/Hex 10-20%) to give the title compound (470 mg, 43%) as an off white solid LC-MS (ES) m/z 350 (M+H)+ c) methyl 4-[1-methyl-4-(trifluoromethyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-(4-iodo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (470 mg, 1 35 mmol), copper (I) iodide (256 mg, 1 35 mmol) and potassium fluoride (78 mg, 1 35 mmol) in anhydrous DMF/HMPA (2 ml/2 mL) was added triethyl(trifluoromethyl)silane (745 mg, 4 04 mmol) The mixture was heated to 70 °C under N2 in a sealed tube After 10h, the reaction was quenched with NH4CI (sat'd) (2 mL), extracted with ether (5 mL x 5) and washed with distilled water (5 mL x 5) The combined organic phase was dned over Mg2SO4 and purified on silica (EtOAc/Hex, 10-30%) to afford the title compound (0 29 g, 74%) as a yellow syrup LC-MS (ES) m/z 291 (M+H)+ d)N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]- 2-thiophenecarboxamide (Formula Removed) To a solution of methyl 4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenerarboxylate (150 mg, 0 52 mmol) in THF/H2O (2 mL/0.5 mL) was added KOH (116 mg, 2 0 mmol) The reaction mixture was heated to 50 °C for 2 h After the mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid, which was used directly in the next step without further purification LC-MS (ES) m/z 277 (M+H)+ To the above acid in DCM (5 mL) at 25 °C was added bromo-tris-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (279 mg, 0 59 mmol) in one portion, followed by the addition of DIPEA (0 5 mL, 2 87 mmol) and 2-[(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (174 mg, 0 5 mmol) After 2h, the solution was concentrated and purified via column chromatography (silica, 1-10 % MeOH/CHCI3) affording the title compound (0 21 g, 67% for 2 steps) LC-MS (ES) m/z 607 (M+H)+ e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-[1 -methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide (Formula Removed) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide (210 mg, 0 35 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2(0 5 mL, 15 9 mmol) The reaction was stirred over 10 h, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 40- 10%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water, and neutralized with aminonium hydroxide The mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH and treated with HCI (aq) After stirring overnight, the reaction was concentrated to give the title compound (95 mg, 57%) as a white solid LC-MS LC-MS (ES) m/z 477 (M+H)+ NMR (d6-DMSO, 400 MHz) δ ppm 8 92 (d, J = 9 1 Hz, 1H), 8 06 (m, 4H), 7 99 (s, 1H), 7 69 (d, J = 7 6 Hz, 1H), 7 59 (d, J = 7 6 Hz, 1H), 7 53 (m, 1H), 7 43 (m, 1H), 4 49 (m, 1H), 3 83 (s, 3H), and 3 14-2 99 (m, 4H) Example 256 N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-proopl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) 1-propyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (Formula Removed) To a suspension of NaH (60% in mineral oil, 4 0 g, 100 mmol) in THF (200 mL) was added 1H-pyrazole (6 8 g, 100 mmol) at 0 °C portionwise After stirring at RT for 1h, Prl (17 85 g, 105 mmol) was added dropwise at 0 °C The reaction mixture was stirred for 10h and monitored by LC-MS m/e = 111 (M+H)+ After the reaction was complete, Nal was removed by filtration The resulting 1-propyl-1H-pyrazole containing THF solution was used directly in the next step To the above THF solution of 1 -propyl- 1H-pyrazole was added n-BuLi (2 5M in Hexane, 40 rnL, 100 mmol) at -78°C, The reaction solution was stirred for 2 hours at RT and then re-cooleo to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-i$opropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (18 6 g, 100 mmol) After 20 min at -78°C, the reaction was quenched with saturated NH4CI solution and exacted with DCM The organics were dried over Na2SO4 and concentrated under vacuum to afford the title compound as a brown solid which was used directly without furthei punfication LC-MS (ES) m/z 154 (M+H)+for [RB(OH)2] b) methyl 4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a solution of methyl 4-bromo-2-thiophenecarboxylate (221 mg, 1 0 mmol) in dioxane/H2O (5 1,6 mL) was added K2CO3 (414 mg, 3 0 mmol), tetrakispriphenylphosphme Pd(0) (60 mg, 0 05 mmol), and 1-propyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (404 mg, 1 5 mmol) The reaction mixture was heated to 70° C in a sealed tube for 2h The reaction mixture was concentrated and punfied on silica gel (EtOAc/Hex 10-40%) to give the title compound (176 mg, 70%) as a white solid LC-MS (ES) m/z 251 (M+H)+ c) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-propyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide (Formula Removed) To a solution of methyl 4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (160 mg, 0 64 mmol) in THF/H2O (2 mL/1 mL) was added KOH (151 mg, 2 56 mmol) The reaction mixture was heated to 50 °C for 2 h After the mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid, which was used directly in the next step without further purification LCMS (ES) m/z = 237 (M+H)+ To the above acid in DCM (2 mL) at 25 °C was added bromo-tns-pyrrolidmo phosphoniumhexafluorophosphate (PyBrOP) (298 mg, 0 64 mmol) in one portion, followed by the addition of DIPEA (0 2 mL, 1 15 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (208 mg, 0 6 mmol) After 1h, the solution was concentrated and purified via column chromatography (silica, 1-10 % MeOH/CHCI3) affording the title compound (0 22 g, 61% for 2 steps) LC-MS (ES) m/z 567 (M+H)+ d) N-((1S)-amino-1-{[2-(trifluoromethyl)phenyl]methyl]ethyl)-4-(1-propyl-1H- pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (220 mg, 0 36 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (0 3 mL, 9 56 mmol) The reaction was stirred over 10 h, concentrated and punfied by reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water and neutralized with aminonium hydroxide The mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH (2 mL) and treated with HCI (4M in dioxane) After stirring overnight, the reaction solution was concentrated to give the title compound (112 mg, 57%) as an off white solid LC-MS (ES) m/z 437 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 9 06-8 99 (m, 1H), 8 23-8 02 (m, 4H), 7 92 (br s, 1H), 7 69 (d, J = 7 8 Hz, 1H), 7 62-7 49 (m, 3H), 7 42 (m, 1H), 4 50 (m, 1H), 4 20 (m, 2H), 3 15-2 99 (m, 4H), 1 74 (m, 2H), and 0 80 (t, J = 7 3 Hz, 3H) Example 257 N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyllmethyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) a) methyl 4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A mixture of methyl 4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 1 0 mmol) and NCS (200 mg, 1 5 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 10% EtOAc/Hexane) affording the title compound (199 mg, 70%) as a white solid LC-MS (ES) m/z 285 (M+H)+ b) 4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (Formula Removed) To a solution of methyl 4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (199 mg, 0 7 mmol) in THF/H2O (2 mL/0 5 mL) was added KOH (100 mg, 1 7 mmol) The leaction mixture was heated to 50 °C for 2 h After tne mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid, which was used directly in the next step without further punfication LC-MS (ES) m/z 271 (M+H)+ To the above acid in DCM (5 mL) at 25 °C was added bromo-tns-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (326 mg, 0 7 mmol) in one portion, followed by the addition of DIPEA (0 3 mL, 1 15 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (232 mg, 0 7 mmol) After 10 mm, the solution was concentrated and purified via column chromatography (silica, 1-10 % MeOH/CHCI3) affording the title compound (312 mg, 74% for 2 steps) LC-MS (ES) m/z 601 (M+H)+ c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Formula Removed) 4-(4-Chloro-1-propyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (312 mg, 0 52 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (0 5 mL, 15 9 mmol) The reaction was stirred over 10 h, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water and neutralized with aminonium hydroxide The mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a free base of the tile compound The free base compound was dissolved in MeOH (2 mL) and treated with HCI (aq) After stirring overnight, the reaction was concentrated to give the title compound (185 mg, 66%) as an off white solid LC-MS (ES) m/z 471 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 92 (m, 2H), 7 74-7 68 (m, 1H), 7 60 (s, 1H), 7 58-7 51 (m, 2H), 7 45-7 41 (m, 1H), 4 67 (m, 1H), 4 15 (t, J = 7 1 Hz, 2H), 3 37-3 09 (m, 4H), 1 77 (m, 2H), and 0 82 (t, J = 7 6 Hz, 3H) Example 258 N-{(1S)-2-amino-1-[(3.4-difluorophenyl]methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)2-thiophenecarboxamide (Formula Removed) a) methyl 5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) To a 100 mL sealed flask was added 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 61 g, 11 74 mmol), potassium carbonate (3 25 g, 23 48 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (2 g, 7 83 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 4 g, 0 78 mmol) in 1,2-dimethoxyethane (DME) (50 mL) and H2O (10 ml) After stirring for 3h at 70 °C, the reaction solution was diluted with DCM (100 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was purified on silica gel [EtOAc/hexanes, 10-30% ] to give the product [1 8 g, 85%] as an off white solid LC-MS (ES) m/z 271 (M+Hf b) methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (Formula Removed) Methyl 5-chloro4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 8 g, 6 65 mmol) and NCS (1 3 g, 9 74 mmol) in THF (10 mL) were heated to 70 °C under N2 for 2 h The reaction solution was concentrated and purified on silica (EtOAc/Hex, 10-30%) to afford the title compound (1 5 g, 74%) as a syrup LC-MS (ES) m/z 305 (M+H)+ b) N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecaiboxamide (Formula Removed) The title compound (290 mg, 58 4 %) was prepared as an off-white solid according to the procedure of Example 236, except substituting 5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (526 mg, 1 662 mmol) for 5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide LC-MS (ES) m/z 459 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 76 (m, 1H), 7 62 (s, 1H), 7 28-7 22 (m, 1H), 7 20-7 10 (m, 2H), 4 52 (m, 1H), 4 07 (m, 2H), 3 27-3 16 (m 2H), 3 05-2 94 (m, 2H), and 1 34 (m, 3H) Example 259 (Formula Removed) N-{(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxamide (Formula Removed) a) methyl 5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) To a 100 mL sealed flask was added 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 61 g, 11 74 mmol), potassium carbonate (3 25 g, 23 48 mmol), methyl 4-bromo-5-chloro-2-furancarboxylate (1 85 g, 8 33 mmol) and bis(tri-t-butylphosphme)palladium(0) (0 16 g, 0 31 mmol) in 1,2-Dtmethoxyethane (DME) (30 mL) and H2O (5 mL) After stirring for 2h at 75 °C, the reaction solution was diluted with DCM (100 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was punfied on silica gel [EtOAc/hexanes, 10-30%] to give the product (0 8 g, 50 1%) as an off-white solid LC-MS (ES) m/z 255 (M+H)+ b) methyl 5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-furancarboxylate (Formula Removed) A mixture of methyl 5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl)-2-furancarboxylate (800 mg, 3 14 mmol) and NCS (600 mg, 4 49 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 10-20% EtOAc/Hexane) affording the title compound (710 mg, 78%) as a white solid LC-MS (ES) m/z 289 (M+H)+ c)5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-furancarboxamide (Formula Removed) To a solution of methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate (480 mg, 1 66 mmol) in THF/H2O (5mL/1 mL) was added KOH (460 mg, 8 20 mmol) The reaction mixture was heated to 50° C for 4 h After the mixture was concentrated and diluted with H2O (2 mL), the pH was adjusted to 3 The mixture was extracted with DCM (10 mL x3) The collected organic layers were concentrated under vacuum to give a crude acid (420 mg, 92%), which was used directly without further purification LC-MS (ES) m/z 275 (M+H)+ To the above acid (400 mg) in DCM (5 mL) at 25 °C was added PyBrOP (881 mg, 1 89 mmol) in one portion, followed by the addition of DIPEA (1 5 mL, 8 59 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (506 mg, 1 60 mmol) was added After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 30-50 % EtOAc/Hexane) affording the title compound (655 mg, 79%) as a white solid LC-MS (ES) m/z 573 (M+H)+ c) N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yI)-2-furancarboxamide At RT, NH2NH2 (0 5 mL, 15 93 mmol) was added to a solution of 5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindo!-2-yl)mbthyl]ethyl}-2-furancarboxamide (610 mg, 1 06 mmol) in MeOH (5 mL) After I0h, the solvent was removed under vacuum The resulting residue was taken into DCM (20 mL) and washed with H20 (20 mL x 3) To the DCM solution was added HCI (36%, 10 mL, 120 mmol) After 1h, the aqueous phase was separated and washed with DCM (30 ml x 3) Water was removed under high vacuum to give the tilte compound (410 mg, 87%) as an off-white solid LC-MS (ES) m/z 443 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 61 (s, 1H), 7 36 (s, 1H), 7 29-7 10 (m, 3H), 4 57 (m, 1H), 4 09 (q, J = 7 3 Hz, 2H), 3 27-3 23 (m, 1H), 3 20-3 14 (m, 1H), 3 06-3 01 (m, 1H), 2 97-2 92 (m, 1H), and 1 36 (t, J = 7 3 Hz, 3H) Example 260 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamtde a) 1,1 -dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) A mixture of 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (prepared according to Preparation 22 except substituting 2-[(2S)-2-amino-3-pherv/lpropyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3- (2,4-dichlorophenyl)propylHH-isoindole-1,3(2H)-dione) (236 mg, 0 537 mmol), 1-methyl-5-(tnbutylstannanyl)-1H-1,2,3-tr azole (200 mg, 0 537 mmol) (prepared according to patent IPN WO97/01553), pd(PPh3)2Cl2 (37 7 mg, 0 054 mmol), TRIETHYLAMINE (74 9 pi, 0 537 mmol) and toluene (3 ml) was degassed by N2 and sealed The reaction mixture was heated at 110 °C for 4 hr LC/MS showed the reaction was completed The reaction mixture was concentrated and punfied via column chromatography (silica, 70% EtOAc in hexane) to give the title product (120 mg, 51%) LCMS (ES) m/z = 442 2 (M+H) b) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide A solution of 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (60 mg, 0 14 mmol) in TFA-DCM (4ml, 1 3) was stirred at rt for 1 h LCMS showed the reaction was completed The reaction mixture was concentrated and the residue was punfied by reverse phase HPLC (5%-65% acetonitnle in water with 0 1% TFA) to give 42 2 mg (67%) of the TFA salt as a white solid LCMS (ES) m/z 342 2 (M+H)\ 1H NMR (400 MHz, METHANOL-d) δppm 8 06 (d, J=1 52 Hz, 1H), 7 87-7 91 (m, 2H), 7 34-7 21 (m, 5H), 4 55 (m, 1H), 4 19 (s, 3H), 3 30-3 21 (m, 1H), 3 09-3 18 (m, 1H), 3 01 (d, J=7 6Hz, 2H) Example 261 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide a) 1,1-Dimethylethyl [(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol- 5-yl)-2-thienyl]carbony!}arnino)-3-phenylpropyl]carbamate (Formula Removed) To a solution of 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenyipropyl]carbamate (70 mg, 0 16 mmol) in 2 ml of DMF was added NCS (42 3 mg, 0 32 rrmol) The reaction mixture was heated at 50 °C for 2 hr and then diluted with 50 ml of EtOAc The organic layer was washed with H2O and concentrated to give the title product as a crude mixture, which was used in next step without purification LCMS (ES) m/z = 5102 (M+H) b)N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide A solution of 1,1-dimethylethyl [(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from a) in TFA-DCM (4ml, 1 3) was stirred at rt for 1h The reaction mixture was concentrated and the residue was punfied by reverse phase HPLC (5%-65% acetonitnle in water with 0 1% TFA) to give 10 mg (12% two steps) of white solid as TFA salt LCMS (ES) m/z 410 0/412 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 62 (s, 1H), 7 32-7 25 (m, 5H), 4 55 (m, 1H), 4 02 (s, 3H), 3 21 (m, 1H), 3 10 (m, 1H),2 98(d,2H) Example 262 (Formula Removed) Preparation of N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluoronhciiyl)propyl]carbamate (123mg, 0 27mmol) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LCMS (ES) m/z 360 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 05 (d, J=1 6 Hz, 1H), 7 89-7 91 (m, 2H), 7 33-7 30 (m, 2H, 7 06-7 02 (m, 2H), 4 55 (m, 1H), 4 20 (s, 3H), 3 23 (m, 1H), 3 17 (m, 1H), 2 99 (m, 2H) Example 263 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethylM-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide a) 1,1-Dimethylethyl[(2S)-3-(3,4-difluorophenyl)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)propyl]carbamate (Formula Removed) A solution of 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-di-fluorophenyl)propyl]carbamate (50 mg, 0 11 mmol), 1-methyl-5-(4,4,5,5- tetramethyl-1,3,2-dioxaboro!an-2-yl)-1H-1,2,3-triazole (44 mg, 0 21 mmol), Na2CO3 (2N, 0 1ml) and PddppfCI2 (8 6 mg, 0 01 mmol) in 3 ml of 1,4-dioxane was irndiated in MW reactor at 150 °C for 20 mm The crude reaction mixture was purified by column chromatography (silica, 70% EtOAc in hexane) to give the title product (29 mg, 46%) LCMS (ES) m/z = 478 2 (M+H) b) N-(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared according to Example 260 b) except substituting 1,1-dimethylethyl [(2S)-3-(3,4-difluorophenyl)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}arnino)propyl]carbamate (29mg, 0 06mmol) for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl 3-phenylpropyl]carbamate LCMS (ES) m/z 378 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 07 (d, J=1 6 Hz, 1H), 7 88-7 91 (m, 2H), 7 23-7 09 (m, 3H), 4 55 (m, 1H), 4 20 (s, 3H), 3 24 (m, 1H), 3 15 (m, 1H), 2 98 (m, 2H) Example 264 (Formula Removed) Preparation of N-{nS)-2-amino-1-[(4-fluorophenv0methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-1,2.3-triazol-5-y0-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-(4-fluorophenyl)propyl]carbamate (68 mg, 0 15 mmol) for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyljcarbamate LCMS (ES) m/z 428 0/430 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 66 (s, 1H), 7 30 (m, 2H), 7 04 (m, 2H), 4 55 (m, 1H), 4 02 (s, 3H, 3 21-3 10 (m, 2H), 2 98 (m, 2H) Example 265 (Formula Removed) ]Preparation N-{f1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-n-methyl-1f/-1.2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3-fluorophenyl)propyl]carbamate (300mg, 0 66mmol) for 1,1-dimethylethyi [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 360 2 (M+H)\ 1H NMR (400 MHz, METHANOL-cW) δppm 8 06 (d, J=1 6 Hz, 1H), 7 90 (m, 2H), 7 33-7 30 (m, 1H), 7 13-7 09 (m, 2H), 6 98-6 95 (m, 1H), 4 55 (m, 1H), 4 19 (s, 3H), 3 24 (m, 1H), 3 17(m, 1H), 3 04-2 99 (m, 2H) Example 266 (Formula Removed) Preparation N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,5-difluorophenyl)propyl]carbamate(300mg, 0 66mmol)for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 378 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 06 (d, J=1 6 Hz, 1H), 7 91 (m, 2H), 6 96-6 93 (m, 2H), 6 84-6 83 (m, 1H), 4 55 (m, 1H), 4 19 (s, 3H), 3 24 (m, 1H), 3 19 (m, 1H), 3 05-2 98 (m, 2H) Example 267 (Formula Removed) Preparation N-{(1S)-2-amino-1-[(3-trifluoromethylphenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3-(trifluoromethyl)phenyl)propyl]carbamate (500 mg, 0 99 mmol)for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 410 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 06 (d, J=1 2 Hz, 1H), 7 97 (s, 1H), 7 91 (s, 1H), 7 72 (d, J=1 2Hz, 1H)7 54(m, 2H), 7 44 (m, 1H), 4 55 (m, 1H), 4 21 (s, 3H), 3 30-3 10 (m, 4H) Example 268 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-1,2.3-triazol-5-yl)-2-thiophenecarbox3mide The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-(3-fluorophenyl)propyl]carbamate (50mg, 0 11mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 428 0/430 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 63 (s, 1H), 7 33 (m, 1H), 7 12-7 07 (m, 3H), 4 55 (m, 1H), 4 02 (s, 3H), 3 23-2 98 (m, 4H) Example 269 (Formula Removed) Preparation of N-((1S)-2-amino-1-[(2-(trifluoromethyl)phenyl)methyl]ethyl}-5-chloro-4-( 1 -methyl-1H-1,2.3-triazol-5-yl)-2-th lophenecarboxamide a) methyl 5-chloro-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A mixture of 1-methyl-5-(tnbutylstannanyl)-1H-1,2,3-triazole (2 0 g, 5 37 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (1 25 g, 4 9 mmol), Pd(PPh3)2CI2 (171 mg, 0 244 mmol), TRIETHYLAMINE (0 68 ml, 4 89 mmol) and toluene (3 ml) was heated at 110 °C for 4hr under N2 The reaction mixture was purified via column chromatography (silica, 50%-70% EtOAc in hexane) to give the title compound as a white solid (400 mg, 32%) LCMS (ES) m/z 258 2 (M+H)+ b) 5-Chloro-4-(1-methyl-1H-1,2,3-trazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) A solution of methyl 5-chloro-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate (400 mg, 1 55 mmol) and 1N LiOH (2 0 ml, 2 0 mmol) in THF (6 ml) was stirred at rt overnight After removal of THF, the residue was diluted with 10 ml of H2O and washed with DCM (10ml x 2) The aqueous layer was acidified to pH 3 with 1N HCI and then extracted with EtOAc (30 ml x 4) The organic layers were combined and concentrated to give 370 mg of the title compound as a white solid LCMS (ES) m/z 244 0 (M+H)+ c) 5-Chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2- (trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2- thiophenecarboxamide (Formula Removed) solution of 5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid (370mg, 1 52mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (from Preparation 6, 529mg, 1 52 mmol), PyBrop (708 mg, 1 52 rnmol) and DIPEA (2 65 ml, 15 2 mmol) in 20 ml of DCM was stirred at rt for 2hr The reaction mixture was diluted with 50 ml of DCM and washed with H2O, 0 1N HCI and bnne The organic layer was concentrated and the residue was purified via column chromatography (silica, 50%-70% EtOAc in hexane) to give the title compound as a white solid (700mg, 80%) LCMS (ES) m/z 574 0 (M+H)+ d) N-{(1S)-2-amino-1-[(2-(trifluoromethyl)phenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-thiophenecarboxamide A solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2--thiophenecarboxamide (700 mg, 1 22 mmol) and hydrazine (0 19 mL, 6 1 mmol) in 5 mL of MeOH was stirred at rt overnight, diluted with 200 ml of H20 and extracted with DCM (100 ml x2) The combined organic layers were concentrated and the resulting solid was dissolved in 6N HCI (50 ml) The aqueous layer was washed with DCM (50 ml x2) The organic layers were discarded and the remaining aqueous solution was concentrated to give the product as an HCI salt (490mg, 75%) LCMS (ES) m/z 444 0 (M+H)+, 1H NMR (400 MHz, METHANOL-cW) δppm 8 10(m, 1H), 7 92 (m, 1H), 7 73 (m, 1H), 7 57 (m, 1H), 7 44 (m, 1H), 4 65 (m, 1H), 4 17(s,3H), 3 25-3 11 (m, 4H) Example 270 (Formula Removed) reparation of N-[(1S)-2-amino-1-^Dhenylmethyl)ethyl]-5-methyl-4-n-methyl-1fy-1,2.3-triazol-5-yl)-2-thiophenecarboxarrnde The title compound was prepared as an off-white solid according to the procedure of Example 269, except substituting methyl 4-bromo-5-methyl-2-thiophenecarboxylate (from Preparation 10) for methyl 4-bromo-5-chloro-2-miophenecarboxylate and 2-{(2S)-2-amino-3-phenylpropyl}-1 H-isoindole-1,3(2H)-dione (preparation 5) for 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 356 2 (M+Hf, 1H NMR (400 MHz, METHANOL-d4) δppm 8 60 (s, 1H), 8 01 (s, 1H), 7 34-7 21 (m, gM), 4 55 (m, 1H), 4 26 (s, 3H), 3 25 (m, 2H), 3 03 (m, 2H), 2 21 (s, 3H) Example 271 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2-(trifluoromethyl)phenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2.3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 261, except substituting N-{(1S)-2-amino-1-[(2-(trifluoromethyl)phenyl) methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide (120 mg, 0 27 mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 478 0/ 480 0(M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 79 (s, 1H), 7 73(d, J=7 6Hz, 1H), 7 56 (m, 2H), 7 45 (m, 1H), 4 65 (m, 1H), 4 05 (s,3H), 3 29-3 10 (m, 4H) Example 272 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 261, excent substituting 1,1-dimethylethyl [(2S)-2-({[5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyljcarbamate (prepared in Example 270) for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyljcarbamate LCMS (ES) m/z 390 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 72(s, 1H), 7 31-7 22 (m, 5H), 4 55 (m, 1H), 3 99 (s, 3H), 3 19 (m, 2H), 3 02 (m, 2H), 2 41 (s, 3H) Example 273 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3.5-difluorophenyl]methyl]ethyl}-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide a) Methyl 4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate (Formula Removed) The title compound was prepared according to the procedure of Example 269 a), except substituting methyl 4-bromo-2-thiophenecarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate LCMS (ES) m/z 224 0 (M*H)+ b) methyl 4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate (Formula Removed) A solution of methyl 4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate (500 mg, 2 24 mmol) and NCS (1196 mg, 8 96 mmol) in N,N-Dimethylformamide (DMF) (10 ml) was heated at 50 °C for 2hr The reaction mixture was diluted with 50 ml of EtOAc The organic layer was washed with H2O (50 ml x 2) and brine (50 ml), and then concentrated to give 460 mg of a crude mixture, which was used in next step without further separation LCMS (ES) m/z 258 0 (M+H)+ c) 4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid (Formula Removed) The title compound was prepared following the procedure of Example 269 b), except substituting methyl 4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate for methyl 4-(1-methyl-1H-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecarboxylate LCMS (ES) m/z 244 0(M+H)+ d) N-{(1S)-2-amino-1 -[(3,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared following the procedure of Example 269 c-d), except substituting 4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid for 4-(1-methyMH-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecaroxylic acid and substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 412 0/414 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 13 (m, 1H), 8 06 (m, 1H), 6 97 (m, 2H), 6 82 (m, 1H), 4 55 (m, 1H), 4 16 (s, 3H), 3 26 (m 2H), 3 04 (m, 2H) Example 274 (Formula Removed) Preparation of N-(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared following the procedure of Example 273, except substituting 2-[(2S)-2-amino-3-(3,4-drfluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (82 mg, 0 15 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 412 0/414 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 12 (d, J=1Hz,1H), 8 05 (d, J=1Hz,1H) 7 30-7 10 (m, 3H), 4 55 (m, 1H), 4 16 (s, 3H), 3 26 (m 2H), 2 99 (m, 2H) Example 275 (Formula Removed) Preparation of N-(1S)-2-amino-1-[(2-(trifluoromethyl)pheoyl)methyl]ethyl]-4-(4-chloro-1-methyl-1H-1.2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared following the procedure of Example 274, except substituting 2-[(2S)-2-amino-3-(2-(trifluoromethyl)phenyl)propyl]-1H-isoindole-1,3(2H)-dione (130 mg, 0 23 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 444 0/446 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 13(d, J=1Hz,1H), 8 09 (d, J=1Hz,1H), 7 72 (m, 1H), 7 56 (m, 2H), 7 43 (m, 1H), 4 60 (m, 1H), 4 17 (s, 3H), 3 26-3 15(m, 4H) Example 276 (Formula Removed) Preparation of N-(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1 ,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared following the procedure of Example 273, except substituting 2-[(2S)-2-amino-3-(4-chlorophenyl)propyl]-1 H-isoindole-1,3(2/-/)-dione (73 mg, 0 14 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 410 0/412 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 12(d, J=1Hz,1H), 8 03 (d,J=1Hz,1H), 7 31 (m, 4H), 4 55 (m, 1H), 4 15 (s, 3H), 3 26 (m 2H), 3 05 (m, 2H) Example 277 (Formula Removed) Preparation of N-(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared following the procedure of Example 273, except substituting 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (67 mg, 0 12 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione LCMS (ES) m/z 444 0/448 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 12(d, J=1Hz,1H), 8 03 (d, J=1Hz, 1H), 7 49 (d, 1H), 7 38 (d, 1H), 7 25 (m, 1H), 4 60 (m, 1H), 4 16 (s, 3H), 3 30-3 09 (m, 4H) Example 278 (Formula Removed) Preparation N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(cycolhexyl)propyl]carbamate (300 mg, 0 67 mmol) for 1,1 -dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 348 2 (M+H)+, 1H NMR (400 MHz, METHAN0L-d4) δppm 8 09(d, J=1Hz,1H), 8 03 (d, J=1Hz, 1H), 7 91 (s, 1H), 4 48 (m, 1H), 4 22 (s, 3H), 3 20 (m 1H), 3 05 (m, 1H), 2 00-0 95 (m, 13H) Example 279 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3- cycolhexylpropyl]carbamate (50 mg, 0 11 mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 416 0/418 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 74(s, 1H), 4 48 (m, 1H), 4 04 (s, 3H), 3 40-2 95 (m 2H), 1 90-0 95 (m, 13H) Example 280 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 269, except substituting 2-[(2S)-2-amino-3-cyclohexylpropyl]-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 382 2 (M+Hf, 1H NMR (400 MHz, METHANOL-d4) δppm 7 93 (s, 1H), 7 81 (m, 1H), 4 43 (m, 1H), 4 10 (s, 3H), 3 17 (m 1H), 3 05 (m, 1H), 2 00-0 90 (m, 13H) Example 281 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl]ethyl]-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as an off white solid according to the procedure of 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-cycolhexylpropyl]carbamate (100mg, 0 22mmol) for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate, and the amount of NCS was reduced to 1eq LCMS (ES) m/z 382 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm8 15(d, J=1Hz, 1H), 8 08 (d, J=1Hz,1H), 4 45 (m, 1H), 4 16 (s, 3H), 3 14 (m 1H), 3 05 (m, 1H), 2 00-0 90 (m, 13H) Example 282 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl]ethyl]-5-chloro-4-(4-bromo-1-methyl-1 H-1 ^.S-triazol-S-vD^-thiophenecarboxamide A solution or 1,1-dimethylethyl [(2S)-2-({[5-chloro-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}ainino)-3-cyclohexylpropyl]carbamate (140mg, 0 29 mmol, prepared in Example 280) and NBS (103 mg, 0 58 mmol) in 2 mL of DMF was neated at 100 CC for 2 hours The reaction mixture was punfied by reverse phase HPLC (5-65% acetonitnle in H20 with 1% TFA) to give the title compound 14 1mg (8%) as a white solid LCMS (ES) m/z 462 0 (M+H)\ 1H NMR (400 MHz, METHANOL-d4) δppm 7 75 (s, 1H), 4 43 (m, 1H), 4 05 (s, 3H), 3 17 (m 1H), 3 05 (m, 1H), 2 00-0 90 (m, 13H) Example 283 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(phenylmethyl]ethyl]-5-n-methyl-1ry-1,2.3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(5-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl]carbamate (270 mg, 0 62 mmol) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-th lenyl )ca rbonyl]am ino}-3-phenylpropyl)carbamate LCMS (ES) m/z 342 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 96 (s, 1H), 7 75 (d, J=3 6Hz, 1H), 7 47 (d, J=3 6Hz, 1H), 7 31-7 22 (m, 5H), 4 55 (m, 1H), 4 21 (s, 3H), 3 20(m, 2H) 2 99 (m, 2H) Example 284 Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-(4-chloro-1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecorboxamide The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1 dimethylethyl [(2S)-2-({[5-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (68 mg, 0 15 mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-i,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 376 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δ ppm 7 82 (m, 1H), 7 55 (d, J=3 6Hz, 1H), 7 47 (d, J=3 6Hz, 1H), 7 32-7 23 (m, 5H), 4 55 (m, 1H),4 19 (s, 3H), 3 20(m, 2H), 3 02 (m, 2H) Example 285 (Formula Removed) Preparation of N-(C\ S)-2-amino-1-{r2-(trifluoromethyOphenyl]methyl}ethyO-5-methyl-4-(1-methyl-1 H-1.2.3-triazol-5-yl)-2-furancarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 269, except substituting methyl 4-bromo-5-methyl-2-furanocarboxylate (ref Bach, T , Kruger, L Synlett 1998, 1185-1186) for methyl 4-bromo-5-chloro-2-thiophenecarboxylate LCMS (ES) m/z 408 2 (M+H)+, 1H NMR (400 MHz, METHANOL-^) δppm 8 09 (s, 1H), 7 71 (m, 1H), 7 55 (m, 2H), 7 43 (m, 2H), 4 68 (m, 1H), 4 13 (s, 3H), 3 25-3 15 (m, 4H), 2 48 (s, 3H) Example 286 (Formula Removed) Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)ph6nvnmethyl}ethyl)-4-(1-methyl-1 H-1.2,3-triazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-furanyl)carbonyl]amino}-3-(2-(trifluoromethyl)phenyl)propyl]carbamate (200 mg, 0 4 mmol)for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LCMS (ES) m/z 394 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δ ppm 8 23 (s, 1H), 7 93 (s, 1H), 7 71 (d, 1H), 7 54 (m, 2H), 7 43 (m, 2H), 4 75 (m, 1H), 4 18 (s, 3H), 3 30-3 10(m, 4H) Example 287 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furanyl]carbonyl}amino)-3-(2-(trifluoromethyl)phenyl)propyl]carbamate (90 mg, 0 18 mmol) for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamane LCMS (ES) m/z 462 0/464 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 73 (m, 1H), 7 56 (m, 2H), 7 45 (m, 1H), 7 40 (s, 1H), 4 75 (m, 1H), 4 05 (s, 3H), 3 30-3 10 (,n, 4H) Example 268 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[3-fluorophenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 269, except substituting methyl 4-bromo-5-methyl-2-furanocarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate and 2-{(2S)-2-amino-3-[3-fluorophenyI]propyl}-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LCMS (ES) m/z 358 2 (M+H)\ 1H NMR (400 MHz, METHANOL-cW) δppm 8 47 (s, 1H), 7 44 (s, 1H), 7 35 (m, 1H), 7 15 (m, 2H), 6 96 (m, 1H), 4 65 (m, 1H), 4 22 (s, 3H), 3 25 (m, 2H), 3 04(m, 2H), 2 49 (s, 3H) Example 289 (Formula Removed) Preparation of N-((1S)-2-amino-14f3.5-difluorophenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2.3-triazol-5-yl)-2-furancarboxamide The title compound was prepared as an off-white solid according to the procedure of Example 269 except substituting methyl 4-bromo-5-methyl-2-furanocarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate and 2-{(2S}-2-amino-3-[3,5-difluorophenyl]propyl}-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LCMS (ES) m/z 376 2 (M+H)+, 1H NMR (400 MHz, METHANOL-c(4) δppm 8 30 (s, 1H), 7 43 (s, 1H), 6 95 (m, 2H), 6 82 (m, 1H), 4 53 (m, 1H), 4 18 (s, 3H), 3 25 (m, 2H), 3 07(m, 2H), 2 48 (s, 3H) Example 290 (Formula Removed) Preparation of N-[(1S)-2-amino-H(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 261, except substituting [(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide (prepared according to Example 263) for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate and following Example 269 for deprotection LCMS (ES) m/z 446 0/448 0 (M+H)+, 1H NMR (400 MHz, METHANOL-c/4) δppm 7 88 (s, 1H), 7 20-7 15 (m, 3H), 4 53 (m, 1H), 4 05 (s, 3H), 3 23 (m, 2H), 3 00 (m, 2H) Example 291 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-1.2.4-triazol-5-yl)--2-thiophenecarboxamide a) 1,1 -dimethylethy! [(2S)-2-({[4-(1 -methyl-1 H-1 ,2,H triazol-5-yl)-2- thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) A suspension of 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (prepared according to preparation 22 except substituting 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione) (200 mg, 0 455 mmol), dioxabonnane (123 mg, 0 546 mmol), potassium acetate (134 mg, 1 366 mmol), and PdCI2(dppf)2 (16 7 mg, 0 023 mmol) in dry THF (3 ml) was charged into a sealed tube and heated to 80 °C for one hour 5-lodo-1-methyl-1 H-1,2,4-triazole (114 mg, 0 546 mmol), 2M sodium carbonate (0 34 ml, 0 683 mmol) and Pd(Ph3P)4 (26 3 mg, 0 023 mmol) were then added The mixture was heated at 85 °C for 2 hours The solvent was removed and the residue was punfied by biotage (70% H/E) to give the title product (120 mg, 60%) b) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2- thiophenecarboxamide (Formula Removed) TFA (1 ml) was added to a solution of 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (Formula Removed) (100mg, 0 226 mmol) in DCM (5 ml) The reaction was stirred at RT for 30 mm The solvent was removed and the residue was punfied by reverse phase HPLC (10% org - 60% org) to give the title compound as a white solid (90 mg, 87%) LC-MS (ES) m/z 342 2 (M+H)+, 1H NMR (d4-M60H, 400 MHz) δ 8 23 (s, 1H), 8 03 (m, 2H), 7 22-7 31 (m, 5H), 4 60 (m, 1H), 4 08 (s, 3H), 3 10-3 20 (m, 2H), 3 00 (m, 2H) Example 292 (Formula Removed) Preparation of A/4(1S)-2-amino-1-[(3.4-difluorophenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxamide a) 1,1 -dimethylethyl [(2S)-3-(3,4-difluorophenyl)-2-({[4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)propyl]carbamate (Formula Removed) This intermediate was prepared according to the procedure of Example 291 a) except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2- thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamatefor 1,1- dimethylethyl ((2S)-2-{[(4-bromo-2-thlenyl)carbonyl]amino}-3- phenylpropyl)carbamate LC-MS (ES) m/z = 478 2 (M+H)+ b) /v-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl- 1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide A solution of 1,1-dimethylethyl [(2S)-3-(3,4-difluorophenyl)-2-({[4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)propyl]carbamate (279 mg, 0 497 mmol) and NCS (133 mg, 0 993 mmol) in N,N-Dimethylformamide (DMF) (3 ml) was heated at 110 °C for 1 hr The crude reaction mixture was concentrated and the residue was punfied by flash column chromatography on silica gel (DCM MeOH NH4OH 9 1 1) to give the product as a free base, which was treated with 0 13 mL of 2N HCI aq (2 eq ) to give 75 mg of HCI salt as an off-white solid LC-MS (ES) m/z = 412 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8 80 (s, 1H), 8 18 (s, 1H), 7 3-7 1 (m, 3H), 4 54 (m, 1H), 4 11 (s, 3H), 3 26 (d, J = 7 Hz, 2H), 3 03 (d, J = 8 Hz, 2H) Example 293 (Formula Removed) Preparation of N-{nS)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared an off-white solid according to the procedure of Example 291 except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate for 1,1-dimethylethyl((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final product was purified by flash column chromatography on silica gel (DCM MeOH NH4OH 9 1 1) to give a free base, which was treated with 2N HCI aq solution to give the HCI salt LC-MS (ES) m/z = 378 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8 78 (s, 1H), 8 50 (d, J = 2Hz, 1H), 8 36 (d, J = 2Hz, 1H), 7 3-7 1 (m, 3H), 4 57 (m, 1H), 4 23 (s, 3H), 3 27 (d, J = 8 Hz, 2H), 3 04 (d, J = 8 Hz, 2H) Example 294 (Formula Removed) Preparation of N-[(1 S,2S)-2-amino-3-hydroxy-1-phenylpropylV5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide a) 1,1-dimethylethyl [(1S,2S)-2-amino-1-({[(1,1-dimethylethyl)(dimethyl)silyl]oxy}methyl)-2-phenylethyl]carbamate (Formula Removed) he title compound was prepared according to Preparation 1 except substituting 1,1-dimeihylethyl [(1R,2R)-1-({[(1,1- dimethylethyl)(dimethy!)siyl]oxy}methyl)-2-hydroxy-2-phenylethyl]carbarnate(ref Veeresa, G , Datta, Apurba Stereoselective synthesis of chloramphenicol from D-senne Tetrahedron Letters (1998\ 39(46), 8503-8504 ) for 1,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate b) N-[(1S,2S)-2-amino-3-hydroxy-1-phenylpropyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide This intermediate was prepared according to the procedures of Example 261, except substituting 1,1-dimethylethyl [(1S,2S)-2-amino-1-({[(1,1-dimethylethyl)(dimethyl)silyl]oxy}methyl)-2-phenylethyl]carbamate for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z = 425 0/427 0 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 86 (s, 1H), 7 59 (s, 1H), 7 56-7 38 (m, 5H), 5 50(m, 1H), 3 91-3 84 (m, 3H) Example 295 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide a) Methyl 4-bromo-5-chloro-2-furancarboxylate (Formula Removed) Isopropylmagnesium chloride (1 20 ml, 2 40 mmol) was added dropwise to a solution of methyl 4,5-dibromo-2-furancarboxylate (568 mg 2 0 mmol) in Tetrahydrofuran (THF) (16 ml) at 0 °C The resulting mixture was stirred at this temperature for 30 mm and then cooled to -78 °C A solution of hexylchloroethane (568 mg, 2 401 mmol) in THF (1 mL) was added dropwise, and the resulting mixture was stirred at this temperature for 1 hr The reaction was quenched with addition of NH4CI (sat aq) and the resulting mixture was stirred at rt overnight Ether and water were added and the aqueous layer was discarded The organic layer was washed with brine, dried (Na2SO4) and concentrated to give 0 34 g of the product containing its isopropyl ester b) N-t(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide The title compound was prepared according to the procedure of Example 273, except substituting methyl 4-bromo~5-chloro-2-furancarboxylate for methyl 4-bromo-2-thiophenecarboxylate, and substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione The final product was purified by RP-HPLC and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z = 412 0/414 0 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 44 (s, 1H), 7 33 (m, 1H), 7 14-7 07 (m, 2H), 6 98 (m, 1H), 4 55 (m, 1H), 4 05 (s, 3H), 3 25-2 98 (m, 4H) Example 296 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide a) 1,1-dimethylethyl ((2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3- ph enylpropy I )ca rba mate A solution of 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (prepared according to Preparation 22), except substituting 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-'2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 455 mmol) and NCS (61 mg, 0 455 mmol) in DMF (3 ml) was heated at 50 °C in a sealed tube for 2 hours The solvent was removed and the residue was purified by biotage (30% Hex/EtOAc) to give the title product (140 mg, 65%) b) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5- yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according the procedure of Example 291, except substituting 1,1-dimethylethyl ((2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LC-MS (ES) m/z 376 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 12 (s, 1H), 7 74 (s, 1H), 7 31-7 35 (m, 5H), 4 58 (m, 1H), 3 94 (s, 3H), 3 35 (m, 2H), 3 05 (m, 2H) Example 297 (Formula Removed) Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamate for 1,1 -dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate, LC-MS (ES) m/z 410 2 (M+H)\ 1H NMR (d4-MeOH, 400 MHz) δ 8 33 (m, 2H), 7 73 (m, 1H), 7 41-7 56 (m, 4H), 4 70 (m, 1H), 4 13 (s, 3H), 3 36(m, 2H), 3 18(m, 2H) Example 298 (Formula Removed)Preparation of N-[(1S)--2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 24 (s, 1H), 8 06 (m, 2H), 7 29-7 34 (m, 2H), 7 01-7 05 (m, 2H), 4 66 (m, 1H), 4 08 (s, 3H), 3 23 (m, 2H), 3 15 (m, 2H) Example 299 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxarrnde The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4- difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC to give the title compound as a white solid LC-MS (ES) m/z 394 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 10 (s, 1H), 7 70 (s, 1H), 7 28-7 31 (m, 2H), 7 01-7 06 (m, 2H), 4 56 (m, 1H), 3 92 (s, 3H), 3 21 (m, 2H), 2 96 (m, 2H) Example 300 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-cyclohexylpropyl)carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropylCarbamate LC-MS (ES) m/z 348 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 27 (m, 1H), 8 13 (s, 1H), 8 02 (s, 1H), 4 56 (m, 1H), 4 11 (s, 3H), 3 16 (m, 1H), 3 02 (m, 1H), 1 17-1 95 (m, 13H) Example 301 (Formula Removed) Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-cyclohexylpropyl)carbamate for 1,1-dimethylethyl[(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC to give the title compound as a white solid LC-MS (ES) m/z 382 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 10 (s, 1H), 7 82 (s, br, 1H), 4 42 (m, 1H), 3 94 (s, 3H), 3 16-3 30 (m, 1H), 2 98-3 10 (m, 1H), 1 06-1 96 (m, 13H) Example 302 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl)ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamatefor 1,1 -dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate, The final compound was purified by RP-HPLC to give the title compound as a white solid LC-MS (ES) m/z 444 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 20 (s, brJH), 7 86 (s, br, 1H), 7 71 (m, 1H), 7 42-7 56 (m, 3H), 4 63 (m, 1H), 3 96 (s, 3H), 3 09-3 27 (m, 4H) Example 303 (Formula Removed) Preparation of N-{(1S)--2-amino-1-[(3-fluorophenyl)methyl]ethyl\|-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3-fluorophenyl)propyl]carbamatefor 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 24 (s, 1H), 8 02 (m, 2H), 7 30 (m, 1H) 7 06-7 13 (m, 2H), 6 96 (m, 1H), 4 63 (m, 1H), 4 08 (s, 3H), 3 09-3 27 (m, 4H) Example 304 (Formula Removed) Preparation of N-[(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-([(4-bromo-2-thienyl)carbonyl]amino}-3-(3-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4- difluorophenyl)propyl]carbamate, The final compound was purified by RP-HPLC to give the title compound as a white solid LC-MS (ES) m/z 394 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 10 (s, 1H), 7 70 (s, 1H), 7 31 (m, 1H), 6 97-7 11 (m, 3H), 4 52 (m, 1H), 3 92 (s, 3H), 2 96-3 26 (m, 4H) Example 305 (Formula Removed) Preparation of N-((1S)-2-amino-1-{r3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2- thienyl)carbonyl]amino}-3-[3-(trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 410 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 81 (s, 1H), 8 51 (d, J=1Hz, 1H), 8 39 (d, J-1Hz, 1H), 7 64 (m, 2H), 7 50 (m, 2H), 4 66 (m, 1H), 4 23 (s, 3H), 3 30 (m, 2H), 3 15(m, 2H) Example 306 (Formula Removed) Preparation of N-(C\ S)-2-amino-1-{r3-(trifluoromethyl]Dhenyllmethyl)ethyl)-5-chloro-4-(1 -methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 292, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-[3-(trifluoromethyl)phenyl]propyl}carbamatefor 1,1-dimethylethyl[(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate The final compound was punfied by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 440 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 53 (s, 1H), 8 02 (s, 1H), 7 50-7 64 (m, 4H), 4 56 (m, 1H), 4 03 (s, 3H), 3 10-3 27 (m, 4H) Example 307 (Formula Removed) Preparation of N-inS)-2-amino-1-[(3.5-difluorophenyl)methyl]ethy[M-n-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2- thienyl)carbonyl]arrl,no}-3-(3,5-difluorophenyl)propyl]carbamate for 1,1- dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3- phenylpropyl)carbamate, The findi compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LCVS (ES) m/z 378 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 68 (s, 1H), 8 47 (d, J=1Hz, 1H), 8 35 (d, J=1 Hz, 1H), 6 96 (m, 2H), 6 80 (m,1 H), 4 60 (m, 1H), 4 21 (s, 3H), 3 28 (m, 2H), 3 08 (m, 2H) Example 308 (Formula Removed) Preparation of N-l(1S)-2-amino-1-[(3.5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2- thienyl)carbonyl]amino}-3-(3,5-difluorophenyl)propyl]carbamate for 1,1- dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4- difluorophenyl)propyl]carbamate, The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 412 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 44 (s, 1H), 7 98 (s, 1H), 6 96 (m, 2H), 6 82 (m, 1H), 4 66 (m, 1H), 4 01 (s, 3H), 3 20-3 25 (m, 2H), 3 02-3 05 (m, 2H) Example 309 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluorometnyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxainide a) 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonyl]amino}-3-[2- (trifluoromethyl)phenyl]propyl}carbamate (Formula Removed) This intermediate was prepared according to Preparation 22, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (Bioorganic & Medicinal Chemistry Letters (2002), 12(3), 491-495) for 4-bromo-2-thiophenecarboxylic acid, and substituting 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isomdole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl- 1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonyl]amino}-3-[2- (trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 424 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 68 (s, 1H), 8 04 (s, 1H), 7 70 (m, 1H), 7 58 (m, 1H), 7 52 (m, 1H), 7 43 (m, 1H), 4 65 (m, 1H), 4 05 (s, 3H), 3 16-3 28 (m, 4H), 2 59 (s, 3H) Example 310 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl]-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(2-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 60 (s, 1H), 8 43 (d, J=1Hz, 1H), 8 24 (d, J=1Hz, 1H), 7 37 (m, 1H), 7 27 (m, 1H), 7 08 (m, 2H), 4 66 (m, 1H), 4 19 (s, 3H), 3 27 (m, 2H), 3 10 (s, 2H) Example 311 (Formula Removed) Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonylJamino}-3-[2- (trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 31 (s, 1H), 7 94 (s, 1H), 7 70 (m, 1H), 7 56 (m, 2H), 7 43 (m, 1H), 4 65 (m, 1H), 4 19 (s, 3H), 3 15-3 28 (m, 4H), 2 50 (s, 3H) Example 312 (Formula Removed) Preparation of N-((1S)-2-amino-1-{r2-(triflUoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-1,2.3-triazol-5-yl)-5-methyl-2 thiophenecarboxamide The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 458 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 70 (m, 2H), 7 55 (m, 2H), 7 44 (m, 1H), 4 67 (m, 1H), 3 99 (s, 3H), 3 12-3 21 (m, 4H), 2 42 (s, 3H) Example 313 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-1,2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4- difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 394 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) S 8 49 (s, 1H), 7 95 (s, 1H), 7 27-7 36 (m, 2H), 7 06-7 13 (m, 2H), 4 61 (m, 1H), 4 03 (s, 3H), 3 02-3 25 (m, 4H) Example 314 (Formula Removed) Preparation of N-((1S)-2-amino-1-f[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-furancarboxamide The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-furanyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamatefor 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 394 2 (M+H)\ 1H NMR (d4-MeOH, 400 MHz) δ 8 50 (s, 1H), 8 43 (s, 1H), 7 71 (m, 1H), 7 61 (s, 1H), 7 54 (m, 2H), 7 42 (m, 1H), 4 66 (m, 1H), 4 14 (s, 3H), 3 25 (m, 2H), 3 14 (m, 2H) Example 315 (Formula Removed) Preparation of N-((1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2- thienyl)carbonyl]amino}-3-(2,4-dichlorophenyl)propyl]carbamate(from Preparation 22) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt wth 2N HCI aqueous solution LC-MS (ES) m/z 410 0 (M+Hf, 1HNMR (J4-MeOH, 400 MHz) δ 8 23 (s, 1H), 8 14 (m, 2H), 7 47 (d, J=1Hz, 1H), 7 41 (d, J=1Hz, 1H), 7 25 (m, 1H), 4 68 (m, 1H), 4 30 (s, 3H), 3 11-3 28 (m, 4H) Example 316 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(2,4-dichlorophenyl)propyl]carbamate (from Preparation 22) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 410 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 71 (s, 1H), 8 47 (d, J=1Hz, 1H), 8 34 (d, J=1Hz, 1H), 7 45(m, 2H), 7 23 (m, 1H), 4 71 (m, 1H), 4 23 (s, 3H), 3 14-3 22 (m, 4H) Example 317 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2.4-dichlorophenyl]methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1.2,4-trtazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amiiio}-3-(2,4-dichlorophenyl)propyl]carbamatefor 1,1-dimethylethyl[(2S)-2-{[(4-bromo-2-thienyi)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate The final compound was punfied by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 446 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 65 (s, 1H), 3 11 (s, 1H), 7 44 (m, 2H), 7 25 (m, 1H), 4 68 (m, 1H), 4 08 (s, 3H), 3 10-3 23 (m, 4H) Example 318 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(2,4-dichlorophenyl)propyl]carbamate (from Preparation 21) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 480 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 80 (m, 1H), 7 48 (m, 1H), 7 39 (m, 1H), 7 27 (m, 1H), 4 66 (m, 1H), 4 05 (s, 3H), 3 08-3 14 (m, 4H) Example 319 (Formula Removed) Preparation of N-{(1S)-2-y mino-1-[(4-chlorophenyl)methyl]ethyl)--4-(1-methyl-1 H-1.2,4-triazol-5-yl)--2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl K2S)-2-{[(4-bromo-2- thienyl)carbonyl]amino}-3-(4-chlorophenyl)propyl]carbamate for 1,1 -dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 376 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 68 (s, 1H), 8 46 (d, J=1Hz, 1H), 8 29 (d, J=1Hz, 1H), 7 27-7 34 (m, 4H), 4 57 (m, 1H), 4 21 (s, 3H), 3 25 (m, 2H), 3 04 (m, 2H) Example 320 (Formula Removed) Preparation of N-i(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-n-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2- thienyl)carbonyl]amino}-3-(4-chlorophenyl)propyl]carbamate for 1,1 -dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4- difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 410 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 47 (s, 1H), 7 97 (s, 1H), 7 30 (m, 4H), 4 60 (m, 1H), 4 03 (s, 3H), 3 22 (m, 2H), 3 00 (m, 2H) Example 321 (Formula Removed) Preparation of N4(1S)-2-arr i,icM-[(3.5-difluorophenv0methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-1.2,3-triazol-5-yl)-2-thiop:-.enecarboxamide The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-?-thienyl)carbonyl]amino}-3-(3,5-difluorophenyl)propyl]carbamatefor 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 446 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 80 (s, 1H), 6 95 (m, 2H), 6 84 (m, 1H), 4 62 (m, 1H), 4 04 (s, 3H), 3 20 (m, 2H), 3 01 (m, 2H) Example 322 (Formula Removed) Preparation of N-i(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-1.2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-chlorophenyl)propyl]carbamate for 1,1 -dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 444 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) S 7 73 (s, 1H), 7 30 (m, 4H), 4 66 (m, 1H), 4 04 (s, 3H), 3 18 (m, 2H), 2 99 (m, 2H) Example 323 (Formula Removed) Preparation of N-((1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-5-chloro-4-(1.4-dimethyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide a) 4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarbox> he acid (Formula Removed) This intermediate was prepared according to the procedures of Example 269 a) and b) except substituting 1,4-dimethyl-5-(tnbutylstannanyl)-1H-1,2,3-triazole (from Preparation 21) for 1-methyl-5-(tnbutylstannanyl)-1H-1,2,3-triazole and substituting methyl 4-bromo-2-thiophenecarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate LC-MS (ES) m/z 224 2 (M+H)+ b) 4-(1,4-Dimethyl-1 H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H- isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) This intermediate was prepared according to the procedure of Example 269 c) except substituting 4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid for 5-chloro-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid, and substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 504 2 (M+H)+ c) 5-chloro-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fIuorophenyl)methyl]ethyl}-2-thiophenecarboxamide (Formula Removed) A solution of 4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (254 mg, 0 454 mmol), and NCS (60 6 mg, 0 454 mmol) in N,N-Dimethylformamide (DMF) (5 mL) to was heated at 40 °C overnight The reation mixture was taken into EtOAc, which was washed with H20 3X and brine, dried (Na2SO4) and concentrated The residue was punfied on a 25g Biotage column, which was eluted with 50-100% EtOAc /hexane to give 76 mg (28%) of product as a white foamy solid and 63 mg of recovered starting material LC-MS (ES) m/z 538 0 (M+H)+ d) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 269 d), except substituting 5-chloro-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide for 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 408 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 88 (m, 1H), 7 30 (m, 1H), 7 10 (m, 2H), 6 96 (m, 1H), 4 65 (m, 1H), 4 10 (s, 3H), 3 21 (m, 2H), 3 03 (m, 2H), 2 06 (s, 3H) Example 324 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl}-4-(1.4-dimethyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedures of Example 323 a), b) and d), except substituting 4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-AA-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide for 5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide LC-MS (ES) m/z 374 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 09 (d, J=1Hz, 1H), 8 06 (d, J=1Hz, 1H), 7 31 (m, 1H), 7 16 (m, 1H), 6 96 (m, 1H), 4 56 (m, 1H), 4 20 (s, 3H), 3 23 (m, 2H), 3 05 (m, 2H), 2 47 (s, 3H) Example 325 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3,5-difluorophenyl]methyl]ethyl}-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedures of Example 323 a), b) and d), except substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 392 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 13 (m, 2H), 6 99 (m, 2H), 6 79 (m, 1H), 4 59 (m, 1H), 4 22 (s, 3H), 3 26 (m, 2H), 3 06 (m, 2H), 2 49 (s, 3H) Example 326 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3.5-difluorophenyl]methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 323, except substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 426 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 88 (s, 1H), 6 96 (m, 2H), 6 82 (m, 1H), 4 62 (m, 1H), 4 07 (s, 3H), 3 22 (m, 2H), 3 05 (m, 2H), 2 34 (s, 3H) Example 327 (Formula Removed) Preparation of N-{(1S)-2-amino-1-[(3,4-difluorophenvl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide The title compound was prepared as a white solid according to the procedure of Example 323, except substituting substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 426 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 87 (s, 1H), 7 12-7 26 (m, 3H), 4 62 (m, 1H), 4 08 (s, 3H), 3 21 (m, 2H), 3 00 (m, 2H), 2 36 (s, 3H) Example 328 (Formula Removed) N-((1S)-2-amino-1-[(3.4 difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide a) methyl 4-bromo-5-methyl-2-furancarboxylate (Formula Removed) To a solution of methyl 4,5-dibromo-2-furancarboxylate (4 5 g, 15 85 mmol) and BIS(TRIPHENYLPHOSPHINE)PALLADIUM(ll) CHLORIDE (0 38 g, 0 541 mmol) in THF (100 mL) at RT was added chloro(methyl)zinc (15 mL, 30 mmol) dropwise After stirring for 10h, the reaction was quenched with NH4CI (sat'd) (50 mL) The mixture was extracted with EtOAc (50 mL x 3), and the collected organic layers were dried over MgSO4 Solvent was removed under vaccum and the resulting residue was punfied via column chromatography (silica, EtOAc/Hex 10-20%) to give the title compound (2 5 g, 72%) as a white solid LC-MS (ES) m/z 220 (M+H)+ b) methyl 4-(1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (Formula Removed) To a 100 mL sealed flask was added 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 2 g, 9 91 mmol), potassium carbonate (2 84 g, 20 54 mmol), methyl 4-bromo-5-methyl-2-furancarboxylate(1 5 g, 6 85 mmol) and BIS(TRI-T-BUTYLPHOSPHINE)PALLADIUM(0) (0 175 g, 0 34 mmol) in 1,2-dimethoxyethane (6 mL) and H2O (1 mL) After stirring for 2h at 72 °C, the reaction solution was diluted with DCM (50 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was punfied on silica gel [EtOAC/hexanes, 10-30%] to give the product [1 1 g, 68 6%] as an off white solid LC-MS (ES) m/z 235 (M+H)+ c; methyl 4-(4-ch!oro-1-ethyl-1 H-pyrazol-5-yl)-5-methyl-2-forancarboxylate (Formula Removed) A mixture of methyl 4-(1-ethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (950 mg, 4 06 mmol) and NCS (650 mg, 4 87 mmol) in THF (10 mL) was heated at 70 °C in a sealed tube After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 10-20% EtOAc/Hexane) affording the title compound (970 mg, 89%) as a white solid LC-MS (ES) m/z 269 (M+H)+ d) 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-furancarboxamide (Formula Removed) To a solution of methyl 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (500 mg, 1 86 mmol) in THF/H2O (5mL/1 mL) was added KOH (500 mg, 8 91 mmol) The reaction mixture was heated to 50° C for 4 h The mixture was concentrated, diluted with H2O (2 mL) and the pH was adjusted to 3 The mixture was extracted with DCM (10 mL x 3) The collected organic layers were concentrated under vacuum to give a crude acid (460 mg, 97%), which was used directly without of further purification LC-MS (ES) m/z 255 (M+H)+ , To the above acid (221 mg, 0 869 mmol) in DCM (5 mL) at 25 °C was added PyBrOP(480 mg, 1 03 mmol) in one portion, followed by addition of DIPEA (1 0 mL, 5 73 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (250 mg, 0 79 mmol) was added to the reaction solution After 1h, the reaction mixture was concentrated and purified via column chromatography (silica, 30-50 % EtOAc/Hexane) affording the title compound (401 mg, 92%) as a white solid LC-MS (ES) m/z 553 (M+H)+ e)N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (Formula Removed) At rt, NH2NH2 (0 5 mL, 15 93 mmol) was added to 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-furancarboxamide (260 mg, 0 47 mmol) in MeOH (5 mL) After 48h, the solvent was removed under vaccum The resulting residue was taken into DCM (20 mL), and washed with H2O (20 mL x 3) To the DCM solution was added HCI (36%, 10 mL, 120 mmol) After 1h, the aqueous phase was separated, and washed with DCM (30 ml x 3) Water was removed under high vacuum to give the title compound (140 mg, 69 7%) as an off-white solid LC-MS (ES) m/z 423 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 59 (s, 1H), 7 27-7 16 (m, 3H), 7 13-7 08 (m, 1H), 4 56 (m, 1H), 4 06 (q, J = 7 3 Hz, 2H), 3 26-3 22 (m, 1H), 3 17-311 (m, 1H), 3 05-3 00 (m, 1H), 2 97-2 91 (m, 1H), 2 36 (s, 3H), and 1 33 (t, J = 7 3 Hz, 3H) Example 329 - Capsule Composition An oral dosage form for administering the present invention is produced by filing a standard two piece hard gelatin capsule with the ingredients in the proportions shown in Table I, below Table I (Table Removed) Example 330 - Intertable Parenteral Composition An injectable form for administering the present invention is produced by stirring 1 5% by weight of N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Compound of Example 2) in 10% by volume propylene glycol in water Example 331 - Tablet Composition The sucrose, calcium sulfate dihydrate and an Akt inhibitor as shown in Table II below, are mixed and granulated in the proportions shown with a 10% gelatin solution The wet granules are screened, dried, mixed with the starch, talc and stearic acid,, screened and compressed into a tablet Table II (Table Removed) While the preferred embodiments of the invention are illustrated by the above, it is to be understood that the invention is not limited to the precise instructions herein disclosed and that the right to all modifications coming within the scope of the following claims is reserved What is claimed is: 1. A compound of Formula (I): (Formula Removed) R41 and R42 are independently selected from: hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted C1-4alkyloxy, furan, substituted fruan, thiophene and substituted thiophene, where Q and Y are independently selected from: nitrogen and -C(R70 )-, and Z is selected from: nitrogen and -C(R48 )-, provided that at least one and at most 2 of Q, Y and Z are nitrogen, and R30 is selected from: C1-4alkyl and C1-4alkyl substituted with form one to three fluorine atoms, where R is selected from: hydrogen, and halogen, and R48 is selected from: hydrogen, C1-4alkyl, substituted C1-4alkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, cylcoalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, and halogen; R43 is selected from: hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted C1-4alkyloxy, furan and thiophene; R44 is absent or selected from: -(CR60 R61 )mAR wherein the AR is unsubstituted, -( CR60 R61 )mAR wherein the AR is substituted and C1-6alkyl, where m is 0 to 3 and AR is a cyclic or polycyclic aromatic or saturated or unsaturated non-aromatic ring containing from 3 to 16 carbon atoms and optionally containing from one to three heteroatoms, provided that when the ring is aromatic and the number of carbon atoms is 3 the ring contains at least two heteroatoms and when the ring is aromatic and the number of carbon atoms is 4 the ring contains at least one heteroatom, and R and R are independently selected from: hydrogen and C1-4alkyl, provided that when m is 3 no more than 4 of R and R when added together are C1-4alkyl, R45 is selected from hydrogen and C1-4alkyl; R20 is selected from hydrogen, C1-4alkyl and hydroxy; X is selected from O, S and NR49 , where R49 is selected from hydrogen and C1-4alkyl; and n is 0 to 2 and this moiety is optionally, if applicable, substituted by hydroxyC1-4alkyl; (Formula Removed) provided that one and only one of R41 and R42 is and/or a pharmaceutically acceptable salt thereof. 2. A compound of Formula (I), as defined in Claim 1, wherein: (Formula Removed) R41 and R42 are independently selected from: hydrogen, halogen, C1-4alkyl, trifluoromethyl, methoxy and furan, where Q is nitrogen, Y is selected from: nitrogen and -C(R70 )-, and Z is selected from: nitrogen and -C(R48 )-, provided that at most one of Y and Z are nitrogen, and R30 is C1-4a!kyl, where R is selected from: hydrogen, and halogen, and R48 is selected from: hydrogen, C1-4alkyl, trifluoromethyl, phenyl, cylcopropyl, and halogen; R43 is selected from: hydrogen, halogen, C1-4alkyl and methoxy; R44 is absent or selected from: -(CR60 R61 )mAAR wherein the AAR is unsubstituted, -( CR60 R61 )mAAR wherein the AAR is substituted and C1-6alkyl, where m is 0 to 3 and AAR is selected from phenyl, indole, naphthalene, pyridine and cyclohexyl, and R and R are independently selected from: hydrogen and methyl, provided that when m is 3 no more than 4 of R and R when added together are methyl, R45 is selected from hydrogen and C1-4alkyl; R20 is selected from hydrogen, methyl and hydroxy; X is selected from O, S and NR49 , where R49 is selected from hydrogen and methyl; and n is 1 to 2 and this moiety is optionally substituted by hydroxylmethyl; (Formula Removed) provided that one and only one of R41 and R42 is and/or pharmaceutically acceptable salts thereof. 3. A compound of Claim 1 represented by the following Formula (AA): (Formula Removed) wherein: (Formula Removed) R1 and R2 are independently selected from: hydrogen, halogen, C1-4alkyl, furan and thiophene, where R6 is C1-4alkyl and R7 is selected from hydrogen, C1-4alkyl and halogen; R3 is selected from: hydrogen, halogen, C1-4alkyl, furan and thiophene; R4 is selected from -(CH2)maryl and -(CH2 )maryl wherein the aryl is substituted, where m is 0 to 2; 5 R5 is selected from hydrogen and C1-4alkyl; X is selected from O and S; and n is 0 to 2; (Formula Removed) provided that one and only one of R1 and R2 is and further provided that at least one of R1, R2 and R3 is hydrogen; and/or a pharmaceutically acceptable salt thereof. 4. A compound of claim 1 selected from: N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2- furancarboxamide; N-(2-amino-1-phenylethyl)-5-(1-methyl-1 H-pyrazol-5-yl)-2- thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide; N-(2-amino-1 -phenylethyl)-4-{[(2Z)-1 -methyl-2-(2-propen-1 - ylidene)hydrazino]methyl}-2-thiophenecarboxamide; N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H- pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-(3-furanyl)-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamicle; N-[3-amino-1-(phenylmethyl)propyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; 4-bromo-N-[2-(methylamino)-1-phenylethyl]-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1 -(phenylmethyl)ethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[2-amino-1 -(phenylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1-methyl-1H-pyrazol-S-yl)-4-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1 - methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1- methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[1 -(aminomethyl)-3-phenylpropyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide; N-[1-(aminomethyl)-3-phenylpropyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; 4-bromo-N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; 4-bromo-N-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-1-methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-(methylamino)-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-N-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1 S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyI]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[4-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-[2-amino1-(phenylmethyl)ethyl]-5-(1-methyl-1H-imidazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -(1 H-indol-3-ylmethyl)ethyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yI)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(1-naphthalenyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(1-naphthalenyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{2-amino-1 -[2-(trifluoromethyl)phenyl]ethyl}-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyI)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-(3-amino-1-phenylpropyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-ethyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-3,4-dibromo-5-(1-methyl-1 H-pyrazol-5- yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxy-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl- 1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-1H- pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1- ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1 S)-2-amino-1 -{[2-(trifllioromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -ethyI-1H-py razol-5-y I )-2-th ioph eneca rboxa m i d e; N-[2-amino-1-(phenylmethyl)ethyl]-3-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-[(1 S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-((1 S)-2-amino-1-{[2-(triffuoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethylH-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide; N-{(1S)-2-amino-1-[(4-fIuorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide; N-{(1S)-2-amino-1-[(3-fIuorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1H-pyrazol-5-yI)-5-ethyl-2-furancarboxam ide; N-((1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1 S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; /S/-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difchlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,6-difIuorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1 -[(2,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1 S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-cyclopropyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fIuorophenyl)methyj]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(3-f!uotophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-{(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,5-difIuorophenyl)methyl]ethyl}-5-methyi-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fIuorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifruoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(3-pyridinylmethyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1R)-2-amino-1-phenylethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-phenylethyl]-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-phenylethyl]-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-phenylethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-ami no 1 -(4-ch lorophenyl)ethyl]-5-chloro-4-( 1 -methyl-1 H-pyrazol-5-yl )-2-thiophenecarboxamide; N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-[2-amino-1 -(2-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1 -(3-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-(2-aminoethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1 -(4-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(1,4~dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[(1S)-2-amino-1-phenylethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-[(1 S)-2-amino1 -methylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[3-(trifluoromethyl)phenyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-[(1S)-1-(aminomethyl)-3-methylbutyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyra2ol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-arrnno-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H- pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyI)phenyl]methyl}ethyl)-4-(4-chloro-1- ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-py razol-5-yl)-2-th iophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yI)-2-thiophenecarboxamide; N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; (N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1 -ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fIuorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-diethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifIuoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyI]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamicle; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-[(3,4-difIuorophenyl)methy[]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1 -[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -ethyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-{1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyf)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyI}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(phenyrmethyl)ethyl]-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyI)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)72-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-[(1S)-2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-[(1 S)-2-amino-1 -(phenylmethyl)ethyl]-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-[(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1 -[(2,4-dichlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1.4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-[(3,4-clifluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamidej N-[(1S,2S)-2-amino-3-hydroxy-1-phenylpropyl]-5-chloro-4-(4-chloro-1- methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1- methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide; and N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H- pyrazol-5-yl)-5-methyl-2-furancarboxamide; and/or a pharmaceutically acceptable salt thereof. 5. A pharmaceutical composition comprising a compound according to claim 1, and/or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. 6. A process for preparing a pharmaceutical composition containing a pharmaceutically acceptable carrier or diluent and an effective amount of a compound of Formula (I) as described in claim 1 and/or a pharmaceutically acceptable salt thereof, which process comprises bringing the compound of Formula (I) and/or a pharmaceutically acceptable salt thereof into association with a pharmaceutically acceptable carrier or diluent. 7 A pharmaceutical combination as claimed in claim 16 for use in therapy. 8. A compound of Formula (I), as defined in Claim 1, wherein: R is selectpri from: chlorine, ethyl, methyl and methoxy; (Formula Removed) where Q is nitrogen, Y is -CH- and Z is -C(R48 )-, and R30 is selected from methyl and ethyl, where R18 is selected from: hydrogen, methyl, chlorine and bromine; R43 is hydrogen; R44 is -CH2-phenyl wherein the phenyl is substituted by one or two substituents selected from fluorine and trifluoromethyl; R45 is hydrogen; R20 is hydrogen; X is selected from O and S; and n is 1; and/or a pharmaceutically acceptable salt thereof. 9, A compound of claim 3 selected from: N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2- furancarboxamide; N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2- thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide; N-(2-amino-1 -phenylethyl)-4-{[(2Z)-1 -methyl-2-(2-propen-1- ylidene)hydrazino]methyl}-2-thiophenecarboxamide; N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H- pyrazol-5-yl)-2-thiophenecarboxamide; N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}etriyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methy!}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyllethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; and N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; and/or a pharmaceutically acceptable salt thereof. 10. A compound of claim 1 selected from: N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chIoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chIoro-2-thiophenecarboxamide; N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenylJmethyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-{(1 S)-2-amino-1 -[(4-fIuoropheny!)methyl]ethyl}-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-5-(methy!oxy)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-diflIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl- 1H-pyrazol-5-yl)-2-furancarboxamide; N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 - ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; and N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyI-1H-py razol-5-yl)-2-furancarboxam ide; and/or a pharmaceutically acceptable salt thereof. 11. A compound of claim 1 selected from: N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide; N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide; N-{(1 S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-furancarboxamide; and/or a pharmaceutically acceptable salt thereof.

Full Text

INHIBITORS OF Akt ACTIVITY
FIELD OF THE INVENTION This invention relates to novel heterocyclic carboxamide compounds, the use of such compounds as inhibitors of protein kinase B (hereinafter PKB/Akt, PKB or Akt) activity and in the treatment of cancer and arthritis
BACKGROUND OF THE INVENTION The present invention relates to heterocyclic carboxamide containing compounds that are inhibitors of the activity of one or more of the isoforms of the serine/threonine kinase, Akt (also known as protein kinase B), suitably the compounds of the invention are inhibitors of the activity of all three isoforms of the serine/threonine kinase, Akt The present invention also relates to pharmaceutical compositions comprising such compounds and methods of using the instant compounds in the treatment of cancer and arthritis (Liu et al Current Opin Pharmacology 3 317-22 (2003))
Apoptosis (programmed cell death) plays essential roles in embryonic development and pathogenesis of various diseases, such as degenerative neuronal diseases, cardiovascular diseases and cancer Recent work has led to the identification of various pro- and anti-apoptotic gene products that are involved in the regulation or execution of programmed cell death Expression of anti-apoptotic genes, such as Bcl2 or Bcl-xL, inhibits apoptotic cell death induced by vanous stimuli On the other hand, expression of pro-apoptotic genes, such as Bax or Bad, leads to programmed cell death (Adams et al Science, 281 1322-1326 (1998)) The execution of programmed cell death is mediated by caspase -1 related proteinases, including caspase-3, caspase- 7, caspase-8 and caspase-9 etc (Thornberry et al Science, 281 1312-1316(1998))
The phosphatidyhnositol 3'-OH kinase (PI3K)/Akt/PKB pathway appears important for regulating cell survival/cell death (Kulik et al Mol Cell Biol 17 1595-1606 (1997), Franke et al, Cell, 88 435-437 (1997), Kauffmann-Zeh et al Nature 385 544-548 (1997) Hemmings Science, 275 628-630 (1997), Dudek et al, Science, 275 661-665 (1997)) Survival factors, such as platelet derived growth factor (PDGF), nerve growth factor (NGF) and insulin-like growth factor-1 (IGF-I), promote cell survival under various conditions by inducing the activity of PI3K (Kulik et al 1997, Hemmings 1997) Activated PI3K leads to the production of phosphatidylinositol (3,4,5)-trtiphosphate (Ptdlns (3,4,5)-P3), which in turn binds to, and promotes the activation of, the serine/ threonine kinase Akt, which contains a
pleckstrin homology (PH)-domain (Franke et al Cell, 81 727-736 (1995), Hemmings Science, 277 534 (1997), Downward, Curr Opm Cell Biol 10 262-267 (1998), Alessi et al, EMBO J 15 6541-6551 (1996)) Specific inhibitors of PI3K or dominant negative Akt/PKB mutants abolish survival-promoting activities of these growth factors or cytokines It has been previously disclosed that inhibitors of PI3K (LY294002 or wortmannin) blocked the activation of Akt/PKB by upstream kinases In addition, introduction of constitutively active PI3K or Akt/PKB mutants promotes cell survival under conditions in which cells normally undergo apoptotic cell death (Kulik et al 1997, Dudeketal 1997)
Analysis of Akt levels in human tumors showed that Akt2 is overexpressed in a significant number of ovanan (J Q Cheung et al Proc Natl Acad Sci USA 89 9267-9271(1992)) and pancreatic cancers (J Q Cheung et al Proc Natl Acad Sci USA 93 3636-3641(1996)) Similarly, Akt3 was found to be overexpressed in breast and prostate cancer cell lines (Nakatani et al J Biol Chem 274 21528-21532 (1999) It was demonstrated that Akt-2 was over-expressed in 12% of ovarian carcinomas and that amplification of Akt was especially frequent in 50% of undifferentiated tumors, suggestion that Akt may also be associated with tumor aggressiveness (Bellacosa, et al, Int J Cancer, 64, pp 280-285, 1995) Increased Akt1 kinase activity has been reported in breast, ovarian and prostate cancers (Sun et al Am J Pathol 159 431-7(2001))
The tumor suppressor PTEN, a protein and lipid phosphatase that specifically removes the 3' phosphate of Ptdlns(3,4,5)-P3, is a negative regulator of the PI3K/Akt pathway (Li et al Science 275 1943-1947 (1997), Stambolic et al Cell 95 29-39(1998), Sun et al Proc Natl Acad Sci USA 96 6199-6204(1999)) Germhne mutations of PTEN are responsible for human cancer syndromes such as Cowden disease (Liaw et al Nature Genetics 16 64-67 (1997)) PTEN is deleted in a large percentage of human tumors and tumor cell lines without functional PTEN show elevated levels of activated Akt (Li et al supra, Guldberg et al Cancer Research 57 3660-3663 (1997), Risinger et al Cancer Research 57 4736-4738 (1997))
These observations demonstrate that the PI3K/Akt pathway plays important roles for regulating cell survival or apoptosis in tumongenesis
Three members of the Akt/PKB subfamily of second-messenger regulated serine/threonine protein kinases have been identified and termed Akt1/ PKBa, Akt2/PKBp, and Akt3/PKBy respectively The isoforms are homologous, particularly in regions encoding the catalytic domains Akt/PKBs are activated by phosphorylation events occurring in response to PI3K signaling PI3K
phosphorylates membrane inositol phospholipids, generating the second messengers phosphatidyl- inositol 3,4,5-tnsphosphate and phosphatidylinositol 3,4-bisphosphate, which have been shown to bind to the PH domain of Akt/PKB The current model of Akt/PKB activation proposes recruitment of the enzyme to the membrane by 3'-phosphorylated phosphoinositides, where phosphorylation of the regulatory sites of Akt/PKB by the upstream kinases occurs (B A Hemmings, Science 275 628-630 (1997), B A Hemmings, Science 276 534 (1997), J Downward, Science 279 673-674 (1998))
Phosphorylation of Akt1/PKBa occurs on two regulatory sites, Thr308 in the catalytic domain activation loop and on Ser473 near the carboxy terminus (D R Alessiefa/ EMBO J 15 6541-6551 (1996) and R Meier et al J Biol Chem 272 30491-30497 (1997)) Equivalent regulatory phosphorylation sites occur in Akt2/PKBB and Akt3/PKBy The upstream kinase, which phosphorylates Akt/PKB at the activation loop site has been cloned and termed 3 '-phosphoinositide dependent protein kinase 1 (PDK1) PDK1 phosphorylates not only Akt/PKB, but also p70 nbosomal S6 kinase, p90RSK, serum and glucocorticoid-regulated kinase (SGK), and protein kinase C The upstream kinase phosphorylating the regulatory site of Akt/PKB near the carboxy terminus has not been identified yet, but recent reports imply a role for the mtegnn-hnked kinase (ILK-1), a serine/threonine protein kinase, or autophosphorylation
Inhibition of Akt activation and activity can be achieved by inhibiting PI3K with inhibitors such as LY294002 and wortmannin However, PI3K inhibition has the potential to mdiscnminately affect not just all three Akt isozymes but also other PH domain-containing signaling molecules that are dependent on Pdtlns(3,4,5)- P3, such as the Tec family of tyrosine kinases Furthermore, it has been disclosed that Akt can be activated by growth signals that are independent of PI3K
Alternatively, Akt activity can be inhibited by blocking the activity of the upstream kinase PDK1 The compound UCN-01 is a reported inhibitor of PDK1 Biochem J 375(2) 255 (2003) Again, inhibition of PDK1 would result in inhibition of multiple protein kinases whose activities depend on PDK1, such as atypical PKC isoforms, SGK, and S6 kinases (Williams et al Curr Biol 10 439-448 (2000)
Small molecule inhibitors of Akt are useful in the treatment of tumors, especially those with activated Akt (e g PTEN null tumors and tumors with ras mutations) PTEN is a critical negative regulator of Akt and its function is lost in many cancers, including breast and prostate carcinomas, glioblastomas, and several cancer syndromes including Bannayan-Zonana syndrome (Maehama, T et al Annual Review of Biochemistry, 70 247 (2001)), Cowden disease (Parsons, R ,
Simpson, L Methods in Molecular Biology (Totowa, NJ, United States), 222 (Tumor Suppressor Genes, Volume 1) 147 (2003)), and Lhermitte-Duclos disease (Backman, S et al Current Opinion in Neurobiology, 12(5) 516 (2002)) Akt3 is up-regulated in estrogen receptor-deficient breast cancers and androgen-independent prostate cancer cell lines and Akt2 is over-expressed in pancreatic and ovanan carcinomas Akt1 is amplified in gastnc cancers (Staal, Proc Natl Acad Sci USA 84 5034-7 (1987) and upregulated in breast cancers (Stal et al Breast Cancer Res 5 R37-R44 (2003)) Therefore a small molecule Akt inhibitor is expected to be useful for the treatment of these types of cancer as well as other types of cancer Akt inhibitors are also useful in combination with further chemotherapeutic and anticancer agents
It is an object of the instant invention to provide novel compounds that are inhibitors of Akt/PKB
It is also an object of the present invention to provide pharmaceutical compositions that comprise a pharmaceutical carner and compounds useful in the methods of the invention
It is also an object of the present invention to provide a method for treating cancer that comprises administering such inhibitors of Akt/PKB activity
It is also an object of the present invention to provide a method for treating arthritis that comprises admmistenng such inhibitors of Akt/PKB activity
SUMMARY OF THE INVENTION
This invention relates to novel compounds of Formula (I)
(Formula Removed)
wherein
(Formula Removed)
R41 and R42 are independently selected from hydrogen,
halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted
C1-4alkyloxy, furan, substituted fruan, thiophene and substituted
thiophene,
where Q and Y are independently selected from nitrogen and
-C(R70)-, and Z is selected from nitrogen and
-C(R48)-, provided that at least one and at most 2 of Q, Y and Z are
nitrogen, and R30 is selected from C1-4alkyl and C1-4alkyl
substituted with form one to three fluorine atoms,
where R is selected from hydrogen, and halogen, and
48 R is selected from hydrogen, C1-4alkyl, substituted C1-4alkyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl, cylcoalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, and halogen,
43 R is selected from hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl,
C1-4alkyloxy, substituted C1-4alkyloxy, furan and thiophene,
R is absent or selected from -(CR60R61 )mAR wherein the AR is
unsubsttuted, -( CR60 R61 )mAR wherein the AR is substituted and
C1-6alkyl.
where m is 0 to 3 and AR is a cyclic or polycyclic aromatic or saturated or unsaturated non-aromatic ring containing from 3 to 16 carbon atoms and optionally containing from one to three heteroatoms, provided that when the ring is aromatic and the number of carbon atoms is 3 the ring contains at least two
heteroatoms and when the ring is aromatic and the number of carbon atoms is 4 the ring contains at least one heteroatom, and
R60 and R61 are independently selected from hydrogen and C1-4alkyl, provided that when m is 3 no more than 4 of R and R when added together are C1-4alkyl,
45 R is selected from hydrogen and C1-4alkyl,
20 R is selected from hydrogen, C1-4alkyl and hydroxy,
X is selected from O, S and NR49 ,
49 where R is selected from hydrogen and C1-4alkyl, and
n is 0 to 2 and this moiety is optionally, if applicable, substituted by hydroxyC1-4alkyl,
(Formula Removed)
provided that one and only one of R41 and R42 is
and/or pharmaceutically acceptable salts thereof
This invention relates to a method of treating cancer, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I)
This invention relates to a method of treating arthritis, which comprises administering to a subject in need thereof an effective amount of an Akt/PKB inhibiting compound of Formula (I)
The present invention also relates to the discovery that the compounds of Formula (I) are active as inhibitors of Akt/PKB
In a further aspect of the invention there is provided novel processes and novel intermediates useful in preparing the presently invented Akt/PKB inhibiting compounds
Included in the present invention are pharmaceutical compositions that compnse a pharmaceutical carrier and compounds useful in the methods of the invention
Also included in the present invention are methods of co-administering the presently invented Akt/PKB inhibiting compounds with further active ingredients
DETAILED DESCRIPTION OF THE INVENTION This invention relates to compounds of Formula (I) as described above The presently invented compounds of Formula (I) inhibit Akt/PKB activity In
particular, the compounds disclosed herein inhibit each of the three Akt/PKB
isoforms
Included among the presently invented compounds of Formula (I) are those in which
(Formula Removed)
R41 and R42 are independently selected from hydrogen, ,
halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted
C1-4alkyloxy, furan, substituted fruan, thiophene and substituted
thiophene,
where Q is nitrogen, Y is selected from nitrogen and
-C(R70)-, and Z is selected from nitrogen and
48 -C(R )-, provided that at most one of Y and Z are nitrogen, and
30 R is selected from C1-4alkyl and C1-4alkyl substituted with form
one to three fluorine atoms,
where R is selected from hydrogen, and halogen, and
48 R is selected from hydrogen, C1-4alkyl, substituted C1-4alkyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl, cylcoalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, and halogen,
43 R is selected from hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl,
C1-4alkyloxy, substituted C1-4alkyloxy, furan and thiophene,
R is absent or selected from -(CR R )mAR wherein the AR is
unsubstituted, -( CR60 R61 )mAR wherein the AR is substituted and
C1-6alkyl,
where m is 0 to 3 and AR is a cyclic or polycyclic aromatic or saturated or unsaturated non-aromatic ring containing from 3 to 16 carbon atoms and optionally containing from one to three heteroatoms, provided that when the ring is aromatic and the number of carbon atoms is 3 the ring contains at least two heteroatoms and when the ring is aromatic and the number of
carbon atoms is 4 the nng contains at least one heteroatom, and

R60 and R61 are independently selected from hydrogen and C1-
4alkyl, provided that when m is 3 no more than 4 of R and R
when added together are C1-4alkyl,
R45 is selected from hydrogen and C1-4alkyl,
R20 is selected from hydrogen, C1-4alkyl and hydroxy,
X is selected from O, S and NR49 ,
where R49 is selected from hydrogen and C1-4alkyl, and
n is 0 to 2 and this moiety is optionally, if applicable, substituted by hydroxyC1-4alkyl,

(Formula Removed)
provided that one and only one of R41 and R42 is
and/or pharmaceutically acceptable salts thereof
Included among the presently invented compounds of Formula (I) are those in which
(Formula Removed)
R and R are independently selected from hydrogen,
halogen, C1-4alkyl, trifluoromethyl, methoxy, furan and thiophene, where Q is nitrogen, Y is selected from nitrogen and
-C(R )-, and Z is selected from nitrogen and
48 -C(R )-, provided that at most one of Y and Z are nitrogen, and
R30 is C1-4alkyl,
where R70 is selected from hydrogen, and halogen, and
R48 is selected from hydrogen, C1-4alkyl, trifluoromethyl, aryl,
heteroaryl, cylcoalkyl, heterocycloalkyl, and halogen,
R43 is selected from hydrogen, halogen, C1-4alkyl and methoxy,
R44 is absent or selected from -(CR60 R61 )mAAR wherein the AAR is
unsubstituted, -( CR60 R61)mAAR wherein the AAR is substituted
and C1-6alkyl,
where m is 0 to 3 and AAR is selected from phenyl, indole,
naphthalene, pyridine and cyclohexyl, and

R60 and R61 are independently selected from hydrogen and methyl,

provided that when m is 3 no more than 4 of R60 and R61 when added together are methyl,
R45 is selected from hydrogen and C1-4alkyl,
R20 is selected from hydrogen, methyl and hydroxy,
X is selected from O, S and NR49 ,
where R49 is selected from hydrogen and methyl, and
n is 1 to 2 and this moiety is optionally substituted by hydroxylmethyl,
(Formula Removed)
provided that one and only one of R41 and R42 is
and/or pharmaceutically acceptable salts thereof
Included among the presently invented compounds of Formula (I) are those in which
(Formula Removed)
R41 and R42 are independently selected from hydrogen,
halogen, C1-4alkyl, trifluoromethyl, methoxy and furan, where Q is nitrogen, Y is selected from nitrogen and
-C(R70)-, and Z is selected from nitrogen and
-C(R48 )-, provided that at most one of Y and Z are nitrogen, and
R30 is C1-4alkyl,
where R70 is selected from hydrogen, and halogen, and
R48 is selected from hydrogen, C1-4alkyl, trifluoromethyl, phenyl,
cylcopropyl, and halogen,
R43 is selected from hydrogen, halogen, C1-4alkyl and methoxy,

R44 is absent or selected from -(CR60 R461 )mAAR wherein the AAR is
unsubstituted, -( CR60 R61 )mAAR wherein the AAR is substituted
and C1-6alkyl,
where m is 0 to 3 and AAR is selected from phenyl, indole,
naphthalene, pyndine and cyclohexyl, and

R60 and R61 are independently selected from hydrogen and methyl,
provided that when m is 3 no more than 4 of R60 and R61 when added together are methyl,
R45 is selected from hydrogen and C1-4alkyl,
R20 is selected from hydrogen, methyl and hydroxy,
X is selected from O, S and NR49,
where R49 is selected from hydrogen and methyl, and
n is 1 to 2 and this moiety is optionally substituted by hydroxylmethyl,
(Formula Removed)
provided that one and only one of R41 and R42 is
and/or pharmaceutically acceptable salts thereof
Included among the presently invented compounds of Formula (I) are those
in which
R41 is selected from chlorine, ethyl, methyl and methoxy,

(Formula Removed)
where Q is nitrogen, Y is -CH- and Z is -C(R48 )-, and
R30 is selected from methyl and ethyl,
where R48 is selected from hydrogen, methyl, chlorine and bromine,
R43 is hydrogen,
R44 is -CH2-phenyl wherein the phenyl is substituted by one or two
substituents selected from fluorine and trifluoromethyl,
45 R is hydrogen,
R is hydrogen,
X is selected from O and S, and n is 1,
and/or pharmaceutically acceptable salts thereof
Included in the presently invented compounds of Formula (I) are compounds of Formula (AA)
(Formula Removed)
R and R are independently selected from hydrogen
halogen, C1-4alkyl, furan and thiophene,
where R6 is C1-4alkyl and R7 is selected from hydrogen, C1-4alkyl
and halogen,
3 R is selected from hydrogen, halogen, C1-4alkyl, furan and thiophene,
R4 is selected from -(CH2)maryl and ~(CHfe2 )maryl wherein the aryl is
substituted, where m is 0 to 2,
R5 is selected from hydrogen and C1-4alkyl,
X is selected from O and S, and n is 0 to 2,
(Formula Removed)
provided that one and only one of R and R is and further
provided that at least one of R , R and R is hydrogen,
and/or pharmaceutically acceptable salts thereof
Included in the presently invented compounds of Formula (I) are compounds of Formula (BB)
(Formula Removed)
R and R are independently selected from hydrogen, halogen, C1-4alkyl,
furan and thiophene,
R is C1-4alky!,
R is selected from hydrogen, C1-4alkyl and halogen,
R is selected from -(CH2)mC5-C12aryl and -(CH2)mC5-C12aryl wherein
the aryl is substituted, where m is 0 to 2,
11 R is selected from hydrogen and C1-4alkyl,
X is selected from O and S, and
provided that at least one of R and R is hydrogen,
and/or pharmaceutically acceptable salts thereof
Included in the presently invented compounds of Formula (I) are compounds of Formula (CC)
(Formula Removed)
wherein
12 R is selected from hydrogen, halogen, C1-4alkyl, furan and thiophene,
13 R is selected from -(CH2)mPhenyl and -(CH2)mPhenyl wherein the
phenyl is substituted,
where m is 0 to 2, X is selected from O and S, and
and/or pharmaceutically acceptable salts thereof
Included among the compounds useful in the present invention are
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide,
N-(2-amino-1-phenylethyl)-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide,
N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)--2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-(3-furanyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylrnethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[3-amino-1-(phenylmethyl)propyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
4-bromo-N-[2-(methylamino)-1-phenylethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1 -(phenylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-[1-(aminomethyl)-3-phenylpropyl]-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[1-(aminomethyl)-3-phenylpropyl]-5-(1-methyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide,
4-bromo-N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
4-bromo-N-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-1 -methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide,
N-[2-a mi no-1 -(phenyl methyl )ethy I]-1 -methyl-4-( 1 -methyl-1 H-py razol-5-y I )-1 H-pyrrole-2-carboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-(methylamino)-1-(phenylmethyl)ethyl]-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-N-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-ylly-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-20-

N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1 -{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,4-triazol-5-yl )-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-imidazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-3,4-dibromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(1 H-indol-3-ylmethyl)ethyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-21 -

N-[2-amino-1-(1-naphthalenyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(1-naphthalenyl)ethyl]-4-(1-methyl-1f/-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-(1-methyl-1H-pyra2ol-5-yl)-2-thiophenecarboxamide,
N-{2-amino-1 -[2-(trifluoromethyl)phenyl]ethyl}-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,5-difIuorophenyl)methyl]ethyl}-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-[(3-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{{ 1 S)-2-am ino-1-[(4-ch lorophenyl )methyl]ethyl}-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-(3-amino-1-phenylpropyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-22-

N-[2-amino-1-(phenylmethyl)ethyl]-3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1,4-dimethyl-1 f/-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxy-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl )-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-23-

N-[2-amino-1 -(phenylmethyl)ethyl]-3-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyI]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
-24-

N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamicle,
N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
-25-

N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(4-chlora-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyi)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenylJmethyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1 -methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
-26-

N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide,
N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide,
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide,
-27-

N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-(( 1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,6-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,4-difIuorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S}-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-28-

N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-methyl-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxam!de,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
-29-

N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide,
N-{( 1 S)-2-amino-1 -[(4-fluorophenyl)methylJethyl}-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,5-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-30-

N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl}-2-thiophenecarboxamide,
N-{( 1 S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1-methyi-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yI)-5-methyl-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1N-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-31 -

N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(3-pyndinylmethyl)ethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1 R)-2-amino-1-phenylethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-phenylethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -phenylethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -phenylethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
-32-

N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1 -(4-chlorophenyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(3-chlorophenyl)ethyf]-5-chloro-4-(1-methyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1 -(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide,
N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-(2-aminoethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[2-amino-1-(4-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
-33-

N-[(1S)-2-amino-1 -phenylethyl]-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -methylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[3-(trifluoromethyl)phenyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-[(1S)-1 -(aminomethyl)-3-methylbutyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
-34-

N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1 -methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-t(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3-f!uorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-35-

N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-5-(trifiuoromethyl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
(N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1 -ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S>2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-diethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
-36-

N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl )-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-[2-amino-1-(phenylmethyl)ethyl]-3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-furancarboxamide,
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
-37-

N-[(1S)-2-amino-1 -(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(IS)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1 -{[2-(trifluoromethyl )phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide,
-38-

N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3)4-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1 -methyl-1 H-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecarboxamide,
N-[(1S)-2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
-39-

N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3-fiuorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(pyphenylmethyl)ethyl]-5-chloro-4-C1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
-40-

N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fiuorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chlor(>-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S )-2-am mo-1 -{[2-(tnfluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-nriethyl-1H-1,2,4-triazol-5-yl)-2-furancarboxamide,
N-{(1S)-2-amino-1 -[(2,4-dichlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(2,4-dich!orophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(3,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl)-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide,
N-[(1S,2S)-2-amino-3-hydroxy-1 -phenylpropyl]-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide,
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide, and
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide,
and/or pharmaceutically acceptable salts thereof
Compounds of Formula (I) are included in the pharmaceutical compositions of the invention and used in the methods of the invention
Certain of the compounds described herein may contain one or more chiral atoms, or may otherwise be capable of existing as two enantiomers Accordingly, the compounds of this invention include mixtures of enantiomers as well as purified enantiomers or enantiomencally enriched mixtures Also, it is understood that all tautomers and mixtures of tautomers are included within the scope of the compounds of Formula (I)
Certain compounds described herein may form a solvate which is understood to be a complex of variable stoichiometry formed by a solute (in this invention, a compound of Formula I a salt thereof) and a solvent Such solvents for
the purpose of the invention may not interfere with the biological activity of the solute Examples of suitable solvents include, but are not limited to, water, methanol, ethanol and acetic acid Preferably the solvent used is a pharmaceutically acceptable solvent Examples of suitable pharmaceutically acceptable solvents include, without limitation, water, ethanol and acetic acid Most preferably the solvent used is water
By the term "aryl", and denvatives thereof, used alone or as part of a larger moiety as in "-(CH2)maryl" as used herein, unless otherwise defined, is meant monocyclic, bicyclic, and tricyclic ring systems having a total of five to fourteen ring members, wherein at least one ring system is aromatic and wherein each ring in the system contains 3 to 7 members, such as phenyl, naphthalene, tetrahydronaphthalene and biphenyl
Suitably, by the term "aryl" is meant a monocyclic aromatic ring system having a total of five to 7 ring members
By the term "heteroaryl", and derivatives thereof, used alone or as part of a larger moiety as in "-(CH^mheteroaryl" as used herein, unless otherwise defined, is meant a cyclic aromatic ring containing from 3 to 7 carbon atoms and containing from one to 3 heteroatoms, provided that when the number of carbon atoms is 3 the aromatic ring contains at least two heteroatoms Exemplary "heteroaryl" groups include pyridine and indole
By the term " cycloalkyl", and denvatives thereof, used alone or as part of a larger moiety as in "-(CH2)mcycloalkyl" as used herein, unless otherwise defined, is meant a non-aromatic cyclic hydrocarbon ring having from three to seven carbon atoms Exemplary "cycloalkyl" groups include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl
By the term "heterocycloalkyl", and derivatives thereof, used alone or as part of a larger moiety as in "-(CH2)mheterocycloalkyl" as used herein, unless
otherwise defined, is meant a non-aromatic cyclic hydrocarbon ring having from three to six carbon atoms and containing 1 or 2 heteroatoms Exemplary "cycloalkyl" groups include piperazine and pyrrolidine
By the term "C5-C-|2aryl", used alone or as part of a larger moiety as in "-(CH2)rnC5-C12aryl", as used herein, is meant an aromatic group selected from phenyl, naphthalene, tehrahydronaphthanlene and biphenyl
The term "substituted" as used herein, unless otherwise defined, is meant that the subject chemical moiety has from one to five substituents, suitably from one to three substituents, selected from the group consisting of -CC^R^O, C1-C4alkyl, hydroxyC-]-C4alkyl, C-j-C4alkyloxy, amino, C1-C4alkyiamino, aminoC-j-C4alkyl,
diC1-C4alkylamino, hydroxy, nitro, tetrazole, cyano, oxo, halogen and trifluoromethyl, where R20 is selected form hydrogen, C1-C4alkyl, and trifluoromethyl
Suitably, the term "substituted" as used herein is meant that the subject chemical moiety has from one to three substituents, selected from the group consisting of C1-C4alkyl, hydroxyC1-C4alkyl, C1-C4alkyloxy, amino, C1-C4alkylamino, aminoC1-C4alkyl, hydroxy, tetrazole, halogen and trifluoromethyl
Suitably, the term "substituted" as used herein is meant that the subject chemical moiety has from one to three substituents, selected from the group consisting of halogen and trifluoromethyl
By the term "heteroatom" as used herein is meant oxygen, nitrogen or sulfur
By the term "halogen" as used herein is meant a substituent selected from bromide, iodide, chloride and fluoride
By the term "alkyl" and derivatives thereof and in all carbon chains as used herein, including alkyl chains defined by the term "-(CH2)n". "-(CH2)m" and the like, is meant a linear or branched, saturated or unsaturated hydrocarbon chain, and unless otherwise defined, the carbon chain will contain from 1 to 12 carbon atoms Examples of alkyl as used herein include -CH3, -CH2-CH3, -CH2-CH2-CH3, -CH(CH3)2, -CH2-CH2-C(CH3)3, -C=C-C(CH3)3, -C(CH3)3, -(CH2)3-CH3, -CH2-CH(CH3)2, -CH(CH3)-CH2-CH3, -CH=CH2, and -CEC-CH3
By the term "treating" and denvatives thereof as used herein, is meant prophylactic and therapeutic therapy Prophylactic therapy is appropriate, for example, when a subject is considered at high nsk for developing cancer, or when a subject has been exposed to a carcinogen
As used herein, the term "effective amount" and derivatives thereof means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal or human that is being sought, for instance, by a researcher or clinician Furthermore, the term "therapeutically effective amount" and derivatives thereof means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder The term also includes within its scope amounts effective to enhance normal physiological function
Compounds of Formula (I) are included in the pharmaceutical compositions of the invention and used in the methods of the invention Where a -COOH or -OH group is present, pharmaceutically acceptable esters can be employed, for example methyl, ethyl, pivaloyloxymethyl, and the like for -COOH, and acetate maleate and the like for -OH, and those esters known m the art for modifying solubility or hydrolysis characteristics, for use as sustained release or prodrug formulations
The pharmaceutically acceptable salts of the compounds of the invention are readily prepared by those of skill in the art
The novel compounds of Formulas (I), (AA), (BB) and (CC) are generally prepared as shown in Schemes 1 to 3 below, or by analogous methods, provided the X and 'R' substituents in Formulas (I), (AA), (BB) and (CC) respectively do not include any such substituents that render inoperative the processes of any of Schemes 1 to 3 All of the starting materials are commercially available or are readily made from commercially available starting materials by those of skill in the art
General Schemes
Scheme 1
(Scheme Removed)
Reagents (a) Phthahmide, PPh3, DEAD, THF, RT, (b) NH2NH2) MeOH, 50 °C
Amino alcohol (1-1) was reacted under Mitsunobu conditions to provide the differentially protected diamine (I-2) Mitsunobu reactions are well know to those skilled in the art of organic synthesis Methods and reaction conditions for such transformations are discussed in Synthesis 1981, 1-28 Selective deprotection of the phthahmide group of (1-2) using a nucleophilic amine such as hydrazine or methyl amine in a polar solvent such as methanol, afforded amine (1-3) Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein Methods for
the protection of amines are descnbed in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience)
Scheme 2
(Scheme Removed)
Reagents (a) PyBrop, (i-Pr)2NEt, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate, DCM, RT, (b)5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole, K2CO3, Pd(PPh3)4, dioxane/H2O, (c) TFA / DCM, RT
Carboxylic acid (II-1) was reacted with 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate to form amide (II-2) A vanety of amide coupling reagents such as EDC, PyBrop, etc are commercially available Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (i-Pr)2NEt Dibromide (II-2) was regioselectively coupled with 1,1-dimethylethyl (2-{[(4,5-dibromo-2-furanyl)carbonyl]amino}-3-phenylpropyl)carbamate using a Suzuki coupling procedure Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4 in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF Methods for palladium-mediated couplings are described in standard reference volumes, such as Schlosser "Organometallics in Synthesis" (published by Wiley and sons) Acidic treatment of II-3 with HCI or TFA to remove the Boc protecting group produced amine (II-4) Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein Methods
for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience)
Scheme 3
(Scheme Removed)
Reagents (a) MeOH, H2SO4, 60°C, (b) AICI3, Br2, CHCI3, (c) 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole, K2CO3, Pd2(t-Bu)3, dioxane/H2O, 70°C, (d) NCS, THF, 70°C, (e) 6M NaOH, THF/MeOH, 50°C, (f) PyBrop, (i-Pr)2NEt, 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione, DCM, RT, (g) NH2NH2, THF/MeOH, RT
Carboxylic acid (III-1) was estenfied under standard Fisher estenfication conditions and then selectively halogenated with the aid of a Lewis acid to give (III-2) The dihalogenated ester was selectively coupled with 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole using Suzuki coupling chemistry to give (III-3) Suzuki-like couplings are typically run using a palladium(O) catalyst such as Pd(PPh3)4 with an inorganic base, for example K2CO3, Na2CO3 or K3PO4 in an aqueous mixture containing ethereal solvents such as DME, dioxane, or THF
Methods for palladium-mediated couplings are described in standard reference volumes, such as Schlosser "Organometallics in Synthesis" (published by Wiley and sons) Ester (III-3) was chlorinated using NCS and in situ saponified using aqueous NaOH The resulting carboxylic acid (III-4) was coupled with 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione to form amide (III-5) A vanety of amide coupling reagents such as EDC, PyBrop, etc are commercially available Amide coupling reactions are generally run in solvents such as DCM or DMF, utilizing an organic base like Et3N or (i-Pr)2NEt Amide (III-5) was deprotected using hydrazine to give amine (III-6) Many different protecting groups are available to one skilled in the art and can be used here as long as they do not interfere with the processes listed herein Methods for the protection of amines are described in standard reference volumes, such as Greene "Protective Groups in Organic Synthesis" (published by Wiley-lnterscience)
By the term "co-administering" and derivatives thereof as used herein is meant either simultaneous administration or any manner of separate sequential administration of an AKT inhibiting compound, as described herein, and a further active ingredient or ingredients, known to be useful in the treatment of cancer, including chemotherapy and radiation treatment, or to be useful in the treatment of arthritis The term further active ingredient or ingredients, as used herein, includes any compound or therapeutic agent known to or that demonstrates advantageous properties when administered to a patient in need of treatment for cancer or arthritis Preferably, if the administration is not simultaneous, the compounds are administered in a close time proximity to each other Furthermore, it does not matter if the compounds are administered in the same dosage form, e g one compound may be administered topically and another compound may be administered orally
Typically, any anti-neoplastic agent that has activity versus a susceptible tumor being treated may be co-administered in the treatment of cancer in the present invention Examples of such agents can be found in Cancer Principles and Practice of Oncology by V T Devita and S Hellman (editors), 6th edition (February 15, 2001), Lippincott Williams & Wilkins Publishers A person of ordinary skill in the art would be able to discern which combinations of agents would be useful based on the particular characteristics of the drugs and the cancer involved Typical antineoplastic agents useful in the present invention include, but are not limited to, anti-microtubule agents such as diterpenoids and vinca alkaloids, platinum coordination complexes, alkylating agents such as nitrogen mustards, oxazaphosphonnes,
alkylsulfonates, nitrosoureas, and triazenes, antibiotic agents such as anthracyclins, actmomycins and bleomycins, topoisomerase II inhibitors such as epipodophyllotoxins, antimetabolites such as punne and pynmidine analogues and anti-folate compounds, topoisomerase I inhibitors such as camptothecins, hormones and hormonal analogues, signal transduction pathway inhibitors, nonreceptor tyrosine kinase angiogenesis inhibitors, immunotherapeutic agents, proapoptotic agents, and cell cycle signaling inhibitors
Examples of a further active ingredient or ingredients (anti-neoplastic agent) for use in combination or co-administered with the presently invented AKT inhibiting compounds are chemotherapeutic agents
Anti-microtubule or anti-mitotic agents are phase specific agents active against the microtubules of tumor cells during M or the mitosis phase of the cell cycle Examples of anti-microtubule agents include, but are not limited to, diterpenoids and vinca alkaloids
Diterpenoids, which are denved from natural sources, are phase specific anti -cancer agents that operate at the G2/M phases of the cell cycle It is believed that the diterpenoids stabilize the ß-tubulin subunit of the microtubules, by binding with this protein Disassembly of the protein appears then to be inhibited with mitosis being arrested and cell death following Examples of diterpenoids include, but are not limited to, paclitaxel and its analog docetaxel
Pachtaxel, 5ß,20-epoxy-1,2α,4,7ß, 10ß, 13α-hexa-hydroxytax-11 -en-9-one 4,10-diacetate 2-benzoate 13-ester with (2R,3S)-N-benzoyl-3-phenylisoserine, is a natural diterpene product isolated from the Pacific yew tree Taxus brevifolia and is commercially available as an injectable solution TAXOL® It is a member of the taxane family of terpenes It was first isolated in 1971 by Warn et al J Am Chem, Soc , 93 2325 1971), who characterized its structure by chemical and X-ray crystallographic methods One mechanism for its activity relates to pachtaxel's capacity to bind tubulin, thereby inhibiting cancer cell growth Schiff et al, Proc Natl, Acad, Sci USA, 77 1561-1565 (1980), Schiff et al, Nature, 277 665-667 (1979), Kumar, J Biol, Chem, 256 10435-10441 (1981) For a review of synthesis and anticancer activity of some paclitaxel derivatives see D G I Kingston et al, Studies in Organic Chemistry vol 26, entitled ' New trends in Natural Products Chemistry 1986", Attaur-Rahman, P W Le Quesne, Eds (Elsevier, Amsterdam, 1986) pp 219-235
Paclitaxel has been approved for clinical use in the treatment of refractory ovarian cancer in the United States (Markman et al, Yale Journal of Biology and
-50-

Medicine, 64 583, 1991, McGuire et al, Ann Intern, Med ,111 273,1989) and for the treatment of breast cancer (Holmes et al, J Nat Cancer Inst, 83 1797,1991 ) It is a potential candidate for treatment of neoplasms in the skin (Einzig et al, Proc Am Soc Clin Oncol, 20 46) and head and neck carcinomas (Forastire et al, Sem Oncol, 20 56, 1990) The compound also shows potential for the treatment of polycystic kidney disease (Woo et al, Nature, 368 750 1994), lung cancer and malaria Treatment of patients with paclitaxel results in bone marrow suppression (multiple cell lineages, Ignoff, R J et al, Cancer Chemotherapy Pocket Guide,. 1998) related to the duration of dosing above a threshold concentration (50nM) (Kearns, C M et al, Seminars in Oncology, 3(6) p 16-23, 1995)
Docetaxel, (2R.3S)- N-carboxy-3-phenylisoserine,N-tert-butyl ester, 13-ester with 5p-20-epoxy-1,2α,4,7ß,10ß,13α-hexahydroxytax-11-en-9-one 4-acetate 2-benzoate, tnhydrate, is commercially available as an injectable solution as TAXOTERE® Docetaxel is indicated for the treatment of breast cancer Docetaxel is a semisynthetic derivative of paclitaxel q v, prepared using a natural precursor, 10-deacetyl-baccatin III, extracted from the needle of the European Yew tree The dose limiting toxicity of docetaxel is neutropenia
Vinca alkaloids are phase specific antineoplastic agents derived from the periwinkle plant Vinca alkaloids act at the M phase (mitosis) of the cell cycle by binding specifically to tubulin Consequently, the bound tubulin molecule is unable to polymenze into microtubules Mitosis is believed to be arrested in metaphase with cell death following Examples of vinca alkaloids include, but are not limited to, vinblastine, vincristine, and vinorelbine
Vinblastine, vincaleukoblastine sulfate, is commercially available as VELBAN® as an injectable solution Although, it has possible indication as a second line therapy of various solid tumors, it is primarily indicated in the treatment of testicular cancer and various lymphomas including Hodgkin's Disease, and lymphocytic and histiocytic lymphomas Myelosuppression is the dose limiting side effect of vinblastine
Vincristine, vincaleukoblastine, 22-oxo-, sulfate, is commercially available as ONCOVIN® as an injectable solution Vincristine is indicated for the treatment of acute leukemias and has also found use in treatment regimens for Hodgkin's and non-Hodgkin's malignant lymphomas Alopecia and neurologic effects are the most common side effect of vincristine and to a lesser extent myelosupression and gastrointestinal mucositis effects occur
Vinorelbine, 3',4'-didehydro -4'-deoxy-C'-norvincaleukoblastine [R-(R*,R*)-2,3-dihydroxybutanedioate (1 2)(salt)], commercially available as an injectable
solution of vinorelbine tartrate (NAVELBINE®), is a semisynthetic vinca alkaloid Vinorelbine is indicated as a single agent or in combination with other chemotherapeutic agents, such as cisplatin, in the treatment of various solid tumors, particularly non-small cell lung, advanced breast, and hormone refractory prostate cancers Myelosuppression is the most common dose limiting side effect of vinorelbine
Platinum coordination complexes are non-phase specific anti-cancer agents, which are interactive with DNA The platinum complexes enter tumor cells, undergo, aquation and form intra- and interstrand crosslinks with DNA causing adverse biological effects to the tumor Examples of platinum coordination complexes include, but are not limited to, cisplatin and carboplatin
Cisplatin, cis-diamminedichloroplatinum, is commercially available as PLATINOL® as an injectable solution Cisplatin is primarily indicated in the treatment of metastatic testicular and ovarian cancer and advanced bladder cancer The primary dose limiting side effects of cisplatin are nephrotoxicity, which may be controlled by hydration and diuresis, and ototoxicity
Carboplatin, platinum, diammine [1,1-cyclobutane-dicarboxylate(2-)-0,0'], is commercially available as PARAPLATIN® as an injectable solution Carboplatin is primarily indicated in the first and second line treatment of advanced ovarian carcinoma Bone marrow suppression is the dose limiting toxicity of carboplatin
Alkylating agents are non-phase anti-cancer specific agents and strong electrophiles Typically, alkylating agents form covalent linkages, by alkylation, to DNA through nucleophilic moieties of the DNA molecule such as phosphate, amino, sulfhydryl, hydroxyl, carboxyl, and imidazole groups Such alkylation disrupts nucleic acid function leading to cell death Examples of alkylating agents include, but are not limited to, nitrogen mustards such as cyclophosphamide, melphalan, and chlorambucil, alkyl sulfonates such as busulfan, nitrosoureas such as carmustine, and triazenes such as dacarbazme
Cyclophosphamide, 2-[bis(2-chloroethyl)amino]tetrahydro-2H-1,3,2-oxazaphosphonne 2-oxide monohydrate, is commercially available as an injectable solution or tablets as CYTOXAN® Cyclophosphamide is indicated as a single agent or in combination with other chemotherapeutic agents, in the treatment of malignant lymphomas, multiple myeloma, and leukemias Alopecia, nausea, vomiting and leukopenia are the most common dose limiting side effects of cyclophosphamide
Melphalan, 4-[bis(2-chloroethyl)amino]-L-phenylalanine, is commercially available as an injectable solution or tablets as ALKERAN® Melphalan is
indicated for the palliative treatment of multiple myeloma and non-resectable epithelial carcinoma of the ovary Bone marrow suppression is the most common dose limiting side effect of melphalan
Chlorambucil, 4-[bis(2-chloroethyl)amino]benzenebutanoic acid, is commercially available as LEUKERAN® tablets Chlorambucil is indicated for the palliative treatment of chronic lymphatic leukemia, and malignant lymphomas such as lymphosarcoma, giant follicular lymphoma, and Hodgkin's disease Bone marrow suppression is the most common dose limiting side effect of chlorambucil
Busulfan, 1,4-butanediol dimethanesulfonate, is commercially available as MYLERAN® TABLETS Busulfan is indicated for the palliative treatment of chronic myelogenous leukemia Bone marrow suppression is the most common dose limiting side effects of busulfan
Carmustine, 1,3-[bis(2-chloroethyi)-1 -nitrosourea, is commercially available as single vials of lyophilized material as BiCNU® Carmustine is indicated for the palliative treatment as a single agent or in combination with other agents for brain tumors, multiple myeloma, Hodgkin's disease, and non-Hodgkin's lymphomas Delayed myelosuppression is the most common dose limiting side effects of carmustine
Dacarbazine, 5-(3,3-dimethyl-1-triazeno)-imidazole-4-carboxamide, is commercially available as single vials of material as DTIC-Dome® Dacarbazine is indicated for the treatment of metastatic malignant melanoma and in combination with other agents for the second line treatment of Hodgkin's Disease Nausea, vomiting, and anorexia are the most common dose limiting side effects of dacarbazine
Antibiotic anti-neoplasties are non-phase specific agents, which bind or intercalate with DNA Typically, such action results in stable DNA complexes or strand breakage, which disrupts ordinary function of the nucleic acids leading to cell death Examples of antibiotic anti-neoplastic agents include, but are not limited to, actinomycms such as dactinomycin, anthrocyclins such as daunorubicin and doxorubicin, and bleomycins
Dactinomycin, also know as Actinomycin D, is commercially available in injectable form as COSMEGEN® Dactinomycin is indicated for the treatment of Wilm's tumor and rhabdomyosarcoma Nausea, vomiting, and anorexia are the most common dose limiting side effects of dactinomycin
Daunorubicin, (8S-cis-)-8-acetyl-10-[(3-amino-2,3,6-tndeoxy-a-L-lyxo-hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-tnhydroxy-1-methoxy-5,12 naphthacenedione hydrochloride, is commercially available as a liposomal
injectable form as DAUNOXOME® or as an injectable as CERUBIDINE® Daunorubicm is indicated for remission induction in the treatment of acute nonlymphocytic leukemia and advanced HIV associated Kaposi's sarcoma Myelosuppression is the most common dose limiting side effect of daunorubicm
Doxorubicin, (8S, 10S)-10-[(3-amino-2,3,6-tndeoxy-a-L-lyxo-hexopyranosyl)oxy]-8-glycoloyl, 7,8,9,10-tetrahydro-6,8,11 -tnhydroxy-1 -methoxy-5,12 naphthacenedione hydrochlonde, is commercially available as an injectable form as RUBEX® or ADRIAMYCIN RDF® Doxorubicin is pnmanly indicated for the treatment of acute lymphoblastic leukemia and acute myeloblasts leukemia, but is also a useful component in the treatment of some solid tumors and lymphomas Myelosuppression is the most common dose limiting side effect of doxorubicin
Bleomycin, a mixture of cytotoxic glycopeptide antibiotics isolated from a strain of Streptomyces verticillus, is commercially available as BLENOXANE® Bleomycin is indicated as a palliative treatment, as a single agent or in combination with other agents, of squamous cell carcinoma, lymphomas, and testicular carcinomas Pulmonary and cutaneous toxicities are the most common dose limiting side effects of bleomycin
Topoisomerase II inhibitors include, but are not limited to, epipodophyllotoxins
Epipodophyllotoxins are phase specific antineoplastic agents denved from the mandrake plant Epipodophyllotoxins typically affect cells in the S and G2 phases of the cell cycle by forming a ternary complex with topoisomerase II and DNA causing DNA strand breaks The strand breaks accumulate and cell death follows Examples of epipodophyllotoxins include, but are not limited to, etoposide and teniposide
Etoposide, 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R )-ethylidene-p-D-glucopyranoside], is commercially available as an injectable solution or capsules as VePESID® and is commonly known as VP-16 Etoposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of testicular and non-small cell lung cancers Myelosuppression is the most common side effect of etoposide The incidence of leucopenia tends to be more severe than thrombocytopenia
Teniposide, 4'-demethyl-epipodophyllotoxin 9[4,6-0-(R )-thenylidene-ß-D-glucopyranoside], is commercially available as an injectable solution as VUMON® and is commonly known as VM-26 Teniposide is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia in
-54-

children Myelosuppression is the most common dose limiting side effect of teniposide Teniposide can induce both leucopenia and thrombocytopenia
Antimetabolite neoplastic agents are phase specific anti-neoplastic agents that act at S phase (DNA synthesis) of the cell cycle by inhibiting DNA synthesis or by inhibiting purine or pynmidine base synthesis and thereby limiting DNA synthesis Consequently, S phase does not proceed and cell death follows Examples of antimetabolite anti-neoplastic agents include, but are not limited to, fluorouracil, methotrexate, cytarabme, mecaptopunne, thioguanine, and gemcitabine
5-fluorouracil, 5-fluoro-2,4- (1H,3H) pynmidinedione, is commercially available as fluorouracil Administration of 5-fluorouracil leads to inhibition of thymidylate synthesis and is also incorporated into both RNA and DNA The result typically is cell death 5-fluorouracil is indicated as a single agent or in combination with other chemotherapy agents in the treatment of carcinomas of the breast, colon, rectum, stomach and pancreas Myelosuppression and mucositis are dose limiting side effects of 5-fluorouracil Other fluoropyrimidine analogs include 5-fluoro deoxyundine (floxundine) and 5-fluorodeoxyuridine monophosphate
Cytarabme, 4-amino-1-|3-D-arabinofuranosyl-2 (1H)-pynmidinone, is commercially available as CYTOSAR-U® and is commonly known as Ara-C It is believed that cytarabme exhibits cell phase specificity at S-phase by inhibiting DNA chain elongation by terminal incorporation of cytarabme into the growing DNA chain Cytarabme is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia Other cytidine analogs include 5-azacytidme and 2',2'-difluorodeoxycytidine (gemcitabine) Cytarabme induces leucopenia, thrombocytopenia, and mucositis
Mercaptopurme, 1,7-dihydro-6H-punne-6-thione monohydrate, is commercially available as PURINETHOL® Mercaptopurme exhibits cell phase specificity at S-phase by inhibiting DNA synthesis by an as of yet unspecified mechanism Mercaptopurme is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia Myelosuppression and gastrointestinal mucositis are expected side effects of mercaptopurme at high doses A useful mercaptopurme analog is azathiopnne
Thioguanine, 2-amino-1,7-dihydro-6H-punne-6-thione, is commercially available as TABLOID® Thioguanine exhibits cell phase specificity at S-phase by inhibiting DNA synthesis by an as of yet unspecified mechanism Thioguanine is indicated as a single agent or in combination with other chemotherapy agents in the treatment of acute leukemia Myelosuppression, including leucopenia,
-55-

thrombocytopenia, and anemia, is the most common dose limiting side effect of thioguanine administration However, gastrointestinal side effects occur and can be dose limiting Other purine analogs include pentostatin, erythrohydroxynonyladenine, fludarabine phosphate, and cladnbine
Gemcitabine, 2'-deoxy-2', 2'-difluorocytidine monohydrochlonde (p-isomer), is commercially available as GEMZAR® Gemcitabine exhibits cell phase specificity at S-phase and by blocking progression of cells through the G1/S boundary Gemcitabine is indicated in combination with cisplatin in the treatment of locally advanced non-small cell lung cancer and alone in the treatment of locally advanced pancreatic cancer Myelosuppre'ssion, including leucopenia, thrombocytopenia, and anemia, is the most common dose limiting side effect of gemcitabine administration
Methotrexate, N-[4[[(2,4-diamino-6-ptendinyl) methyljmethylamino] benzoyl]-L-glutamic acid, is commercially available as methotrexate sodium Methotrexate exhibits cell phase effects specifically at S-phase by inhibiting DNA synthesis, repair and/or replication through the inhibition of dyhydrofolic acid reductase which is required for synthesis of purine nucleotides and thymidylate Methotrexate is indicated as a single agent or in combination with other chemotherapy agents in the treatment of choriocarcinoma, meningeal leukemia, non-Hodgkin's lymphoma, and carcinomas of the breast, head, neck, ovary and bladder Myelosuppression (leucopenia, thrombocytopenia, and anemia) and mucositis are expected side effect of methotrexate administration
Camptothecins, including, camptothecin and camptothecin denvatives are available or under development as Topoisomerase I inhibitors Camptothecins cytotoxic activity is believed to be related to its Topoisomerase I inhibitory activity Examples of camptothecins include, but are not limited to innotecan, topotecan, and the various optical forms of 7-(4-methylpiperazino-methylene)-10,11-ethylenedioxy-20-camptothecin described below
Innotecan HCI, (4S)-4,11-diethyl-4-hydroxy-9-[(4-pipendinopipendino) carbonyloxy]-1 H-pyrano[3',4',6,7]indohzmo[1,2-b]quinohne-3,14(4H, 12H)-dione hydrochloride, is commercially available as the injectable solution CAMPTOSAR®
Innotecan is a derivative of camptothecin which binds, along with its active metabolite SN-38, to the topoisomerase I - DNA complex It is believed that cytotoxicity occurs as a result of irreparable double strand breaks caused by interaction of the topoisomerase I DNA inntecan or SN-38 ternary complex with replication enzymes Innotecan is indicated for treatment of metastatic cancer of
-56-

the colon or rectum The dose limiting side effects of innotecan HCI are myelosuppression, including neutropenia, and Gl effects, including diarrhea
Topotecan HCI, (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1 H-pyrano[3',4',6,7]indohzino[1,2-b]quinoline-3,14-(4H, 12H)-dione monohydrochlonde, is commercially available as the injectable solution HYCAMTIN® Topotecan is a derivative of camptothecin which binds to the topoisomerase I - DNA complex and prevents rehgation of singles strand breaks caused by Topoisomerase I in response to torsional strain of the DNA molecule Topotecan is indicated for second line treatment of metastatic carcinoma of the ovary and small cell lung cancer The dose limiting side effect of topotecan HCI is myelosuppression, primarily neutropenia
Also of interest, is the camptothecin derivative of formula A following, currently under development, including the racemic mixture (R,S) form as well as the R and S enantiomers
(Formula Removed)
known by the chemical name "7-(4-methylpiperazino-methylene)-10,11-ethylenedioxy-20(R,S)-camptothecin (racemic mixture) or "7-(4-methylpiperazmo-methylene)-10,11-ethylenedioxy-20(R)-camptothecin (R enantiomer) or "7-(4-methylpiperazino-methylene)-10,11 -ethylenedioxy-20(S)-camptothecin (S enantiomer) Such compound as well as related compounds are described, including methods of making, in U S Patent Nos 6,063,923, 5,342,947, 5,559,235, 5,491,237 and pending U S patent Application No 08/977,217 filed November 24, 1997
Hormones and hormonal analogues are useful compounds for treating cancers in which there is a relationship between the hormone(s) and growth and/or lack of growth of the cancer Examples of hormones and hormonal analogues useful in cancer treatment include, but are not limited to, adrenocorticosteroids such as prednisone and prednisolone which are useful in the treatment of malignant lymphoma and acute leukemia in children, aminoglutethimide and other aromatase inhibitors such as anastrozole, letrazole, vorazole, and exemestane useful in the
-57-

treatment of adrenocortical carcinoma and hormone dependent breast carcinoma containing estrogen receptors, progestnns such as megestrol acetate useful in the treatment of hormone dependent breast cancer and endometnal carcinoma, estrogens, androgens, and anti-androgens such as flutamide, nilutamide, bicalutamide, cyproterone acetate and 5a-reductases such as finastende and dutastende, useful in the treatment of prostatic carcinoma and benign prostatic hypertrophy, anti-estrogens such as tamoxifen, toremifene, raloxifene, droloxifene, lodoxyfene, as well as selective estrogen receptor modulators (SERMS) such those described in U S Patent Nos 5,681,835, 5,877,219, and 6,207,716, useful in the treatment of hormone dependent breast carcinoma and other susceptible cancers, and gonadotropm-releasmg hormone (GnRH) and analogues thereof which stimulate the release of leutinizing hormone (LH) and/or follicle stimulating hormone (FSH) for the treatment prostatic carcinoma, for instance, LHRH agonists and antagagonists such as goserelin acetate and luprolide
Signal transduction pathway inhibitors are those inhibitors, which block or inhibit a chemical process which evokes an intracellular change As used herein this change is cell proliferation or differentiation Signal tranduction inhibitors useful in the present invention include inhibitors of receptor tyrosine kinases, non-receptor tyrosine kinases, SH2/SH3domain blockers, serine/threonine kinases, phosphotidyl inositol-3 kinases, myo-inositol signaling, and Ras oncogenes
Several protein tyrosine kinases catalyse the phosphorylation of specific tyrosyl residues in various proteins involved in the regulation of cell growth Such protein tyrosine kinases can be broadly classified as receptor or non-receptor kinases
Receptor tyrosine kinases are transmembrane proteins having an extracellular ligand binding domain, a transmembrane domain, and a tyrosine kinase domain Receptor tyrosine kinases are involved in the regulation of cell growth and are generally termed growth factor receptors Inappropriate or uncontrolled activation of many of these kinases, i e aberrant kinase growth factor receptor activity, for example by over-expression or mutation, has been shown to result in uncontrolled cell growth Accordingly, the aberrant activity of such kinases has been linked to malignant tissue growth Consequently, inhibitors of such kinases could provide cancer treatment methods Growth factor receptors include, for example, epidermal growth factor receptor (EGFr), platelet derived growth factor receptor (PDGFr), erbB2, erbB4, vascular endothelial growth factor receptor (VEGFr), tyrosine kinase with immunoglobulm-like and epidermal growth factor homology domains (TIE-2), insulin growth factor-I (IGFI) receptor, macrophage
-58-

colony stimulating factor (cfms), BTK, ckit, cmet, fibroblast growth factor (FGF) receptors, Trk receptors (TrkA, TrkB, and TrkC), ephnn (eph) receptors, and the RET protooncogene Several inhibitors of growth receptors are under development and include ligand antagonists, antibodies, tyrosine kinase inhibitors and anti-sense oligonucleotides Growth factor receptors and agents that inhibit growth factor receptor function are described, for instance, in Kath, John C , Exp Opin Ther Patents (2000) 10(6) 803-818, Shawver et al DDT Vol 2, No 2 February 1997, and Lofts, F J et al, "Growth factor receptors as targets", New Molecular Targets for Cancer Chemotherapy, ed Workman, Paul and Kerr, David, CRC press 1994, London
Tyrosine kinases, which are not growth factor receptor kinases are termed non-receptor tyrosine kinases Non-receptor tyrosine kinases for use in the present invention, which are targets or potential targets of anti-cancer drugs, include cSrc, Lck, Fyn, Yes, Jak, cAbl, FAK (Focal adhesion kinase), Brutons tyrosine kinase, and Bcr-Abl Such non-receptor kinases and agents which inhibit non-receptor tyrosine kinase function are described in Sinh, S and Corey, S J , (1999) Journal of Hematotherapy and Stem Cell Research 8 (5) 465 - 80, and Bolen, J B , Brugge, J S , (1997) Annual review of Immunology 15 371-404
SH2/SH3 domain blockers are agents that disrupt SH2 or SH3 domain binding in a variety of enzymes or adaptor proteins including, PI3-K p85 subunit, Src family kinases, adaptor molecules (She, Crk, Nek, Grb2) and Ras-GAP SH2/SH3 domains as targets for anti-cancer drugs are discussed in Smithgall, T E (1995), Journal of Pharmacological and Toxicological Methods 34(3) 125-32
Inhibitors of Serine/Threonine Kinases including MAP kinase cascade blockers which include blockers of Raf kinases (rafk), Mitogen or Extracellular Regulated Kinase (MEKs), and Extracellular Regulated Kinases (ERKs), and Protein kinase C family member blockers including blockers of PKCs (alpha, beta, gamma, epsilon, mu, lambda, iota, zeta) IkB kinase family (IKKa, IKKb), PKB family kinases, akt kinase family members, and TGF beta receptor kinases Such Serine/Threonine kinases and inhibitors thereof are described in Yamamoto, T, Taya, S , Kaibuchi, K , (1999), Journal of Biochemistry 126 (5) 799-803, Brodt, P, Samani, A, and Navab, R (2000), Biochemical Pharmacology, 60 1101-1107, Massague, J , Weis-Garcia, F (1996) Cancer Surveys 27 41-64, Philip, P A, and Harris, AL (1995), Cancer Treatment and Research 78 3-27, Lackey, K etal Bioorganic and Medicinal Chemistry Letters, (10), 2000, 223-226, U S Patent No 6,268,391, and Martinez-lacaci, L , et al, Int J Cancer (2000), 88(1), 44-52
-59-

Inhibitors of Phosphotidyl inositol-3 Kinase family members including blockers of PI3-kinase, ATM, DNA-PK, and Ku may also be useful in the present invention Such kinases are discussed in Abraham, R T (1996), Current Opinion in Immunology 8 (3) 412-8, Canman, C E , Lim, D S (1998), Oncogene 17 (25) 3301-3308, Jackson, S P (1997), International Journal of Biochemistry and Cell Biology 29 (7) 935-8, and Zhong, H et al, Cancer res, (2000) 60(6), 1541-1545
Also of interest in the present invention are Myo-inositol signaling inhibitors such as phospholipase C blockers and Myoinositol analogues Such signal inhibitors are described in Powis, G , and Kozikowski A , (1994) New Molecular Targets for Cancer Chemotherapy ed , Paul Workman and David Kerr, CRC press 1994, London
Another group of signal transduction pathway inhibitors are inhibitors of Ras Oncogene Such inhibitors include inhibitors of farnesyltransferase, geranyl-geranyl transferase, and CAAX proteases as well as anti-sense oligonucleotides, nbozymes and immunotherapy Such inhibitors have been shown to block ras activation in cells containing wild type mutant ras, thereby acting as antiproliferation agents Ras oncogene inhibition is discussed in Scharovsky, O G , Rozados, V R , Gervasoni, S I Matar, P (2000), Journal of Biomedical Science 7(4) 292-8, Ashby, M N (1998), Current Opinion in Lipidology 9 (2) 99 - 102, and BioChim Biophys Acta, (19899)1423(3)19-30
As mentioned above, antibody antagonists to receptor kinase hgand binding may also serve as signal transduction inhibitors This group of signal transduction pathway inhibitors includes the use of humanized antibodies to the extracellular hgand binding domain of receptor tyrosine kinases For example Imclone C225 EGFR specific antibody (see Green, M C et al, Monoclonal Antibody Therapy for Solid Tumors, Cancer Treat Rev , (2000), 26(4), 269-286), Herceptin ® erbB2 antibody (see Tyrosine Kinase Signalling in Breast cancer erbB Family Receptor Tyrosine Kinases, Breast Cancer Res , 2000, 2(3), 176-183), and 2CB VEGFR2 specific antibody (see Brekken, R A et al, Selective Inhibition of VEGFR2 Activity by a monoclonal Anti-VEGF antibody blocks tumor growth in mice, Cancer Res (2000)60,5117-5124)
Non-receptor kinase angiogenesis inhibitors may also be useful in the present invention Inhibitors of angiogenesis related VEGFR and TIE2 are discussed above in regard to signal transduction inhibitors (both receptors are receptor tyrosine kinases) Angiogenesis in general is linked to erbB2/EGFR signaling since inhibitors of erbB2 and EGFR have been shown to inhibit angiogenesis, primarily VEGF expression Accordingly, non-receptor tyrosine
kinase inhibitors may be used in combination with the compounds of the present invention For example, anti-VEGF antibodies, which do not recognize VEGFR (the receptor tyrosine kinase), but bind to the ligand, small molecule inhibitors of integnn (alphav beta3) that will inhibit angiogenesis, endostatin and angiostatin (non-RTK) may also prove useful in combination with the disclosed compounds (See Bruns CJ et al (2000), Cancer Res , 60 2926-2935, Schreiber AB, Winkler ME, and Derynck R (1986), Science, 232 1250-1253, Yen L et al (2000), Oncogene 19 3460-3469)
Agents used in immunotherapeutic regimens may also be useful in combination with the compounds of formula (I) There are a number of immunologic strategies to generate an immune response These strategies are generally in the realm of tumor vaccinations The efficacy of immunologic approaches may be greatly enhanced through combined inhibition of signaling pathways using a small molecule inhibitor Discussion of the immunologic/tumor vaccine approach against erbB2/EGFR are found in Reilly RT et al (2000), Cancer Res 60 3569-3576, and Chen Y, Hu D, Ehng DJ, Robbins J, and Kipps TJ (1998), Cancer Res 58 1965-1971
Agents used in proapoptotic regimens (e g , bcl-2 antisense oligonucleotides) may also be used in the combination of the present invention Members of the Bcl-2 family of proteins block apoptosis Upregulation of bcl-2 has therefore been linked to chemoresistance Studies have shown that the epidermal growth factor (EGF) stimulates anti-apoptotic members of the bcl-2 family (i e , mcl-1) Therefore, strategies designed to downregulate the expression of bcl-2 in tumors have demonstrated clinical benefit and are now in Phase ll/lll trials, namely Genta's G3139 bcl-2 antisense oligonucleotide Such proapoptotic strategies using the antisense oligonucleotide strategy for bcl-2 are discussed in Water JS et al (2000), J Clin Oncol 18 1812-1823, and Kitada S etal (1994), Antisense Res Dev 4 71-79
Cell cycle signalling inhibitors inhibit molecules involved in the control of the cell cycle A family of protein kinases called cyclin dependent kinases (CDKs) and their interaction with a family of proteins termed cyclins controls progression through the eukaryotic cell cycle The coordinate activation and inactivation of different cyclm/CDK complexes is necessary for normal progression through the cell cycle Several inhibitors of cell cycle signalling are under development For instance, examples of cyclin dependent kinases, including CDK2, CDK4, and CDK6 and inhibitors for the same are described in, for instance, Rosania et al, Exp Opin Ther Patents (2000) 10(2) 215-230
In one embodiment, the cancer treatment method of the clarmed invention includes the co-administration a compound of Formula (I) and/or a pharmaceutically acceptable salt thereof and at least one antineoplastic agent, such as one selected from the group consisting of anti-microtubule agents, platinum coordination complexes, alkylating agents, antibiotic agents, topoisomerase II inhibitors, antimetabolites, topoisomerase I inhibitors, hormones and hormonal analogues, signal transduction pathway inhibitors, non-receptor tyrosine kinase angiogenesis inhibitors, immunotherapeutic agents, proapoptotic agents, and cell cycle signaling inhibitors
Because the pharmaceutically active compounds of the present invention are active as AKT inhibitors they exhibit therapeutic utility in treating cancer and arthritis
Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from brain (gliomas), glioblastomas, Bannayan-Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, inflammatory breast cancer, Wilm's tumor, Ewing's sarcoma, Rhabdomyosarcoma, ependymoma, medulloblastoma, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma, osteosarcoma, giant cell tumor of bone, thyroid,
Lymphoblastic T cell leukemia, Chronic myelogenous leukemia, Chronic lymphocytic leukemia, Hairy-cell leukemia, acute lymphoblastic leukemia, acute myelogenous leukemia, Chronic neutrophilic leukemia, Acute lymphoblastic T cell leukemia, Plasmacytoma, Immunoblastic large cell leukemia, Mantle cell leukemia, Multiple myeloma Megakaryoblastic leukemia, multiple myeloma, acute megakaryocyte leukemia, promyelocytic leukemia, Erythroleukemia,
malignant lymphoma, hodgkins lymphoma, non-hodgkins lymphoma, lymphoblastic T cell lymphoma, Burkitt's lymphoma, follicular lymphoma,
neuroblastoma, bladder cancer, urothelial cancer, lung cancer, vulval cancer, cervical cancer, endometrial cancer, renal cancer, mesothelioma, esophageal cancer, salivary gland cancer, hepatocellular cancer, gastric cancer, nasopharangeal cancer, buccal cancer, cancer of the mouth, GIST (gastrointestinal stromal tumor) and testicular cancer
Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from brain (gliomas), glioblastomas, Bannayan-Zonana syndrome, Cowden disease, Lhermitte-Duclos disease, breast, colon, head and neck, kidney, lung, liver, melanoma, ovarian, pancreatic, prostate, sarcoma and thyroid
Suitably, the present invention relates to a method for treating or lessening the severity of a cancer selected from ovarian, breast, pancreatic and prostate
Isolation and Purification of His-tagqed AKT1 (aa 136-480)
Insect cells expressing His-tagged AKT1 (aa 136-480) were lysed in 25 mM HEPES, 100 mM NaCI, 20 mM imidazole, pH 7 5 using a polytron (5 mLs lysis buffer/g cells) Cell debns was removed by centnfuging at 28,000 x g for 30 minutes The supernatant was filtered through a 4 5-micron filter then loaded onto a nickel-chelating column pre-equilibrated with lysis buffer The column was washed with 5 column volumes (CV) of lysis buffer then with 5 CV of 20% buffer B, where buffer B is 25 mM HEPES, 100 mM NaCI, 300 mM imidazole, pH 7 5 His-tagged AKT1 (aa 136-480) was eluted with a 20-100% linear gradient of buffer B over 10 CV His-tagged AKT1 (136-480) eluting fractions were pooled and diluted 3-fold with buffer C, where buffer C is 25 mM HEPES, pH 7 5 The sample was then chromatographed over a Q-Sepharose HP column pre-equilibrated with buffer C The column was washed with 5 CV of buffer C then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D, where buffer D is 25 mM HEPES, 1000 mM NaCI, pH 7 5 His-tagged AKT1 (aa 136-480) containing fractions were pooled and concentrated in a 10-kDa molecular weight cutoff concentrator His-tagged AKT1 (aa 136-480) was chromatographed over a Superdex 75 gel filtration column pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 1 mM DTT, pH 7 5 His-tagged AKT1 (aa 136-480) fractions were examined using SDS-PAGE and mass spec The protein was pooled, concentrated and frozen at -80C
His-tagged AKT2 (aa 138-481) and His-tagged AKT3 (aa 135-479) were isolated and purified in a similar fashion
His-taqqed AKT Enzyme Assay
Compounds of the present invention were tested for AKT 1, 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate The substrate phosphorylation assays use the catalytic domains of AKT 1, 2, or 3 AKT 1, 2 and 3 are also commercially available from Upstate USA, Inc The method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine
residue of a biotinylated synthetic peptide SEQ ID NO 1 (Biotin-ahx-ARKRERAYSFGHHA-amide) Substrate phosphorylation was detected by the following procedure
Assays were performed in 384well U-bottom white plates 10 nM activated AKT enzyme was incubated for 40 minutes at room temperature in an assay volume of 20ul containing 50mM MOPS, pH 7 5, 20mM MgCl2, 4uM ATP, 8uM peptide, 0 04 uCi [g-33P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1 ul of test compound in 100% DMSO The reaction was stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg2+ and Ca2\ 0 1% Triton X-100, 5mM EDTA, 50uM ATP, 2 5mg/ml Streptavidin-coated SPA beads ) The plate was sealed, the beads were allowed to settle overnight, and then the plate was counted in a Packard Topcount Microplate Scintillation Counter (Packard Instrument Co , Menden, CT)
The data for dose responses were plotted as % Control calculated with the data reduction formula 100*(U1-C2)/(C1-C2) versus concentration of compound where U is the unknown value, C1 is the average control value obtained for DMSO, and C2 is the average control value obtained for 0 1M EDTA Data are fitted to the curve described by y = ((Vmax * x) / ( K + x )) where Vmax is the upper asymptote and K is the IC50
Cloning of full-length human (FU AKT1
Full-length human AKT1 gene was amplified by PCR from a plasmid containing mynstylated-AKT1-ER (gift from Robert T Abraham, Duke University under MTA, described in Khppel et al in Molecular and Cellular Biology 1998 Volume 18 p 5699) using the 5' primer SEQ ID NO 2, 5' TATATAGGATCCATGAGCGACGTGGC 3' and the 3' primer SEQ ID NO 3, AAATTTCTCGAGTCAGGCCGTGCTGCTGG 3' The 5' primer included a BamHI site and the 3'pnmer included an Xhol site for cloning purposes The resultant PCR product was subcloned in pcDNA3 as a BamHI / Xhol fragment A mutation in the sequence (TGC) coding for a Cysteine25 was converted to the wild-type AKT1 sequence (CGC) coding for an Argmine25 by site-directed mutagenesis using the QuikChange® Site Directed Mutagenesis Kit (Stratagene) The AKT1 mutagenic primer SEQ ID NO 4, 5' ACCTGGCGGCCACGCTACTTCCTCC and selection primer SEQ ID NO 5, 5' CTCGAGCATGCAACTAGAGGGCC (designed to destroy
an Xbal site in the multiple cloning site of pcDNA3) were used according to manufacturer's suggestions For expression/purification purposes, AKT1 was isolated as a BamHI / Xhol fragment and cloned into the BamHI / Xhol sites of pFastbacHTb (Invitrogen)
Expression of FL human AKT1
Expression was done using the BAC-to-BAC Baculovirus Expression System from Invitrogen (catalog # 10359-016) Briefly 1) the cDNA was transferred from the FastBac vector into bacmid DNA, 2) the bacmid DNA was isolated and used to transfect Sf9 insect cells, 3) the virus was produced in Sf9 cells, 4) T ni cells were infected with this virus and sent for purification
Purification of FL human AKT1
For the purification of full-length AKT1, 130 g sf9 cells (batch # 41646W02) were resuspended in lysis buffer (buffer A, 1L, pH 7 5) containing 25 mM HEPES, 100 mM NaCI, and 20 mM imidazole The cell lysis was carried out by Avestm (2 passes at 15K-20K psi) Cell debris was removed by centnfuging at 16K rpm for 1 hour and the supernatant was batch bound to 10 ml Nickel Sepharose HP beads at 4 C for over night The beads were then transferred to column and the bound material was eluted with buffer B (25 mM HEPES, 100 mM NaCI, 300 mM imidazole, pH 7 5) AKT eluting fractions were pooled and diluted 3 fold using buffer C (25 mM HEPES, 5 mM DTT, pH 7 5) The sample was filtered and chromatographed over a 10 mL Q-HP column pre-equilibrated with buffer C at 2 mL/min
The Q-HP column was washed with 3 column volume (CV) of buffer C, then step eluted with 5 CV 10%D, 5 CV 20% D, 5 CV 30% D, 5 CV 50% D and 5 CV of 100% D, where buffer D is 25 mM HEPES, 1000 mM NaCI, 5 mM DTT, pH 7 5 5 mL fractions collected AKT containing fractions were pooled and concentrated to 5 ml The protein was next loaded to a 120 ml Superdex 75 sizing column that was pre-equilibrated with 25 mM HEPES, 200 mM NaCI, 5 mM DTT, pH 7 5 2 5 mL fractions were collected
AKT 1 eluting fractions were pooled, aliquoted (1 ml) and stored at -80C Mass spec and SDS-PAGE analysis were used to confirm purity and identity of the purified full-length AKT1
Full length AKT2 and full length AKT3 were cloned, expressed and purified in a similar fashion
AKT Enzyme Assay
Compounds of the present invention are tested for AKT 1, 2, and 3 protein serine kinase inhibitory activity in substrate phosphorylation assays This assay examines the ability of small molecule organic compounds to inhibit the serine phosphorylation of a peptide substrate The substrate phosphorylation assays use the catalytic domains of AKT 1, 2, or 3 AKT 1, 2 and 3 are also commercially available from Upstate USA, Inc The method measures the ability of the isolated enzyme to catalyze the transfer of the gamma-phosphate from ATP onto the serine residue of a biotinylated synthetic peptide SEQ ID NO 1 (Biotm-ahx-ARKRERAYSFGHHA-amide) Substrate phosphorylation is detected by the following procedure
Assays are performed in 384well U-bottom white plates 10 nM activated AKT enzyme is incubated for 40 minutes at room temperature in an assay volume of 20ul containing 50mM MOPS, pH 7 5, 20mM MgCl2, 4uM ATP, 8uM peptide, 0 04 uCi [g- P] ATP/well, 1 mM CHAPS, 2 mM DTT, and 1ul of test compound in 100% DMSO The reaction is stopped by the addition of 50 ul SPA bead mix (Dulbecco's PBS without Mg2+ and Ca2\ 0 1% Triton X-100, 5mM EDTA, 50uM ATP, 2 5mg/ml Streptavidin-coated SPA beads) The plate is sealed, the beads are allowed to settle overnight, and then the plate is counted in a Packard Topcount Microplate Scintillation Counter (Packard Instrument Co , Menden, CT)
The data for dose responses are plotted as % Control calculated with the data reduction formula 100*(U1-C2)/(C1-C2) versus concentration of compound where U is the unknown value, C1 is the average control value obtained for DMSO, and C2 is the average control value obtained for 0 1M EDTA Data are fitted to the curve described by y = ((Vmax * x) / ( K + x )) where Vmax is the upper asymptote and KisthelC50
Compounds of the invention are tested for activity against AKT1, AKT2, and AKT3 in one or more of the above assays
The majority of the compounds of the Examples were tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value ^59 against full length AKT1, ^50 against full length AKT2, and > 5 0 against full length AKT3
The compounds of Examples 31, 32, 91, 95, 120, 128, 140, 161, 167, 169, 170, 190, 222, 225, 237, 249, 258 and 259 were tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value ^86 against full length AKT1, and ^75 against full length AKT2 The majority of the compounds of Examples 31, 32, 91, 95, 120, 128, 140, 161, 167, 169, 170, 190, 222, 225, 237, 249, 258 and 259 were tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value, ^76 against full length AKT3
The compound of Example 96 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 9 0 against full length AKT1, equal to 8 0 against full length AKT2, and equal to 8 8 against full length AKT3
The compound of Example 137 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 9 0 against full length AKT1, equal to 7 8 against full length AKT2, and equal to 8 4 against full length AKT3
The compound of Example 224 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 8 7 against full length AKT1, and equal to 7 8 against full length AKT2
The compound of Example 161 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 8 8 against full length AKT1, equal to 7 5 against full length AKT2, and equal to 7 6 against full length AKT3
The compound of Example 222 was tested generally according to the above AKT enzyme assays and in at least one experimental run exhibited a plC50 value equal to 8 8 against full length AKT1, and equal to 7 9 against full length AKT2, and equal to 8 5 against full length AKT3
In the above data, plC50 is defined as -log(IC50) where the IC50 value is expressed in molar units
The pharmaceutically active compounds within the scope of this invention are useful as AKT inhibitors in mammals, particularly humans, in need thereof
The present invention therefore provides a method of treating cancer, arthritis and other conditions requinng AKT inhibition, which compnses administenng an effective compound of Formula (I) and/or a pharmaceutically acceptable salt, hydrate, solvate or pro-drug thereof The compounds of Formula (I) also provide for a method of treating the above indicated disease states because of their demonstrated ability to act as Akt inhibitors The drug may be administered to a patient in need thereof by any conventional route of administration, including, but not limited to, intravenous, intramuscular, oral, subcutaneous, intradermal, and parenteral
The pharmaceutically active compounds of the present invention are incorporated into convenient dosage forms such as capsules, tablets, or injectable preparations Solid or liquid pharmaceutical carriers are employed Solid carriers include, starch, lactose, calcium sulfate dihydrate, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid Liquid carriers include syrup, peanut oil, olive oil, saline, and water Similarly, the carrier or diluent may include any prolonged release material, such as glyceryl monostearate or glyceryl distearate, alone or with a wax The amount of solid carrier vanes widely but, preferably, will be from about 25 mg to about 1 g per dosage unit When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion, soft gelatin capsule, sterile injectable liquid such as an ampoule, or an aqueous or nonaqueous liquid suspension
The pharmaceutical preparations are made following conventional techniques of a pharmaceutical chemist involving mixing, granulating, and compressing, when necessary, for tablet forms, or mixing, filling and dissolving the ingredients, as appropriate, to give the desired oral or parenteral products
Doses of the presently invented pharmaceutically active compounds in a pharmaceutical dosage unit as described above will be an efficacious, nontoxic quantity preferably selected from the range of 0 001 -100 mg/kg of active compound, preferably 0 001 - 50 mg/kg When treating a human patient in need of an Akt inhibitor, the selected dose is administered preferably from 1-6 times daily, orally or parenterally Preferred forms of parenteral administration include topically, rectally, transdermally, by injection and continuously by infusion Oral dosage units for human administration preferably contain from 0 05 to 3500 mg of active compound Oral administration, which uses lower dosages, is preferred
Parenteral administration, at high dosages, however, also can be used when safe and convenient for the patient
Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular Akt inhibitor in use, the strength of the preparation, the mode of administration, and the advancement of the disease condition Additional factors depending on the particular patient being treated will result in a need to adjust dosages, including patient age, weight, diet, and time of administration
The method of this invention of inducing Akt inhibitory activity in mammals, including humans, comprises administering to a subject in need of such activity an effective Akt inhibiting amount of a pharmaceutically active compound of the present invention
The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use as an Akt inhibitor
The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in therapy
The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating cancer
The invention also provides for the use of a compound of Formula (I) in the manufacture of a medicament for use in treating arthritis
The invention also provides for a pharmaceutical composition for use as an Akt inhibitor which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier
The invention also provides for a pharmaceutical composition for use in the treatment of cancer which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier
The invention also provides for a pharmaceutical composition for use in treating arthritis which comprises a compound of Formula (I) and a pharmaceutically acceptable carrier
No unacceptable toxicological effects are expected when compounds of the invention are administered in accordance with the present invention
In addition, the pharmaceutically active compounds of the present invention can be co-administered with further active ingredients, such as other compounds known to treat cancer or arthritis, or compounds known to have utility when used in combination with an Akt inhibitor
Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent The following Examples are, therefore, to be construed as merely illustrative and not a limitation of the scope of the present invention in any way
Expenmental Details
The compounds of Examples 1 to 328 are readily made according to Schemes 1 to 3 or by analogous methods
Preparation 1 Preparation of 1.1-dimethylethyl (2-amino-2-prtenylethy0carbamate
(Formula Removed)
a) 1,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate
(Formula Removed)
To a solution of 2-amino-1-phenylethanol (5 g, 36 4 mmol) in THF (182 mL) at 25 °C was added BoC20 (8 7 g, 40 1 mmol) in one portion After 0 5h, the solution was concentrated and the residue used directly without further purification LC-MS (ES) m/z = 238 (M+H)+
b) 1,1-dimethylethyl[2-(1,3-dioxc-1,3-dihydro-2H-isoindol-2-yl)-2-
phenylethyljcarbamate
(Formula Removed)
o a solution of 1,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate (2 g, 8 44 mmol), phthalimide (1 g, 7 03 mmol) and priphenylphosphine (2 76 g, 10 5 mmol) in THF (35 mL) at 25 °C was added DEAD (1 7 mL, 10 5 mmol) dropwise After 0 5h, the solution was concentrated and purified via column chromatography (silica, 15 % EtOAc in hexanes) affording the title compound (2 g, 80%) as a white foam LC-MS (ES) m/z = 367 (M+H)+
c) 1,1 -dimethylethyl (2-amino-2-phenylethyl)carbamate
(Formula Removed)
solution of 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-2-phenylethyl]carbamate (2 g, 5 46 mmol) and either MeNH2 (40wt% in H20, 10eq ) or NH2NH2 (10eq ) in MeOH (0 5M, 10 mL) was heated to 60 °C in a sealed tube After 12h, the solution was concentrated and purified via column chromatography (silica-dry load, 2% MeOH in DCM (1% NH4OH)) affording the title compound (1 1 g, 85%) as a white solid LC-MS (ES) m/z = 237 (M+H)+
Preparation 2
(Formula Removed)
reparation of 1.1-dimethylethyl (2-amino-3-phenylpropyl)carbamate
a) 1-amino-3-phenyl-2-propanol
(Formula Removed)
solution of 2-(phenylmethyl)oxirane (7 5 g, 56 3 mmol) in NH4OH (100 mL) was stirred at 25 °C in a sealed tube After 12h, the solution was concentrated and used directly LCMS (ES) m/e 152 (M+H)+
b) 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)carbamate
(Formula Removed)
o a solution of 1-amino-3-phenyl-2-propanol ( 7 6 g, 50 mmole) in THF (50 mL) at RT was added (Boc)20 (12 0 g, 55 mmole) After stirnng at RT for 2 h, the reaction solution was concentrated under vacuum and the residue punfied on silica gel (5% MeOH in DCM (0 5% NH4OH)) affording the title compound (13 1 g, 91%) as a clear yellow oil LCMS (ES) m/z 252 (M+H)+
c) 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-
phenylpropyljca rbamate
(Formula Removed)
o a solution of 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)carbamate (10 0 g, 39 8 mmol), PPh3 (12 5 g, 47 8 mmol) and phthalimide (6 44 g, 43 8 mmol) in THF (125 mL) at RT was added DEAD (9 4 mL, 59 7 mmol) over 5 mm After 1 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAc, 2 1) to give the title compound as a white solid (12 6 g, 83%) LCMS (ES) m/z 381 (M+H)+
d) 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate
NH2NH2 (12 5 mL, 394 mmol) was added to a THF/MeOH (50mL / 50mL) solution of 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (7 5 g, 19 7 mmol) and stirred at 50 °C in a sealed system After 12 hours, the solids were filtered, washing with methanol The filtrate was concentrated and punfied by column chromatography using 5% MeOH in CHCI3containing 0 5% NH4OH to give the title compound (3 75 g, 76%) as a white solid LC-MS (ES) m/z = 251 (M+H)+
Preparation 3
(Formula Removed)
reparation of 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate
a) 3-amino-1-phenyl-1-propanol
(Formula Removed)
enzoylacetonitnle (2 g, 13 8 mmol) in THF (35 mL) was added dropwise via addition funnel to a 0 °C solution of LAH (1 6 g, 41 3 mmol) in THF (35 mL) The resulting solution warmed to 25 °C and then was heated to 60 °C for an additional 2h After cooling to 0 °C, a saturated solution of sodium potassium tartrate was added dropwise and the solution was extracted several times with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica, 5-8% MeOH in DCM (1% NH4OH)) affording the amino alcohol (1 4 g, 67%) as a clear oil LCMS (ES) m/z 152 (M+H)+
b) 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)carbamate
(Formula Removed)
-amino-1-phenyl-1-propanol (1 4 g, 9 27 mmol) was dissolved in THF (50 mL) and BoC2O (2 4 g, 11 1 mmol) was added in one portion After 30 mm , the solution was concentrated and the residue purified through via silica (0 5-1% MeOH in DCM (1% NH4OH)) affording the title compound (1 6 g, 69%) as a pale white solid LCMS(ES)m/z152(M+H)+
c) 1,1-dimethylethyl[3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-ph en yl propyl]ca rba ma te
(Formula Removed)
o a solution of 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)carbamate (3 g, 11 95 mmol), PPh3 (4 g, 15 5 mmol) and phthalimide (1 8 g, 11 95 mmol) in THF (60 mL) at RT was added DEAD (2 4 mL, 15 5 mmol) over 5 mm After 1 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAc, 4 1) to give the title compound as a white solid (2 2 g, 48%) LCMS (ES) m/z 381 (M+H)+
c) 1,1-dimethylethyl (3-amino-3-phenylpropyl)carbamate
NH2NH2 (1 8 mL, 57 7 mmol) was added to a THF/MeOH (1 1, 30 mL) solution of 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-phenylpropyl]carbamate (2 2 g, 5 79 mmol) and stirred at 50 °C in a sealed system After 12 hours, the solids were filtered, washing with methanol The filtrate was
concentrated and punfied by column chromatography using 5% MeOH in CHCI3 containing 1% NH4OH to give the title compound (1 1 g, 76%) as a white solid LC-MS (ES) m/z = 251 (M+H)+
Preparation 4
(Formula Removed)
reparation of 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate
a) 2-(2-phenylethyl)oxirane
(Formula Removed)
-chlorobenzenecarboperoxoic acid (12 1 g, 54 0 mmol) is added in one portion to a solution of 3-buten-1-ylbenzene (7 15 g, 54 1 mmol) in CH2CI2 at 0 °C followed by warming to 25 °C overnight Saturated NaHCO3 was added and the mixture separated and the resulting clear oil (8 0 g, quant) was carried forward without further purification LC-MS (ES) m/z = 149 (M+H)+
b) 1-amino-4-phenyl-2-butanol
(Formula Removed)
-(2-phenylethyl)oxirane (8 0 g, 54 mmol) was placed in a sealed tube with 7N NH3-MeOH (130 mL) and stirred 2 hours at 70 °C followed by concentration to a clear oil (and was used without further purification in the following step
c) 1,1-dimethylethyl (2-hydroxy-4-phenylbutyl)carbamate
(Formula Removed)
-amino-4-pheny!-2-butanol (7 4 g, 50 0 mmol) was dissolved in THF (50 mL) and B0C2O (13 g, 59 6 mmol) was added in one portion After 30 mm , the solution was concentrated and the residue purified through a silica plug (5% MeOH
in DCM (0 5% NH4OH)) affording the title compound (13 1 g, 91%) as a clear yellow oil LCMS (ES) m/z 266 (M+H)+
d) 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-4-
phenylbutyljcarbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl (2-hydroxy-4-phenylbutyl)carbamate (3 0 g, 11 4 mmol), PPh3 (3 6 g, 13 7 mmol) and phthahmide (1 84 g, 12 5 mmol) in THF (60 mL) at RT was added DEAD (1 8 mL, 11 4 mmol) over 5 mm After 0 5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2 1) to give the title compound as a white solid (3 1 g, 69%) LCMS (ES) m/z 395 (M+H)+
e) 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate
NH2NH2 (2 5 mL, 79 6 mmol) was added to a THF/MeOH (40mL/40mL) solution of 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (3 1 g, 7 83 mmol) and stirred overnight After 12 hours, the solution was concentrated and punfied by column chromatography using 5% MeOH in CHCI3 containing 0 5% NH4OH to give the title compound (1 4 g, 66%) as a white solid LC-MS (ES) m/z = 265 (M+H)+
Preparation 5
(Formula Removed)
Preparation of 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione
a) 1,1-dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(phenylmethyl)ethyl]carbamate
(Formula Removed)
To a solution of (S)-(-)-2-(tert-butoxycarbonylamino)-3-phenyl-1-propanol (3 0 g, 11 9 mmole), PPh3 (3 74 g, 14 4 mmole) and phthahmide (1 93 g, 13 1 mmole) in THF (75 mL) at RT was added DEAD (2 8 mL, 17 8 mmole) over 5 mm After 1 5 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAC, 2 1) to give the title compound as a white solid (4 3 g, 95%) LCMS (ES) m/z 381 (M+H)+
b) 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione
To a solution of 1,1-dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(phenylmethyl)ethyl]carbamate (4 3 g, 11 3 mmole) in MeOH (100 mL) at RT was added 4M HCI in dioxane (50 mL) After stirring for 3h at RT, the reaction solution was concentrated to a white solid (quant) LCMS (ES) m/z 281 (M+H)+
Preparation 6
(Formula Removed)
Preparation of 2-{(2S)-2-amino-3-[2-(trifiuoromethyl)phenyl]propyl}-1 H-isomdole-1.3(2H)-dione
a) 1,1-dimethylethyl ((1S)-2-hydroxy-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)carbamate
(Formula Removed)
To a solution of N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine (5 g, 15 mmol) in THF (75 mL) at 0 °C stirred was added BH3-THF (45 mL, 45 mmol-1 M in THF) After 12h, the reaction was quenched with AcOH MeOH (1 5, 24 mL) and partitioned between saturated aqueous NaHCO3 and DCM The aqueous phase was then extracted several times with DCM The combined organic fractions were dned over Na2SO4 and used directly (4 2 g, 88%) LCMS (ES) m/e 320 (M+H)+
b) 1,1-dimethylethyl((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl ((1S)-2-hydroxy-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)carbamate (4 2 g, 13 2 mmol), priphenylphosphine (4 5 g, 17 1 mmol) and phthalimide (1 9 g, 13 2 mmol) in THF (66 mL) at 25 °C was added diethyl azodicarboxylate (2 7 mL, 17 1 mmol) After stirring at RT for 1 h, the reaction solution was concentrated under vacuum and the residue purified on silica gel (1 % MeOH in DCM) affording the title compound (3 2 g, 54 %) as a white solid LCMS (ES) m/z 449 (M+H)+
c) 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione
To a solution of 1,1-dimethylethyl ((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)carbamate (3 2 g, 7 1 mmol) in MeOH (35 mL) at RT was added 4M HCI in dioxane (18 mL) After 12h, the solution was concentrated affording the title compound (2 7 g, quant) as the HCI salt LCMS (ES) m/z 349 (M+H)+
Preparation 7
(Formula Removed)
Preparation of 5-(5.5-dimethyl-1,3.2-dioxabonnan-2-yl)-1 -methyl-1 H-pyrazole
To a solution of 1-methyl pyrazole (4 1 g, 50 mmole) in THF (100 mL) at 0°C was added n-BuLi (2 2M in THF, 55 mmole) The reaction solution was stirred for 1 hour at RT and then cooled to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (12 3 mL, 60 mmole) After 15 mm at -78°C, the reaction was allowed to warm to 0°C over 1hour The reaction was diluted with saturated NH4CI solution and extracted with DCM The organic fractions were washed with H2O (2 x 100 mL), dried over Na2SO4 and concentrated under vacuum to afford a tan solid (8 0 g, 77%) which was used without further purification LCMS (ES) m/z 127 (M+H)+ for [RB(OH)2], 1H NMR (CDCI3, 400 MHz) δ 7 57 (s, 1H), 6 75 (s, 1H), 4 16 (s, 3H), and 1 41 (s, 12H)
Preparation 8
(Formula Removed)
Preparation of 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate a) 3-oxo-4-phenylbutanenitnle
(Formula Removed)
To a solution of cyanoacetic acid (2 g, 23 5 mmol) in THF (100 mL) at -78 °C was added nBuLi (10 mL, 25 9 mmol, 2 5M in hexanes) After 30mm, phenylacetyl chloride (1 6 mL, 118 mmol) was added dropwise Following an additional 30min, the solution was partitioned between 1N HC1-Et20 and the aqueous phase was washed several times with Et20 The combined organic fractions were dried over Na2SO4, concentrated and purified via column
chromatography (silica, 30% EtOAc in hexanes) yielding the title compound (770 mg, 40%) as a tan oil LCMS (ES) m/z 160 (M+H)+
b) 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate
A solution of 3-oxo-4-phenylbutanenitnle (1 1 g, 6 92 mmol) in THF (10 mL) was added to a 0 °C solution of lithium aluminum hydnde (787 mg, 20 8 mmol) in THF (25 mL) After 12h, the solution was quenched with H2O (943 uL), 6N NaOH (716 uL) and H2O (3 5 mL) The resulting precipitate was filtered and the pad was washed several times with DCM The filtrate was concentrated then redissolved in THF (30 mL) and BoC2O (1 5 g, 6 92 mmol) was added in one portion After 30 mm, the solution was concentrated and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound (1g, 55%-2steps) as an orange solid LCMS (ES) m/z 265 (M+H)+
c) 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-4-
phenylbutyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate (1 g, 3 77 mmol), PPh3 (1 3 g, 4 91 mmol) and phthalimide (555 mg, 3 77 mmol) in THF (18 mL) at RT was added DEAD (772 uL, 4 91 mmol) over 5 mm After 1 h at RT, the reaction solution was concentrated and purified on silica (hexanes/EtOAc, 5 1) to give the title compound as a white solid (725 mg, 49%) LCMS (ES) m/z 395 (M+H)+
d) 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate
NH2NH2 (577 uL, 18 4 mmol) was added to a THF/MeOH (1 1, 10 mL) solution of 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-4-
phenylbutyl]carbamate (725 mg, 1 84 mmol) and stirred at 50 °C in a sealed system After 12 hours, the solids were filtered, washing with methanol The filtrate was concentrated and punfied by column chromatography using 5% MeOH in CHCI3 containing 1% NH4OH to give the title compound (483 mg, quant) as a white solid LC-MS (ES) m/z = 264 (M+H)+
Preparation 9
(Formula Removed)
Preparation of 4-bromo-5-methyl-2-thiophenecarboxylic acid
A solution of bromine (725 uL, 14 1 mmol) in AcOH (2 8 mL) was added dropwise to 5-methyl-2-thiophenecarboxylic acid (2 g, 14 1 mmol) and FeCl3 (456 mg, 2 81 mmol) in AcOH (28 mL) at 25 °C After 5h, the solution was poured onto ice and the precipitate was filtered and washed with water affording the title compound (3 g, quant) as a yellow powder LCMS (ES) m/z 222 (M+H)+
Preparation 10
(Formula Removed)
Preparation of methyl 4-bromo-5-methyl-2-thiophenecarboxylate
A solution of 4-bromo-5-methyl-2-thiophenecarboxylic acid (3 g, 13 6 mmol) in MeOH (67 mL) and H2SO4 (3 mL) was stirred at 50 °C After 12h, the solution was added to ice-H20 and the pH was adjusted to ~11 The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly yielding the title compound (3 g, 94%) as an orange solid LCMS (ES) m/z 236 (M+H)+
Preparation 11
(Formula Removed)
Preparation of 4-bromo-5-chloro-2-thioDhenecarboxylic acid
A solution of bromine (634 uL, 12 3 mmol) in AcOH (2 5 mL) was added dropwise to 5-chloro-2-thiophenecarboxylic acid (2 g, 12 3 mmol) and FeCI3 (399 mg, 2 50 mmol) in AcOH (25 mL) at 25 °C The reaction mixture was warmed to reflux where additional bromine (634 uL, 12 3 mmol) and FeCI3 (399 mg, 2 50 mmol) were added After 7d, the solution was poured onto ice and the precipitate was filtered and washed with water affording the title compound (3 g, quant) as a yellow powder LCMS (ES) m/z 242 (M+H)+
Preparation 12
(Formula Removed)
Preparation of 1.1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate
a) 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)methylcarbamate
(Formula Removed)
3-(methylamino)-1-phenyl-1-propanol (4 12 g, 24 9 mmol) was dissolved in THF (30 mL) and BoC2O (1M/THF, 30 mL, 30 mmol) was added in one portion After 30 mm , the solution was concentrated and the residue purified through a silica plug (5% MeOH in DCM (0 5% NH4OH)) affording the title compound (6 4 g, 97%) as a clear yellow oil LCMS (ES) m/z 265 (M+H)+
b) 1,1-dimethylethyl[3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-
phenylpropyl]methylcarbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl (3-hydroxy-3-phenylpropyl)methylcarbamate (2 8 g, 10 4 mmol), PPh3 (3 3 g, 12 7 mmol) and phthalimide (1 86 g, 12 6 mmol) in THF (50 mL) at RT was added DEAD (1 98 mL, 12 6 mmol) over 5 mm After 0 5 h at RT, MeOH (10 mL) was added and the reaction solution was absorbed onto silica and purified via chromatography (hexanes/EtOAC, 2 1) to give the title compound as a white solid (2 7 g, 65%) LCMS (ES) m/z 395 (M+H)+
c) 1,1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate
NH2NH2 (1 7 mL, 54 2 mmol) was added to a THF/MeOH (50mL/10mL) solution of 1,1-dimethylethyl [3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-phenylpropyl]methylcarbamate (2 7 g, 6 8 mmol) and stirred overnight After 12 hours, the solution was absorbed onto silica and purified by column chromatography using 5% MeOH in CHCI3containing 0 5% NH4OH to give the title compound (1 4 mg, 77%) as a white solid LC-MS (ES) m/z = 265 (M+H)+
Preparation 13
(Formula Removed)
Preparation of 1.1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate a) 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)methylcarbamate
(Formula Removed)
To a solution of 1-(methylamino)-3-phenyl-2-propanol (13 g, 78 mmol) [prepared according to Galons, H et al Eur J Med Chem Chim Ther 1979 14, 165-170 ] in THF (390 mL) at RT was added (Boc)20 (21 6 g, 99 mmol) After stirring at RT for 2 h, the reaction solution was absorbed onto silica and purified via chromatography (35% EtOAc/Hex) affording the title compound (11 6 g, 56%) as a clear yellow oil LCMS (ES) m/z 266 (M+H)+
b) 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-
phenylpropyljmethylcarbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl (2-hydroxy-3-phenylpropyl)methylcarbamate (11 6 g, 43 72 mmol), PPh3 (14 3 g, 54 5 mmol) and phthahmide (8 7 g, 59 1mmol) in THF (220 mL) at RT was added DEAD (8 5 mL, 54 mmol) over 15 mm After 0 5 h at RT, MeOH (10 mL) was added and the reaction solution was absorbed onto silica and purified via chromatography (hexanes/EtOAC, 2 1) to give the title compound as a white solid (9 97 g, 57%) LCMS (ES) m/z 395 (M+H)+
c) 1,1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate
NH2NH2 (7 mL, 0 2 mol) was added to a THF/MeOH (100mL/25mL) solution of 1,1 -dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-3-phenylpropyl]methylcarbamate (2 7 g, 6 8 mmol) and stirred overnight After 12 hours, the solution was absorbed onto silica and purified by column chromatography using 5% MeOH in CHCI3containing 0 5% NH4OH to give the title compound (5 8 mg, 88%) as a white solid LC-MS (ES) m/z = 265 (M+H)+
Preparation 14
(Formula Removed)
Preparation of 2-(2-amino-3-methyl-3-phenylbutyl)-1H-isoindole-1,3(2H)-dione
a) methyl 2-azido-3-methyl-3-phenylbutanoate
(Formula Removed)
To a solution of KHMDS (36 mL, 17 9 mmol) in THF (70 mL) at -78 °C was added methyl 3-methyl-3-phenylbutanoate (3 g, 15 6 mmol) in THF (15 mL) dropwise After 1h, trisylazide (5 g, 18 7 mmol) in THF (15 mL) was added dropwise over 10 mm After an additional 5 mm, acetic acid (4 1 mL) was added and the reaction mixture warmed to 25 °C over 1h The solution was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 20% EtOAc in hexanes) yielding the title compound (2 6 g, 71%) contaminated with 33% methyl 3-methyl-3-phenylbutanoate to be purified out in the following steps LCMS (ES) m/e 234 (M+H)+
b) methyl beta.beta-dimethylphenylalaninate
(Formula Removed)
A solution of methyl 2-azido-3-methyl-3-phenylbutanoate (2 6 g, 11 2 mmol) and PPh3 (4 4 g, 16 7 mmol) in H20 (400 uL) and THF (100 mL) was stirred at 25 °C over 2d then at 50 °C for 12h The solution was concentrated and punfied via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) yielding the title compound (1 4 g, quant) LCMS (ES) m/e 208 (M+H)+
c) 2-amino-3-methyl-3-phenyl-1 -butanol
(Formula Removed)
To a solution of methyl beta.beta-dimethylphenylalaninate (1 4 g, 6 76 mmol) in THF (20 mL) at 0 °C was added dropwise a solution of lithium aluminum hydride (384 mg, 10 1 mmol) in THF (10 mL) After warming to 25 °C over 12h, the solution was quenched by sequential addition of H20 (659 uL), 6N NaOH (500 uL) and H20 (2 4 mL) The resulting precipitate was filtered and the pad washed thoroughly with DCM The filtrate was concentrated and purified via column
chromatography (silica, 2-5% MeOH in DCM (1% NH4OH)) yielding the title compound (770 mg, 64%) LCMS (ES) m/e 179 (M+H)+
d) 1,1-dimethylethyl [1-(hydroxymethyl)-2-methyl-2-phenylpropyl]carbamate
(Formula Removed)
BoC2O (1 g, 4 76 mmol) was added in one portion to 2-amino-3-methyl-3-phenyl-1-butanol (770 mg, 4 33 mmol) in THF (20 mL) at 25 °C After 30 mm, the solution was concentrated yielding the title compound (1 2 g, quant) as a white solid which was used without further purification LCMS (ES) m/e 279 (M+H)+
e) 1,1-dimethylethyl{1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]-2-methyl-2-
phenylpropyl}carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [1-(hydroxymethyl)-2-methyl-2-phenylpropyljcarbamate ( 775 mg, 2 8 mmol), priphenylphosphine (915 mg, 3 5 mmol) and phthahmide (499 mg, 3 4 mmol) in THF (15 mL) at 25 °C was added diethyl azodicarboxylate (0 54 mL, 3 4 mmol) After stirring at RT for 1 h, MeOH was added (5 mL) and the solution was adsorbed onto silica and purified via column chromatography (1 % MeOH in DCM) affording the title compound (723 mg, 64 %) as a white solid LCMS (ES) m/z 409 (M+H)+
f) 2-(2-amino-3-methyl-3-phenylbutyl)-1 H-isoindole-1,3(2H)-dione
(Formula Removed)
To a solution of 1,1-dimethylethyl {1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]-2-methyl-2-phenylpropyl}carbamate (723 mg, 1 77 mmol) in CHCI3 MeOH (10 1, 55 mL) at RT was added 4M HCI in dioxane (10 mL) After stirring for 3h at RT, the reaction solution was concentrated to a white solid (quant) LCMS (ES) m/z 309 (M+H)+
Preparation 15
(Formula Removed)
Preparation of 5-todo-1-methyl-1H-1.2.4-triazole
1-methyl-1H-1,2,4-triazole (2 05 g, 24 7 mmol) was added slowly over 15 minutes to an Et20 solution of nBuLi at -70 °C The mixture was stirred for 60 minutes at -70 °C and allowed to warm to -30 °C A solution of l2 (6 5 g, 25 6 mmol) in THF (27 mL) was added slowly over 15 minutes and the mixture was allowed to warm to room temperature and stir for 60 minutes The mixture was partitioned with saturated Na2S203, the phases were separated and the organic solvent removed The crude iodide was used without further purification LCMS (ES) m/z 210(M+H)+
Preparation 16
(Formula Removed)
Preparation of 1.1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate
a) hydroxy(1-naphthalenyl)acetonitnle
(Formula Removed)
To a solution of potassium cyanide in ether (100 mL) at 0 °C was added dropwise a mixture of 1-naphthalenecarbaldehyde (1 56 g, 10 mmol) and acetic acid (1 41 g, 23 5 mmol) in ether (10 mL) The resulting mixture was warmed to 25 °C for 20h, where the precipitate was filtered and the filtrate was concentrated affording the title compound as a clear oil (1 67 g, 9 14 mmol, 91%) LCMS (ES) m/z 184 (M+H)+
b) 2-amino-1 -(1 -naphthalenyl)ethanol
(Formula Removed)
To a solution of hydroxy(1-naphthalenyl)acetonitnle (1 67 g, 9 14 mol) in THF (90 mL) at 0 °C was added dropwise a solution of LAH-THF (1M, 11 mL, 11 mmol) After 2 hrs, the solution was quenched by sequential addition of H2O (0 42 mL), 6N NaOH (6M, 0 32 mL) and H2O (1 6 mL) The resulting precipitate was filtered and the filtrate was concentrated and used directly yielding the title compound (0 897 g, 4 8 mmol, 53%) as a clear oil LCMS (ES) m/z 188 (M+H)+
c) 1,1-dimethylethyl [2-hydroxy-2-(1-naphthalenyl)ethyl]carbamate
(Formula Removed)
To a solution of 2-amino-1-(1-naphthalenyl)ethanol(1 38g, 4 8 mmol) in dichloromethane (50 mL) was added Boc anhydride (1 155 g, 5 3 mmole) After stirring at RTfor 12 h, the reaction solution was concentrated and partitioned between NaHCO3 sat /DCM The aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly yielding the title compound as a white solid (1 378 g, 4 8 mmol, quant) LCMS (ES) m/z 288 (M+H)+
d)1,1-dimethylethyl[2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-2-(1-naphthalenyl)ethyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [2-hydroxy-2-(1-naphthalenyl)ethyl]carbamate (1 38 g, 4 8 mmol), priphenylphosphine (1 52 g, 5 76 mmol) and phthahmide (0 74 g, 5 04 mmol) in THF (50 mL) at 25 °C was added diethyl azodicarboxylate (0 87 mL, 5 52 mmol) After stirring at RT for 1 h, the reaction solution was concentrated under vacuum and the residue purified on silica gel (20% EtOAc in hexanes) affording the title compound (1 29 g, 3 1 mmol, 65 %) as a white solid LCMS (ES) m/z 387 (M+H)+
e) 1,1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-2-(1-naphthalenyl)ethyl]carbamate (1 29 g, 3 1 mmol) in MeOH (30 mL) was added anhydrous hydrazine (0 5 mL, 15 5 mmol) at 25 °C After 12h, the solution was partitioned between DCM/H20 The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly yielding the title compound as a white solid (491 mg, 1 72 mmole, 55%) LCMS (ES) m/z 287 (M+H)+
Preparation 17
(Formula Removed)
Preparation of 1.4-dimethyl-5-(4.4.5.5-tetramethyl-1.3.2-dioxaborolan-2-yl)-1H-pyrazole
To a suspension of NaH (60% in mineral oil, 3 5 g, 146 mmol, washed with 200 mL of hexane) in THF (200 mL) was added 4-methyl-1 H-pyrazole (10 g, 122 mmol) at 0 °C dropwise After stirring at RT for 1 h, to above suspension was added Mel (7 3 mL, 117 mmol) dropwise at 0 CC The reaction mixture was stirred overnight The Nal by-product was removed by filtration and the filtrate solution was used directly in the next step
At 0°C, to above THF solution of 1,4-dimethyl pyrazole was added n-BuLi (2 5M in hexane, 58 5 mL, 146 mmole) The reaction solution was stirred for 2 hour at RT and then cooled to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (27 2 g, 146 mmole) After 15 mm at -78°C, the reaction was allowed to warm to 0°C and stir for 3h The reaction was diluted with saturated NH4CI solution and extracted with DCM The organics were dried over Na2SO4 and concentrated under vacuum to afford the title compound as a brown solid (21 g, 78%) which was used directly without further purification LC-MS 141 (M-C6H12)+, 223 (M+H)+ 1H NMR (CDCI3) δ 7 28 (s, 1H), 4 03 (s, 3H), 2 22 (s, 3H), and 1 32 (s, 12H)
Preparation 18
(Formula Removed)
Preparation of 2-[(2S)--2-amino-3-(2.6-difluorophenyl]propyl]-1 H-isoindole-1.3(2HV dione
a) N-{[(1,1-dimethylethyl)oxy]carbonyl}-2,6-difluoro-L-phenylalanine
(Formula Removed)
1,4-Dioxane (55 mL) and water (12 mL) was added to 2,6-difluoro-L-phenylalanine (3 00 g, 12 62 mmol) in a 200 mL round-bottomed flask The mixture was cooled to 0 °C followed by the slow addition of NaOH (12 62 mL, 31 6 mmol) and then BoC20 (3 42 g, 15 20 mmol) The mixture was allowed to warm to room temperature and monitored for completion by LC-MS Upon completion, the mixture was cooled to 0 °C and made neutral by the slow addition of 2 5M HCI (12 mL) The solvents removed under reduced pressure The resulting solid was sonicated with 20%MeOH/CHCl3 (150mL), filtered and the organic solvent removed to give the product (4 3 g, 14 4 mmol, quant) as a white solid which was used in the next step without further purification LC-MS (ES) m/z = 302 (M+H)+
b) 1,1-dimethylethyl [(1S)-2-(2,6-difluorophenyl)-1-(hydroxymethyl)ethyl]carbamate
(Formula Removed)
BH3 THF (64 7 ml, 64 7 mmol) was added slowly to a tetrahydrofuran (THF) (60 mL) solution of N-{[(1,1-dimethylethyl)oxy]carbonyl}-2,6-drfluoro-L-phenylalanine (4 33 g, 14 37 mmol) at 0 °C in a 200 mL round-bottomed flask The
mixture was stirred for 2 hours and then placed in the freezer overnight Excess reagent was quenched by the slow addition of AcOH in MeOH at 0 °C and the mixture warmed to room temperature for 2 hours The THF volume was reduced by 1/2 and the product partitioned between CHCI3 and aqueous NaHCO3 (sat) The combined organic fractions were dried over Na2SO4 and used directly without further purification (3 4 g, 78%) LC-MS (ES) m/z = 288 (M+H)+
c) 1,1-dimethylethyl{(1S)-2-(2,6-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)methyl]ethyl}carbamate
(Formula Removed)
To a 200 mL round-bottomed flask was added 1,1-dimethylethyl [(1S)-2-(2,6-difluorophenyl)-1-(hydroxymethyl)ethyl]carbamate (3 38 g, 11 76 mmol), phthahmide (2 02 g, 13 73 mmol), and PS - TPP (Polymer bound TnphenylPhosphine (2 15 mmol/g, 4 92 g, 14 76 mmol) in Tetrahydrofuran (THF) (58 8 ml) DEAD (2 23 ml, 14 09 mmol) was added and the mixture stirred at ambient temperature for approximately 30 minutes at which point MeOH was added The mixture was filtered through Celite adsorbed onto silica and purified via column chromatography affording the title compound (2 7 g, 55%) LC-MS (ES) m/z = 317(M+H)+
d) 2-[(2S)-2-amino-3-(2,6-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione
In a 200 mL round-bottomed flask was added 1,1-dimethylethyl {(1S)-2-(2,6-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}carbamate (2 72 g, 6 40 mmol) in Chloroform (75 ml) and Methanol (10 ml) HCI / 1,4-Dioxane (40 0 ml, 160 mmol) was added and the mixture stirred overnight The solvents were removed affording the title compound (2 4 g, quant) as the HCI salt LC-MS (ES)m/z = 317(M+H)+
Preparation 19
(Formula Removed)
Preparation of 2-[(2S)-2-amino-3-(3-pyridinyl)propyl]-1 1H-isoindole-1.3(2H)-dione
a) 1,1-dimethylethyl [(1S)-2-hydroxy-1-(3-pyridinylmethyl)ethyl]carbamate
(Formula Removed)
To a solution of Boc-L-3-pyridylanihne (1 064 g, 4 mmol) in THF (5 mL) at 0 °C was added BH3-THF (20 mL, 20 mmol-1 M in THF) dropwise After 2 h, the reaction was quenched with AcOH MeOH (1 5, 14 3 mL) at 0 °C, followed by Et3N (1 67 mL, 12 mmol) and l2 (2 03 g, 8 mmol) The resulting mixture was warmed to ambient temperature and stirred for 20h, turning from brown to colorless The solution was concentrated and partitioned between DCM and water The aqueous phase was then extracted several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated to afford the desired product as a colorless oil which was used without further purification (957 6 mg, 95%) LC-MS (ES) m/z= 253 (M+H)+
b) 1,1 -dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -(3-
pyridinylmethyl)ethyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [(1S)-2-hydroxy-1-(3-pyndinylmethyl)ethyl]carbamate (958 mg, 3 8 mmol), priphenylphosphine (1 21 g,
4 6 mmol) and phthahmide (617 mg, 4 2 mmol) in THF (40 mL) at 25 °C was added diethyl azodicarboxylate (0 72 mL, 4 6 mmol) After stirring at RT for 1 h, the reaction solution was concentrated under vacuum and the residue purified on silica gel (0-50% ethyl acetate / hexane) affording the title compound (797 mg, 55 %) as a white solid LCMS (ES) m/z 382 (M+H)+
c) 2-[(2S)-2-amino-3-(3-pyndmyl)propyl]-1 H-isomdole-1,3(2H)-dione
To a solution of 1,1-dimethylethyl [(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(3-pyndinylmethyl)ethyl]carbamate (796 7 mg, 2 1 mmol) in DCM (10 mL) at RT was added 1M HCI in dioxane (10 mL) After 20h, the solution was concentrated affording the title compound (404 mg, 68%) as the HCI salt LCMS (ES) m/z 282 (M+H)+
Preparation 20
(Formula Removed)
Preparation of 1-methyl-1H-1,2,3-triazole
To a solution of 1,2,3-trazole (10 g, 145 mmol) in 150 ml of THF were added potassium carbonate (40 g, 290 mmol) and Mel (13 58 ml, 217 mmol) The resulting reaction mixture was stirred at rt for 3hr The reaction mixture was filtered and the filtrate was concentrated to afford the title compound (9 2 g, 78%) 1H NMR (400 MHz, CDCI3) δppm 7 71 (s, 1H), 7 55 (s, 1H), 4 14 (s, 3H)
Preparation 21 Preparation of 1.4-dimethyl-5-(tributylstannanyl)-1 H-1.2.3-triazole
(Formula Removed)
) 1,4-dimethyl-1 H-1,2,3-triazole
(Formula Removed)
solution of methylamine (25 4 ml, 50 8 mmol, 2M in MeOH) was added dropwise to a suspension of N'-(2,2-dichloro-1-methylethylidene)-4-methylbenzenesulfonohydrazide (ref Sakai, K etal, Bull Chem Soc Jpn, 1986, 59, 179-183) (3 g, 10 16 mmol) in methanol (10 ml) at 0 °C The solid went into solution The resulting dark brown mixture was stirred at 0 °C for 2h, evaporated, and the solid was filtered and rinsed with EtOAc The combined filtrates were concentrated and purified on a 25M biotage column, which was eluted with 50-75% of EA/hexane to give 0 57 g of brown liquid LC-MS (ES) m/z = 98 (M+H)\ 1H NMR (CDCI3, 400 MHz) δ 7 27 (s, 1H), 4 06 (s, 3H), 2 35 (s, 3H)
b) 1,4-dimethyl-5-(tnbutylstannanyl)-1 HA ,2,3-triazole
(Formula Removed)
solution of 1,4-dimethyl-1,2,3-triazole (0 56 g, 5 77 mmol) in THF (5 mL) was added dropwise to a solution of BuLi (2 77 ml, 6 92 mmol, 2 5 M in hexane) in 30 mL of THF at -78 °C under N2 The resulting cloudy mixture was stirred at -70 °C for 1h
Then tnbutyltinchlonde (1 711 ml, 6 34 mmol) was added The reaction mixture became clear and was stirred at this temperature for 30 mm, and gradually warmed to rt To the reaction mixture was added 10 ml of NH4CI and 10 ml of water The reaction mixture was extracted with ether The combined organic layers were washed with brine, dried over Na2SO4, and concentrated The residue was purified on FCC (20% EA/Hexane) to give 1 7 g of a clear liquid (73%) LC-MS (ES) m/z = 388 (M+H)+, 1H NMR (CDCI3> 400 MHz) δ 4 05 (s, 3H), 2 38 (s, 3H), 1 5-0 9 (m, 27H)
Preparation 22
Preparation of 1.1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]aminol-3-(2,4-dichlorophenyl)propyllcarbamate
A solution of 4-bromo-2-thiophenecarboxylic acid (1 29 g, 6 22 mmol), 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (2 0 g, 5 19 mmol), PyBrop (3 62 g, 7 78 mmol) and Hunig's Base (3 62 ml, 20 74 mmol) in DCM (50 ml) was stirred at RT for 30 mm The reaction mixture was washed with H20, 1N HCI, NaHCO3 (sat aq ) and brine The solvent was removed and the residue was dissolved in MeOH, hydrazine monohydrate (1 3 g, 26 mmol) was added The reaction was stirred at rt overnight The white solid formed, and was filtered and rinsed with DCM To the filtrates were added (Boc)2O (1 7g, 7 78 mmol) and NaHCO3 (sat aq , 3 ml) The reaction mixture was stirred at RT for 2 hours and was washed with NaHCO3 (sat aq ) and brine The solvent was removed and the residue was purified by biotage (50% H/E) to give the product (2 Og, 76%) LC-MS (ES) m/z = 531 0 (M+Na)+
Example 1
(Formula Removed)
eparation of N-[2-amino-1-(phenylmethyl]ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
a) 1,1-dimethylethyl (2-{[(4,5-dibromo-2-furanyl)carbonyl]amino}-3-phenylpropyl)carbamate
(Formula Removed)
o a solution of 4,5-dibromo-2-furancarboxylic acid (2 81 g, 10 4 mmol), PyBrOP (5 6 g, 12 0 mmol) and dnsopropylethyl amine (4 2 mL, 24 0 mmol) in DCM (70 mL) at 25 °C was added 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (2 0 g, 8 0 mmol) After 16h, the solution was partitioned between H2O and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and punfied via column chromatography (silica, hexanes/EtOAc, 2 1) affording the title compound (4 3 g, 82%) as a white solid LC-MS (ES) m/z = 503 (M+H)+
b)1,1-dimethylethyl[2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
o a solution of 1,1-dimethylethyl (2-{[(4,5-dibromo-2-furanyl)carbonyl]amino}-3-phenylpropyl)carbamate (0 30 g, 0 60 mmol) in dioxane/H2O (5 1, 8 6 mL) was added K2CO3 (0 25 g, 1 8 mmol), tetrakispriphenylphosphine Pd(0) (70 mg, 0 06 mmol), and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (0 12 g, 0 60 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h The reaction solution was poured onto H2O (100 mL) and extracted with DCM The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 1 1) to give the title compound (0 20 g, 66%) as a white solid LC-MS (ES) m/z = 504
c) N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
1,1-Dimethylethyl[2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate (0 20 g, 0 40 mmol) was dissolved in DCM (10 mL) and treated with TFA (5 mL) After 2 h, the solution was
concentrated, and purified on reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) affording the TFA salt of the title compound (0 16 g, 91%) as a white powder LC-MS (ES) m/z = 405 (M+H)\ 1H NMR (d4-MeOH, 400 MHz) δ 7 59 (s, 1H), 7 33 (m, 3H), 7 30 (m, 2H), 6 85 (s, 1H), 4 57 (m, 1H), 4 03 (s, 3H), 3 25 (m, 1H), 3 14 (m, 1H), and 2 98 (m, 2H)
Example 2
(Formula Removed)
Preparation of N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 1,1 -dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-
phenylethyl)carbamate
(Formula Removed)
To a solution of 5-bromo-2-thiophenecarboxylic acid (3 2 g, 15 2 mmol), PyBrOP (8 5 g, 18 2 mmol) and dnsopropylethyl amine (10 6 mL, 60 9 mmol) in DCM (76 mL) at 25 °C was added 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate (3 6 g, 3 14 mmol)[prepared in Preparation 1] After 16h, the solution was partitioned between H20 and washed with DCM The combined organic fraction were dried (Na2SO4), concentrated and purified via column chromatography (silica, 1% MeOH in DCM) affording the title compound (4 g, 62%) as a white solid LC-MS (ES) m/z = 426 (M+H)+
b) 1,1 -dimethylethyl [2-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-
2-thienyl]carbonyl}amino)ethyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-2-phenylethyl)carbamate (1 g, 2 35 mmol) in DMF (9 mL) were added KOAc (693 mg, 7 05 mmol), bis(pmocolato)diboron (1 2 g, 4 71 mmol) and Pd(dppf)CI2 (169 mg, 0 212 mmol) The reaction contents were heated to 80°C in a sealed tube for 18 hours and were then partitioned between 6N NaOH and DCM The pH of the aqueous fraction was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated to a solid under vacuum and used directly in the next reaction LC-MS (ES) m/z = 473 (M+H)+ boronic ester, 391(M+H)+ boronic acid
c) 1,1-dimethylethyl [2-({[5-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-
phenylethyljcarbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [2-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2-thienyl]carbonyl}amino)ethyl]carbamate (200 mg, 0 42 mmol) in dioxane/H2O (5 1,8 6 mL) was added K2CO3 (234 mg, 1 69 mmol), tetrakispriphenylphosphme Pd(0) (24 mg, 0 02 mmol), and 5-iodo-1-methyl-1H-pyrazole (97 mg, 0 47 mmol) [prepared according to Effenberger, F , et al J Org Chem 1984, 49, 24, 4687] The reaction mixture was heated to 80° C in a sealed tube for 12h The reaction solution was poured onto H2O (100 mL) and extracted with DCM The organics were dried (Na2SO4), concentrated under vacuum, and purified on silica gel (1% MeOH in DCM) to give the title compound (56 mg, 31%) as a yellow solid LC-MS (ES) m/z = 427
d) N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
1,1 -dimethylethyl [2-({[5-(1 -methyl-1 H-pyrazol-5-yl}-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (56 mg, 0 131 mmol) was dissolved in MeOH (2 mL) and treated with excess 4M HCI in dioxane (656 µL, 2 62 mmol) After 4h, the solution was concentrated affording the title compound (46 mg, quant) as a yellow solid LC-MS (ES) m/z 327 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9 46 (d, J = 8 2 Hz, 1H), 8 27 (bs, 1H), 8 20 (d, J = 4 0 Hz, 1H), 7 48-7 75 (m, 3H), 7 37-7 40 (m, 2H), 7 31-7 33 (m, 1H), 6 58 (d, J = 1 9 Hz, 1H), 5 21-5 30 (m, 1H), 3 97 (s, 3H), 3 36-3 41 (m, 1H), 3 19-3 25 (m, 1H)
Example 3
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl]ethyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as an tan solid according to Example 2, except substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (1 65 g, 7 97 mmol)[prepared in Preparation 2] for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z 341 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 8 74 (d, J = 8 5 Hz, 1H), 8 05 (bs, 1H), 7 89 (d, J = 3 9 Hz, 1H), 7 47 (d, J = 1 9 Hz, 1H), 7 43 (d, J = 3 9 Hz, 1H), 7 26-7 29 (m, 3H), 7 20-7 22 (m, 1H), 6 56 (d, J = 2 0 Hz, 1H), 4 31-4 42 (m, 1H), 2 98-3 01 (m, 2H), 2 91-2 93 (m, 2H)
Example 4
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-([(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 2, except substituting 4-bromo-2-thiophenecarboxylic acid (1 g, 4 83 mmol) for 5-bromo-2-thiophenecarboxylic acid and 1,1-dimethylethyl (2-amino-3-
phenylpropyl)carbamate (1 2 g, 4 83 mmol)[prepared in Preparation 2] for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z 441 (M+H)\ 1H NMR (d6-DMSO, 400 MHz) δ 8 98 (bs, 1H), 8 29 (s, 1H), 8 17 (bs, 2H), 7 98 (s, 1H), 7 46 (s, 1H), 7 27-7 29 (m, 3H), 7 19 (s, 1H), 6 46 (s, 1H), 4 35-4 37 (m, 1H), 3 51 (s, 3H), 2 75-3 12 (m, 4H)
Example 5
(Formula Removed)
Preparation of N-(2-amino-1-phenylethyl)-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazinolmethyl}-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 2, except substituting 4-bromo-2-thiophenecarboxylic acid (650 mg, 3 14 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 427 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9 65 (d, J = 7 3 Hz, 1H), 8 58 (s, 1H), 8 31 (br s, 2H), 7 99 (s, 1H), 7 42-7 51 (m, 2H), 7 72-7 80 (m, 2H), 7 20-7 31 (m, 1H), 6 51 (s, 1H), 3 52 (s, 1H), 5 25-5 35 (m, 1H), 3 51 (s, 3H), 3 32-3 48 (m, 1H), 3 15-3 21 (m, 1H)
Example 6
(Formula Removed)
Preparation of N-(2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-5-n-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 5-bromo-2-thiophenecarboxylic acid (100 mg, 0 48 mmol) in dioxane/H2O (5 1,6 mL) was added K2CO3 (267 mg, 1 93 mmol), tetrakispriphenylphosphine Pd(0) (28 mg, 24 umol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (94 mg, 0 48 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h and was then partitioned between 6N NaOH and DCM The pH of the aqueous phase was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dned (Na2SO4), concentrated under vacuum and used directly without further purification (~100 mg, quant) LC-MS (ES) m/z = 209 (M+H)+
b) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (100 mg, 0 48 mmol), PyBrOP (270 mg, 0 58 mmol) and diisopropylethyl amine (420 uL, 2 4 mmol) in DCM (5 mL) at 25 °C was added 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI (168 mg, 0 48 mmol)[from Preparation 6] After 16h, the solution was partitioned between H2O and washed with DCM The combined organic fractions were dried (Na2SC"4), concentrated and purified via column chromatography (silica) affording the title compound (74 mg, 28%) as a white solid LC-MS (ES) m/z = 539 (M+H)+
c) N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-
yl)-2-thiophenecarboxamide
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (74 mg, 0 14 mmol) in MeOH/THF (2 mL, 1 1) at RT was added hydrazine (86 ^L, 2 75 mmol) After stirring for 18h at RT, the reaction
solution was concentrated under vacuum and punfied via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound
The neutral compound from above was dissolved in MeOH (2 mL), treated with excess 4M HCI in dioxane (500 nl_) and concentrated affording the HCI salt of the title compound LC-MS (ES) m/z = 409 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8 97 (d, J = 9 0 Hz, 1H), 8 17 (bs, 1H), 8 00 (d, 3 8 Hz, 1H), 7 68 (d, J = 7 8 Hz, 1H), 7 55-7 61 (m, 2H), 7 42-7 47 (m 2H), 6 56 (d, J = 2 0 Hz, 1H), 4 47-4 51 (m, 1H), 4 18 (s, 3H), 3 09-3 11 (m, 4H)
Example 7
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 1, except substituting 4,5-dibromo thiophenecarboxylic acid (376 mg, 1 32 mmol) for 4,5-dibromo furancarboxylic acid LC-MS (ES) m/z = 419 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 8 92 (d, J = 8 6 Hz, 1H), 8 03-8 06 (m, 2H), 7 56 (d, J = 1 9 Hz, 1H), 7 26-7 32 (m, 3H), 7 21-7 23 (m, 1H), 6 55 (d, J = 1 9 Hz, 1H), 4 32-4 42 (m, 1H), 3 77 (s, 3H), 3 00-3 01 (m, 2H), 2 89-2 91 (m, 2H)
Example 8
(Formula Removed)
Preparation of N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 1, except substituting 4,5-dibromo thiophenecarboxylic acid (2 2 g, 7 69 mmol) for
4,5-dibromo furancarboxylic acid and 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate (1 1 g, 4 66 mmol) for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z = 406 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ 9 47 (d, J = 7 9 Hz, 1H), 8 26 (s, 1H), 8 17 (bs, 1H), 7 58 (d, J = 1 6 Hz, 1H), 7 38-7 46 (m, 3H), 7 30-7 34 (m, 1H), 6 56 (d, J = 1 6 Hz, 1H), 5 28-5 37 (m, 1H), 3 81 (s, 3H), 3 35-3 41 (m, 1H), 3 21-3 28 (m, 1H)
Example 9
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl)ethyl)-5-(1-methyl-1H-pyrazol-5-vh-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 5-bromo-2-furancarboxylic acid (58 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z = 393 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 7 62 (br s, 1H), 7 57 (m, 1H), 7 51 (m, 3H), 7 22(m, 1H), 6 91 (m, 1H), 6 76 (m, 1H), 4 6 (m, 1H), 4 07 (m, 3H)and 3 15 (m, 4H)
Example 10
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI (306 mg, 0 80 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-
HCI LC-MS (ES) m/z = 409 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 81 - 2 88 (m, 1H) 2 93 (td, J= 9 03, 4 93 Hz, 2H) 3 09 (dd, J= 13 89, 5 31 Hz, 1H) 4 00 (s, 3H) 4 28 - 4 35 (m, 1H) δ 53 (d, J= 2 02 Hz, 1 H) 7 32 (d, J= 4 04 Hz, 1H) 7 45 - 7 52 (m, 3H) 7 54 - 7 58 (m, 1H)7 60(s, 1H) 7 70 (d, J= 4 04 Hz, 1H)
Example 11
(Formula Removed)
Preparation of N-((1S)-2-amino-1 -{[2-(trifluoromethyhphenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (237 mg, 0 83 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z = 488 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δppm 2 97 - 3 10 (m, 4H) 3 78 (s, 3H) 4 42 - 4 54 (m, 1H) δ 56 (d, J=2 02 Hz, 1H) 7 45 (t, J=7 58 Hz, 1H) 7 50 - 7 54 (m, 1H) 7 56 - 7 63 (m, 2H) 7 71 (d, J=7 58 Hz, 1H) 7 92 (s, 1H) δ 76 (d, J=9 09 Hz, 1H)
Example 12
(Formula Removed)
Preparation of N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (237 mg, 0 83 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI (206 mg, 0 535 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-
isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 488 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ ppm 2 97 - 3 07 (m, 1H) 3 10 - 3 21 (m, 2H) 3 27 (d, J=3 54 Hz, 1H) 3 82 (s, 3H) 4 50 - 4 59 (m, 1H) δ 51 (d, J= 2 02 Hz, 1H) 7 50 - 7 60 (m, 4H) 7 62 (s, 1H) 7 71 (s, 1H)
Example 13
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 5-bromo-2-furancarboxylic acid (44 mg, 0 23 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI (87 mg, 0 25 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 393 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 63 (br s, 1H), 7 57 (m, 1H), 7 51 (m, 3H), 7 22 (m, 1H), 6 91 (m, 1H), 6 77 (m, 1H), 4 6 (m, 1H), 4 07 (m, 3H) and 3 14 (m, 4H)
Example 14
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-furancarboxylic acid (82 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI (115 mg,
0 3 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 472 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 61 (m, 2H), 7 53 (m, 3H), 7 30 (m, 1H), 6 84 (m, 1H), 4 59 (m, 1H), 4 03 (s, 3H), 3 28 (m, 1H), 3 17 (m, 2H) and 3 01 (m, 1H)
Example 15
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-furancarboxylic acid (82 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z = 472 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ 7 71 (m, 1H), 7 60 (m, 1H), 7 53 (m, 2H), 7 44 (m, 1H), 7 33 (m, 1H), 6 88 (m, 1H), 4 7 (m, 1H), 4 06 (s, 3H), 3 25 (m, 3H) and 3 09 (m, 1H)
Example 16
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 1,1-dimethylethyl [2-({[4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbarnate
(Formula Removed)
To a solution of 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (0 35 g, 0 67 mmol) [from Example 7] in dioxane/H20 (5 1, 25 5 mL) was added K2CO3 (0 28 mg, 2 0 mmol), tetrakistriphenylphosphine Pd(0) (77 mg, 0 06 mmol), and tnmethylboroxine (0 17 mL, 1 2 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h The reaction solution was concentrated under vacuum and punfied on silica gel (hexanes/EtOAc, 1 1) to give the title compound (0 10 g, 33%) as a white solid LC-MS (ES) m/z = 455 (M+H)+
b) N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
1,1 -dimethylethyl [2-({[4-methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (0 10 g, 0 22 mmol) was dissolved in MeOH (10 mL) and THF (5 mL) and treated with 4 M HCI in dioxane (5 mL) After 4 h, the solution was concentrated affording the HCI salt of the title compound (68 mg, 91%) as a white powder LC-MS (ES) m/z = 355 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 79 (s, 1H), 7 68 (s, 1H), 7 31 (m, 4H), 7 25 (m, 1H), 6 56 (s, 1H), 4 54 (m, 1H), 3 87 (s, 3H), 3 69 (s, 2H), 3 34 (m, 2H), 3 03 (d, J = 7 6 Hz, 2H) and 2 21 (s, 3H)
Example 17
(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-4-(3-furanyl)5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 16, except substituting 3-furan boronic acid (0 13 g, 1 2 mmole) for trimethylboroxine LC-MS (ES) m/z = 472 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8 13 (s, 1H), 7 81 (s, 1H), 7 53 (m, 2H), 7 34 (m, 4H), 7 26 (m, 1H), 6 61 (s, 1H), 6 20 (s, 1H), 4 57 (m, 1H), 3 68 (s, 2H), 3 63 (s, 3H), 3 24 (m, 2H) and 3 07 (m, 2H)
Example 18
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 5-chloro-2-thiophenecarboxylate
(Formula Removed)
To a solution of 5-chloro-2-thiophenecarboxylic acid (2 0 g, 12 3 mmol) in dry MeOH (75 mL) was added H2SO4 (1 mL) The reaction mixture was heated to 50° C for 20h and was then concentrated under vacuum The residue was dissolved in DCM and washed several times with saturated NaHCO3 solution The organic fraction was dried (Na2SO4), concentrated under vacuum and used directly without further purification 21 3g, quant) LC-MS (ES) m/z = 177 (M+H)+
b) methyl 5-chloro-4-iodo-2-thiophenecarboxylate
(Formula Removed)
To a solution of 5-chloro-2-thiophenecarboxylic acid (5 0 g, 28 0 mmol) in acetic acid (150 mL) was added ZnCI2 (38g, 280 mmoles) and benzyltrimethylaminonium dichloroiodate (20 5 g, 58 8 mmole) [Bull Chem Soc
Jpn 64, 2566-2568 (1991)] The reaction mixture was heated to 70° C for 48h and was then concentrated under vacuum The residue was extracted with hexanes (2 x 200 mL) and the hexane solution washed with saturated NaHCO3 solution The organic fractions were dned (Na2SO4), concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 4 1) to give the title compound (3 8 g, 45%) as a light yellow solid LC-MS (ES) m/z = 302 (M+H)+
c) methyl 5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 5-chloro-4-iodo-2-thiophenecarboxylate (1 75 g, 5 8 mmol) in dioxane/H20 (50 5 mL) was added K2CO3 (3 4 g, 24 9 mmol), tetrakispriphenylphosphine Pd(0) (0 96 g, 0 83 mmol), and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (3 4 g, 16 5 mmol) The reaction mixture was heated to 80° C in a sealed tube for 15h The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 4 1) to give the title compound (0 35 g, 24%) as a yellow oil LC-MS (ES) m/z = 257 (M+H)+
d) 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (0 30 g, 1 17 mmole) in THF (10 mL) and MeOH (10 mL) was added 6N NaOH (5 mL) The reaction solution was heated to 50°C for 2hrs The reaction solution was concentrated under vacuum, made acidic (pH ~ 2) with 3N HCI, and extracted with DCM The organic solution was dried (Na2SO4) and concentrated to a solid (0 22 g) which was used without further purification LC-MS (ES) m/z = 243 (M+H)+
e) 5-chloro-N-[(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-
(phenylmethyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (0 21 g, 0 87 mmol), PyBrOP (610 mg, 1 3mmol) and diisopropylethyl amine (0 76 mL, 4 35 mmol) in DCM (20 mL) at 25 °C was added 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione HCI (380 mg, 0 96 mmol)[prepared according to Preparation 5] After 16h, the solution was partitioned between H20 and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica) affording the title compound (200 mg, 46%) as a white solid LC-MS (ES) m/z = 505 (M+H)+
f) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a solution of 5-chloro-N-[(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-(phenylmethyl)ethyl]-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (200 mg, 0 40 mmol) in MeOH/THF (10 mL, 1 1) at RT was added hydrazine hydrate (0 20 mL, 4 0 mmol) After stirring for 24h at RT, the reaction solution was concentrated under vacuum and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound as a light yellow solid
The neutral compound from above was dissolved in DCM (2 mL), treated with excess 4M HCI in dioxane (1mL) and concentrated affording the HCI salt (102 mg) of the title compound LC-MS (ES) m/z = 375 (M+H)\ 7 78 (s, 1H), 7 63 (s, 1H), 7 31 (m, 4H), 7 26 (m, 1H), 6 55 (s, 1H), 4 54 (m, 1H), 3 91 (s, 3H), 3 24 (m, 2H) and 3 03 (m, 2H)
Example 19 -111 -

(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyl)ethyH-4-bromo-3-(methyloxv)-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 4-bromo-3-hydroxy-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
Methyl 4,5-dibromo-3-hydroxy-2-thiophenecarboxylate (500 mg, 1 59 mmol), 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (339 mg, 1 75 mmol), Pd(PPh3)4 (92 mg, 79 4 umol) and K2CO3 (876 mg, 6 35 mmol) in dioxane (6 6 mL) and H20 (1 3 mL) were combined in a sealed tube After 12h at 80 °C, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0 5 % MeOH in DCM) affording the title compound (75 mg, 15%) as a brown residue LCMS (ES) m/z = 318 (M+H)+
b) methyl 4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-3-hydroxy-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (175 mg, 0 554 mmol), MeOH (26 ul_, 0 609 mmol), PPh3 (189 mg, 0 720 mmol) in THF (6 mL) at 25 °C was added DEAD (113 uL, 0 720 mmol) in one portion After 30 mm, the reaction was concentrated and purified via column chromatography (silica, 20% EtOAc in hexanes) affording the title compound (135 mg, 74%) as a white solid LC-MS (ES) m/z = 332 (M+H)+
c) 1,1 -dimethylethyl [2-({[4-bromo-3-(methyloxy)-5-(1 -methyl-1 H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
i) A solution of methyl 4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (135 mg, 0 410 mmol) in 6N NaOH (4 mL) and THF (4 mL) was stirred in a sealed tube at 80 °C After 2h, the solution was acidified to pH 3 using 1N HCI then extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 318 (M+H)+
II) To a solution of the crude acid, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (88 mg, 0 351 mmol)[from Preparation 2], dnsopropylethyl amine (305 uL, 1 76 mmol) in DCM (3 5 mL) was added PyBrop (196 mg, 0 422 mmol) in one portion After 12h, additional dnsopropylethyl amine (305 uL, 1 76 mmol) and PyBrop (196 mg, 0 422 mmol) were added After 2h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 550 (M+H)+
d) N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1-methyl-1H-
pyrazol-5-yl)-2-thiophenecarboxamide
A solution of 1,1-dimethylethyl [2-({[4-bromo-3-(methyloxy)-5-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part
e) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30mm, the solution was
concentrated and the residue neutralized through a silica plug (3% MeOH in DCM
(1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound as the HCI salt LC-MS (ES) m/z 450 (M+H)+, 1H NMR (400 MHz, DMSO-d6) § ppm 8 07 (br s , 3 H) 7 85 (d, J=8 84 Hz, 1 H) 7 58 (d, J=2 02 Hz, 1 H) 7 32 (d, J=7 07 Hz, 2 H) 7 26 - 7 29 (m, 2 H) 7 20 - 7 24 (m, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 4 50-4 55 (m, 1H) 3 79 (d, J=6 82 Hz, 3 H) 3 74 (d, J=6 57 Hz, 1 H) 3 17 (s, 1 H) 2 98-3 10 (m, 4 H)
-113-

Example 20
(Formula Removed)
Preparation of N-r3-amino-1-(phenylmethy0propyll-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 4,5-dibromo-2-thiophenecarboxylic acid (1 g, 3 5 mmol) in dioxane/H20 (5 1,18 mL) was added K2CO3 (1 9 g, 13 98 mmol), tetrakispriphenylphosphine Pd(0) (201 mg, 0 175 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (678 mg, 3 5 mmol) The reaction mixture was heated to 80° C in a sealed tube for 12h and was then partitioned between 6N NaOH and DCM The pH of the aqueous phase was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (~1 g, quant) LC-MS (ES) m/z = 288 (M+H)+
b) 1,1-dimethylethyl[3-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-4-phenylbutyl]carbamate
(Formula Removed)
To a solution of 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (250 mg, 0 874 mmol), PyBrOP (489 mg, 8 74 mmol) and diisopropylethyl amine (762 uL, 4 37 mmol) in DCM (8 mL) at 25 °C was added 1,1-dimethylethyl (3-
amino-4-phenylbutyl)carbamate (230 mg, 0 874 mmol)[prepared according to Preparation 8] After 16h, the solution was partitioned between H20 and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica) affording the title compound (130 mg, 29%) as a white solid LC-MS (ES) m/z = 533 (M+H)+
c) N-[3-amino-1-(phenylmethyl)propyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
A solution of 1,1-dimethylethyl [3-({[4-bromo-5-( 1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-4-phenylbutyl]carbamate (130 mg, 0 24 mmol) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30min, the solution was concentrated and the residue neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (40 mg, 40%) as the HCI salt LC-MS (ES) m/z 433 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 68 (d, J=8 59 Hz, 1 H) 7 97 (s, 1 H) 7 77 (br s, 3 H) 7 57 (d, J=2 02 Hz, 1 H) 7 28 (d, J=2 27 Hz, 3 H) 7 25 -7 32 (m, 2 H) δ 55 (d, J=2 02 Hz, 1 H) 4 17 - 4 24 (m, 1 H) 3 78 (s, 3 H) 2 77 - 2 89 (m, 4 H) 1 85 -1 92 (m, 1 H) 1 81 (td, J=9 54, 4 93 Hz, 1 H)
Example 21
(Formula Removed)
Preparation of 4-bromo-N-[2-(methylamino)-1-ohenylethyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 1, except substituting 1,1-dimethylethyl (2-amino-2-phenylethyl)methylcarbamate (1 g, 4 02 mmol) [Prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate and substituting 4,5-dibromo-2-thiophenecarboxylic acid (1 89 g, 6 6 mmol) for 4,5-
dibromo-2-furancarboxylic acid LCMS (ES) m/z 420 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 9 64 (d, J=8 34 Hz, 1 H) δ 91 (br s , 1 H) δ 33 (s, 1 H) 7 58 (d, J=2 02 Hz, 1 H) 7 42 - 7 50 (m, 2 H) 7 38 - 7 42 (m, 2 H) 7 34 (d, J=7 07 Hz, 1 H) δ 56 (d, J=2 02 Hz, 1 H) δ 37 - 5 44 (m, 1 H) 3 79 (s, 3 H) 3 47 - 3 54 (m, 1 H) 3 33 (td, J=8 46, 3 79 Hz, 1 H) 2 63 (t, J=5 31 Hz, 3 H)
Example 22
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyn-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (81 mg, 0 368 mmol)[from Preparation 10] for 4,5-dibromo-2-furancarboxylic acid LC-MS (ES) m/z 355 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=8 34 Hz, 1 H) δ 15 (br s , 3 H) δ 00 (s, 1 H) 7 52 (d, J=1 77 Hz, 1 H) 7 24 - 7 31 (m, 4 H) 7 17 - 7 23 (m, 1 H) δ 36 (d, J=1 77 Hz, 1 H) 4 35 (d, J=3 03 Hz, 1 H) 3 78 (s, 3 H) 3 03 (dd, J=6 82, 2 53 Hz, 1 H) 2 93 - 2 99 (m, 2 H) 2 90 (d, J=6 06 Hz, 1 H) 2 38 (s, 3 H)
Example 23
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl]ethyl]-5-chloro-4-(1-methyl-1 H-ovrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 1, except substituting 4-bromo-5-chloro-2-thiophenecarboxylic acid (250 mg, 1 04 mmol)[from Preparation 11] for 4,5-dibromo-2-furancarboxylic acid LC-MS (ES) m/z 375 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 9 09 (d, J=8 59 Hz, 1 H) δ 14 (s, 3 H) δ 10 (br s , 1 H) 7 55 (d, J=1 77 Hz, 1 H) 7 25 - 7 32 (m, 4 H) 7 21 (dd, J=6 19, 2 40 Hz, 1 H) δ 48 (d, J=2 02 Hz, 1 H) 4 35 (d, J=8 59 Hz, 1 H) 3 84 (s, 3 H) 2 99 (d, J=10 86 Hz, 1 H) 2 89 - 2 96 (m, 3 H)
Example 24
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 4-bromo-2-thiophenecarboxylic acid (1 g, 4 83 mmol) in dioxane/H20 (5 1,16 mL) was added K2CO3 (2 7 g, 19 mmol), tetrakispriphenylphosphine Pd(0) (279 mg, 0 241 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h and additional tetrakispriphenylphosphine Pd(0) (279 mg, 0 241 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) were added After 12h, the reaction was partitioned between 6N NaOH and DCM The pH of the aqueous
phase was adjusted to ~3 with 3M HCI and washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (-1 g, quant) LCMS (ES) m/z = 209 (M+H)+
b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (600 mg, 2 88 mmol) and N-chlorosuccinimide (384 mg, 2 88 mmol) in THF (14 mL) was stirred in a sealed tube at 70 °C After 1h, the solution was partitioned between H20-DCM, the aqueous phase was adjusted to pH 3 and the aqueous phase was washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further punfication (698 mg, quant) LCMS (ES) m/z = 243 (M+H)+
c) 1,1-dimethylethyl[2-({[4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(350 mg, 1 45 mmol), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (362 mg, 1 45 mmol)[from Preparation 2] and diisopropylethyl amine (1 3 mL, 7 23 mmol) in DCM (7 mL) was added PyBrop (809 mg, 1 74 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase
was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 476 (M+H)+
d) N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
A solution of 1,1-dimethylethyl [2-({[4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part c) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30 mm, the solution was concentrated and the residue neutralized through a silica plug (4% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (90 mg, 17%-2steps) as the HCI salt LCMS (ES) m/z 476 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 75 (d, J=8 08 Hz, 1 H) δ 10 (d, J=1 52 Hz, 2 H) δ 08 (s, 3 H) 7 68 (s, 1 H) 7 26 - 7 32 (m, 4 H) 7 22 (dd, J=6 06, 2 53 Hz, 1 H) 4 39 (br s , 1 H) 3 87 (s, 3 H) 2 91 (d, J=7 33 Hz, 4 H)
Example 25
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-bromo-5-chloro-2-thiophenecarboxylic acid (1 3 g, 5 42 mmol), PyBrOP (3 g, 6 5 mmol) and diisopropylethyl amine (4 7 mL, 27 1 mmol) in DCM (54 mL) at 25 °C was added 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isomdole-1,3(2H)-dione (2 0 g, 5 42 mmol)[prepared in Preparation 6] After 1 h, the solution was partitioned between H20 and washed with DCM The combined organic fractions were dried (Na2SO4), concentrated and used directly LCMS (ES) m/z = 572 (M+H)+
b) 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-[2-
(trifluoromethyl)phenyl)propyl}carbamate
(Formula Removed)
To a solution of 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (crude from part a) in THF-MeOH (1 1, 20 mL) was added hydrazine (1 59 mL, 54 2 mmol) After 12h, the solution was filtered and the filtrate concentrated, dry loaded onto silica and purified via column chromatography (2% MeOH in DCM (1% NH4OH)) affording the free base which was dissolved in THF (25 mL) and treated with BoC20 (1 2 g, 5 31 mmol) After 30 mm the solution was concentrated affording a white powder of the title compound (800 mg, 27%-3 steps) LCMS (ES) m/z = 542 (M+H)+
c) 1,1 -dimethylethyl {(2S)-2-({[5-chloro-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamate(750mg, 1 38 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (762 mg, 5 52 mmol), tetrakistriphenylphosphine Pd(0) (80 mg, 69 umol), and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (373 mg, 1 8 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h where additional tetrakistriphenylphosphine Pd(0) (80 mg, 69 umol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (373 mg, 1 8 mmol) were added After 12h, the solution was poured onto H20 (100 mL) and extracted with DCM The organics were dried (NaaSO-O, concentrated under vacuum, and purified on silica gel (hexanes/EtOAc, 1 1) to give the title compound (194 mg, 26%) as a white solid LC-MS (ES) m/z = 544
c) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
1,1-dimethylethyl{(2S)-2-({[5-chloro-4-(1-methyl-1H-pyrazol-5-yl)2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (194 mg, 0 357 mmol) was dissolved in TFA-DCM (3 mL, 1 2) and stirred at 25 °C After 30min, the solution was concentrated with a toluene azeotrope and the residue neutralized through a silica plug (2-5% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (134 mg, 85%) as the HCI salt LCMS (ES) m/z 444 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 9 10 (d, J=9 09 Hz, 1 H) δ 11 (s, 1 H) δ 10 (bs, 3 H) 7 70 (d, J=8 08 Hz, 1 H) 7 57 (d, J=2 02 Hz, 2 H) 7 43 (s, 1 H) δ 49 (d, J=2 02 Hz, 1 H) 4 47 (br s , 1 H) 3 85 (s, 3 H) 3 06 (d, J=8 34 Hz, 4 H)
Example 26
(Formula Removed)
Preparation ofN-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
The title compound was prepared as white solid according to the procedure of Example 24, except substituting 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (288 mg, 0 826 mmol)[from Preparation 6] for 1,1-dimethylethyl (2-amino-3-phenylpropylCarbamate LCMS (ES) m/z 444 (M+H)+
b)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (150 mg, 0 262 mmol) in THF-MeOH (11,2 mL) was added hydrazine (123 uL, 2 62 mmol) After 12h, the solution was filtered and the filtrate was concentrated, dry loaded onto silica and purified via column chromatography (2% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (30 mg, 26%) as the HCI salt LCMS (ES) m/z 444 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 69 (s, 1 H) δ 11 (d, J=1 26
Hz, 1 H) δ 03 (d, J=1 26 Hz, 1 H) 7 93 (bs, 3H) 7 69 (s, 2 H) 7 53 - 7 59 (m, 2 H) 7 44 (d, J=4 80 Hz, 1 H) 4 49 (br s , 1 H) 3 87 (s, 3 H) 2 99 - 3 12 (m, 4 H)
Example 27
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethy0ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting NBS (325 mg, 2 43 mmol) for NCS LCMS (ES) m/z 434 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 65 (br s , 1 H) δ 01 (br s , 3 H) 7 80 (s, 1 H) 7 70 (s, 1 H) 7 25 - 7 32 (m, 4 H) 7 21 (td, J=6 19, 2 78 Hz, 1 H) 4 31 - 4 35 (m, 1 H) 3 71 (s, 3 H) 2 86 - 2 92 (m, 4 H) 2 33 (s, 3H)
Example 28
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 26, except substituting 4-bromo-5-methyl-2-
thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting NBS (325 mg, 2 43 mmol) for NCS LCMS (ES) m/z 502 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 81 (br s , 1 H) δ 05 (br s , 3 H) 7 83 - 7 90 (m, 1 H) 7 67 - 7 74 (m, 2 H) 7 53 - 7 60 (m, 2 H) 7 39 - 7 47 (m, 1 H) 4 48 (d, J=5 05 Hz, 1 H) 3 68 - 3 76 (m, 3 H) 3 01 -3 08 (m, 4 H) 2 33 (s, 3 H)
Example 29
(Formula Removed)
Preparation of rV-(nS)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 26, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid LCMS (ES) m/z 457 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 76 (br s , 1 H) δ 03 (br s , 3 H) 7 86 (s, 1 H) 7 70 (s,
2 H) 7 53 - 7 60 (m, 2 H) 7 39 - 7 47 (m, 1 H) 4 46 (d, J=9 35 Hz, 1 H) 3 72 (s, 3 H)
3 03-3 10 (m, 4H)2 34(s, 3 H)
Example 30
(Formula Removed)
Preparation of AH2-amino-1-(phenylmethy0ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (1g, 4 52 mmol)[from Preparation 9] for 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid LCMS (ES) m/z 389 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 67 (br s , 1 H) δ 01 (br s , 3 H) 7 82 (s, 1 H) 7 70 (s, 1 H) 7 25 - 7 32 (m, 4 H) 7 19 - 7 23 (m, 1 H) 4 31 - 4 38 (m, 1 H) 3 71 (s, 3 H) 2 97 (br s , 2 H) 2 89 (t, J=6 19 Hz, 2 H) 2 34 (s, 3 H)
Example 31
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 1,1-dimethylethyl {(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate
(Formula Removed)
A solution of 1,1-dimethylethyl {(2S)-2-({[5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (110 mg, 0 202 mmol)[prepared in Example 25] and N-chlorosuccmimide (35 mg, 0 263 mmol) in THF (2 mL) was stirred in a sealed tube at 70 °C After 1h, the solution was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried (Na2SO4),
concentrated under vacuum and used directly without further purification LCMS (ES) m/z = 578 (M+H)+
b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
1,1-dimethylethyl{(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (crude from part a) was dissolved in TFA-DCM (3 mL, 1 2) and stirred at 25 °C After 30mm, the solution was concentrated and the residue neutralized through a silica plug (5% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (43 mg, 44%-2 steps) as the HCI salt LCMS (ES) m/z 478 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 9 10 (d, J=8 84 Hz, 1 H) δ 06 (s, 4 H) 7 75 (s, 1 H) 7 70 (d, J=7 83 Hz, 1 H) 7 54 - 7 61 (m, 2 H) 7 43 (t, J=7 45 Hz, 1 H) 4 47 (t, J=8 84 Hz, 1 H) 3 78 (s, 3 H) 2 98 - 3 12 (m, 4 H)
Example 32
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide
a) 1,1-dimethylethyl {(2S)-2-({[4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-chloro-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate
(Formula Removed)
A solution of 1,1-dimethylethyl {(2S)-2-({[5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (121 mg, 0 22 mmol)[prepared in Example 25] and N-bromosuccinimide (52 mg, 0 290 mmol) in THF (2 mL) was stirred in a sealed tube at 70 °C After 1h, the solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried (NaaSO4), concentrated under vacuum and used directly without further purification LCMS (ES) m/z = 622 (M+H)+
b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
1,1-dimethylethyl {(2S)-2-({[4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thienyl]carbonyl}amino)-3-[2-(trifluoromethyl)phenyl]propyl}carbamate (crude from part a) was dissolved in TFA-DCM (3 mL, 1 2) and stirred at 25 °C After 30 mm, the solution was concentrated and the residue neutralized through a silica plug (5% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (42 mg, 44%-2 steps) as the HCI salt LCMS (ES) m/z 522 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 9 13 (d, J=9 09 Hz, 1 H) δ 17 (br s , 1 H) δ 05 (s, 3 H) 7 75 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 54 -7 61 (m, 2 H) 7 43 (t, J=7 58 Hz, 1 H) 4 46 (d, J=9 60 Hz, 1 H) 3 78 (s, 3 H) 2 99 -3 13(m, 4H)
Example 33
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
The title compound was prepare as an orange oil according to Example 24, except substituting N-bromosuccinimide (1 g, 5 77 mmol) for N-chlorosuccinimide LCMS (ES) m/z 288 (M+H)+
b) 4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (688 mg, 2 41 mmol) in dioxane/H2O (5 1,12 mL) was added K2CO3 (1 3 g, 9 6 mmol), tetrakispriphenylphosphine Pd(0) (139 mg, 0 120 mmol), and 5-(5,5-dimethyl-1,3,2-dioxaborman-2-yl)-1-methyl-1H-pyrazole (293 mg, 2 41 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h where additional tetrakispriphenylphosphine Pd(0) (139 mg, 0 120 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (293 mg, 2 41 mmol) were added After 12h, the solution was poured onto H2O and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title
compound white was used directly without further purification LC-MS (ES) m/z = 284 (M+H)+
c) 1,1-dimethylethyl [2-({[4-(1 -methyl-4-phenyl-1 H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of 4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (341 mg, 1 2 mmol), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (300 mg, 1 2 mmol)[from Preparation 2], diisopropylethyl amine (1 mL, 6 01 mmol) in DCM (6 mL) was added PyBrop (673 mg, 1 44 mmol) in one portion After 1 h, the reaction contents were partitioned between H2O/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES)m/z = 517(M+H)+
d) N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
A solution of 1,1-dimethylethyl [2-({[4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part c) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30mm, the solution was concentrated and the residue neutralized through a silica plug (4% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (105 mg, 21%-3steps) as the HCI salt LCMS (ES) m/z 417 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 82 (d, J=8 34 Hz, 1 H) δ 14 (br s , 3 H) 7 96 (s, 1 H) 7 90 (d, J=1 26 Hz, 1 H) 7 82 (s, 1 H) 7 29 (s, 1 H) 7 25 (t, J=8 46 Hz, 9 H) 4 34 (dd, J=7 45, 5 68 Hz, 1 H) 3 75 (s, 3 H) 2 94 -3 00 (m, 2 H) 2 89 (dd, J=6 82, 5 31 Hz, 2 H)
Example 34
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazo(-5-yl)-2-thiophenecarboxamide
a) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
The title compound was prepared as a white solid according to the procedure of Example 33, except substituting 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (420 mg, 1 2 mmol) [from Preparation 6] for 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate LCMS (ES)m/z615(M+H)+
b) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-
phenyl-1 H-pyrazol-5-yl)-2 -thiophenecarboxamide
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (crude from part a) in THF-MeOH (1 1,10 mL) was added hydrazine (384 uL, 12 mmol) After 12h, the solution was filtered and the filtrate was concentrated, dry loaded onto silica and purified via column chromatography (2% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (40 mg, 7%) as the HCI salt LCMS (ES) m/z 485 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 78 (d, J=9 09 Hz, 1 H) δ 05 (br s , 3 H) 7 91 (dd, J=9 09, 1 26 Hz, 2 H) 7 83 (s, 1 H) 7 69 (d, J=7 33 Hz, 1 H) 7 50 - 7 53 (m, 1 H) 7 43 (d, J=7 58 Hz, 1 H) 7 47 (t, J=6 82 Hz, 1 H) 7 23 - 7 30 (m, 4 H) 7 22 (s, 1 H) 4 47 (br s , 1 H) 3 75 (s, 3 H) 3 01 (d, J=8 08 Hz, 4 H)
Example 35
(Formula Removed)
Preparation ofN-fnS^-amino-Hre-ftrifluoromethyhphenyl]methyl]ethyl)-S-^-chloro-l-methyl-IH-pyrazol-S-ylM-methyl]y-thiophenecarboxamide
a) methyl 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 5-bromo-4-methyl-2-thiophenecarboxylate (1 g, 4 25 mmol) in dioxane/H20 (5 1, 20 mL) was added K2CO3 (2 3 g, 17 mmol), bis(tn-t-butylphosphme)palladium(O) (108 mg, 0 213 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-y()-1-methyl-1H-pyrazole (1 2 g, 5 52 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h and additional tetrakispriphenylphosphine Pd(0) (279 mg, 0 241 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) were added After 12h, the reaction was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification LCMS (ES) m/z = 237 (M+H)+
b) 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (crude from part a) in THF (4 mL) and 6N NaOH (4 mL) was heated to 70 °C After 1h, the solution was poured onto H20 and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title compound as a white solid which was used directly without further purification LCMS (ES) m/z = 223 (M+H)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 27, except substituting 4-methyl-5-( 1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (424 mg, 1 92 mmol)for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid LCMS (ES) m/z 457 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=8 84 Hz, 1 H) δ 05 (br s , 3 H) 7 84 (s, 1 H) 7 74 (s, 1 H) 7 71 (d, J=8 08 Hz, 1 H) 7 56 - 7 63 (m, 2 H) 7 44 (t, J=7 20 Hz, 1 H) 4 47 - 4 54 (m, 1 H) 3 70 (s, 3 H) 2 93 - 3 12 (m, 4 H) 2 10 (s, 3 H)
Example 36
(Formula Removed)
Preparation ofN-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1-methyl-1H-pyrazol-5-vD-4-methyl-2-thiophenecarboxamide
a) methyl 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thtophenecarboxylate
(Formula Removed)
To a solution of methyl 5-bromo-4-methyl-2-thiophenecarboxylate (1 g, 4 25 mmol) in dioxane/H20 (5 1, 20 mL) was added K2CO3 (2 3 g, 17 mmol), bis(tn-t-butylphosphine)palladium(O) (108 mg, 0 213 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 5 52 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h and additional tetrakispriphenylphosphine Pd(0) (279 mg, 0 24 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 6 27 mmol) were added After 12h, the reaction was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification LCMS (ES) m/z = 237 (M+H)+
b) 4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (crude from part a) in THF (4 mL) and 6N NaOH (4 mL) was heated to 70 °C After 1h, the solution was poured onto H20 and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title compound white was used directly without further purification LCMS (ES) m/z = 223 (M+H)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1-methyl-
1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 26, except substituting 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (424 mg, 1 92 mmol) for 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting N-bromosuccimmide (376 mg, 2 11 mmol) for N-chlorosuccmimide LCMS (ES) m/z 502 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=9 09 Hz, 1 H) δ 05 (br s , 3 H) 7 83 (s, 1 H) 7 67 - 7 74
(m, 2 H) 7 60 (q, J=7 83 Hz, 2 H) 7 40 - 7 47 (m, 1 H) 4 50 (d, J=4 04 Hz, 1 H) 3 71 (s, 3 H) 2 98-3 12 (m, 4 H) 2 09 (s, 3 H)
Example 37
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl]Dhenyllmethyl)ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 4-bromo-2-thiophenecarboxylate
(Formula Removed)
To a solution of 4-bromo-2-thiophenecarboxylic acid (4g, 19 mmol) in MeOH (100 mL) was added H2SO4 (5 mL) dropwise at 25 °C The solution was stirred for 12 h at 50 °C and was poured into ice-H20 and the pH was adjusted to ~11 with aqueous NaOH The aqueous phase was extracted several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly (4 27g, quant) LCMS (ES) m/z 222 (M+H)+
b) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-2-thiophenecarboxylate (1 g, 4 52 mmol) in dioxane/H20 (5 1,16 mL) was added K2CO3 (2 7 g, 19 mmol), bis(tn-t-butylphosphine)palladium(O) (116 mg, 0 226 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 2 g, 5 88 mmol) The reaction mixture was heated to 80° C in a sealed tube After 1h, the reaction was partitioned
between H2O-DCM and the aqueous phase was extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z 223 (M+H)+
c) methyl 4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (330 mg, 1 49 mmol) and selectfluor ® (793 mg, 2 23 mmol) in THF (7 mL) and H20 (500 uL) was stirred in a sealed tube at 70 °C After 1h, additional selectfluor (793 mg, 2 23 mmol) was added and the solution stirred an additional 12h The reaction mixture was then partitioned between H20-DCM, the aqueous phase was washed several times with DCM The combined organic fractions were dried (Na2SO4), concentrated and purified via column chromatography (silica, 20% EtOAc in hexanes) affording the title compound (126 mg, 33%) as a white solid LCMS (ES) m/z = 241 (M+H)+
d) 4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(126 mg, 0 53 mmol) in THF (1 mL) and 6N NaOH (1 mL) was heated to 70 °C After 1h, the solution was poured onto H2O and the pH was adjusted to ~4 with aqueous HCI The aqueous phase was extracted several times with DCM and the combined organic fractions were dried (Na2SO4) and concentrated affording the title compound white was used directly without further purification LCMS (ES) m/z = 227 (M+H)+
e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(84 mg, 0 372 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (130 mg, 0 372 mmol)[from Preparation 6], dnsopropylethyl amine (323 uL, 1 86 mmol) in DCM (4 mL) was added PyBrop (208 mg, 0 446 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 0 5 % MeOH-DCM) affording the title compound (135 mg, 65%) as a white solid LCMS (ES) m/z = 557 (M+H)+
f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-
1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (135 mg, 0 242 mmol) in THF-MeOH (11,2 mL) was added hydrazine (75 uL, 2 42 mmol) After 12h, the solution was filtered and the filtrate was concentrated, dry loaded onto silica and purified via column chromatography (3% MeOH in DCM (1% NH4OH)) The title compound was further purified via Gilson reverse phase chromatography using 5-95% mobile phase gradient affording the TFA-salt of the title compound which was neutralized through a silica plug ((5% MeOH in DCM (1% NH4OH)) then transferred to the HCI salt using excess 4M HCI in dioxane (40 mg, 26%) LCMS (ES) m/z 427 (M+H)\ 1H NMR (400 MHz, DMSO-d6) d ppm 8 88 (d, J=8 84 Hz, 1 H) δ 13 (s, 1 H) δ 06 (bs, 3 H) 7 70 (d, J=7 83 Hz, 1
H) 7 55 - 7 62 (m, 3 H) 7 54 (br s , 1 H) 7 41 (d, J=2 53 Hz, 1 H) 4 49 (d, J=5 05 Hz, 1 H) 3 92 (s, 3 H) 2 99 - 3 11 (m, 4 H)
Example 38
(Formula Removed)
Preparation of /N/-((1S)-2-amino-14r2-(trifluoromethyl]phenyl]methyl)ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)--5-methyl-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 37, except substituting methyl 4-bromo-5-methyl-2-thiophenecarboxylate (1g, 4 26 mmol)[from Preparation 11] for methyl 4-bromo-2-thiophenecarboxylate LCMS (ES) m/z 441 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 8 78 (d, J=9 60 Hz, 1 H) δ 03 (br s, 3 H) 7 91 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 62 (d, J=4 55 Hz, 1 H) 7 52 - 7 59 (m, 2 H) 7 39 - 7 46 (m, 1 H) 4 47 (br s , 1 H) 3 74 (s, 3 H) 3 06 (br s , 4 H) 2 36 (s, 3 H)
Example 39
(Formula Removed)
Preparation of N-[1-(aminomethyl)-3-phenylpropyl1-4-bromo-5-n-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (2-amino-4-
phenylbutyl)carbamate (0 44 g, 1 7 mmol) [from Preparation 4] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z = 435 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 1 92 - 2 22 (m, 2 H) 2 71 - 2 82 (m, 2 H) 3 02 - 3 11 (m, 1 H)
3 12 - 3 24 (m, 1 H) 3 88 (s, 3 H) 4 30 (s, 1 H) δ 59 (d, J=1 77 Hz, 1 H) 7 17 (t,
J=7 07 Hz, 1 H) 7 22 - 7 29 (m, 4 H) 7 67 (d, J=1 77 Hz, 1 H) 7 85 (s, 1 H)
Example 40
(Formula Removed)
Preparation of N-ri-(aminomethyl)-3-phenylpropyll-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 5-(1 -methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (223 mg, 1 07 mmol) for 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate (0 51 g, 1 9 mmol) [from Preparation 4] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 87 -1 99 (m, 2 H) 2 69 - 2 91 (m, 4 H) 4 00 - 4 07 (m, 3 H)
4 08 - 4 16 (m, 1 H) δ 56 (d, J=2 02 Hz, 1 H) 7 15 (t, J=6 95 Hz, 1 H) 7 20 - 7 28 (m,
4 H) 7 35 (d, J=3 79 Hz, 1 H) 7 51 (d, J=1 77 Hz, 1 H) 7 79 (d, J=3 79 Hz, 1 H)
Example 41
(Formula Removed)
Preparation of 4-bromo-AH3-(methylamino)-1 -phenylpropyl]-5-(1-methyl-1 H-pyrazol-5-yl)2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate (289 mg, 1 09 mmol) [from Preparation 12] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 435 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 12 - 2 23 (m, 2 H) 2 45 - 2 52 (m, 3 H) 2 64 - 2 74 (m, 1 H) 2 76 (dd, J=8 72, 5 94 Hz, 1 H) 3 77 - 3 88 (m, 3 H) δ 10 - 5 20 (m, 1 H) δ 52 (d, J=2 02 Hz, 1 H) 7 30 (d, J=6 82 Hz, 1 H) 7 35 - 7 45 (m, 4 H) 7 57 (d, J=1 77 Hz, 1 H) 7 89 (s, 1 H)
Example 42
(Formula Removed)
Preparation of [(1-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (3-amino-3-phenylpropyl)methylcarbamate (430 mg, 1 63 mmol) [from Preparation 12] for 1,1-dimethylethyl (2-amino-4-phenylbutyl)carbamate and substituting 5-( 1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (224 mg, 1 08 mmol) for 4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 18 - 2 28 (m, 2 H) 2 55 (s, 3 H) 2 77 - 2 85 (m, 1 H) 2 87 (dd, J=8 84, 5 81 Hz, 1 H) 4 01 (s, 3 H) δ 19 (dd, J=8 59, 6 57 Hz, 1 H) δ 55 (d, J=2 02 Hz, 1 H) 7 31 (d, J=7 07 Hz, 1 H) 7 34 - 7 41 (m, 3 H) 7 44 - 7 47 (m, 2 H) 7 50 (d, J=2 02 Hz, 1 H) 7 85 (d, J=4 04 Hz, 1 H)
Example 43
(Formula Removed)
Preparation of 4-bromoN-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate (0 26 g, 1 09 mmol) [from Preparation 12] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 435 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 60 (s, 3 H) 2 90 - 3 01 (m, 2 H) 3 06 (d, J=6 57 Hz, 2 H) 3 83 (s, 3 H) 4 48 - 4 58 (m, 1 H) δ 52 (d, J=1 77 Hz, 1 H) 7 17 - 7 27 (m, 1 H) 7 27 - 7 33 (m, 4 H) 7 57 (d, J=2 02 Hz, 1 H) 7 77 (s, 1 H)
Example 44
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 6, except substituting 2-{(2S)-2-amino-3-[4-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (0 22 g, 0 62 mmol) [prepared according to the procedure of Preparation 6] for_2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione-HCI The reaction mixture was absorbed onto silica and purified via column chromatography to yield the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1 %TFA)/MeCN(1 %TFA) to afford the TFA salt LC-MS (ES) m/z 489 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 04 - 3 30 (m, 4 H) 3 81 - 3 85 (m, 3 H) 4 59 (dd,
J=6 32, 3 28 Hz, 1 H) δ 52 (d, J=2 02 Hz, 1 H) 7 50 (d, J=8 08 Hz, 2 H) 7 58 (d, J=2 02 Hz, 1 H) 7 64 (d, J=8 08 Hz, 2 H) 7 73 (s, 1 H)
Example 45
(Formula Removed)
Preparation of N-f1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (194 mg, 0 68mmol) for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2 -(2-amino-3-methyl-3-phenylbutyl)-1H-isoindole-1,3(2H)-dione (0 20 g, 0 58 mmol) [prepared according to preparation 16] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H20 (1 %TFA)/MeCN(1 %TFA) to afford the TFA salt LC-MS (ES) m/z 448 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 40 (s, 3 H) 1 47 (s, 3 H) 2 85 - 2 92 (m, 1 H)301 (d, J=11 37 Hz, 1 H) 3 83 - 3 86 (m, 3 H)4 74 (dd, J=11 37, 2 27 Hz, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 7 28 (t, J=7 33 Hz, 1 H) 7 41 (t, J=7 71 Hz, 3 H) 7 52 (d, J=7 58 Hz, 2 H) 7 59 (d, J=2 02 Hz, 1 H) 7 89 (s, 1 H)
Example 46
(Formula Removed)
Preparation of N-{{(1S)-2-amino-1-[(2,4-dlchlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thlophenecarboxamlde
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (135 mg, 0 47mmol) for 5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (153 mg, 0 44 mmol) [prepared according to the procedure of Preparation 6] for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H20 (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 491 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 03 (dd, J=13 89, 9 35 Hz, 1 H) 3 14 - 3 21 (m, 1 H) 3 21 - 3 29 (m, 2 H) 3 84 (s, 3 H) 4 62 - 4 70 (m, 1 H) δ 53 (d, J=2 02 Hz, 1 H) 7 28 - 7 32 (m, 1 H) 7 33 - 7 37 (m, 1 H) 7 51 (d, J=2 02 Hz, 1 H) 7 58 (d, J=2 02 Hz, 1 H) 7 73 - 7 76 (m, 1 H)
Example 47
(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a pale yellow solid according to the procedure of Example 30, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (2 84 g, 9 9mmol) for 4-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 457 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 95 - 3 07 (m, 4 H) 3 75 (s, 3 H) 4 44 (dd, J=6 44, 4 93 Hz, 1 H) 7 18 - 7 24 (m, 1 H) 7 27 - 7 32 (m, 4 H) 7 59 (s, 1 H) 7 86 (s, 1 H)
Example 48
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyltethyl]-4-bromo-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide
a) 4,5-dibromo-1-methyl-1H-pyrrole-2-carboxylic acid
(Formula Removed)
NBS (6 3 g, 35 4 mmol) was added in portions over 15 minutes to a stirred solution of 1-methyl-1H-pyrrole-2-carboxylic acid (2 1 g, 16 78 mmol) in DMF (30 mL) at 0 °C Upon complete addition the mixture was slowly brought to 70°C After 1h, the solution was partitioned between H2O-CHCI3, the aqueous phase was adjusted to pH 3 and the aqueous phase was washed several times with CHCI3 The combined organic fractions were dried (Na2SO4) and concentrated under vacuum to yield a 3 4 mixture of 5-bromo-1-methyl-1H-pyrrole-2-carboxylic acid and 4,5-dibromo-1-methyl-1H-pyrrole-2-carboxylic acid (3 4g) which was used directly without further purification LCMS (ES) m/z = 206/286 (M+H)+
b) 1,1 -dimethylethyl (2-{[(4,5-dibromo-1 -methyl-1 H-pyrrol-2-yl)carbonyl]amino}-3-
phenylpropyl)carbamate
(Formula Removed)
To a solution of 5-bromo-1-methyl-1H-pyrrole-2-carboxylic acid and 4,5-dibromo-1-methyl-1H-pyrrole-2-carboxylic acid (1 3 g), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (1 2 g, 4 8 mmol) [from Preparation 2] and PyBrop (2 6 g, 5 6 mmol) in CHCI3 (30 mL) was added dusopropylethyl amine (2 8 mL, 16 1 mmol) The reaction mixture was stirred overnight, adsorbed onto silica and purified via column chromatography [1 3 EtOAc/hexanes] to give a 1 1 mixture of 1,1-dimethylethyl (2-{[(5-bromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate and 1,1-dimethylethyl (2-{[(4,5-dibromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate (800 mg) LCMS (ES) m/z = 438/518 (M+H)+
c) 1,1-dimethylethyl [2-({[4-bromo-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of a 1 1 mixture of 1,1-dimethylethyl (2-{[(5-bromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate and 1,1-dimethylethyl (2-{[(4,5-dibromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate (307 mg) in dioxane/H2O (5 1,5 6 mL) was added Cs2CO3 (800 mg, 2 5 mmol), tetrakispriphenylphosphine Pd(0) (44 mg, 0 04 mmol) and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (157 mg, 0 75 mmol) The reaction mixture was heated to 80° C in a sealed tube for 2h after which additional tetrakispriphenylphosphine Pd(0) (20 mg, 0 02 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (177 mg, 0 85 mmol) were added After 12h, the reaction mixture was adsorbed onto silica and purified via column chromatography to give two isomers the title compound 1,1-dimethylethyl [2-({[4-bromo-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyl]carbamate (17 mg, 0 033 mmol) and 1,1-dimethylethyl [2-({[1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyljcarbamate (20 mg, 0 05 mmol)
d) N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-1 -methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide
1,1 -dimethylethyl [3-{[4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]amino}-3-oxo-2-(phenylmethyl)propyl]carbamate (0 045 g, 0 09 mmol) dissolved in CHCI3 (4 mL) and MeOH (1 mL) was treated with 4 M HCI in dioxane (2 mL) After stirring for 18h at RT, the reaction solution was adsorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound as a white solid
The neutral compound from above was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 (150 \iL) and concentrated affording the HCI salt of the title compound LC-MS (ES) m/z 418 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 76 - 2 98 (m, 4 H) 3 57 (d, J=2 78 Hz, 3 H) 3 71 (d, J=1 26 Hz, 3 H) 4 28 (ddd, J=8 27, 5 12, 2 78 Hz, 1 H) δ 44 (dd, J=7 58, 2 02 Hz, 1 H) δ 85 (s, 1 H) 7 18 - 7 24 (m, 1 H) 7 27 - 7 32 (m, 4 H) 7 61 (d, J=2 02 Hz, 1 H)
Example 49
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-5-(1-methyl-1H-pyrazol-5-yl)-1 H-pvrrole-2-carboxamide
1,1 -dimethylethyl [2-({[1 -methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1 H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyl]carbamate (20 mg, 0 05 mmol) [prepared in Example 48] in CHCI3 (4 mL) and MeOH (1 mL) was treated with 4 M HCI in dioxane (2 mL) After stirring for 18h at RT, the reaction solution was adsorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound
The above compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 (150 |iL) and concentrated affording the HCI salt of the title compound LC-MS (ES) m/z 338 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 74 -2 81 (m, 1 H) 2 83 - 2 90 (m, 2 H) 2 92 - 2 98 (m, 1 H) 3 63 (s, 3 H) 3 76 (s, 3 H)
4 29 (ddd, J=8 02, 5 12, 2 53 Hz, 1 H) δ 27 (d, J=4 04 Hz, 1 H) δ 39 (d, J=2 02 Hz, 1 H) δ 80 (d, J=4 04 Hz, 1 H) 7 20 (td, J=5 87, 2 65 Hz, 1 H) 7 26 - 7 31 (m, 4 H) 7 57 (d, J=2 02 Hz, 1 H)
Example 50
(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyOethylH -methyl-4-f 1 -methyl-1 N-pyrazol-5-yl)-1 H-pyrrole-2-carboxamide
a) 1,1-dimethylethyl (2-{[(4-bromo-1-methyl-1 H-pyrrol-2-yl)carbonyl]amino}-3-
phenylpropyl)carbamate
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-bromo-1-methyl-1H-pyrrole-2-carboxylic acid (610 mg, 3 0 mmol), 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (748 mg, 2 99 mmol) [prepared according to the procedure of Preparation 2] and PyBrop (1 71 g, 3 67 mmol) in Chloroform (15 mL) DIEA (1 8 mL, 10 3 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (Hex/EtOAc) affording the title compound (335 mg, 26%) LC-MS (ES) m/z = 438 (M+H)+
b) 1,1-dimethylethyl [2-({[1-methyl-4-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-
yl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl (2-{[(4-bromo-1-methyl-1H-pyrrol-2-yl)carbonyl]amino}-3-phenylpropyl)carbamate (313 mg, 0 717 mmol) in dioxane/H20 (4 1, 6 25 mL) was added Cs2CO3 (840 mg, 2 6 mmol), tetrakispriphenylphosphine Pd(0) (62 mg, 0 05 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (202 mg, 1 04 mmol) The reaction mixture was heated to 80 °C in a sealed tube for 12h and was then partitioned between H20 and CHCI3 The combined organic fractions were dried (Na2SO4), concentrated under vacuum, adsorbed onto silica gel and purified via column chromatography (35% EtOAc/Hex) affording the title compound (285 mg, 91%) LC-MS (ES) m/z = 438 (M+H)+
c) N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-4-(1-methyl-1H-pyrazol-5-yl)-1H-py rrol e-2-carboxa m id e
HCI in Dioxane (4M, 2mL) was added to a solution of 1,1-dimethylethyl [2-({[1-methyl-4-(1-methyl-1H-pyrazol-5-yl)-1H-pyrrol-2-yl]carbonyl}amino)-3-phenylpropyljcarbamate (285 mg, 0 65 mmol) in CHCI3/MeOH (10 1,10 mL) affording the title compound as a white solid (71 mg, 0 21 mmol, 32%) LC-MS (ES) m/z 338 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 77 - 2 93 (m, 4 H) 3 86 (s, 3 H) 3 92 (s, 3 H) 4 29 (ddd, J=8 15, 4 74, 2 02 Hz, 1 H) δ 30 (d, J=2 02 Hz, 1 H)
6 94 (d, J=1 77 Hz, 1 H) 7 14 (d, J=1 77 Hz, 1 H) 7 19 (td, J=5 56, 3 03 Hz, 1 H)
7 25 - 7 30 (m, 4 H) 7 41 (d, J=1 77 Hz, 1 H)
Example 51
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl]ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (232 mg, 1 11mmol)for5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 409 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 09 - 3 30 (m, 4 H)
3 97 - 4 00 (m, 3 H) 4 62 - 4 72 (m, 1 H) δ 48 (d, J=2 02 Hz, 1 H) 7 43 (ddd, J=8 08,
4 42, 4 17 Hz, 1 H) 7 51 - 7 56 (m, 3 H) 7 72 (d, J=7 83 Hz, 1 H) 7 89 - 7 93 (m, 2 H)
Example 52
(Formula Removed)
Preparation of N-[2-(methylamino)-1-(phenylmethyl]ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)methylcarbamate (0 32 g, 1 2 mmol) [from Preparation 13] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate and substituting 4-(1-methyl-1H-
pyrazol-5-yl)-2-thiophenecarboxylic acid (220 mgT 1 06 mmol) for 4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 41 (s, 3 H) 2 81 (td, J=11 81, 7 96 Hz, 2 H) 2 87 - 2 97 (m, 2 H) 3 96 (s, 3 H) 4 43 - 4 52 (m, 1 H) δ 45 (d, J=1 52 Hz, 1 H) 7 16 - 7 23 (m, 1 H) 7 25 - 7 30 (m, 4 H) 7 50 (d, J=1 52 Hz, 1 H) 7 85 (d, J=13 14 Hz, 2 H)
Example 53
(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-N-methyl-4-(1 -methyl-1 H-pyrazol-5-v0-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 2-[2-(methylamino)-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 7 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI and substituting 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (150 mg, 0 72 mmol) for 4-bromo-5-( 1 -methyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylic acid The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 86 (s, 3 H) 2 97 (dd, J=14 02, 8 72 Hz, 2 H) 3 12 - 3 23 (m, 2 H) 3 70 (m, 1 H) 3 97 (s, 3 H) δ 47 (d, J=2 02 Hz, 1 H) 7 30 - 7 35 (m, 1 H) 7 37 - 7 43 (m, 5 H) 7 51 (d, J=2 02 Hz, 1 H) 7 88 (d, J=1 52 Hz, 1 H) 7 94 (d, J=1 52 Hz, 1 H)
Example 54
(Formula Removed)
Preparation of N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (129 mg, 0 62 mmol) for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2 -(2-amino-3-methyl-3-phenylbutyl)-1H-isoindole-1,3(2H)-dione (0 20 g, 0 58 mmol) [prepared according to the procedure of Preparation 14] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 369 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 1 36 (s, 3 H) 1 41 (s, 3 H) 2 61 (d, J=6 82 Hz, 2 H) 3 99 (s, 3 H) 4 49 (t, J=6 95 Hz, 1 H) δ 49 (d, J=1 77 Hz, 1 H) 7 23 (t, J=7 33 Hz, 1 H) 7 36 (t, J=7 71 Hz, 2 H) 7 47 - 7 52 (m, 3 H) 7 89 (d, J=1 26 Hz, 1 H) δ 00 (d, J=1 52 Hz, 1 H))
Example 55
(Formula Removed)
Preparation of N-K1 S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)--2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (99 mg, 0 48mmol) for 5-( 1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (155 mg, 0 44 mmol) [prepared
according to procedure of Preparation 6] for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine The reaction mixture was absorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 411 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 05 - 3 28 (m, 4 H) 3 97 (s, 3 H) 4 63 - 4 72 (m, 1 H) δ 47 (d, J=2 02 Hz, 1 H) 7 26 - 7 29 (m, 1 H) 7 34 - 7 37 (m, 1 H) 7 49 (d, J=2 27 Hz, 1 H) 7 51 (d, J=2 02 Hz, 1 H) 7 86 (d, J=1 52 Hz, 1 H) 7 90 (d, J=1 52 Hz, 1 H)
Example 56
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)--methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (206 mg, 0 93 mmol) [prepared according
to the procedure of Preparation 9], 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (209 mg, 0 60 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (340 mg, 0 73 mmol) in Chloroform (15 mL) DIEA (0 81 mL, 4 65 mmol) was added and the mixture stirred overnight at room temperature Upon completion, the reaction mixture was adsorbed onto silica and purified via column chromatography (25 -75% EtOAc/Hex) affording the title compound (112 mg, 0 203 mmol, 22%) LC-MS (ES) m/z = 553 (M+H)+
b)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (112 mg, 0 203 mmol) in Tetrahydrofuran (THF) (6 mL) and Methanol (1 mL) Hydrazine (40 uL, 1 3 mmol) was added and the mixture stirred overnight at room temperature Upon completion, the mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et2Oand concentrated affording the HCI salt of the title compound (43 mg, 0 102 mmol, 50 % yield) LC-MS (ES) m/z 423 (M+H)+, 'H NMR (400 MHz, DMSO-d6) δ ppm 2 38 (s, 3 H) 3 01 (m, 1 H) 3 08 (d, J=6 57 Hz, 3 H) 3 76 - 3 83 (m, 3 H) 4 47 (m, 1 H) δ 37 (d, J=2 02 Hz, 1 H) 7 41 (t, J=7 58 Hz, 1 H) 7 50 - 7 57 (m, 2 H) 7 57 - 7 63 (m, 1 H) 7 68 (d, J=7 58 Hz, 1 H) δ 04 (d, J=9 09 Hz, 1 H) δ 15 (s, 3 H) δ 96 (s, 1 H)
Example 57
(Formula Removed)
Preparation of N-{(S)-2-amino-1-[(3-fluoroDhenvhmethyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (222 mg, 1 07mmol)for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (357 mg, 1 2 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-
1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 359 (M+H)+, 1H NMR (400 MHz,
DMSO-d6) δ ppm 2 96 - 3 06 (m, 4 H) 3 92 - 3 98 (m, 3 H) 4 40 (dd, J=8 08, 5 56
Hz, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 02 (td, J=8 46, 2 02 Hz, 1 H) 7 14 (t, J=8 08 Hz,
2 H) 7 26 - 7 35 (m, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 16 -
8 27 (m, 3 H) δ 34 (d, J=1 26 Hz, 1 H) 9 08 (d, J=8 34 Hz, 1 H)
Example 58
(Formula Removed)
Preparation of N-((1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (138 mg, 0 66 mmol) for 5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (196 mg, 0 66 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-
1 H-isoindole-1,3(2H)-dione-HCI The reaction mixture was adsorbed onto silica and purified via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further punfied by Gilson reverse phase chromatography 5-95% H2O (1 %TFA)/MeCN(1 %TFA) to afford the TFA salt LC-MS (ES) m/z 359 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 2 80 - 3 03 (m, 4 H) 3 89 - 3 97 (m, 3 H) 4 30 - 4 40 (m, 1 H) δ 45 (d, J=1 77 Hz, 1 H) 7 12 (t, J=8 84 Hz,
2 H) 7 29 (dd, J=8 34, 5 56 Hz, 2 H) 7 48 (d, J=1 77 Hz, 1 H) 7 92 (br s, 3 H) 7 96 (d, J=1 26 Hz, 1 H) δ 02 (d, J=1 26 Hz, 1 H) δ 58 (d, J=8 84 Hz, 1 H)
Example 59
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (189 mg, 0 91mmol) for 5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (297 mg, 0 85 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 409 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 3 06 (d, J=7 07 Hz, 4 H) 3 91 -
3 98 (m, 3 H) 4 35 - 4 45 (m, 1 H) δ 46 (d, J=1 77 Hz, 1 H) 7 47 (d, J=1 77 Hz, 1 H)
7 49 - 7 57 (m, 2 H) 7 58 - 7 63 (m, 1 H) 7 69 (s, 1 H) 7 98 (d, J=1 52 Hz, 1 H) δ 23
(s, 3 H) δ 32 (d, J=1 26 Hz, 1 H) 9 11 (d, J=8 84 Hz, 1 H)
Example 60
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[4-(trifluoromethyl]phenyl]methyl)ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (240 mg, 0 9 mmol) for 5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 2-{(2S)-2-amino-3-[4-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (278 mg, 0 80 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 409 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 04 (m, 4 H) 3 96 (s, 3 H) 4 42 (s, 1 H) δ 44 - 6 49 (m, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 52 (d, J=7 83 Hz, 2 H) 7 66 (d, J=8 08 Hz, 2 H) δ 01 (s, 1 H) δ 05 - 8 32 (br m, 3H) δ 34 (m, 1H) δ 9 - 9 2 (br s, 1H)
Example 61
(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
a)1,1-dimethylethyl[2-({[5-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [3-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2-thienyl]carbonyl}amino)propyl]carbamate (154 mg, 0 32 mmol) [prepared according to the procedure of Example 3] in Dioxane / H2O (5 1,3 1 mL) was added Cs2CO3 (415 mg, 1 27 mmol), tetrakispriphenylphosphine Pd(0) (29 mg, 0 03 mmol), and 5-iodo-1-methyl-1 H-1,2,4-triazole (95 mg, 0 46 mmol) [prepared according to the procedure of Preparation 15] The reaction mixture was heated to 85 °C in a sealed tube for 12 hours The reaction was partitioned between H20 and CHCI3, the organic layer dned with Na2SO4, absorbed onto silica and purified via column chromatography (35-50% EtOAc/Hexanes) affording the title compound as a yellow solid (61 mg, 28%) LC-MS (ES) m/z = 521
b) N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
HCI in Dioxane (4M, 1mL) was added to a solution of 1,1-dimethylethyl [2-({[5-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thienyl]carbonyi}amino)-3-phenylpropyljcarbamate (61 mg, 0 12 mmol) in CHCl3/MeOH (10 1,10 mL) and the mixture stirred overnight Upon completion, the mixture was adsorbed onto silica gel and punfied via chromatography (90 10 1 CHCI3/MeOH/NH4OH) The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et2O and concentrated affording the HCI salt of the title compound as a white solid (30 mg, 0 09 mmol, 77%) LC-MS (ES) m/z 341 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 79 - 2 91 (m, 3 H) 2 94 (t, J=5 56 Hz, 1 H) 4 10 (s, 3 H) 4 25 - 4 34 (m, 1 H) 7 18 (ddd, J=8 27, 5 75, 3 16 Hz, 1 H) 7 24 - 7 29 (m, 4 H) 7 63 (d, J=4 04 Hz, 1 H) 7 75 (d, J=4 04 Hz, 1 H) 7 95 (s, 1 H)
Example 62
(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-imidazol-5-yl)-2-thiophenecarboxamide
a) 1,1-dimethylethyl [2-({[5-(1-methyl-1H-imidazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [2-phenyl-2-({[5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-2-thienyl]carbonyl}amino)ethyl]carbamate (72 mg, 0 15 mmol) [prepared according to the procedure of Example 3] in dioxane/H2O (5 1, 14 mL) was added Cs2CO3 (200 mg, 0 61 mmol), tetrakispriphenylphosphine Pd(0) (8 5 mg, 0 01 mmol), and 5-bromo-1-methyl-1H-imidazole (64 mg, 0 40 mmol) The reaction mixture was heated to 85 °C in a sealed tube for 12h Upon completion, the reaction mixture was partitioned between H20 (25 mL) and CHCI3 The organics were dried (Na2SO4), concentrated under vacuum, adsorbed onto silica gel and purified via column chromatography (35 - 50% EtOAc / Hexanes) to give the title compound (19 6 mg, 31%) as a yellow solid LC-MS (ES) m/z = 441
b)N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-imidazol-5-yl)-2-thiophenecarboxamide
HCI in Dioxane (4M, 1mL) was added to a solution of 1,1-dimethylethyl [2-({[5-(1 -methyl-1 H-imidazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (19 6 mg, 0 04 mmol) in CHCI3/MeOH (10 1,5 mL) Upon completion of the reaction, the mixture was adsorbed onto silica gel and purified via chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et2O and concentrated affording the HCI salt of the title compound as a white solid (19 mg, 0 05 mmol, quant) LC-MS (ES) m/z 341 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 77 - 2 83 (m, 1 H) 2 85 - 2 91 (m, 2 H) 2 93 - 2 99 (m, 1 H) 3 82 (s, 3 H) 4 30 (ddd, J=8 08, 4 80, 1 77 Hz, 1 H) 7 15 - 7 31 (m, 7 H) 7 69 (d, j=4 04 Hz, 1 H) 7 76 (s, 1 H)
Example 63
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl]ethyl)-3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (253 mg, 0 69mmol) for 5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid The reaction mixture was adsorbed onto silica and punfied via column chromatography (silica, 3% MeOH in DCM (1% NH4OH)) yielding the title compound, which was further purified by Gilson reverse phase chromatography 5-95% H2O (1%TFA)/MeCN(1%TFA) to afford the TFA salt LC-MS (ES) m/z 569 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 14 - 3 30 (m, 4 H) 3 82 (s, 3 H) 4 73 (dd, J=9 47, 4 67 Hz, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 7 44 - 7 50 (m, 1 H) 7 56 - 7 62 (m, 3 H) 7 74 (d, J=7 83 Hz, 1 H)
Example 64
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]Dhenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (143 mg, 0 50 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 488 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 15 (s, 2 H) 3 23 (s, 2 H) 3 84 (s, 3 H) 4 65 (s, 1 H) δ 52 - 6 57 (m, 1 H) 7 46 (s, 1 H) 7 52 - 7 61 (m, 3 H) 7 72 (s, 1 H) 7 81 (s, 1 H)
Example 65
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (143 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(157mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{{2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 455 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 3 11 (s, 1 H) 3 22 (s, 1 H) 3 27 (s, 2 H) 3 85 (s, 3 H) 4 70 (s, 1 H) δ 57 (s, 1 H) 7 26 (s, 2 H) 7 41 (s, 2 H) 7 66 (s, 1 H) 7 88 (s, 1 H)
Example 66
(Formula Removed)
Preparation of N-{(S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thlophenecarboxamlde
The title compound was prepared as a light yellow solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-thiophenecarboxylic acid (143 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-fluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione-HCI (149 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 438 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 00 (s, 1 H) 3 09 (s, 1 H) 3 15 (dd, J=3 41, 1 64 Hz, 2 H) 3 83 (s, 4 H) 4 58 (s, 1 H) δ 52 (d, J=2 02 Hz, 1 H) 7 08 - 7 17 (m, 3 H) 7 27 - 7 37 (m, 3 H) 7 59 (d, J=2 02 Hz, 1 H) 7 74 (d, J=3 54 Hz, 1 H)
Example 67
(Formula Removed)
Preparation of N-(1S)-2-amino-1 -(1 H-indol-3-ylmethyl)ethyl]-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4,5-dibromc~2-thiophenecarboxylic acid (143 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(1 H-indol-3-yl)propyl]-1 H-isoindole-1,3(2H)-dione-dione-HCI (160 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 459 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 15 (dt, J=10 42, 6 79 Hz,
3 H) 3 27 (dd, J=4 04, 2 27 Hz, 1 H) 3 84 (s, 3 H) 4 63 (d, J=6 82 Hz, 1 H) δ 54 (d, J=2 02 Hz, 1 H) 7 05 (t, J=7 45 Hz, 1 H) 7 13 (t, J=7 07 Hz, 1 H) 7 19 (s, 1 H) 7 37 (d, J=8 08 Hz, 1 H) 7 64 - 7 73 (m, 2 H) 7 77 (s, 1 H)
Example 68
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl)--4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(157mg,
0 5 mmol) [prepared according to Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 AV-isomdole-1,3(2H)-dione-HCI LC-MS (ES) m/z 375 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 11 - 3 20 (m, 1 H) 3 22 - 3 31 (m, 3 H) 4 23 (s, 3 H) 4 75 (s, 1 H) δ 96 (s, 1 H) 7 18 - 7 26 (m, 2 H) 7 38 (d, J=6 06 Hz,
1 H) 7 46 (d, J=4 55 Hz, 1 H) δ 22 (s, 2 H) δ 32 (s, 1 H)
Example 69
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(2-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(149mg,
0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-
amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS
(ES) m/z 359 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 3 06 - 3 17 (m, 2 H) 3 25 -
3 31 (m, 2 H) 4 18 (s, 3 H) 4 59 - 4 67 (m, 1 H) δ 88 (s, 1 H) 7 05 - 7 12 (m, 2 H)
7 23 - 7 30 (m, 1 H) 7 36 - 7 42 (m, 1 H) δ 12 (d, J=1 01 Hz, 1 H) δ 17 (s, 1 H) δ 21 (s, 1 H)
Example 70
(Formula Removed)
Preparation of N-[2-amino-1-(1-naphthalenyl)ethyl]-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)--2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate (143 mg, 0 5 mmol) [from Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 456 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 60 (s, 1 H) 3 72 (s, 1 H) 3 84 (s, 3 H) δ 33 (d, J=10 11 Hz, 1 H) δ 55 (s, 1 H) 7 55 - 7 61 (m, 3 H) 7 64 (d, J=8 34 Hz, 1 H) 7 74 (s,
1 H) 7 92 - 7 99 (m, 2 H) δ 09 (s, 1 H) δ 26 (s, 1 H)
Example 71
(Formula Removed)
Preparation of N-[2-amino-1 -(1 -naphthalenv0ethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl [2-amino-2-(1-naphthalenyl)ethyl]carbamate (143 mg, 0 5 mmol) [from Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 377 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 62 (d, J=4 04 Hz, 1 H) 3 67 - 3 78 (m, 1 H) 4 08 - 4 10 (m, 3 H) δ 35 (s, 1 H) δ 73 (d, J=2 27 Hz, 1 H) 7 55 - 7 60 (m, 2 H) 7 62 - 7 67 (m, 1 H) 7 76 (d, J=7 33 Hz, 1 H) 7 88 (d, J=2 53 Hz, 1 H) 7 93 - 7 99 (m, 2 H) δ 10 (d, J=1 52 Hz, 1 H) δ 23 - 8 27 (m, 2 H)
Example 72
(Formula Removed)
Preparation of N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl {2-amino-2-[2-(trifluoromethyl)phenyl]ethyl}carbamate (152 mg, 0 5 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 36 - 3 39 (m, 1 H) 3 46 - 3 53 (m, 1 H) 3 98 (s, 3 H) δ 86 - 5 91 (m, 1 H) δ 48 (s, 1 H) 7 51 (d, J=2 02 Hz, 1 H) 7 60 (s, 1 H) 7 76 (s, 1 H) 7 83 (d, J=8 08 Hz, 2 H) 7 94 (s, 1 H) δ 05 (s, 1 H)
Example 73
(Formula Removed)
Preparation of N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 1,1-dimethylethyl {2-amino-2-[2-(trifluoromethyl)phenyl]ethyl}carbamate (152 mg, 0 5 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 474 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 37 (s, 1 H) 3 65 (s, 1 H) 3 89 - 4 00 (m, 3 H) δ 88 (s, 1 H) δ 76 (d, J=2 27 Hz, 1 H) 7 58 (s, 1 H) 7 77 (d, J=9 60 Hz, 2 H) 7 91 - 8 03 (m, 2 H) δ 26 (d, J=2 27 Hz, 1 H)
Example 74
(Formula Removed)
Preparation of N-[2-amino-1 -(phenylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 24, except substituting NBS (194 mg, 1 09 mmol) for NCS LC-MS (ES) m/z 418 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 3 03 (d, J=7 33 Hz, 2 H) 3 23 (s, 2 H) 3 90 (s, 3 H) 4 56 (d, J=1 77 Hz, 1 H) 7 20 - 7 27 (m, 1 H) 7 28 - 7 34 (m, 4 H) 7 58 (s, 1 H) 7 96 (s, 2 H)
Example 75
(Formula Removed)
Preparation of N-((1S)-2-amino-14r2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-trnophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 25, except substituting NBS (67 mg, 0 5 mmol) for NCS LC-MS (ES) m/z488 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 10-3 19 (m, 1 H) 3 20 - 3 28 (m, 3 H) 3 91 (s, 3 H) 4 66 (dd, J=8 59, 3 03 Hz, 1 H) 7 39 - 7 47 (m, 1 H) 7 51 - 7 58 (m, 2 H) 7 59 (s, 1 H) 7 72 (d, J=8 08 Hz, 1 H) 7 98 (s, 2 H)
Example 76
(Formula Removed)
Preparation of A/4(1S)-2-amino-1-[(3.5-difluorophenyl]methyl]ethyl)-4-(1-methyl-1H-pyrazol-5-yl)2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione-HCI(158 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 94 - 3 06 (m, 4 H) 3 95 (s, 3 H) 4 40 (d, J=6 06 Hz, 1 H) δ 46 (d, J=1 77 Hz, 1 H) 7 00 - 7 10 (m, 3 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 10 (s, 2 H) δ 21 (s, 1H) δ 92 (d, J=8 0 Hz, 1H)
Example 77
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-chlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (157 mg, 0 5 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 92 - 3 04 (m, 4 H) 3 92 - 3 98 (m, 3 H) 4 36 (d, J=5 56 Hz, 1 H) δ 47 (s, 1H) 7 19 - 7 29 (m, 2 H) 7 29 - 7 35 (m, 1 H) 7 37-7 42 (m, 1 H)7 47(s, 1H) δ 17 (s, 3 H) δ 85-9 07 (m, 1H)
Example 78
(Formula Removed)
Preparation of N-K1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (104 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(4-chlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (157 mg, 0 5
mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z 395 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 92 - 2 97 (m, 2 H) 2 99 -
3 04 (m, 2 H) 4 01 (s, 3 H) 4 32 - 4 42 (m, 1 H) δ 43 - 6 50 (m, 1 H) 7 27 - 7 37 (m,
4 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 21 (s, 3 H) δ 94-9 10 (m, 1H)
Example 79
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-brorrio-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 6, except substituting 4,5-dibromo-2-furancarboxylic acid (135 mg, 0 5 mmol) for 5-bromo-2-thiophenecarboxylic acid LC-MS (ES) m/z 472 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 3 11 (d, J=9 85 Hz, 1 H) 3 21 - 3 31 (m, 3 H) 4 06 (s, 3 H) 4 70 (s, 1 H) δ 87 (d, J=2 02 Hz, 1 H) 7 33 (s, 1 H) 7 41 - 7 48 (m, 1 H) 7 50 - 7 57 (m, 2 H) 7 60 (d, J=2 02 Hz, 1 H) 7 71 (d, J=7 83 Hz, 1 H)
Example 80
(Formula Removed)
Preparation of N-(3-amino-1-phenylpropyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 20 except substituting 1,1-dimethylethyl [3-(methylamino)-3-
phenylpropyljcarbamate (125 mg, 0 5 mmoles) [from Preparation 3] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 420 (M+H)+, 1H NMR (400 MHz, DMSO) δ ppm 2 25 - 2 37 (m, 2 H) 2 96 (d, J=8 08 Hz, 1 H) 3 04 -3 13 (m, 1 H) 3 84 (s, 3 H) δ 22 (t, J=7 58 Hz, 1 H) δ 53 (d, J=1 52 Hz, 1 H) 7 35 (d, J=6 57 Hz, 1 H) 7 44 (dt, J=15 09, 7 48 Hz, 4 H) 7 58
Example 81
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-ethyl-1 f/-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole
(Formula Removed)
To a suspension of NaH (60% in mineral oil, 2 2 g, 55 mmol) in THF (50 mL) was added pyrazole (3 4 g, 50 mmol) in THF (10 mL) at room temperature After 30 mm, to above suspension was added Etl (7 75 g, 50 mmol) dropwise After the reaction was complete (20 h), the suspension was filtered, and the resulting solution was used directly with further purification
At 0°C, to above solution of 4-methyl pyrazole (-50 mmol) was added n-BuLi (2 5M in hexane, 22 mL, 55 mmol) The reaction solution was stirred for 1 hour at RT and then cooled to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (10 2 g, 55 mmol) After 15 mm at -78°C, the reaction was allowed to warm to 0°C over 1hour The reaction was diluted with saturated NH4CI solution and extracted with DCM The organics were dned over Na2SO4 and concentrated under vacuum to afford a tan solid (9 8 g, 89%) which was used without further purification LCMS (ES) m/z 141 (M+H)+ for [RB(OH)2], 1H NMR (CDCI3, 400 MHz) δ ppm 7 52 (d, J =
2 Hz, 1H), 6 36 (d, J = 2 Hz, 1H), 4 48 (q, J = 7 2 Hz, 2H), 1 44 (t, J = 7 2Hz, 3H), 1 36 (s, 12 H)
b) 1,1-dimethylethyl [2-({[5-(1-ethyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-
phenylpropyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (100 mg, 0 23 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (100 mg, 0 72 mmol), tetrakispriphenylphosphine Pd(0) (30 mg, 26 umol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (64 mg, 0 29 mmol) The reaction mixture was heated to 70° C in a sealed tube After 12h, the reaction mixture was concentrated under vacuum and purified on silica (hex/EtOAc, 40-60%) to afford the title compound (0 074 g, 71%) as a light yellow solid LC-MS (ES) m/z 455 (M+H)+
c) N-[2-aminc-1 -(phenylmethyl)ethyl]-5-(1 -ethyl-1 H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
1,1 -Dimethylethyl [2-({[5-(1 -ethyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (74 mg, 0 16 mmol) was dissolved in DCM (2 mL) and treated with TFA (1 mL) After 1 h, the solution was concentrated and neutralized through silica using 4% MeOH in DCM (1% NH4OH) The title compound was further punfied using reverse-phase HPLC (C18 column H20/CH3CN, 40-10%) affording the bis-TFA salt of the title compound (47 mg, 50%) as a white solid LCMS (ES) m/z 355 (M+H)+, 1H NMR (d -MeOD, 400 MHz) δ ppm 7 71 (d, J = 3 8 Hz, 1H), 7 55 (d, J = 2 0 Hz, 1H), 7 34-7 22 (m, 6H), 6 51 (d J = 1 8 Hz, 1H), 4 55
(m, 1H), 4 34 (q, J = 7 1 Hz, 2H), 3 22 (dd, J = 3 5, 13 1 Hz, 1H), 3 13 (dd, J = 10 1, 13 1 Hz, 1H), 3 00 (m, 2H), and 1 42 (t, J = 7 1 Hz, 3H)
Example 82
Preparation of A^-[2-amino-1-(phenylmethyl)ethyl]-3.4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,1-dimethylethyl (3-phenyl-2-{[(3,4,5-tnbromo-2-thienyl)carbonyl]amino}propyl)carbamate (120 mg, 0 20 mmol)for 1,1-dimethylethyl [2-({[4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z 499 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 59 (d, J = 2 0 Hz, 1H), 7 37-7 24 (m, 5H), 6 53 (d, J = 2 0 Hz, 1H), 4 62(m, 1H), 3 27 (d, J = 13 1,4 3 Hz, 1H), 3 21 (dd, J = 13 1, 9 4 Hz, 1H), 3 09 (dd, J = 14 2, 6 1 Hz, 1H), 3 02 (dd, J = 13 9, 9 1 Hz, 1H), and 1 96 (s, 3H)
Example 83
N-[2-aminc-1-(phenylmethyl)ethyl]-5-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) N-[2-amino-1 -(phenylmethyl)ethyl]-5-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-
1,3,2-dioxaborolan-2-yl)-1H-pyrazole (64 0 mg, 0 23 mmol) [from Preparation 17] for 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate, and substituting 1,1-dimethylethyl (2-{[(5-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (110 mg, 0 25 mmol) for 1,1-dimethylethyl (2-{[(5-bromo-3-thienyl)carbonyl]amino}-2-phenylethyl)carbamate LC-MS (ES) m/z 355 (M+H)+ , 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 75 (d, J= 3 8 Hz, 1H), 7 40 (br s, 1H), 7 32-7 23 (m, 5H), 7 21 (d, J = 3 8 Hz, 1H), 4 56 (m, 1H), 3 86 (s, 3H), 3 23 (dd, J = 13 1, 3 8 Hz, 1H), 3 15 (dd, J = 12 9, 10 1 Hz,1H), 3 01 (m, 2H) and 2 10 (s, 3H)
Example 84
N-[2-amino-1-(phenylmethyl]ethyl]-4-bromo-5-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (77 mg, 0 23 mmol) [from Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole, and substituting 1,1-dimethylethyl (2-{[(4,5-dibromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (150 mg, 0 29 mmol) for 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z 434 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 77 (s, 1H), 7 43 (s, 1H), 7 35-7 23 (m, 5H), 4 55 (m, 1H), 3 72 (s, 3H), 3 23 (dd, J = 3 5 Hz, 1H), 3 13 (dd, J = 10 6, 13 1 Hz, 1H), 3 02 -2 95 (m, 2H), and 1 99 (s, 3H)
Example 85
N-[2-amino-1-(phenylmethyl)ethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 1, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (220 mg, 1 0 mmol) [from Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole, and substituting 1,1-dimethylethyl (2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (150 mg, 0 34 mmol) for 1,1-dimethylethyl [2-({[4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furanyl]carbonyl}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z = 355 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 14-813 (m, 3H), 7 35-7 20 (m, 5H), 4 58 (m, 1H), 4 07 (s, 3H), 3 36-3 22 (m, 2H), 3 12-3 01 (m, 2H), and 2 21 (s, 3H)
Example 86
N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxv-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) 1,1-dimethylethyl {2-[[(4-bromo-2-thienyl)carbonyl](hydroxy)amino]-3-phenylpropyl}carbamate
(Formula Removed)
To a solution of 4-bromo-2-thiophenecarboxylic acid (1 0 g, 4 83 mmol) in DCM (10 mL) was added PyBrop (3 4 g, 7 24 mmol) and Hunig's base (2 mL, 12 6 mmol) After 15 mm, 1,1-dimethylethyl [2-(hydroxyamino)-3-phenylpropyl]carbamate (641 mg, 2 41 mmol) was added to the reaction mixture in DCM (2 mL) and stirred for 2h at RT The reaction solution was concentrated to give crude 1,1-dimethylethyl [2-([(4-bromo-2-thienyl)carbonyl]{[(4-bromo-2-thienyl)carbonyl]oxy}amino)-3-phenylpropyl]carbamate LC-MS (ES) m/z = 645 (M+H)+
To a solution of 1,1-dimethylethyl [2-([(4-bromo-2-thienyl)carbonyl]{[(4-bromo-2-thienyl)carbonyl]oxy}amino)-3-phenylpropyl]carbamate in MeOH (5 mL) was added K2CO3 (1 0 g, 7 3 mmol) The mixture was stirred at RT for 2h The mixture was concentrated under vacuum and purified on silica gel (EtOAc/Hexane, 30%) to give the the title compound (410 mg, 37 % for two steps) as an off white solid LC-MS (ES) m/z = 456 (M+H)+
b) 1,1-dimethylethyl [2-(hydroxy{[4-(1-methyl-1H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl {2-[[(4-bromo-2-thienyl)carbonyl](hydroxy)amino]-3-phenylpropyl}carbamate (100 mg, 0 22 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (91 mg, 0 66 mmol), tetrakispriphenylphosphme Pd(0) (23 mg, 0 022 mmol) and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (68 mg, 0 33 mmol) The reaction mixture was heated to 75° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-40%) to afford the title compound (87 mg, 87%) LC-MS (ES) m/z = 456 (M+H)+
c) N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxy-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
1,1 -Dimethylethyl [2-(hydroxy{[4-(1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (84 mg, 0 19 mmol) was dissolved in DCM (2 mL) and treated with TFA (1 mL) The reaction was stirred over 1h, and concentrated, and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 40 -10%), and concentrated to afford the bis-TFA salt of the title compound (51 2 mg, 64 8%) LC-MS (ES) m/z 357 (M+H)+, *H NMR (d4-MeOD, 400 MHz) δ ppm 8 03 (s, 1H), 7 94 (d, J = 1 8Hz, 1H), 7 52 (d, J = 1 8 Hz, 1H), 6 46 (d, J = 1 8 Hz, 1H), 7 34-7 18 (m, 5H), 5 16 (m, 1H), 3 95 (s, 3H), 3 38 (dd, J = 13 1, 10 6 Hz, 1H), 3 17-3 11 (m, 2H), and 2 95 (dd, J = 13 6, 6 6 Hz, 1H)
Example 87
N-((1S)--2-amino-1-fr2-(trifluoromethyl]phenyl]methyl]ethyl)-4-(1.4-dimethyH H-pyrazol-5-yl)-2-thioDhenecarboxamide
(Formula Removed)
a) 4-bromo-N-((1S)-2-(1,3-d 10x0-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
Ta a solution of 4-bromo-2-thiophenecarboxylic acid (80 mg, 0 39 mmol) in DCM (2 mL) at 25 °C was added bromo-tns-pyrrohdino
phosphoniumhexafluorophosphate (PyBrOP) (218 mg, 0 47 mmol) in one portion, followed by addition of DIPEA (0 2 mL, 1 14 mmol) After stirring for 10 mm, diamine 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H>-dione (165mg, 0 43 mmol) was added to above solution After 2h, the solution was concentrated and purified via column chromatography (silica, 10% MeOH in CH3CI) affording the title compound (206 mg, 99%) as a white solid LC-MS (ES) m/z 538 (M+H)+
b) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-bromo-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (200 mg, 0 37 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (0 17g, 1 23 mmol), tetrakispriphenylphosphine Pd(0) (42 mg, 0 036mmol) and 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (413 mg, 1 86 mmol) [from Preparation 17] The reaction mixture was heated to 80° C in a sealed tube for 2h The reaction solution was concentrated under vacuum, and punfied on silica gel (10-50% EtOAc/Hex) to give the title compound (192 mg, 94%) as a white solid LC-MS (ES) m/z 553 (M+H)+
c)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-py razol-5-y I )-2-th loph en eca rboxa m i de
(Formula Removed)
4-(1,4-Dimethyl-1 tf-pyrazol-5-yl)-/v"-((1S)-2-(1,3-dioxo-1,3-dihydro-2W-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (110 mg, 0 198 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (0 5 mL, 15 93 mmol) The reaction was stirred over 10 h, concentrated and the residue in DCM (2 mL) was treated with TFA (1 0 mL) After stirring for 2 h, the solvent was removed and the residue was punfied by reverse-phase HPLC (C18 column H20/CH3CN, 40-10%), and concentrated to afford the bis-TFA salt of the title compound The bis-TFA salt was neutralized through a silica plug (90 9 1 CHCI3/MeOH/NH4OH) affording the free base of the title compound The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (62 mg, 34 6%) as the HCI salt LC-MS (ES) m/z 423 (M+H)\ 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 27 (s, 1H), 8 22 (s, 1H), 8 18 (s, 1H), 7 70 (d, 78Hz,1H), 764(d, J = 76Hz,1H), 7 51 (dd, J = 7 3, 7 3 Hz, 1H), 7 41 (dd, J = 7 6, 7 3 Hz, 1H), 4 69 (m, 1H), 4 12 (s, 3H), 3 41-3 19 (m, 4H), and 2 24 (s, 3H)
Example 88
N-((1S)-2-amino-1-f[2-(trifluoromethyl]phenyl]methyl)ethyl]-4-(1-ethyl-1H-pyrazol-5-vl)-2-thiophenecarboxamide
(Formula Removed)
The title compound was prepared as a white solid according to the procedure of Example 87, except substituting 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1f/-pyrazole (104 mg, 0 47 mmol) for 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 35-8 31 (m, 2H), 8 21 (br s, 1H), 7 70 (d, J =
7 8 Hz, 1H), 7 64 (d, J = 7 3 Hz, 1H), 7 51 (dd, J = 7 3, 7 3 Hz, 1H), 7 42 (dd J = 7 6, 7 3 Hz, 1H), 7 00 (m, 1H), 4 70-4 61 (m, 3H), 3 40-3 17 (m, 4H), and 1 57 (t, J = 6 8 Hz, 3H)
Example 89
N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) 5-chloro-4-methyl-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 4-bromo-2-thiophenecarboxylic acid (2 07 g, 10 mmol) in DMF (5 mL) was added NCS (2 7 g, 15 mmol) in one portion The reaction mixture was stirred at 50 °C for 10 h, and then cooled to room temperature The desired product precipitated after water (5 mL) was added The white solid was filtered and dried under high vacuum to give 1 9 g (79%) LC-MS (ES) m/z =242 (M+H)b) 1,1-dimethylethyl (2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-
phenylpropyl)carbamate
(Formula Removed)
o a solution of 5-chloro-4-methyl-2-thiophenecarboxylic acid (242 mg, 1 0 mmol) and dnsopropylethyl amine (2 5 mL, 14 60 mmol) in DCM (50 mL) at 25 °C
was added PyBrOP (2 5 g, 5 30 mmol) in one portion After 30 mm, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (250 mg, 1 0 mmol) was added at one portion After 2h, the solution was concentrated and purified via column chromatography (silica, 10-40% EtOAc in Hexane) affording the title compound (460 mg, 97%) as a white solid LC-MS (ES) m/z = 474 (M+Hf
c) 1,1-dimethylethyl [2-({[5-chloro4-(1-ethyl-1H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
o a solution of 1,1-dimethylethyl (2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (100 mg, 0 21 mmol) in THF (5 mL) was added Na2CO3 (2N, 0 3 mL, 0 6 mmol), Pd(dppf)CI2 (20 mg, 24 umol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (92 mg, 0 42 mmol) The reaction mixture was heated to 80 °C in a sealed tube under N2 After 2h, the reaction mixture was concentrated under vacuum and punfied on silica (hex/EtOAc, 20-50%) to afford the title compound (74 mg, 72%) as a light yellow solid LC-MS (ES) m/z 489 (M+H)+
d) N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1A7-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
,1 -dimethylethyl [2-({[5-chloro-4-(1 -ethyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (61 mg, 0 12 mmol) was dissolved in DCM (2 mL) and treated with TFA (1 mL) After 0 5h, the solution was concentrated and neutralized through silica using 4% MeOH in DCM (1% NH4OH)
The title compound was further purified using reverse-phase HPLC (C18 column H2O/CH3CN, 40-10%) affording the bis-TFA salt of the title compound (41 mg, 53%) as a white solid LC-MS (ES) m/z = 389 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 61 (d, J = 2 0Hz, 1H), 7 59 (s, 1H), 7 33-7 21 (m, 5H), 6 41 (d, J = 2 0Hz, 1H), 4 52(m, 1H), 4 10(q, J = 7 1 Hz, 2H), 3 22 (dd, J = 12 9, 3 5 Hz, 1H), 3 12 (dd, J = 12 6, 10 1 Hz, 1H), 2 98 (m, 2H), and 1 35 (t, J = 7 1Hz, 3H)
Example 90
N-(H S)--2-amino-1-([2-(trifluoromethyl]phenyl]methyl]ethyl)-5-chloro-4-M -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
The title compound was prepared as an off-white solid according to the procedure of Example 89(c), except substituting 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (150 mg, 0 26 mmol)for 1,1-dimethylethyl (2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LC-MS (ES) m/z 587 (M+H)+
b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1 -ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (110 mg, 0 19 mmol) in MeOH/THF(5 mL/0 5 mL) was added hydrazine (0 5 mL, 15 9 mmol) After stirnng overnight at RT, the reaction mixture was concentrated, and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 40-10%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water, and neutralized by aminonium hydroxide The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4, and concentrated to give a free base of the title compound, which was dissolved in MeOH (2 mL), and treated with HCI (aq, 37%) After stirring overnight, the reaction solution was concentrated to give the title compound (26 mg, 26 %) as a di-HCI salt LC-MS (ES) m/z = 457 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 8 28 (d, J = 2 5Hz, 1H), 8 07 (s, 1H), 7 70 (d, J = 7 6 Hz, 1H), 7 62 (d, J = 7 6 Hz, 1H), 7 53 (dd, J = 7 3, 7 6 Hz, 1H), 7 43 (dd, J = 7 6, 7 6 Hz, 1H), 6 90 (d, J = 2 5 Hz, 1H), 4 66 (m, 1H), 4 43 (q, J = 7 3 Hz, 2H), 3 37-3 16 (m, 4H), and 1 50 (t, J = 7 3 Hz, 3H)
Example 91
N-((1S)-2-amino-1-f[2-(trifluoromethyl]phenyl]methyl)ethyl)-5-chloro-4-n.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a)5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-bromo-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (260 mg, 0 46 mmol) in THF (5 mL) was added Na2CO3 (2N, 0 7 mL, 1 4 mmol), Pd(dppf)CI2 (40 mg, 48 umol) and 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (303 mg, 1 38 mmol) The reaction mixture was heated to 75 °C in a sealed tube under N2 After 8h, the reaction mixture was concentrated under vacuum and punfied on silica (101 CHCI3/MeOH) to afford the title compound (196 mg, 73 4%) LC-MS (ES) m/z = 587 (M+H)+
b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (196 mg, 0 34 mmol) in MeOH/THF(2 mL/0 5 mL) was added hydrazine (0 5 mL, 15 9 mmol) After stirring overnight at RT, the reaction mixture was concentrated, and purified on silica (50% MeOH in CHCI3 (0 5% NH4OH) to give a free base of the tile compound, which was dissolved in MeOH (2 mL), and treated with HCI (aq, 37%) After stirring overnight, the reaction solution was concentrated to give the title compound (107 mg, 51 %) as a di-HCI salt LC-MS (ES) m/z = 457 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 96 (s, 1H), 7 90 (m, 1H), 7 70 (d, J =7 6 Hz, 1H), 7 60 (d, J = 7 6 Hz, 1H), 7 53 (t, J = 7 3 Hz, 1H), 7 43 (t, J = 73 Hz, 1H), 4 66 (m, 1H), 3 91 (s, 3H), 3 33-3 14 (m, 4H), and 2 10 (s, 3H)
Example 92
(Formula Removed)
N-(( 1 S)-2-amino-1 -{[2-(trifluoromethyl]phenyl]methyltethyl)-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-thioDhenecarboxamide
(Formula Removed)
a) methyl 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-2-thiophenecarboxylate (1 0 g, 4 52 mmol) in dioxane/H20 (5 1,6 mL) was added K2CO3 (1 86 g, 13 5 mmol), tetrakistriphenylphosphine Pd(0) (260 mg, 0 23 mmol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole(1 3 g, 5 85 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and punfied on silica (hex/EtOAc, 20-40%) to afford methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 7 g, 66%) as a light yellow solid LC-MS (ES) m/z = 237 (M+H)+
To a solution of the above compound (0 5 g, 2 11 mmol) in THF (10 mL) was added NCS (0 364g, 2 74 mmol) The reaction mixture was heated to 70° C under nitrogen After 2h, the reaction mixture was concentrated under vacuum and purified on silica (Hexanes/EtOAc, 10-20%) to afford the title compound (0 45 g, 78%) as a light yellow solid LC-MS (ES) m/z 271 (M+H)+
(b) 4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of methyl 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 3 g, 1 1 mmol) in THF/H20 (5 mL/0 5 mL) was added KOH (0 2 g, 3 4 mmol) The reaction mixture was heated to 50° C for 4 h and then concentrated and diluted with H20 (2 mL) The pH was adjusted to 3 with aqueous HCI The mixture was extracted with DCM (3x5 mL) and the collected organic fractions were concentrated under vacuum to give crude 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (260 mg) which was used directly without further punfication LC-MS (ES) m/z = 256 (M+H)+
To a solution of 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (0 26 g, 1 0 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (0 35 g, 1 1 mmol) and DIPEA (0 5 mL, 2 86 mmol) in DCM (5 mL) at 25 °C was added PyBrOP (0 6 g, 1 2 mmol) in one portion After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/hexane) affording the title compound (0 54 g, 91%) as a white solid LC-MS (ES) m/z = 588 (M+H)+
c)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (350 mg, 0 60 mmol) was dissolved in MeOH (5 mL) and treated with NH2NH2 (0 5 mL,15 93 mmol) The mixture was stirred at RT overnight, and concentrated The residue was purified by column chromatography (silica, 2-5% MeOH in CHCI3 (0 5% NH4OH) affording the free base of the title compound, which was treated with HCI(aq) in MeOH to give title compound (0 16 g, 51%) as a off white solid LC-MS (ES) m/z = 457 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 97- 7 94 (m, 2H), 7 71 (d, J = 7 8 Hz, 1H), 7 61 (s, 1H), 7 56-7 51 (m, 2H), 7 43 (dd, J = 7 6, 7 6 Hz, 1H), 4 67 (m, 1H), 4 22 (q, J = 7 1 Hz, 2H), 3 36-3 12 (m, 4H), and 1 38 (t, J = 7 1 Hz, 3H)
Example 93 N-(nS)--2-amino-1-f[2-(trifluoromethyl)phenyl]methyl)ethylM-^4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) methyl 4-(4-bromo-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 45 g, 1 9 mmol) [see example 92(a)] in THF (5 mL) was added NBS (0 33 g, 2 5 mmol) The reaction mixture was heated to 70° C under nitrogen After 2h, the reaction mixture was concentrated under vacuum and punfied on silica (EtOAc/hexanes, 10-30%) to afford the title compound (0 47 g, 78%) LC-MS (ES) m/z = 316(M+H)+
b)4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of methyl 4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (0 2 g, 0 63 mmol) in THF/H20 (5 mL/1 mL) was added KOH (0 15 g, 2 4 mmol) The reaction mixture was heated to 50° C for 10h and then
concentrated and diluted with H20 (2 mL) The pH was adjusted to 6 with aqueous HCI The mixture was extracted with DCM (3x5 mL) and the collected organic fractions were concentrated under vacuum to give crude 4-(4-bromo-1 -ethyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, which was used directly without further punfication LC-MS (ES) m/z = 302 (M+H)+
To a solution of 4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid 156 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (0 18 g, 0 52 mmol) and DIPEA (0 5 mL, 2 86 mmol) in DCM (5 mL) at 25 °C was added PyBrOP (0 29g, 0 62 mmol) in one portion After 2h, the solution was concentrated and punfied via column chromatography (silica, 20-60 % EtOAc/hexane) affording the title compound (0 281 g, 86%) LC-MS (ES) m/z = 632 (M+H)+
c) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
4-(4-bromo-1-ethyl-1H-pyrazol-5-y^N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (250 mg, 0 39 mmol) was dissolved in MeOH (5 mL) and treated with NH2NH2 (0 5 mL, 15 93 mmol) The mixture was stirred at RT overnight, and concentrated The residue was purified by column chromatography [silica, 2-10% MeOH in CHCI3 (0 5% NH4OH)] affording the free base of the title compound, which was treated with HCI(aq) in MeOH to give the title compound (144 mg, 51%) as an off white solid LC-MS (ES) m/z 502 (M+H)+ 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 93-7 87 (m, 2H), 7 72 (d, J = 8 1 Hz, 1H), 7 62 (s, 1H), 7 57-7 51 (m, 2H), 7 43 (t, J = 6 6 Hz, 1H), 4 67 (m, 1H), 4 25 (q, J = 7 3 Hz, 2H), 3 37-3 11 (m, 4H), and 1 37 (t, J = 7 1 Hz, 3H)
Example 94
(Formula Removed)
Preparation of N-[2-amino-1-(phenylmethyl)ethyl]-3-(methyloxv)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 3-(methyloxy)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
Methyl 4-bromo-3-(methyloxy)-2-thiophenecarboxylate (250 mg, 0 10 mmol) [prepared according to Corral, C , El-Ashmawy, M B , Lissavetzky, J , Basilio, A, Giraldez, A, Eur J Med Chem Chim Ther 22, 1987, 251-254 ], 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (250 mg, 1 20 mmol), Pd(PPh3)4 (58 mg, 49 8 umol) and K2CO3 (550 mg, 3 98 mmol) in dioxane (5 mL) and H20 (1 mL) were combined in a sealed tube After 12h at 80 °C, the reaction contents were partitioned between H2O/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 0 5 % MeOH in DCM) affording the title compound (215 mg, 86%) as a brown residue LCMS (ES) m/z = 253 (M+H)+
b) 1,1 -dimethylethyl [2-({[3-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
i) A solution of methyl 3-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (215 mg, 0 853 mmol) in 6N NaOH (4 mL) and THF (4 mL) was stirred in a sealed tube at 70 °C After 2h, the solution was acidified to pH 3
using 1N HCI then extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 239 (M+H)+
n) To a solution of the crude acid, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (210 mg, 0 844 mmol) [from Preparation 2] and diisopropylethyl amine (735 uL, 4 22 mmol) in DCM (8 mL) was added PyBrop (472 mg, 1 01 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly LCMS (ES) m/z = 471 (M+H)+
c) N-^-amino-llyphenylmethyl)ethyU-S^methyloxyH-C1-methyl-IH-pyrazol-S-ylly-thiophenecarboxamide
A solution of 1,1-dimethylethyl [2-({[3-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from part b) in TFA-DCM (3 mL, 1 2) was stirred at 25 °C After 30min, the solution was concentrated with a toluene azeotrope and the residue neutralized through a silica plug (3% MeOH in DCM (1% NH4OH)) affording the free base of the title compound
The free base, as a solution in MeOH, was then treated with excess 4M HCI in dioxane affording the title compound (270 mg, 86%-2steps) as the HCI salt LCMS (ES) m/z 371 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 06 (br s , 3 H) 7 91 (s, 1 H) 7 72 (d, J=8 59 Hz, 1 H) 7 52 (d, J=1 77 Hz, 1 H) 7 25 - 7 31 (m, 4 H) 7 18 - 7 23 (m, 1 H) δ 39 (d, J=2 02 Hz, 1 H) 4 52 (br s , 1 H) 3 78 (s, 3 H) 3 41 (s, 3 H) 2 97-3 05 (m, 4 H)
Example 95
(Formula Removed)
Preparation of N-{C\ S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) methyl 5-chloro-2-thiophenecarboxylate
To a solution of 5-chloro-2-thiophenecarboxylic acid (20 g, 123 mmoles) in MeOH (200 mL) was added cone H2SO4 (5 mL) After heating to 55°C for 12 h, the reaction solution was concentrated and diluted with DCM (250 mL) The DCM solution was washed with aqueous NaHCO3, then H20 and dned over Na2SO4 Concentration under vacuum gave the title compound as a yellow oil (21 5 g, 99%) LCMS(ES)m/z178(M+H)+
b) methyl 4-bromo-5-chloro-2-thiophenecarboxylate
(Formula Removed)
To a 1 L round bottom flask was added aluminum chloride (11 32 g, 85 mmol) and methyl 5-chloro-2-thiophenecarboxylate (10 g, 56 6 mmol) dissolved in CHCI3 (250 mL) Br2 (4 08 ml, 79 mmol) was added dropwise over 10 minutes After stirring for 6 h at 25 °C, the light orange reaction solution was washed with sat NaHCO3 The organic layer was dned Na2SO4, filtered and concentrated The residue was purified on silica gel [hexanes/EtOAc, 9 1 ] to give the product [12 g, 80%] as a white solid LCMS (ES) m/z 256 (M+H)+
c) methyl 5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a 300 mL sealed flask was added 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (8 14 g, 39 1 mmol) potassium carbonate (12 98 g, 94 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (8 g, 31 3 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 40 g, 0 78 mmol) in 1,4-dioxane (50 ml) and H20 (6 ml) After stirring for 90 mm at 75 °C, the reaction solution was diluted with DCM (100 mL) and washed with H20 The organic layer was dried Na2SO4, filtered
and concentrated The reaction residue was purified on silica gel [hexanes/EtOAc, 2 1 ] to give the product [5 7 g, 70%] as a tan solid LCMS (ES) m/z 258 (M+H)+
d) 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a 250 mL round-bottomed flask was added methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (4 4 g, 17 14 mmol) and sodium hydroxide (28 6 ml, 171 mmol) in tetrahydrofuran (THF) (50 ml) and MeOH (50 mL) The reaction solution was stirred at RT for 12h and then made acidic (pH ~ 2) with 2 5 M HCI and extracted with DCM The organic layer was separated, dried (Na2SO4) and concentrated to an off-white solid (4 2 g, 94%) which was used directly without further punfication LCMS (ES) m/z 243 (M+H)+
e) 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-
fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 500 mL round-bottomed flask was added 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (4 2 g, 17 31 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (6 37 g, 19 04 mmol) [prepared according to the procedure of Preparation 6], N,N-dnsopropyl ethylamine (4 53 ml, 26 0 mmol) and Pybrop (12 05 g, 26 0 mmol) in dichloromethane (DCM) (150 ml) After stirring at RT for 12 h, the reaction solution was washed with H20 (2 x 100mL) and the organic layer was dried Na2SO4, filtered and concentrated The crude product was added to a silica gel column and was eluted with [EtOAc/hexanes, 1 1] to give the product [7 8 g, 86%] as a white solid LCMS (ES) m/z 524 (M+H)+
f)N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 250 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (7 8g, 14 91 mmol) and hydrazine (14 50 ml, 298 mmol) in tetrahydrofuran (THF) (75 ml) and methanol (75 mL) After 24 h at RT, the precipitate was filtered, the filtrate was concentrated The crude product was purified on a silica gel column [CHCIa/MeOH/NhUOH, 90 9 1 ] to give the title compound as a white solid
The free base product was treated with 4M HCI in dioxane (15 mL) After 5 mm, the solution was concentrated and dried under vacuum to afford the product (6 8 g, 95%) as an HCI salt LCMS (ES) m/z 467 (M+H)+, 1H NMR (400 MHz, CD30D) δ ppm 7 97 (s, 2H), 7 31 (s, 1H), 7 14 (m, 2H), 6 98 (m, 1H), 6 75 (s, 1H), 4 54 (m, 1H), 3 98 (s, 3H), 3 24 (m, 2H), 3 04 (m, 2H)
Example 96
(Formula Removed)
Preparation of N-{(1 Sy2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-chloro-4-(4-chloro-1-methyl-1^/-pyrazol-5-yl)2-thiophenecarboxamtde
a) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a 500 mL flask was added methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (5 g, 19 48 mmol) [from Example 95] and NCS (3 12 g, 23 37 mmol) in tetrahydrofuran (THF) (100 ml) (50 mL) After stirring for 4 h at 70 °C, the yellow reaction solution was treated with 6M NaOH (32 mL, 195 mmole) and stirred an additional 2 hours The reaction solution was diluted with H20 (50 mL)
and DCM (200 mL) The organic layer was separated and the aqueous layer made acidic with 6N HCI The acidic aqueous solution was extracted with DCM (3 x 200 mL), dried over Na2SO4, and concentrated to give the crude product [2 6 g, 48%] as a tan solid LCMS (ES) m/z 277 (M+H)+
b) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-/v-{(1S)-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 500 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (6 g, 21 65 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (7 25 g, 21 65 mmol) [prepared according to the procedure of Preparation 6], N,N-diisopropyl ethylamine (5 67 ml, 32 5 mmol) and Pybrop (15 08 g, 32 5 mmol) in Dichloromethane (DCM) (150 ml) After stirring at RT for 12 h, the reaction solution was washed with H20 (2 x 100mL) and the organic layer was dried Na2SO4, filtered and concentrated The crude product was added to a silica gel column and was eluted with [EtOAc/hexanes, 1 1] to give the product [9 Og, 74%] as a white solid LCMS (ES) m/z 558 (M+H)+
c) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-
1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 250 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (9 g, 16 15 mmol) and hydrazine (15 69 ml, 323 mmol) in tetrahydrofuran (THF) (75 ml) and methanol (75 mL) After 24 h at RT, the precipitate was filtered, the filtrate was concentrated, and the crude product was punfied on a silica gel column [CHCl3/MeOH/NH4OH, 90 9 1 ] to give the title compound as a white solid
The free base product was treated with 4M HCI in dioxane (15 mL) After 5 mm, the product solution was concentrated and dned under vacuum to afford the product (6 5 g, 91%) as an HCI salt LCMS (ES) m/z 428 (M+H)+, 1H NMR (400 MHz, CD3OD) δ ppm 7 75 (s, 1 H), 7 60 (s, 1H), 7 32 (m, 1H) 7 14 (m, 2H), 6 98 (m, 1H), 4 54 (m, 1H), 3 78 (s, 3H), 3 24 (m, 2H), 3 02 (m, 2H)
Example 97
(Formula Removed)
Preparation of N-((1S)-2-amino-Mr2-ftrifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 0 974 mmol)[prepared according to the procedure in Example 95] in acetonitnle (4 864 ml) and H20 (486 ul) was added selectfluor (449 mg, 1 27 mmol) The resulting solution was stirred at 70 °C in a sealed tube for 1 h after which additional selectfluor (449 mg, 1 266 mmol) was added in one portion After stirnng 12h, the solution was partitioned between H20-DCM The aqueous phase was washed several times with DCM-THF and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 10% EtOAc in hexanes) affording methyl 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (65 mg, 0 237 mmol, 24 30 % yield) as a yellow solid, LCMS (ES) m/z 274, 276 (M, M+H)
b) 5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (65 mg, 0 237 mmol) in 6N sodium hydroxide (0 39 ml, 2 37 mmol) and tetrahydrofuran (2 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (54 mg,
0 17 mmol, 72 % yield) as a yellow oil, LCMS (ES) m/e 261, 263 (M, M2)+
c) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (53 mg, 0 203 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (78 mg, 0 203 mmol)[prepared according to Preparation 6] and diisopropylethylamine (0 18 ml,
1 02 mmol) in DCM at 25 °C was added bromo-tris-pyrrohdino-phosphonium
hexafluorophosphate (95 mg, 0 203 mmol) in one portion The solution stirred at 25
°C over 12h and was then partitioned between H20-DCM The aqueous phase was
washed several times with DCM and the combined organic fractions were dried
over Na2SO4, concentrated and punfied via column chromatography (silica, 40%
EtOAc in hexanes) yielding 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-
2-thiophenecarboxamide (106 mg, 0 129 mmol, 63 5 % yield) as a clear oil, LCMS (ES) m/e 591, 593 (M, M+H)+
d) N-((1S)-2-aminc-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1l3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fIuoro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (106 mg, 0 179 mmol) in tetrahydrofuran (1 095 ml) and methanol (1 095 ml) at 25 °C was added hydrazine (0 056 ml, 1 79 mmol) dropwise After 48h, the solution was concentrated, dry loaded (silica, 5% MeOH in DCM (1% NH4OH)) and purified initially by column chromatography The residue was then further punfied via gilson reverse phase chromatography using 2%-95% mobile phase affording the TFA salt of the title compound This compound was neutralized through a plug of silica (5% MeOH in DCM (1% NH4OH)) concentrated and transferred to the HCI salt adding excess 4M HCI in dioxane (500 ul) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (17 mg, 0 029 mmol, 16 16 % yield) as a white solid LCMS (ES) m/z = 461, 463 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 9 11 (s,1 H) δ 11 (s, 1 H) 7 71 (br s , 3 H) 7 66 - 7 70 (m, 2H) 7 54 - 7 61 (m, 2H) 7 41 -7 44 (m, 1 H) 4 47 (br s , 1 H) 3 79 (s, 3 H) 3 07 - 3 16 (m, 4 H)
Example 98
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)Dhenyl]methyl}ethyl)-5-ethyl-4-(1 -methyl-1 H-pyrazol-5-yl V-2-thiophenecarboxamide
a) methyl 4-bromo-5-ethyl-2-thiophenecarboxylate
(Formula Removed)
To a solution of 4-bromo-5-ethyl-2-thiophenecarboxylic acid (1 g, 4 25 mmol) in methanol (21 27 ml) was added sulfunc acid (0 23 mL, 4 25 mmol) The resulting solution was stirred at 50 °C for 48h H20 (50 mL) was added and the reaction was cooled to 0 °C in an ice-bath The pH was adjusted to -12 and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SC"4, concentrated and used directly without further purification providing methyl 4-bromo-5-ethyl-2-thiophenecarboxylate (1 060 g, 4 25 mmol, 100 % yield) LCMS (ES) m/e 248, 250 (M, M2)+
b) methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-ethyl-2-thiophenecarboxylate (300 mg, 1 204 mmol), potassium carbonate (832 mg, 6 02 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (326 mg, 1 565 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (30 8 mg, 0 060 mmol) were combined in a sealed tube and stirred at 80 °C for 1 h The reaction contents were then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (301 mg, 1 204 mmol, 100 % yield) as a brown oil LCMS (ES) m/e 251 (M+H)+
c) 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 198 mmol) in 6N sodium hydroxide (2 397 ml, 1 198 mmol) and tetrahydrofuran (5 992 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (283 mg, 1 2 mmol, 100 % yield) as a yellow oil, LCMS (ES) m/z = 236 (M+H)+
d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (283 mg, 1 2 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (461 mg, 1 2 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (1 043 ml, 5 99 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (615 mg, 1 317 mmol) in one portion The solution was stirred at 25 °C over 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 50% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (486 mg, 0 86 mmol, 71 6 % yield) as a clear oil LCMS (ES) m/e 567 (M+H)+
e) N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-
1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (486 mg, 0 86 mmol) in tetrahydrofuran (2 144 ml) and methanol (2 14 ml) at 25 °C was added hydrazine (0 269 ml, 8 58 mmol) dropwise After 12h, the solution was concentrated, dry loaded and purified via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) The free base was then converted to the HCI salt by adding excess 4M HCI in dioxane (500 ul) to the residue in MeOH (2 ml) affording N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (250 mg, 0 491 mmol, 57 2 % yield)-2 HCI as a white solid LCMS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 84 (d, J=8 84 Hz, 1 H) δ 08 (br s , 3 H) 7 93 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 51-7 61 (m, 3 H) 7 39 - 7 46 (m, 1 H) δ 34 (d, J=2 02 Hz, 1 H) 4 48 (br s , 1 H) 3 77 (s, 3 H) 2 99-3 11 (m, 4 H) 2 74 (q, J=7 49 Hz, 2 H) 1 16 (t, J=7 45 Hz, 3 H)
Example 99
(Formula Removed)
Preparation of N-((1S)-2-amino-1-/[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-n .4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-methyl-2-thiophenecarboxylate (2g, 8 51 mmol)[prepared in Preparation 10], potassium carbonate (5 88 g, 42 5 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 124 g, 10 21 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(O) (0 217 g, 0 425 mmol) in 1,4-Dioxane (35 4 ml) and H20 (7 09 ml) was stirred at 80 °C in a sealed tube for 1 h The reaction mixture was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 25% EtOAc in hexanes) affording methyl 5-methyl-4-( 1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate This reaction was run in several batches (1g, 3 x 2g) which were combined for workup and purification affording the title compound (5 5 g, 78% combined yield) as a viscous yellow oil LCMS (ES) m/e 236 (M+H)+
b) methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (580 mg, 2 45 mmol) and n-bromosuccinimide (437 mg, 2 45 mmol) in tetrahydrofuran (12 300 ml) was stirred in a sealed tube for 1h at 70 °C The solution was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAc in hexanes) yielding methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (600 mg, 1 90 mmol, 78 % yield) as a yellow oil LCMS (ES) m/e 314, 316 (M, M+H)+
c) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (420 mg, 1 33 mmol), potassium carbonate (921 mg, 6 66 mmol), PdCI2(dppf) (98 mg, 0 13 mmol) and tnmethylboroxine (0 371 ml, 2 67 mmol) in N,N-dimethylformamide (6 663 ml) was stirred at 110 °C in a sealed tube for 2h This reaction was run in two batches (100 mg and 420 mg) which were combined and partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (240 mg, 58%) as a yellow oil LCMS (ES) m/e 251 (M+H)+
d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (240 mg, 0 96 mmol) in 6N sodium hydroxide (3 20 ml, 19 18 mmol) and tetrahydrofuran (4 79 ml) was stirred at 70 °C in a sealed tube for 1 h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (217 mg, 0 92 mmol, 96 % yield) as a yellow oil LCMS (ES) m/e 236 (M+H)+
e) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of methyl 4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (217 mg, 0 918 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (353 mg, 0 92 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 800 ml, 4 59 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (472 mg, 1 01 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide (373 mg, 0 66 mmol, 71 7 % yield) as a yellow foam LCMS (ES) m/e 567 (M+H)+
f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethylH-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide (373 mg, 0 66 mmol) in tetrahydrofuran (1 65 ml) and methanol (1 65 ml) at 25 °C was added hydrazine (0 21 ml, 6 58 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-
thiophenecarboxamide (253 mg, 0 497 mmol, 75 % yield) as a yellow solid LCMS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 80 (d, J=8 59 Hz, 1 H) δ 09 (br s , 3 H) 7 82 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 58 (t, J=8 08 Hz, 1 H) 7 43 (t, J=7 33 Hz, 1 H) 7 38 (s, 1 H) 4 47 (br s , 1 H) 3 64 (s, 3 H) 2 99 - 3 07 (m, 4 H) 2 27 (s, 3 H) 1 89 (s, 3 H)
Example 100
(Formula Removed)
Preparation of N-((1S)-2-amino-Hr2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiopheriecarboxamide
a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 2 mmol)[Prepared in Example 98] and N-chlorosuccinimide (160 mg, 1 2 mmol) in tetrahydrofuran (6 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (1 ml, 5 99 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAC in hexanes) yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (325 mg, 1 20 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 271, 273 (M, M2)+
b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (200 mg, 0 74 mmol), N,N-dnsopropylethylamine (0 64 ml, 3 69 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (284 mg, 0 74 mmol)[prepared according to Preparation 6] in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (414 mg, 0 886 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SC"4, concentrated and punfied via column chromatography (silica, 50% EtOAc in hexanes) yielding 4-(4-chloro-1-methyM H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (316 mg, 0 526 mmol, 71 % yield) as a white foam LCMS (ES) m/e 601, 603 (M, M2)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H -pyrazol-5-yl )-5-ethyl-2-th lophenecarboxa mide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (316 mg, 0 53 mmol) in tetrahydrofuran (1 314 ml) and methanol (1 3 ml) at 25 °C was added hydrazine (0 16 ml, 5 26 mmol) dropwise After 12h, the solution was concentrated, purified via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) and converted to the HCI salt by adding excess 2M HCI in Et20 (2 ml) to the residue in MeOH (5 ml) affording the HCI salt of
N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (163 mg, 0 30 mmol, 57 % yield) as a white solid LCMS (ES) m/z = 471, 473 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 82 (br s , 1 H) δ 04 (bs, 3 H) 7 85 (s, 1 H) 7 65 - 7 72 (m, 2 H) 7 52-7 59 (m, 2 H) 7 39 - 7 46 (m, 1 H) 4 41-4 47 (m, 1 H) 3 71 (s, 3 H) 2 98-3 07 (m, 4H) 2 67 (q, J=7 58 Hz, 2 H) 1 16 (t, J=7 58 Hz, 3 H)
Example 101
(Formula Removed)
Preparation of N-((1S)-2-amino-1-l[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-ethyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 2 mmol)[Prepared in Example 98] and N-bromosuccinimide (213 mg, 1 2 mmol) in Tetrahydrofuran (5 99 ml) was stirred in a sealed tube for 1h at 70 °C Aqueous sodium hydroxide (4 0 ml, 23 97 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAC in hexanes) yielding 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (378 mg, 1 2 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 314, 316 (M, M2)+
b) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (200 mg, 0 57 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (181 mg, 0 57 mmol)[Prepared according to Preparation 6] and N,N-dnsopropylethylamine (0 50 ml, 2 87 mmol) in Dichloromethane (4 23 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (295 mg, 0 632 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 50% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (240 mg, 0 37 mmol, 64 8 % yield) as a white foam LCMS (ES) m/e 645, 647 (M, M2)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-
1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (240 mg, 0 37 mmol) in tetrahydrofuran (1 31 ml) and methanol (1 31 ml) at 25 °C was added hydrazine (0 12 ml, 3 72 mmol) dropwise After 12h, the solution was concentrated, purified via column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) and converted to the HCI salt by adding
excess 4M HCI in dioxane (2 ml) to the residue in MeOH (5 ml) affording the HCI salt of N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (167 mg, 0 28 mmol, 76 % yield) as a white solid LCMS (ES) m/z = 515, 517 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 77 (dd, J=15 66, 9 09 Hz, 1 H) δ 02 (br s , 3 H) 7 80 (s, 1 H) 7 66 - 7 72 (m, 2 H) 7 54 - 7 61 (m, 2 H) 7 41 - 7 48 (m, 1 H) 4 42 - 4 47 (m, 1 H) 3 71 (s, 3 H) 2 98 - 3 06 (m, 4 H) 2 66 (dd, J=7 45, 3 16 Hz, 2 H) 1 15 (t, J=7 45 Hz, 3H)
Example 102
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 75 g, 11 64 mmol)[Prepared in Example 99] and N-chlorosuccinimide (1 55 g, 11 64 mmol) in tetrahydrofuran (58 ml) was stirred in a sealed tube for 1h at 70 °C Sodium hydroxide (9 70 ml, 58 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 20% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (2 3 g, 8 96 mmol, 77 % yield) as a yellow oil LCMS (ES) m/e 257, 259 (M, M2)+
b) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-
dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (159 mg, 0 62 mmol), N,N-dnsopropylethylamine (0 54 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 62 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 45% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (231 mg, 0 44 mmol, 71 % yield) as a clear oil LCMS (ES) m/e 525, 527 (M, M2)+
c) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-
yl)-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (231 mg, 0 44 mmol) in tetrahydrofuran (2 20 ml) and methanol (2 20 ml) at 25 °C was added hydrazine (0 14 ml, 4 40 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by
column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was then transferred to the HCI salt adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (124 mg, 0 27 mmol, 60 % yield) as a yellow solid LCMS (ES) m/z = 394, 396 (M, M2)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 8 51 (br s ,
1 H) 7 97 (br s , 3 H) 7 86 (s, 1 H) 7 70 (s, 1 H) 4 24 - 4 26 (m, 1 H) 3 71 (s, 3 H)
2 90 - 2 99 (m, 2 H) 2 36 (s, 3 H) 1 75 -1 79 (m, 1 H) 1 61 1 64 (m, 4 H) 1 48 -1 51 (m, 1 H) 1 31 -1 36 (m, 2 H) 1 10 -1 14 (m, 2 H) 0 91 - 0 94 (m, 2 H)
Example 103
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexylmethyl]ethyl]-5-methyl-4-n-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 1 06 mmol)[Prepared in Example 99] in 6N sodium hydroxide (1 76 ml, 10 6 mmol) and tetrahydrofuran (5 290 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (151 mg, 0 68 mmol, 64 % yield) as a white solid, LCMS (ES) m/z = 223 (M+H)+
b) N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-
methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (138 mg, 0 62 mmol), N,N-dnsopropylethylamine (0 541 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 62 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 50% EtOAc in hexanes) yielding N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (285 mg, 0 581 mmol, 94 % yield) as a white foam LCMS (ES) m/e 491, 493 (M, M2)+
c) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5-
yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl )methyl]ethyl}-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (285 mg, 0 581 mmol) in tetrahydrofuran (2 905 ml) and methanol (2 91 ml) at 25 °C was added hydrazine (0 18 ml, 5 81 mmol) dropwise After 12h, the solution was
concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1 % NH4OH)) The free base was then transferred to the HCI salt by adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (173 mg, 0 40 mmol, 69 % yield) as a yellow solid LCMS (ES) m/z = 360 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 55 (d, J=8 59 Hz, 1 H) δ 01 (br s , 3 ) 7 94 (s, 1 H) 7 52 (d, J=2 02 Hz, 1 H) δ 35 (d, J=1 77 Hz, 1 H) 4 24 - 4 27 (m, 1 H) 3 77 (s, 3 H) 2 91 - 2 94 (m, 2 H) 2 39 (s, 3 H) 1 72 -1 77 (m, 1 H) 1 60 - 1 64 (m, 4 H) 1 49 - 1 52 (m, 1 H) 1 21 - 1 29 (m, 2 H) 1 15 -1 25 (m, 2 H) 0 89 - 0 94 (m, 2 H)
Example 104
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-^cyclohexvlmethyl)ethyl)-5-chloro-4-n-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (150 mg, 0 62 mmol)[Prepared in Example 95], N,N-dnsopropylethylamme (0 54 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 62 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-
phenylalanine] in DCM at 25 °C was added bromotris-pyrrolidino-phosphomum hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 45% EtOAc in hexanes) yielding 5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (168 mg, 0 33 mmol, 53 % yield) as a clear oil LCMS (ES) m/e 511, 513 (M, M2)+
b) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (168 mg, 0 33 mmol) in tetrahydrofuran (1 644 ml) and methanol (1 644 ml) at 25 °C was added hydrazine (0 10 ml, 3 29 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (silica, 5% MeOH in DCM (1% NH4OH)) The free base was then transferred to the HCI salt adding excess 4M HCI in dioxane (1 mL) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (79 mg, 017 mmol, 53 % yield) as a yellow solid LCMS (ES) m/z = 380, 382 (M, M2)+, 1H NMR (400 MHz, DMSO-d) d ppm 8 82 (d, J=8 59 Hz, 1 H) δ 10 (s, 1 H) 7 99 (br s , 3 H) 7 55 (d, J=1 77 Hz, 1 H) δ 48 (d, J=2 02 Hz, 1 H) 4 22 - 4 28 (m, 1 H) 3 81 (s, 3 H) 2 90 -2 95 (m, 2 H) 1 74 -1 78 (m, 1 H) 1 62 -1 65 (m, 4 H) 1 48-1 51 (m, 1 H) 1 37 -1 39 (m, 2 H) 1 09 -1 13 (m, 2 H) 0 92 - 0 96 (m, 2 H)
Example 105
(Formula Removed)
Preparation of N-[(1S)--2-amino-1-(cyclohexvlmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 1 058 mmol)[prepared in Example 99] and N-bromosuccinimide (188 mg, 1 06 mmol) in tetrahydrofuran (5 29 ml) was stirred in a sealed tube for 1h at 70 °C Sodium hydroxide (3 53 ml, 21 16 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated yielding 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (289 mg, 0 96 mmol, 91 % yield) as a yellow oil LCMS (ES) m/e 301, 303 (M, M2)+
b) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-
dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (187 mg, 0 62 mmol), N,N-dnsopropylethylamine (0 54 ml, 3 10 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione
(200 mg, 0 62 mmol) )[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-([(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (347 mg, 0 74 mmol) in one portion The solution stirred at 25 °C for 1 h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over iv^SC^, concentrated and purified via column chromatography (silica, 50% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (226 mg, 0 40 mmol, 64 % yield) as a white foam LCMS (ES) m/e 569, 571 (M, M2)+
c) N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (226 mg, 0 40 mmol) in tetrahydrofuran (1 98 ml) and methanol (1 98 ml) at 25 °C was added hydrazine (0 13 ml, 3 97 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography The free base was then transferred to the HCI salt adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (153 mg, 0 30 mmol, 75 % yield) as a yellow solid LCMS (ES) m/z =439, 441 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 51 (br s , 1 H) 7 96 (br s , 3 H) 7 83 (br s , 1 H) 7 70 (s, 1 H) 4 21 - 4 25 (m, 1 H) 3 94 (s, 3H) 2 89 - 2 92 (m, 2 H) 2 35 (s, 3 H) 1 76 - 1 79 (m, 1 H) 1 60 -1 64 (m, 4 H) 1 48 - 1 54 (m, 1 H) 1 26 - 1 32 (m, 2 H) 1 09 -1 16 (m, 2 H) 0 92 -0 95 (m, 1 H) 0 82 - 0 86 (m, 1 H)
Example 106
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1)3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (216 mg, 0 78 mmol)[prepared according to Example 96], N.N-diisopropylethylamme (0 68 ml, 3 90 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (252 mg, 0 78 mmol)[Prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (401 mg, 0 86 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 40% EtOAc in hexanes) yielding 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (303 mg, 0 55 mmol, 71 % yield) as a clear oil LCMS (ES) m/e 545, 547 (M, M2)+
b) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (303 mg, 0 55 mmol) in tetrahydrofuran (2 78 ml) and methanol (2 78 ml) at 25 °C was added hydrazine (0 17 ml, 5 55 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was then converted to the HCI salt by adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (190 mg, 0 389 mmol, 70 0 % yield) as a yellow solid LCMS (ES) m/z =415, 417 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 84 (br s , 1 H) δ 06 (s, 4 H) 7 74 (s, 1 H) 4 25 (dd, J=8 84, 4 29 Hz, 1 H) 3 77 (s, 3 H) 2 87 - 2 93 (m, 2 H) 1 71 -1 79 (m, 1H) 1 64 (d, J=9 85 Hz, 3 H) 1 54 (br s , 1 H) 1 48 (br s , 1 H) 1 37 (dd, J=13 26, 4 93 Hz, 1 H) 1 14 (br s , 1 H) 1 17 (d, J=7 33 Hz, 2 H) 0 93 (d, J=10 86 Hz, 1 H) 0 82 - 0 89 (m, 1 H)
Example 107
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-p vrazol-5-yl V5-ch loro-2-th ipph en eca rboxa m id e
a) 4-(4-bromo-1-methy|-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid
(Formula Removed)
A solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (50 mg, 0 21 mmol)[prepared in Example 95] and NBS (36 7 mg, 0 21 mmol) in tetrahydrofuran (2 06 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (82 mg, 016 mmol, 79 % yield) as a yellow oil LCMS (ES) m/e 257, 259 (M, M2)+
b) 4-(4'bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-
dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (81 mg, 0 252 mmol), n,n-dnsopropylethylamine (0 22 ml, 1 26 mmol) and 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (81 mg, 0 25 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (141 mg, 0 302 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 40% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (47 mg, 0 080 mmol, 31 6 % yield) as a clear oil LCMS (ES) m/e 589, 591 (M, M2)+
c) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-
yl)-5-chloro-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (48 mg, 0 08 mmol) in tetrahydrofuran (0 41 ml) and methanol (0 41 ml) at 25 °C was added hydrazine (0 03 ml, 0 81 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was then converted to the HCI salt by adding excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide (11 mg, 0 02 mmol, 24 % yield) as a yellow solid LCMS (ES) m/z =459, 461 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 73 (br s ,
1 H) 7 96 (br s , 4 H) 7 74 (s, 1 H) 4 21 - 4 26 (m, 1 H) 3 77 (s, 3 H) 2 92 - 2 99 (m,
2 H) 1 73 - 1 79 (m, 1 H) 1 62 -1 67 (m, 4 H) 1 49 -1 51 (m, 1 H) 1 25 (br s , 2 H) 1 06 -1 13 (m, 2 H) 0 95 (d, J=6 82 Hz, 1 H) 0 82 - 0 89 (m, 1 H)
Example 108
(Formula Removed)
Preparation of N-((1S)-2-amino-Hr2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
a) methyl 4,5-dibromo-2-furancarboxylate
(Formula Removed)
To a solution of 4,5-dibromo-2-furancarboxylic acid (5 7 g, 21 1 mmol) in methanol (106 ml) was added sulfuric acid (113 ml, 211 mmol) The resulting solution stirred at 50 °C over 4days The reaction mixture was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and used directly without further punfication providing methyl 4,5-dibromo-2-furancarboxylate (5 5 g, 19 4 mmol, 92 % yield) LCMS (ES) m/e 283 (M+H)+
b) methyl 4-bromo-2-furancarboxylate
(Formula Removed)
To a solution of methyl 4,5-dibromo-2-furancarboxylate (1 g, 3 52 mmol) in tetrahydrofuran (14 1 ml) at -40 °C was added isopropylmagnesium chlonde (1 85 ml, 3 70 mmol) After 2h, H2O (3 52 ml) was added and the solution warmed to 25 °C The reaction mixture was then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SC"4, concentrated and purified by column chromatography (3% EtOAc in hexanes) affording methyl 4-bromo-2-furancarboxylate (470 mg, 2 04 mmol, 58 % yield) as a white solid LCMS (ES) m/e 204, 206 (M, M2)+
c) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
A solution of methyl 4-bromo-2-furancarboxylate (470 mg, 2 29 mmol), potassium carbonate (1 58 g, 11 46 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (525 mg, 2 52 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (58 6 mg, 0 115 mmol) in 1,4-Dioxane (9 5 ml) and water (1 9 ml) was stirred at 80 °C in a sealed tube for 1h The solution was partitioned between H2O-DCM and the aqueous phase was
washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (30% EtOAc in hexanes) affording methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (124 mg, 0 60 mmol, 26 % yield) as a white powder LCMS (ES) m/e 206 (M+H)+
d) 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (124 mg, 0 60 mmol) in 6N sodium hydroxide (2 0 ml, 12 0 mmol) and tetrahydrofuran (3 0 ml) was stirred at 70 °C in a sealed tube for 2h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over IS^SC^ and concentrated affording 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (54 mg, 0 28 mmol, 47 % yield) as a white solid LCMS (ES) m/e 192 (M+H)+
e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-
furancarboxamide
(Formula Removed)
To a solution of 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (54 mg, 0 28 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (108 mg, 0 28 mmol)[prepared in Preparation 6] and N,N-dnsopropylethylamine (0 24 ml, 1 40 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (158 mg, 0 34 mmol) in one portion
The solution stirred at 25 °C for 1 h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purfied via column chromatography (silica, 50% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (100 mg, 0 14 mmol, 50 % yield) as a white solid LCMS (ES) m/e 523 (M+H)+
f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (100 mg, 0 19 mmol) in tetrahydrofuran (1 ml) and methanol (1 ml) at 25 °C was added hydrazine (0 06 ml, 1 91 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (56 mg, 0 12 mmol, 62 % yield) as a yellow solid LCMS (ES) m/z = 393 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 70 (d, J=9 09 Hz, 1 H) δ 28 (s, 1 H) δ 07 (br s , 3 H) 7 69 (d, J=8 08 Hz, 1 H) 7 56 (d, J=8 08 Hz, 2 H) 7 50 (s, 1 H) 7 45 (d, J=1 77 Hz, 2 H) δ 51 (d, J=1 77 Hz, 1 H) 4 50 - 4 57 (m, 1 H) 3 93 (s, 3 H) 3 02-3 16 (m, 4 H)
Example 109
(Formula Removed)
Preparation of N-((1S)-2-amino-1-l[2-(trifluoromethyl)phenynmethyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (200 mg, 0 64 mmol)[prepared in Example 99], potassium carbonate (438 mg, 3 17 mmol), bis(tn-t-butylphosphine)palladium(0) (324 mg, 0 64 mmol) and 2,4,6-tnvinylcycloboroxane-pyridine complex (77 mg, 0 32 mmol) in 1,4-dioxane (5 3 ml) and H20 (1 ml) was stirred at 80 °C in a sealed tube for 12h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (135 mg, 0 515 mmol, 81 % yield) as a yellow oil LCMS (ES) m/z = 250 (M+H)+
b) methyl 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (135 mg, 0 52 mmol) in methanol (2 6 ml) was added Pd-C (21 9 mg, 0 21 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Celite and concentrated affording methyl 4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-
thiophenecarboxylate (145 mg, 0 51 mmol, 99 % yield) as a yellow oil which was used without further purification LCMS (ES) m/e 265 (M+H)+
c) 4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (145 mg, 0 55 mmol) in 6N sodium hydroxide (1 8 ml, 10 97 mmol) and tetrahydrofuran (4 8 ml) was stirred at 60 °C in a sealed tube for 12h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (137 mg, 0 55 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 250 (M+H)+
d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-
2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (137 mg, 0 55 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (211 mg, 0 55 mmol)[prepared in Preparation 6] and diisopropylethylamme (0 48 ml, 2 74 mmol) in Dichloromethane (5 47 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (281 mg, 0 60 mmol) in one portion The solution stirred at 25 °C for 1h and was then partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SC*4, concentrated and purified via column chromatography (silica, 40-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-
1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (262 mg, 0 45 mmol, 82 % yield) as a clear oil LCMS (ES) m/e 581 (M+H)+
e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)^-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (262 mg, 0 45 mmol) in tetrahydrofuran (2 256 ml) and methanol (2 256 ml) at 25 °C was added hydrazine (0 14 ml, 4 51 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (170 mg, 0 32 mmol, 72 % yield) as a yellow solid LCMS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 72 (br s , 1 H) δ 05 (br s , 2 H) 7 76 (s, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 49 - 7 52 (m, 2 H) 7 40 -7 45 (m, 2 H) 4 42 - 4 47 (m, 1 H) 3 61 (br s , 3 H) 3 01 - 3 07 (m, 4 H) 2 52 - 2 59 (m, 2 H) 2 26 (s, 3 H) 1 02 -1 09 (m, 3 H)
Example 110
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-Dvrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (980 mg, 3 92 mmol)[prepared in Example 98] and N-bromosuccinimide (697 mg, 3 92 mmol) in tetrahydrofuran (19 6 ml) was stirred in a sealed tube for 1h at 70 °C The reaction mixture was then partitioned between h^O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated then purified via column chromatography (silica, 10-40% EtOAC in hexanes) yielding methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (1 1 g, 3 34 mmol, 85 % yield) as a yellow oil LCMS (ES) m/e 329, 331 (M, M2)+
b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (300 mg, 0 911 mmol), potassium carbonate (630 mg, 4 56 mmol), PdCI2(dppf) (66 7 mg, 0 091 mmol) and tnmethylboroxm (0 25 ml, 1 82 mmol) in N,N-dimethylformamide (9 1 ml) was stirred at 110 °C in a sealed tube for 2h The reaction mixture was partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (143 mg, 0 51 mmol, 56 % yield) as a yellow oil LCMS (ES) m/z = 265 (M+H)+
c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (143 mg, 0 54 mmol) in 6N sodium hydroxide (0 90 ml, 5 41 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1 h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (136 mg, 0 54 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 251 (M+H)+
d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (130 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (267 mg, 0 57 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (278 mg, 0 43 mmol, 82 % yield) as a yellow oil LCMS (ES) m/e 581 (M+H)+
e) N-((1S)-2-amino-1 -([2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1 H-
pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-thiophenecarboxamide (278 mg, 0 48 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 15 ml, 4 79 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (3-15% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 2M HCI in Et20 (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide (196 mg, 0 36 mmol, 76 % yield) as a yellow solid LCMS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 86 - 8 93 (m, 1 H) δ 15 (br s , 3 H) 7 83 (s, 1 H) 7 69 (d, J=7 58 Hz, 1 H) 7 55 (br s , 1 H) 7 52 (t, J=7 45 Hz, 1 H) 7 42 (t, J=7 45 Hz, 1 H) 7 38 (s, 1 H) 4 22 - 4 27 (m,1 H) 3 62 (s, 3 H) 2 97 - 3 09 (m, 4 H) 2 60 (q, J=7 49 Hz, 2 H) 1 88 (s, 3 H) 1 13 (t, J=7 58 Hz, 3 H)
Example 111
(Formula Removed)
Preparation of N-((1S)-2-amino-1 -ir2-(trifluoromethyl]phenyl]methyl}ethyl)-5-methyl-4-n-methyl-4-n-methylethyl)-1H-pyrazol-5-vH-2-th)ophenecarboxam>de
a) methyl 5-methyl-4-[1-methyl-4-(1-methylethenyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (300 mg, 0 95 mmol), potassium carbonate (658 mg, 4 76 mmol), bis(tn-t-butylphosphine)palladium(0) (24 32 mg, 0 05 mmol) and 4,4,5,5-tetramethyl-2-(1-methylethenyl)-1,3,2-dioxaborolane (0 18 ml, 0 95 mmol) in 1,4-dioxane (5 3 ml) and H20 (1 0 ml) was stirred at 80 °C in a sealed tube for 12h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-methyl-4-[1-methyl-4-(1-methylethenyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (171 mg, 0 58 mmol, 61 % yield) as a yellow oil LCMS (ES) m/z = 276 (M+H)+
b) methyl 5-methyl-4-[1-methyl-4-(1-methylethyl)-1 H-pyrazol-5-yl]-2-
thiophenecarboxylate
(Formula Removed)
To a solution of methyl 5-methyl-4-[1-methyl-4-(1-methylethenyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (171 mg, 0 62 mmol) in methanol (3 ml) was added PdOH2 (34 8 mg, 0 25 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Cehte and concentrated affording methyl 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (173 mg, 0 62 mmol, 100 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+
c) 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylic
acid
(Formula Removed)
A solution of methyl 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylate (173 mg, 0 62 mmol) in 6N sodium hydroxide (1 ml, 6 21 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylic acid (148 mg, 0 49 mmol, 79 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+
d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-
pyrazol-5-yl]-2-thiophenecarboxamide
(Formula Removed)
To a solution of 5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxylic acid (137 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[Prepared in Preparation 6] and dusopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (267 mg, 0 572 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxamide (211 mg, 0 334 mmol, 64 2 % yield) as a yellow oil LCMS (ES) m/e 595 (M+H)+
e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1 -methyl-4-(1 -methylethyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxamide
(Formula Removed)
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-
pyrazol-5-yl]-2-thiophenecarboxamide (211 mg, 0 36 mmol) in tetrahydrofuran (2 4
ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 11 ml, 3 55 mmol)
dropwise After 12h, the solution was concentrated, dry loaded onto silica and
punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free
base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml)
to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1 -methyl-4-(1 -methylethyl)-1 H-
pyrazol-5-yl]-2-thiophenecarboxamide (108 mg, 0 20 mmol, 57 % yield) as a yellow
solid LCMS (ES) m/z = 465 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 71
(d, J=8 59 Hz, 1 H) δ 07 (br s , 3 H) 7 74 (s, 1 H) 7 65 - 7 68 (m, 1 H) 7 55 - 7 60
(m, 1 H) 7 46 - 7 49 (m, 1 H) 7 39 - 7 46 (m, 2 H) 4 47 (br s , 1 H) 3 57 (s, 3 H) 2 99
- 3 05 (m, 4 H) 2 49 - 2 52 (m, 1 H) 2 25 (s, 3 H) 1 07 -1 14 (m, 6 H)
Example 112
(Formula Removed)
Preparation of N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide
a) methyl 4-bromo-5-propyl-2-thiophenecarboxylate
(Formula Removed)
To a solution of 4-bromo-5-propyi-2-thiopnenecarboxylic acid (5 0 g, 20 07 mmol) in methanol (100 ml) was added sulfunc acid (5 35 ml, 100 mmol) The resulting solution stirred at 50 °C for 36h H20 (50 mL) was added the aqueous phase was washed several times with DCM The combined organic fractions were washed with saturated NaHCO3, dried over Na2SO4, concentrated and used directly without further punfication providing methyl 4-bromo-5-propyl-2-thiophenecarboxylate (5 1 g, 18 61 mmol, 93 % yield) as a yellow oil LCMS (ES) m/e 262, 264 (M, M2)+
b) methyl 4-(1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-propyl-2-thiophenecarboxylate (1 0 g, 3 80
mmol), potassium carbonate (2 63 g, 19 00 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-
1,3,2-dioxaborolan-2-yl)-1H-pyrazole (0 949 g, 4 56 mmol)[prepared according to
Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (0 097 g, 0 19 mmol) were
combined in a sealed tube and stirred at 80 °C for 1 h The reaction contents were
then partitioned between H2O-DCM and the aqueous phase was washed several
times with DCM The combined organic fractions were dried over Na2SO4 and
concentrated and punfied by column chromatography (10-50% EtOAc in hexanes)
affording methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (1 07
g, 3 76 mmol, 99 % yield) as a yellow oil LCMS (ES) m/e 265 (M+H)+
c) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (356 mg, 1 35 mmol) and N-chlorosuccmimide (180 mg, 1 35 mmol) in tetrahydrofuran (6 7 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (2 2 ml, 13 47 mmol) was added in one portion and the solution stirred an additional 12h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and used directly without further purification yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (357 mg, 1 25 mmol, 93 % yield) as a yellow oil LCMS (ES) m/e 271, 273 (M, M2)+
d) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (148 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[Prepared according to Preparation 6] and diisopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (267 mg, 0 57 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (245 mg, 0 39 mmol, 75 % yield) as a yellow oil LCMS (ES) m/e 615, 617 (M, M2)+
e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (245 mg, 0 40 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 12 ml, 3 98 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-
(trifluoromethyl)phenyl]methyl}ethylH-(4-ch,or°-',-metnyl-'H-Pyra2o|-5-y|)-5-Propy|-2-thiophenecarboxamide (178 mg, 0 32 mmol, 80 % yield) as a yellow solid LCMS (ES) m/z = 485, 487 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 96 (br s , 1 H) δ 13 (br s , 3 H) 7 93 (s, 1 H) 7 66 - 7 73 (m, 2 H) 7 62 (br s , 1 H) 7 55 (t, J=7 45 Hz, 1 H) 7 42 (t, J=7 45 Hz, 1 H) 4 48 (br s , 1 H) 3 71 (s, 3 H) 2 99 - 3 08 (m, 4 H) 2 63 (t, J=7 20 Hz, 2 H) 1 53 - 1 57 (m, 2 H) 0 83 (t, J=7 33 Hz, 3 H)
Example 113
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl]ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide
a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (714 mg, 2 70 mmol)[prepared in Example 112] and N-bromosuccinimide (481 mg, 2 70 mmol) in tetrahydrofuran (12 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half of the solution was treated with 6N sodium hydroxide (2 251 ml, 13 51 mmol) The reaction mixture stirred at 70 °C in a sealed tube for 12h and was partitioned between H2O-DCM The pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly affording 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (445 mg, 1 35 mmol, 50 % yield) LCMS (ES) m/e 329, 331 (M, M2)+
b)4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (171 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (200 mg, 0 52 mmol)[prepared according to Preparation 6] and diisopropylethylamine (0 45 ml, 2 60 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (267 mg, 0 57 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-
(trifluoromethyl)phenyl]methy!}ethy!)-5-propyl-2-thiophenecarboxanude (251 mg, 0 37 mmol, 72 % yield) as a yellow oil LCMS (ES) m/e 659,661 (M, M2)+
c) N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (251 mg, 0 38 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 12 ml, 3 81 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide (178 mg, 0 30 mmol, 78 % yield) as a yellow solid LCMS (ES) m/z = 529, 531 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 94 (d, J=8 84 Hz, 1 H) δ 10 (br s , 3 H) 7 87 (d, J=1 77 Hz, 1 H) 7 65 - 7 72 (m, 2 H) 7 58 (dd, J=14 78, 7 71 Hz, 2 H) 7 43 (t, J=7 45 Hz, 1 H) 4 48 (br s , 1 H) 3 71 (s, 3 H) 2 99 - 3 08 (m, 4 H) 2 58 - 2 66 (m, 2 H) 1 53 (ddd, J=13 89, 6 82, 6 57 Hz, 2 H) 0 83 (dd, J=7 33, 2 02 Hz, 3 H)
Example 114
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenvi1methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide
a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (714 mg, 2 70 mmol) and N-bromosuccinimide (481 mg, 2 70 mmol) in tetrahydrofuran (12 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half was partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and used directly yielding methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (464 mg, 1 35 mmol, 50 % yield) as an orange oil LCMS (ES) m/e 343, 345 (M, M2)+
b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-propylthiophene-2-carboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (242 mg, 0 71 mmol), PdCI2(dppf) (52 mg, 0 07 mmol), potassium carbonate (487 mg, 3 53 mmol) and tnmethylboroxine (0 20 ml, 1 41 mmol) in N,N-Dimethylformamide (3 5 ml) was stirred at 110 °C in a sealed tube for 2h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Is^SC^, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (184 mg, 0 60 mmol, 84 % yield) as a yellow oil LCMS (ES) m/z = 279 (M+H)+
c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-propylthiophene-2-carboxylic acid
(Formula Removed)
A solution of methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylate (0 184 g, 0 66 mmol) in 6N sodium hydroxide (2 2 ml, 13 22 mmol) and tetrahydrofuran (6 6 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (180 mg, 0 66 mmol, 100 % yield) as a yellow oil LCMS (ES) m/e 265 (M+H)+
d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)-1-[2-(trifluoromethyl)benzyl]ethyl}-5-propylthiophene-2-carboxamide
(Formula Removed)
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxylic acid (180 mg, 0 68 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (262 mg, 0 68 mmol)[prepared in Preparation 6] and dnsopropylethylamine (0 59 ml, 3 40 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (350 mg, 0 75 mmol) in one portion The solution stirred at 25 °C for 2h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{t2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (243 mg, 0 41 mmol, 60 % yield) as a yellow oil LCMS (ES) m/e 595 (M+H)+
e) N-{(1S)-2-amino-1 -[2-(trifluoromethyl)benzyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-
yl)-5-propylthiophene-2-carboxamide
(Formula Removed)
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-propyl-2-thiophenecarboxamide (243 mg, 0 41 mmol) in tetrahydrofuran (2 ml) and methanol (2 ml) at 25 °C was added hydrazine (0 13 ml, 4 09 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide (172 mg, 0 30 mmol, 74 % yield) as a yellow solid LCMS (ES) m/z = 465 (M+H)+, 1H NMR (400 MHz, DMSO-ofe) δ ppm 8 80 (br s , 1 H) δ 08 (br s , 3 H) 7 78 (s, 1 H) 7 69 (d, J=7 58 Hz, 1 H) 7 50 - 7 55 (m, 2 H) 7 43 (t, J=7 71 Hz, 1 H) 7 37 (s, 1 H) 4 49 (d, J=10 36 Hz, 1 H) 3 61 (s, 3 H) 2 99 - 3 06 (m, 4 H) 2 54 - 2 59 (m, 2 H) 1 87 (s, 3 H) 1 48 - 1 55 (m, 2 H) 0 81 (t, J=7 33 Hz, 3 H)
Example 115
(Formula Removed)
Preparation of N-((1S)-2-amino-1-[2-(trifluoromethyl]benzvllethyl]-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)thiophene-2-carboxamide
a) methyl 5-metriyl-4-{1-methyl-4-[(1 E)-prop-1-en-1-yl]-1 H-pyrazol-5-yl}thiophene-2-carboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (320 mg, 1 015 mmol)[prepared in Example 99], potassium carbonate (702 mg, 5 08 mmol), bis(tn-t-butylphosphine)palladium(0) (25 9 mg, 0 05 mmol) and(1Z)-1-propen-1-ylboronic acid (87 mg, 1 01 mmol) in 1,4-dioxane (5 3 ml) and water (1 3 ml) was stirred at 80 °C in a sealed tube for 12h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-methyl-4-{1-methyl-4-[(1Z)-1-propen-1-yl]-1H-pyrazol-5-yl}-2-thiophenecarboxylate (243 mg, 0 88 mmol, 87 % yield) as a yellow oil LCMS (ES) m/z = 277 (M+H)+
b) methyl 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 5-methyl-4-{1-methyl-4-[(1Z)-1-propen-1-yl]-1H-pyrazol-5-yl}-2-thiophenecarboxylate (243 mg, 0 88 mmol) in methanol (6 8 ml) was added Pd(OH)2 (49 mg, 0 35 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Cehte and concentrated affording methyl 5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (217 mg, 0 69 mmol, 78 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+
c) 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (217 mg, 0 78 mmol) in 6N sodium hydroxide (2 60 ml, 15 59 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (242 mg, 0 78 mmol, 100 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+
d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-
yl )-2-th tophenecarboxamide
(Formula Removed)
To a solution of 5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (206 mg, 0 78 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (300 mg, 0 78 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 68 ml, 3 90 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (400 mg, 0 86 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (283 mg, 0 46 mmol, 60 % yield) as a yellow oil LCMS (ES) m/e 595 (M+H)+
e) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-
methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (283 mg, 0 48 mmol) in tetrahydrofuran (2 4 ml) and methanol (2 4 ml) at 25 °C was added hydrazine (0 15 ml, 4 76 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (186 mg, 0 35 mmol, 73 % yield) as a yellow solid LCMS (ES) m/z = 465 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 81 (br s ,
1 H) δ 13 (br s , 3 H) 7 79 (s, 1 H) 7 68 (d, J=7 58 Hz, 1 H) 7 59 (d, J=7 07 Hz, 1 H) 7 42 - 7 51 (m, 1 H) 7 38 - 7 45 (m, 2 H) 4 47 (br s , 1 H) 3 61 (d, J=2 78 Hz, 3 H)
2 99 - 3 08 (m, 4 H) 2 25 (s, 3 H) 2 11 - 2 21 (m, 2 H) 1 41 - 1 48 (m, 2 H) 0 83 (br s,3H)
Example 116
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
a) methyl 4-bromo-5-methyl-2-furancarboxylate
(Formula Removed)
To a solution of methyl 5-methyl-2-furancarboxylate (1 5 g, 10 70 mmol) and aluminum tnchlonde (2 14 g, 16 06 mmol) in chloroform (21 ml) at 0 °C was added bromine (0 77 ml, 14 99 mmol) The resulting solution stirred at 0 °C and warmed to RT over 12h This reaction was run in batches (1 5g and 1g) and the batches were combined, added to ice and partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified by column chromatography (0 5-10% EtOAc in hexanes) affording the title compound (2 1 g, 54%) as a white solid, LCMS (ES) m/z = 219, 221 (M, M2)+
b) methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-methyl-2-furancarboxylate (2 1 g, 9 59 mmol), potassium carbonate (6 63 g, 47 9 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 19 g, 10 55 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (0 24 g, 0 48 mmol) in 1,4-dioxane (40 ml) and water (8 ml) was stirred at 80 °C in a sealed tube for 1h 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 19 g, 10 55 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 245 g, 0 48 mmol) were added and the reaction stirred an additional 1h and was partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (10-40% EtOAc in hexanes) affording methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (1 7 g, 7 72 mmol, 81 % yield) as a yellow oil LCMS (ES) m/e 221 (M+H)+
c) 5-methyl-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (200 mg, 0 91 mmol) in 6N sodium hydroxide (2 3 ml, 13 62 mmol) and tetrahydrofuran (4 5 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording 5-methyl-4-(1-methyl-1H-pyra2ol-5-yl)-2-furancarboxylic acid (130 mg, 0 57 mmol, 63 % yield) as a yellow oil LCMS (ES) m/e 207 (M+H)+
d) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-
furancarboxamide
(Formula Removed)
To a solution of 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (130 mg, 0 63 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (243 mg, 0 63 mmol)[prepared in Preparation 6] and dnsopropylethylamine (0 55 ml, 3 15 mmol) in DCM at 25 °C was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (324 mg, 0 69 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (190 mg, 0 23 mmol, 37 % yield) as a clear oil LCMS (ES) m/e 537 (M+H)+
e) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-
methyl-1H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
To a solution of N-((1S)-2-(113-dioxo-1)3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-( 1 -methyl- 1H-pyrazol-5-yl)-2-furancarboxamide (190 mg, 0 35 mmol) in tetrahydrofuran (1 5 ml) and methanol (1 5 ml) at 25 °C was added hydrazine (0 11 ml, 3 54 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (71 mg, 0 15 mmol, 42 % yield) as a yellow solid LCMS (ES) m/z 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 60 (d, J=9 60 Hz, 1 H) δ 04 (br s , 3 H) 7 70 (d, J=7 83 Hz, 1 H) 7 53 - 7 59 (m, 2 H) 7 49 (d, J=1 77 Hz, 1 H) 7 38 - 7 45 (m, 2 H) δ 33 (br s , 1 H) 4 52 (br s , 1 H) 3 80 (s, 3 H) 2 98 - 3 09 (m, 4 H) 2 38 (s, 3 H)
Example 117
(Formula Removed)
Preparation of N-((1S)-2-amino-1-[[2-(trifluoromethy0phenyl]methyl)ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (600 mg, 2 72 mmol)[prepared in Example 116] and n-bromosuccinimide (485 mg, 2 72 mmol) in tetrahydrofuran (13 6 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half of the solution was treated with 6N sodium hydroxide (4 54 ml, 27 2 mmol) which stirred at 70 °C in a sealed tube for 4h The solution was partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly affording 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (369 mg, 1 29 mmol, 48 % yield) as an orange oil LCMS (ES) m/e 285, 287 (M, M2)+
b) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-
furancarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (200 mg, 0 70 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (270 mg, 0 70 mmol)[prepared according to Preparation 6] and dusopropylethylamine (0 61 ml, 3 51 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphomum hexafluorophosphate (361 mg, 0 77 mmol) in one portion The solution stirred at 25 °C for 1h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (232 mg, 0 32 mmol, 46 % yield) as a clear oil LCMS (ES) m/e 615, 617 (M+H)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-
1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
(Formula Removed)
To a solution of 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(113-dioxo-1,3-dihydro-2HHsoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (232 mg, 0 38 mmol) in tetrahydrofuran (2 ml) and methanol (2 ml) at 25 °C was added hydrazine (0 12 ml, 3 77 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (106 mg, 0 19 mmol, 50 % yield) as a yellow solid LCMS (ES) m/z = 485, 487 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 60 (d, J=9 60 Hz, 1 H) 7 99 (br s , 3 H) 7 68 (s, 2 H) 7 71 (d, J=8 08 Hz, 1 H) 7 59 (d, J=7 33 Hz, 1 H) 7 44 - 7 56 (m, 1 H) 7 25 - 7 33 (m, 1 H) 4 50 - 4 57 (m, 1 H) 3 74 (s, 3 H) 2 99 - 3 07 (m, 4 H) 2 32 (s, 3 H)
Example 118
(Formula Removed)
Preparation of N-((1S)-2-amino-H[2-arifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 36 mmol) and N-chlorosuccinimide (182 mg, 1 36 mmol) in tetrahydrofuran (6 7 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (3 4 ml, 20 4 mmol) was added in one portion and the solution stirred an additional 12h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification yielding 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (275 mg, 1 14 mmol, 84 % yield) as a orange oil LCMS (ES) m/e 241, 243 (M, M2)+
b) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-
furancarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (200 mg, 0 83 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (320 mg, 0 83 mmol)[prepared according to Preparation 6] and dnsopropylethylamine (0 72 ml, 4 16 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (427 mg, 0 91 mmol) in one portion The solution stirred at 25 °C for 12h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (246 mg, 0 40 mmol, 49 % yield) as a clear oil LCMS (ES) m/e 571, 573 (M, M2)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-
1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (246 mg, 0 43 mmol) in tetrahydrofuran (2 1 ml) and methanol (2 1 ml) at 25 °C was added hydrazine (135 ul, 4 31 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (125 mg, 0 24 mmol, 56 % yield) as a yellow solid LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 63 (d, J=9 09 Hz, 1 H) δ 04 (br s , 3 H) 7 65 - 7 72 (m, 2 H) 7 59 (d, J=7 33 Hz, 1 H) 7 57 (br s , 1 H) 7 39 - 7 47 (m, 1 H) 7 29 - 7 37 (m, 1 H) 4 54 (br s , 1 H) 3 73 (s, 3 H) 2 98 - 3 09 (m, 4 H) 2 33 (s, 3 H)
Example 119
(Formula Removed)
Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (600 mg, 2 72 mmol)[prepared in Example 116] and N-bromosuccinimide (485 mg, 2 72 mmol) in tetrahydrofuran (13 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was divided and half of the solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified by column chromatography (5-15% EtOAc in hexanes yielding methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (130 mg, 0 41 mmol, 15 % yield) as an orange oil LCMS (ES) m/e 299, 301 (M, M2)+
b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (130 mg, 0 43 mmol), potassium carbonate (300 mg, 2 17 mmol), PdCI2(dppf) (15 9 mg, 0 02 mmol) and tnmethylboroxine (0 12 ml, 0 87 mmol) in N,N-Dimethylformamide (3 5 ml) was stirred at 110 °C in a sealed tube for 2h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (60 mg, 0 26 mmol, 59 % yield) as a yellow oil LCMS (ES) m/z = 235 (M+H)+
c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-rnethyl-2-furancarboxylate (60 mg, 0 26 mmol) in 6N sodium hydroxide (0 8 ml, 5 1 mmol) and tetrahydrofuran (2 5 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (53 mg, 0 24 mmol, 94 % yield) as a white foam LCMS (ES) m/e 221(M+H)+
d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide
(Formula Removed)
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (53 mg, 0 24 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (93 mg, 0 24 mmol)[prepared according to Preparation 6] and N,N-dnsopropylethylamine (0 21 ml, 1 20 mmol) in dichloromethane (2 4 ml) at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (124 mg, 0 26 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (113 mg, 0 21 mmol, 85 % yield) as a white foam LCMS (ES) m/e 551 (M+H)+
e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1 H-
pyrazol-5-yl)-5-methyl-2-furancarboxamide
(Formula Removed)
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]rnethyl}ethyl)-5-methyl-2-furancarboxamide (113 mg, 0 21 mmol) in tetrahydrofuran (1 mL) and methanol (1 mL) at 25 °C was added hydrazine (64 ul, 2 05 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide (32 mg, 0 06 mmol, 32 % yield) as a yellow solid LCMS (ES) m/z = 421 (M+H)+, 1H NMR (400 MHz, DMSO-ofe) δ ppm 8 60 (d, J=9 09 Hz, 1 H) δ 05 (br s , 3 H) 7 70 (d, J=7 58 Hz, 1 H) 7 54 - 7 61 (m, 2 H) 7 40 - 7 47 (m, 1 H) 7 35 (s, 1 H) 7 27 (s, 1 H) 4 54 (br s , 1 H) 3 65 (s, 3 H) 2 98 - 3 07 (m, 4 H) 2 26 (s, 3 H) 1 90 (s, 3 H)
Example 120
(Formula Removed)
Preparation of N-K1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)5-ethyl-2-thiophenecarboxarrude
The title compound was prepared as a yellow solid according to the procedure of Example 100, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (155 mg, 0 46 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 421,
423 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 76 (br s , 1 H) δ 06 (br s, 3 H) 7 85 (s, 1 H) 7 69 (s, 1 H) 7 28 - 7 36 (m, 1 H) 7 12 (d, J=7 07 Hz, 2 H) 7 03 (dd, J=17 05, 2 15 Hz, 1 H) 4 36 (br s , 1 H) 3 69 (s, 3 H) 2 93 - 3 02 (m, 4 H) 2 67 (q, J=7 33 Hz, 2 H) 1 16 (t, J=7 45 Hz, 3 H)
Example 121
(Formula Removed)
N-[(1S)-2-amino-1-R3-fluoroDhenyl]methyi1etrivlM-n .4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 110, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (241 mg, 0 72 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 401 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 76 (br S , 1 H) δ 11 (br S , 3 H) 7 79 (s, 1 H) 7 37 (s, 1 H) 7 28 - 7 36 (m, 1 H) 7 12 (d, J=6 82 Hz, 2 H) 7 03 (td, J=8 65, 1 64 Hz, 1 H) 4 41 - 4 43 (m, 1 H, obscured) 3 60 (br S , 3 H) 2 99 - 3 02 (m, 4 H) 2 60 (q, J=7 33 Hz, 2 H) 1 86 (s, 3 H)1 13 (t, J=7 45Hz, 3H)
Example 122
(Formula Removed)
Preparation of N-((1S)-2-amino-1-f[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 110, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (277 mg, 0 72 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 8 70 (br s , 1 H) δ 06 (br s , 3 H) 7 68 - 7 75 (m, 1 H) 7 52 (s, 1 H) 7 50 - 7 56 (m, 3 H) 7 37 (s, 1 H) 4 36 (d, J=8 84 Hz, 1 H) 3 58 (br s , 3 H) 2 98 -3 02 (m, 4 H) 2 55 - 2 61 (m, 2 H) 1 86 (s, 3 H) 1 12 (t, J=7 58 Hz, 3 H)
Example 123
(Formula Removed)
Preparation of N-((1S)-2-amino-1-ir2-(trifluoromethyBphenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 g, 3 99 mmol)[prepared in Example 98] and N-bromosuccinimide (0 711 g, 3 99 mmol) in tetrahydrofuran (8 ml) was stirred in a sealed tube for 1h at 70 °C The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and purified by column chromatography (10-50% EtOAc in hexanes yielding methyl 4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (1 2 g, 3 54 mmol, 89 % yield) as an orange oil LCMS (ES) m/e 329, 331 (M, M2)+
b) methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (300 mg, 0 911 mmol), potassium carbonate (630 mg, 4 56 mmol), bis(tn-t-butylphosphine)palladium(0) (23 29 mg, 0 05 mmol) and 2,4,6-tnvinylcycloboroxane-pyndine complex (110 mg, 0 45 mmol) in 1,4-dioxane (5 ml) and Water (1 ml) was stirred at 80 °C in a sealed tube for 2h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over IS^SC^, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (187 mg, 0 66 mmol, 73 % yield) as a clear oil LCMS (ES) m/z = 277 (M+H)+
c) methyl 5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (187 mg, 0 68 mmol) in methanol (2 5 ml) was added Pd-C (7 20 mg, 0 07 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1 h The solution was then purged with N£, filtered through Celite and concentrated affording methyl 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (187 mg, 0 64 mmol, 95 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+
d) 5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (181 mg, 0 65 mmol) in 6N sodium hydroxide (2 16 ml, 13 0 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (175 mg, 0 65 mmol, 100 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+
e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (175 mg, 0 66 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (255 mg, 0 66 mmol)[prepared according to Procedure 6] and N,N-dnsopropylethylamine (0 58 ml, 3 31 mmol) in Dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (340 mg, 0 73 mmol) in one portion The solution stirred at 25 °C for 1h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (232 mg, 0 38 mmol, 57 % yield) as a clear oil LCMS (ES) m/e 595 (M+H)+
f) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-
methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (232 mg, 0 39 mmol) in tetrahydrofuran (2 mL) and methanol (2 mL) at 25 °C was added hydrazine (122 pi, 3 90 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (176 mg, 0 38 mmol, 97 % yield) as a yellow solid LCMS (ES) m/z = 529, 531 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 64 (br s , 1 H) 7 97 (br s , 3 H) 7 65 - 7 73 (m, 3 H) 7 57 (d, J=5 05 Hz, 2 H) 7 59 (br s , 1 H) 7 44 (br s , 1 H) 4 48 (br s , 1 H) 3 69 (s, 3 H) 2 98 - 3 12 (m, 4 H) 1 24 (dd, J=6 82, 2 27 Hz, 3 H) 1 16 (dd, J=6 82, 2 53 Hz, 3 H)
Example 124
(Formula Removed)
Preparation of N-((1S)-2-amino-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 123, except substituting (1Z)-1-propen-1-ylboronic acid (78 mg, 0 91 mmol) for 2,4,6-trivinylcycloboroxane-pyndine complex LCMS (ES) m/z = 479 (M+H)+, ^ H
NMR (400 MHz, DMSO-d6) δ ppm 8 63 (s, 1 H) δ 01 (br s , 3 H) 7 67 (s, 2 H) 7 56 (d, J=5 05 Hz, 2 H) 7 38 - 7 46 (m, 2 H) 4 42 - 4 47 (m, 1 H) 3 59 (s, 3 H) 2 98 -3 02 (m, 4 H) 2 66 - 2 71 (m, 2 H) 1 40 -1 47 (m, 2 H) 1 13 (t, J=7 52 Hz, 3 H) 0 83 (t, J=7 26 Hz, 3 H)
Example 125
(Formula Removed)
Preparation of N-((1S)-2-amino-14r2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 4-bromo-2-thiophenecarboxylate
(Formula Removed)
To a solution of 4-bromo-2-thiophenecarboxylic acid (25 g, 121 mmol) in methanol (241 ml) was added sulfuric acid (32 ml, 604 mmol) The resulting solution stirred at 50 °C over 4d The solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further punfication providing methyl 4-bromo-2-thiophenecarboxylate (26 g, 118 mmol, 97 % yield), LCMS (ES) m/e 222 (M+H)+
b) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-bromo-2-thiophenecarboxylate (2 5 g, 11 31 mmol), potassium carbonate (7 81 g, 56 5 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)-1 H-pyrazole (2 59 g, 12 44 mmol)[prepared according to Preparation 7] and bis(tri-t-butylphosphine)palladium(0) (0 289 g, 0 56 mmol) in 1,4-dioxane (47 ml) and water (9 ml) was stirred at 80 °C in a sealed tube for 1h 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 59 g, 12 44 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 289 g, 0 56 mmol) were added and the reaction stirred an additional 1 h The mixture was partitioned between H2O-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-40% EtOAc in hexanes) affording methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 5 g, 11 25 mmol, 99 % yield) as a yellow solid LCMS (ES) m/e 223 (M+H)+
c) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 5 g, 11 25 mmol) and n-bromosuccinimide (2 002 g, 11 25 mmol) in tetrahydrofuran (56 2 ml) was stirred in a sealed tube for 1 h at 70 °C The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied by column chromatography (10-50% EtOAc in hexanes yielding methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 7 g, 8 97 mmol, 80 % yield) as a yellow solid LCMS (ES) m/e 301, 303 (M, M2)+
d) methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (300 mg, 0 91 mmol), potassium carbonate (630 mg, 4 56 mmol), bis(tn-t-butylphosphine)palladium(0) (23 mg, 0 05 mmol) and 2,4,6-tnvinylcycloboroxane-pyndine complex (110 mg, 0 46 mmol) in 1,4-dioxane (5 ml)
and water (1 ml) was stirred at 80 °C in a sealed tube for 2h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl}-5-ethyl-2-thiophenecarboxylate (187 mg, 0 66 mmol, 73 % yield) as a clear oil LCMS (ES) m/z = 277 (M+H)+
e) methyl 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (187 mg, 0 68 mmol) in methanol (2 5 ml) was added Pd-C (7 20 mg, 0 07 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1 h The solution was then purged with N2, filtered through Cehte and concentrated affording methyl 5-ethyl-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (187 mg, 0 64 mmol, 95 % yield) as a clear oil which was used without further punfication LCMS (ES) m/e 279 (M+H)+
f) methyl 4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(4-ethyl-1-methyM H-pyrazol-5-yl)-2-thiophenecarboxylate (202 mg, 0 81 mmol) and NCS (108 mg, 0 81 mmol) in N,N-dimethylformamide (4 ml) was stirred in a sealed tube for 1h at 100 °C Additional NCS (108 mg, 0 81 mmol) was added and the solution stirred 1h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (2-30% EtOAc in hexanes) affording methyl 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxylate (135 mg, 0 45 mmol, 56 % yield) as a yellow oil LCMS (ES) m/e 285 (M+H)+
g) 4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (135 mg, 0 47 mmol) in 6N sodium hydroxide (1 6 ml, 9 48 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 12h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (120 mg, 0 41 mmol, 87 % yield) as a white foam LCMS (ES) m/e 270, 272 (M, M2)+
h) 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (120 mg, 0 44 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (171 mg, 0 44 mmol)[prepared according to Preparation 6] and n,n-dnsopropylethylamine (0 39 ml, 2 22 mmol) in Dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (228 mg, 0 49 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(3-chloro-4-
ethyl-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (190 mg, 0 30 mmol, 68 % yield) as a white solid LCMS (ES) m/e 601, 603 (M, M2)+
i) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (190 mg, 0 32 mmol) in tetrahydrofuran (1 58 ml) and methanol (1 58 ml) at 25 °C was added hydrazine (0 08 ml, 2 53 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in Ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (145 mg, 0 26 mmol, 83 % yield) as a yellow solid LCMS (ES) m/z = 471, 473 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 80 (br s , 1 H) 7 87 - 7 99 (m, 6 H) 7 69 (d, J=7 71 Hz, 1H)) 7 57 (d, J=7 83 Hz, 1 H) 7 40 -7 44 (m, 1 H) 4 43 - 4 48 (m, 1 H) 3 74 (s, 3 H) 2 99 - 3 06 (m, 4 H) 2 40 (d, J=7 58 Hz, 2 H) 1 04 (t, J=7 58 Hz, 3 H)
Example 126
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(3-chloro-1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to Example 125, except substituting (1Z)-1-propen-1-ylboronic acid (125 mg, 1 46 mmol) for 2,4,6-tnvinylcycloboroxane-pyndine complex LCMS (ES) m/z = 485, 487 (M, M2)+, 1H NMR (400 MHz, DMSO-Oe) δ ppm 8 94 (d, J=9 09 Hz, 1 H) δ 05 (s, 4 H) 7 98 (s, 1 H) 7 69 (d, J=7 58 Hz, 1 H) 7 55 - 7 63 (m, 1 H) 7 52 (t, J=7 58 Hz, 1 H) 7 42 (t, J=7 33 Hz, 1 H) 4 49 (d, J=4 29 Hz, 1 H) 3 74 (s, 3 H) 2 98 - 3 09 (m, 4 H) 2 37 (q, J=7 07 Hz, 2 H) 1 37 - 1 45 (m, 2 H) 0 80 (t, J=7 33 Hz, 3 H)
Example 127
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
a) methyl 4,5-dibromo-2-furancarboxylate
(Formula Removed)
To a solution of 4,5-dibromo-2-furancarboxylic acid (25 g, 93 mmol) in methanol (185 ml) was added sulfuric acid (24 7 ml, 463 mmol) The resulting solution stirred at 50 °C over 12h The solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification providing methyl 4,5-dibromo-2-furancarboxylate (23 67 g, 83 mmol, 90 % yield), LCMS (ES) m/e 283, 285, 287 (M, M2, M+4)+
b) methyl 4-bromo-2-furancarboxylate
(Formula Removed)
To a solution of methyl 4,5-dibromo-2-furancarboxylate (3 3 g, 11 62 mmol) in tetrahydrofuran (46 ml) at -40 °C was added isopropylmagnesium chloride (6 97 ml, 13 95 mmol) After 1h, Water (11 ml) was added and the solution warmed to 25 °C The reaction mixture was then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified by column chromatography (3% EtOAc in hexanes) affording methyl 4-bromo-2-furancarboxylate (1 4 g, 6 49 mmol, 56 % yield) as a yellow solid LCMS (ES) m/e 205, 207 (M, M2)+
c) methyl 4-bromo-5-chloro-2-furancarboxylate
(Formula Removed)
A solution of methyl 4-bromo-2-furancarboxylate (1 4 g, 6 83 mmol) and NCS (0 912 g, 6 83 mmol) in N,N-dimethylformamide (13 7 ml) was stirred in a sealed tube for 1h at 100 °C After 1h, the solution was partitioned between DCM-H2O and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (2-10% EtOAc in hexanes) affording methyl 4-bromo-5-chloro-2-furancarboxylate (1 348 g, 5 12 mmol, 75 % yield) as a white solid LCMS (ES) m/e 238, 240, 242 (M, M2, M+4)+
d) methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-chloro-2-furancarboxylate (1 1 g, 4 59 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 05 g, 5 05 mmol)[prepared according to Preparation 7], potassium carbonate (3 17 g, 22 97 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 117 g, 0 23 mmol) in 1,4-dioxane (19 14 ml) and water (3 83 ml) was stirred at 80 °C in a sealed tube for 1h The reaction mixture was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried
over Na2SO4, concentrated and purified via column chromatography (silica, 4-25% EtOAc in hexanes) yielding methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (800 mg, 2 53 mmol, 55 % yield) as a yellow oil LCMS m/e ES 240, 242 (M, M2)+
e) 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 25 mmol) in 6N sodium hydroxide (4 16 ml, 24 93 mmol) and tetrahydrofuran (5 4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH -4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (267 mg, 0 59 mmol, 47 % yield) as a white foam LCMS (ES) m/e 265 (M+H)+
f)5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-
furancarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (134 mg, 0 59 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (228 mg, 0 59 mmol)[prepared according to Preparation 6] and N,N-dnsopropylethylamme (0 52 ml, 2 96 mmol) in Dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (304 mg, 0 65 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yllyHP^trifluoromethyl)phenyl]methylJethylH-C-methyl-IH-pyrazol-S-ylly-
furancarboxamide (202 mg, 0 33 mmol, 55 8 % yield) as a yellow oil LCMS (ES) m/e 557, 559 (M, M2)+
g)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2~furancarboxamide
(Formula Removed)
To a solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (202 mg, 0 36 mmol) in tetrahydrofuran (1 8 ml) and methanol (1 8 ml) at 25 °C was added hydrazine (0 08 ml, 2 54 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (2% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 2M HCI in diethyl ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (120 mg, 0 24 mmol, 66 % yield) as a yellow solid LCMS (ES) m/z = 427, 429 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 87 (d, J=9 09 Hz, 1 H) δ 11 (br s , 3 H) 7 66 - 7 73 (m, 2 H) 7 57 (t, J=7 45 Hz, 2 H) 7 53 (d, J=1 52 Hz, 1 H) 7 44 (d, J=6 82 Hz, 1 H) δ 50 (d, J=1 52 Hz, 1 H) 4 43 - 4 51 (m, 1 H) 3 86 (s, 3 H) 2 99 - 3 17 (m, 4H)
Example 128
(Formula Removed)
Preparation of N-((1S)-2-amino-1-f[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
i a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 25 mmol)[prepared according to Example 127] and n-chlorosuccinimide (166 mg, 1 25 mmol) in tetrahydrofuran (6 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (4 1 ml, 24 94 mmol) was added in one portion and the solution stirred an additional 12h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and used directly without further purification yielding 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (232 mg, 0 44 mmol, 36 % yield) as a yellow oil LCMS (ES) m/e 261, 263 (M, M2)+
bJS-chloro^^-chloro-l-methyl-IH-pyrazol-S-ylJ-N-^IS^^I.S-dioxo-I.S-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-furancarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (116 mg, 0 44 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (171 mg, 0 44 mmol)[prepared according to Preparation 6] and n,n-dnsopropylethylamme (0 39 ml, 2 22 mmol) in dichloromethane (4 6 ml) at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (228 mg, 0 49 mmol) in one portion The solution stirred at 25 °C for 1h and was then dry loaded onto silica and punfied via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-furancarboxamide (116 mg, 0 19 mmol, 42 % yield) as a yellow oil LCMS (ES) m/e 591, 593 (M, M2)+
c) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-furancarboxamide (116 mg, 0 20 mmol) in tetrahydrofuran (1 ml) and methanol (1 ml) at 25 °C was added hydrazine (0 04 ml, 1 37 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and purified by column chromatography (2% MeOH in DCM (1 % NH4OH)) The free base was transferred to the HCI salt by addition of excess 2M HCI in Ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (68 mg, 0 13 mmol, 65 % yield) as a yellow solid LCMS (ES) m/z = 461, 463 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 80 (d, J=9 09 Hz, 1 H) δ 03 (br s , 3 H) 7 66 - 7 73 (m, 2 H) 7 58 - 7 61 (m, 1 H) 7 52 - 7 59 (m, 2 H) 7 40 - 7 48 (m, 1 H) 4 5 - 4 57 (m, 1 H) 3 77 (s, 3 H) 2 98 - 3 09 (m, 4 H)
Example 129
(Formula Removed)
Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a yellow solid according to Example 125, except substituting methyl 4-bromo-2-furancarboxylate (5 g, 24 39 mmol) for methyl 4-bromo-2-thiophenecarboxylate LCMS (ES) m/z = 455, 457 (M, M2)+,
1H NMR (400 MHz, DMSO-d) δ ppm 8 75 (d, J=9 09 Hz, 1 H) δ 23 (s, 1 H) δ 05 (br s , 3 H) 7 70 (d, J=7 83 Hz, 1 H) 7 53 - 7 60 (m, 2 H) 7 42=0 - 7 43 (m, 2 H) 4 50 - 4 55 (m, 1 H) 3 74 (s, 3 H) 2 99 - 3 08 (m, 4 H) 2 39 (q, J=7 33 Hz, 2 H) 1 03 (t, J=7 45 Hz, 3 H)
Example 130
(Formula Removed)
Preparation of N-(nS)-2-amino-H-[2-(trifluoromethy0phenyl]methyltethyl)-4-(3-chloro-1.4-dimethyl-1 H-pyrazol-5-vD-2-furancarboxamide
The title compound was prepared as a yellow solid according to Example 125, except substituting trimethylboroxine (0 78 ml, 5 61 mmol) for 2,4,6-trivinylcycloboroxane-pyndine complex and methyl 4-bromo-2-furancarboxylate (5 g, 24 39 mmol) for methyl 4-bromo-2-thiophenecarboxylate LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 71 (d, J=9 35 Hz, 1 H) δ 27 (s, 1 H) δ 01 (br s , 3 H) 7 70 (d, J=7 58 Hz, 1 H) 7 55 (t, J=6 06 Hz, 2 H) 7 40 -7 47 (m, 2 H) 4 50 - 4 57 (m, 1 H) 3 78 (s, 3 H) 2 99 - 3 08 (m, 4 H) 1 98 (s, 3 H)
Example 131
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{r2-(trifluoromethyl]phenyl]methyl)ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide
a) methyl 5-ethenyl-2-furancarboxylate
(Formula Removed)
A solution of methyl 5-bromo-2-furancarboxylate (2 5 g, 12 19 mmol), potassium carbonate (8 43 g, 61 0 mmol), bis(tn-t-butylphosphme)palladium(0) (0 312 g, 0 61 mmol) and 2,4,6-tnvinylcycloboroxane-pyndine complex (1 47 g, 6 10 mmol) in 1,4-dioxane (50 ml) and water (10 ml) was stirred at 80 °C in a sealed tube for 2h The reaction contents were partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-ethenyl-2-furancarboxylate (1 3 g, 7 09 mmol, 58 % yield) as a yellow oil LCMS (ES) m/z = 153 (M+H)+
b) methyl 5-ethyl-2-furancarboxylate
(Formula Removed)
To a solution of methyl 5-ethenyl-2-furancarboxylate (1 3 g, 8 54 mmol) in methanol (15 ml) was added PdOH2 (0 240 g, 1 71 mmol) The reaction mixture was hydrogenated at 1 atm (balloon) for 1h The solution was then purged with N2, filtered through Celite and concentrated affording methyl 5-ethyl-2-furancarboxylate (1 2 g, 7 16 mmol, 84 % yield) as a clear oil which was used without further purification LCMS (ES) m/e 155 (M+H)+
c) methyl 4-bromo-5-ethyl-2-furancarboxylate
(Formula Removed)
To a solution of methyl 5-ethyl-2-furancarboxylate (1 2 g, 7 78 mmol) and aluminum trichloride (1 56 g, 11 68 mmol) in chloroform (15 ml) at 25 °C was added bromine (0 56 ml, 10 90 mmol) The resulting solution stirred at 70 °C in a sealed tube for 2h and the solution was cooled, concentrated and purified via column chromatograpy (silica, 5% EtOAc in hexanes) affording methyl 4-bromo-5-ethyl-2-furancarboxylate (1 1 g, 3 26 mmol, 41 8 % yield) as a white solid, LCMS (ES) m/z = 233, 235 (M, M2)+
d) methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-ethyl-2-furancarboxylate (1 1 g, 4 72 mmol), potassium carbonate (3 26 g, 23 60 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 178 g, 5 66 mmol)[prepared according to Preparation 7] and bis(tn-t-butylphosphine)palladium(0) (0 121 g, 0 24 mmol) were combined in a sealed tube and stirred at 80 °C for 1h LCMS showed 4 1 pdt/sm Additional 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 178 g, 5 66 mmol) and bis(tri-t-butylphosphme)palladium(0) (0 121 g, 0 24 mmol) were added and the solution stirred an additional 2h where crude LCMS showed nearly complete conversion to product The reaction contents were then partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (950 mg, 3 37 mmol, 71 3 % yield) as a yellow oil LCMS (ES) m/e 235 (M+H)+
e) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxylic acid
(Formula Removed)
A solution of methyl 5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (950 mg, 4 06 mmol) and N-chlorosuccinimide (542 mg, 4 06 mmol) in tetrahydrofuran (20 ml) was stirred in a sealed tube for 1h at 70 °C 6N sodium hydroxide (13 5 ml, 81 mmol) was added in one portion and the solution stirred an additional 1h The reaction mixture was then partitioned between H2O-DCM and the pH of the aqueous phase was adjusted to ~4 and washed several times with DCM The combined organic fractions were dried over Na2SC"4, concentrated and used directly without further purification yielding 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-ethyl-2-furancarboxylic acid (683 mg, 2 55 mmol, 62 8 % yield) as a yellow oil LCMS (ES) m/e 254, 256 (M, M2)+
f) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-furancarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxylic acid (145 mg, 0 57 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (219 mg, 0 57 mmol)[prepared according to Preparation 6] and N,N-diisopropylethylamine (0 50 ml, 2 85 mmol) in dichloromethane (4 6 ml) at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (292 mg, 0 63 mmol) in one portion The solution stirred at 25 °C for 1 h and was then dry loaded onto silica and punfied via column chromatography (silica, 30-70% EtOAc in hexanes) yielding 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-furancarboxamide (250 mg, 0 41 mmol, 71 % yield) as a white solid LCMS (ES) m/e 585, 587 (M, M2)+
g) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-
1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide
(Formula Removed)
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-2-furancarboxamide (250 mg, 0 43 mmol) in tetrahydrofuran (1 8 ml) and methanol (1 8 ml) at 25 °C was added hydrazine (0 13 ml, 4 27 mmol) dropwise After 12h the solution was concentrated, dry loaded onto silica and punfied by column chromatography (2% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 2M HCI in Ether (2 ml) to the residue in DCM (2 ml) affording the HCI salt of N-((1S)-2-amino-1-[[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-
2-furancarboxamide (166 mg, 0 30 mmol, 70 % yield) as a yellow solid LCMS (ES) m/z = 455, 457 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 59 (br s , 1 H) δ 06 (br s , 3 H) 7 67 (s, 1 H) 7 70 (d, J=7 83 Hz, 1 H) 7 59 (d, J=4 29 Hz, 2 H) 7 44 (d, J=4 04 Hz, 1 H) 7 31 (d, J=5 81 Hz, 1 H) 4 50 - 4 57 (m, 1 H) 3 72 (s, 3 H) 2 99 -3 12 (m, 4 H) 2 63 (q, J=7 33 Hz, 2 H) 1 21 (t, J=7 45 Hz, 3 H)
Example 132
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(4-fluorophenvhmethyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide
The title compound was prepared as a yellow solid according to Example 131, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (170 mg, 0 57 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 405, 407(M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 56 (d, J=8 59 Hz, 1 H) δ 09 (br s , 3 H) 7 67 (s, 1 H) 7 33 (s, 1 H) 7 31 (dd, J=8 34, 5 81 Hz, 2 H) 7 12 (t, J=8 72 Hz, 2 H) 4 36 - 4 39 (m, 1 H) 3 71 (s, 3 H) 2 91 - 3 03 (m, 4 H) 2 62 (q, J=7 58 Hz, 2 H) 1 20 (t, J=7 45 Hz, 3 H)
Example 133
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamtde
The title compound was prepared as a yellow solid according to Example 131, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (170 mg, 0 57 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 405, 407 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 62 (d, J=8 59 Hz, 1 H) δ 13 (br s , 3 H) 7 67 (s, 1 H) 7 30 - 7 37 (m, 2 H) 7 12 (d, J=6 32 Hz, 2 H) 7 04 (t, J=8 59 Hz, 1 H) 4 40 - 4 47 (m, 1 H) 3 71 (s, 3 H) 2 95 - 3 09 (m, 4 H) 2 62 (q, J=7 07 Hz, 2 H) 1 20 (t, J=7 33 Hz, 3 H)
Example 134
(Formula Removed)
Preparation of NM(1S)-2-amino-14(3-fluorophenv0methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white foam according to the procedure of Example 127, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (295 mg, 0 88 mmol)[prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 377, 379 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 87 (d, J=8 84 Hz, 1 H) δ 16 (br s , 3 H) 7 70 - 7 77 (m, 1 H) 7 53 (d, J=1 77 Hz, 1 H) 7 32 (t, J=7 20 Hz, 1 H) 7 09 - 7 14 (m, 1 H) 7 11 (d, J=6 57 Hz, 2 H) 7 04 (t, J=8 59 Hz, 1 H) δ 49 (d, J=1 77 Hz, 1 H) 4 41 - 4 44 (m, 1 H) 3 86 (s, 3 H) 2 95 - 3 00 (m, 4 H)
Example 135
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white foam according to the procedure of Example 127, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (295 mg, 0 88 mmol)[prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 377, 379 (M, M2)+, 1H NMR (400 MHz, DMSO-d) δ ppm 8 80 (d, J=8 84 Hz, 1 H) δ 11 (br s , 3 H) 7 71 (s, 1 H) 7 53 (d, J=1 77 Hz, 1 H) 7 29 (dd, J=8 59, 5 56 Hz, 2 H) 7 12 (t, J=8 84 Hz, 2 H) δ 49 (d, J=1 77 Hz, 1 H) 4 32 - 4 38 (m, 1 H) 3 86 (s, 3 H) 2 99-3 01 (m, 4 H)
Example 136
(Formula Removed)
Preparation of N-((1S)-2-amino-Hf3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white foam according to the procedure of Example 127, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (340 mg, 0 88 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LCMS (ES) m/z = 427, 429 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 83 (d, J=8 84 Hz, 1 H) δ 11 (br s , 3 H) 7 62 - 7 69 (m, 2 H) 7 51 - 7 59 (m, 4 H) δ 48 (d, J=1 77 Hz, 1 H) 4 39 - 4 44 (m, 1 H) 3 85 (s, 3 H) 2 97 - 3 05 (m, 4 H)
Example 137
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white foam according to the procedure of Example 128, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (321 mg, 0 96 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 411, 413 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 77 (d, J=8 84 Hz, 1 H) δ 04 (br s , 3 H) 7 72 (s, 1 H) 7 59 (s, 1 H) 7 30 - 7 38 (m, 1 H) 7 11 (d, J=7 58 Hz, 2 H) 7 05 (t, J=8 59 Hz, 1 H) 4 39 - 4 43 (m, 1 H) 3 77 (s, 3 H) 2 97 - 3 03 (m, 4 H)
Example 138
(Formula Removed)
Preparation of N-((1S)-2-amino-H[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white foam according to the procedure of Example 128, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (221 mg, 0 58 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 461, 463 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 83 (d, J=8 84 Hz, 1 H)
8 10 (br s , 3 H) 7 72 (s, 1 H) 7 64 (s, 1 H) 7 52 - 7 60 (m, 4 H) 4 39 - 4 41 (m, 1 H) 3 76 (s, 3 H) 2 98 - 3 05 (m, 4 H)
Example 139
(Formula Removed)
Preparation of N-{(1 S^-amino-H-[2-fluorophenvhmethyl]ethyl]-S-chloro-chloro-l-methyl-IH-pyrazol-S-yl)^-furancarboxamide
The title compound was prepared as a white foam according to the procedure of Example 128, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (256 mg, 0 77 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 411, 413 (M, M2)+, 1H NMR (400 MHz, DMSO-c/6) δ ppm 8 78 (d, J=8 59 Hz, 1 H) δ 06 (br s , 3 H) 7 72 (s, 1 H) 7 60 (s, 1 H) 7 30 (dd, J=8 59, 5 56 Hz, 2 H) 7 13 (t, J=8 84 Hz, 2 H) 4 35 - 4 42 (m, 1 H) 3 77 (s, 3 H) 2 99 (br s , 2 H) 2 86 - 2 93 (m, 2 H)
Example 140
(Formula Removed)
Preparation of N-l(1S)-2-amino-1-[(3-fluorophenv0methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 02 g, 4 59 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-
pyrazole and 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (132 mg, 0 39 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 391, 393 (M, M2)+ , 1H NMR (400 MHz, DMSO-d) δ ppm 8 75 (d, J=8 84 Hz, 1 H) δ 04 (br s , 3 H) 7 55 (s, 1 H) 7 37 (s, 1 H) 7 30 - 7 36 (m, 1 H) 7 11-7 15 (m, 2 H) 7 05-7 10 (m, 1 H)4 42(br s, 1 H) 3 70 (s, 3 H) 2 97 (br s,2 H) 2 92 - 2 96 (m, 2 H) 1 94 (s, 3 H)
Example 141
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-[(4-fluorophenv0methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 06 g, 13 78 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole and 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (174 mg, 0 52 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 391, 393 (M, M2)+ , 1H NMR (400 MHz, DMSO-d) δ ppm 8 81 (d, J=8 59 Hz, 1 H) δ 14 (br s , 3 H) 7 59 (s, 1 H) 7 37 (s, 1 H) 7 30 (dd, J=8 59, 5 56 Hz, 2 H) 7 12 (t, J=8 84 Hz, 2 H) 4 32 - 4 38 (m, 1 H) 3 70 (s, 3 H) 2 98 (d, J=5 81 Hz, 2 H) 2 91 (d, J=6 32 Hz, 2 H) 1 94 (s, 3 H)
Example 142
Preparation of N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl]ethyl)-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 06 g, 13 78 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole and 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (200 mg, 0 52 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 83 (br s , 1 H) δ 15 (br s , 2 H) 7 63 (br s , 1 H) 7 52 - 7 58 (m, 4 H) 7 37 (s, 1 H) 4 38 - 4 42 (m, 1 H) 3 68 (s, 3 H) 2 97 - 3 08 (m, 4 H) 1 93 (s, 3 H)
Example 143
(Formula Removed)
Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl)phenyl]methyl)ethyl)-5-chloro-4-(1.4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 127, except substituting 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 06 g, 13 78 mmol)[prepared according to Preparation 17] for 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-
1,3(2H)-dione (200 mg, 0 52 mmol) [prepared according the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LCMS (ES) m/z = 441, 443 (M, M2)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 8 87 (d, J=9 35 Hz, 1 H) δ 11 (br s , 3 H) 7 70 (d, J=7 83 Hz, 1 H) 7 52 - 7 57 (m, 3 H) 7 41 - 7 47 (m, 1 H) 7 38 (s, 1 H) 4 39 - 4 43 (m, 1 H) 3 71 (s, 3 H) 2 98 - 3 09 (m, 4 H) 1 95 (s, 3 H)
Example 144
(Formula Removed)
Preparation of N-((1 S>2-amino-1-{r2-(trifluoromethyl)phenyl]methyltethyl)-4-bromo-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 4,5-dibromo-2-thiophenecarboxylic acid (3 30 g, 11 54 mmol) in dioxane/H20 (4 1, 100 mL) was added K2CO3 (5 5 g, 40 0 mmol), tetrakispriphenylphosphine Pd(0) (671 mg, 0 58 mmol) and 5-(5,5-dimethyl-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (2 66 g, 13 71 mmol) The reaction mixture was heated to 80 °C in a sealed tube for 12 hours The reaction mixture was partitioned between H20 and CHCI3 The pH of the aqueous phase was adjusted to ~3 with 6N HCI and washed several times with CHCI3 The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (3 3 g, quant) LC-MS (ES) m/z = 289 (M+H)+
b) 4-bromo-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
N-chlorosuccinimide (NCS) (299 mg, 2 194 mmol) was added in portions to a 30 mL sealed tube reactor containing 4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (503 mg, 1 23 mmol) in tetrahydrofuran (THF) (6 mL) at room temperature The mixture was heated to 70 °C for 2 hours Upon completion, the reaction mixture was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4, solvents removed by vacuum distillation affording the title compound (0 54 mg, quant) which was used without further punfication LC-MS (ES) m/z = 321 (M+H)+
c) 4-bromo-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-/v-((1 S>-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-bromo-5-(4-chlorc-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (224 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (201 mg, 0 52 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (295 mg, 0 63 mmol) in chloroform (4 mL) DIEA (0 46 mL, 2 63 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (hexanes/EtOAc) affording the title compound (153 mg, 43%) LC-MS (ES) m/z = 651 (M+H)+
d) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-chloro-
1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-bromo-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (153 mg, 0 223 mmol) in tetrahydrofuran (THF) (2 5 mL) and Methanol (0 5 mL) Hydrazine (50 uL, 1 59 mmol) was added and the mixture stirred overnight at room temperature Upon completion, the mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (68 mg, 0 11 mmol, 48 7 % yield) LC-MS (ES) m/z = 523 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 02 - 3 14 (m, 4 H) 3 73 (s, 3 H) 4 50 (s, 1 H) 7 40 - 7 48 (m, 1 H) 7 56 - 7 64 (m, 2 H) 7 71 (d, J=7 83 Hz, 1 H) 7 77 (s, 1 H) δ 14 (s, 3 H) δ 21 (s, 1 H) 9 24 (d, J=9 09 Hz, 1 H)
Example 145
(Formula Removed)
Preparation of N-((1S)-2-amino-1-ir2-(trifluoromethy0phenyl]methyl}ethylM-bromo-5-(4-bromo-1 -methyl-1 A7-pyrazol-5-yl)-2-thiophenecarboxamide
a)4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
The title compound was prepared according to the procedure of Example 144 except substituting N-bromosuccinimide (NBS) (287 mg, 1 596 mmol) for NCS LC-MS (ES) m/z = 364 (M+H)+
b) 4-bromo-5-(4-bromo-1-methyl-1 W-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (238 mg, 0 52 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (209 mg, 0 54 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (293 mg,
0 63 mmol) in chloroform (4 mL) DIEA (0 46 mL, 2 62 mmol) was added and the
mixture stirred overnight at room temperature The reaction mixture was adsorbed
onto silica and purified via column chromatography (silica) (3 1 hex/EtOAc)
affording the title compound (229 mg, 60%) LC-MS (ES) m/z = 695 (M+H)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-bromo-
1 -methyl-1 H-pyrazol-5-yl )-2-th lophenecarboxa mide
To a 50 mL round-bottomed flask was added 4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (229 mg, 0 312 mmol) in Tetrahydrofuran (THF) (2 5 mL) and methanol (0 5 mL) Hydrazine (60 uL, 1 91 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica gel and purified by column chromatography (90 10 1 CHCI3/MeOH/NH4OH, 12g column)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 (500 mL) and concentrated affording the HCI salt of the title compound(104 mg, 0 15 mmol, 49 % yield) LC-MS (ES) m/z = 567 (M+H)+, 1H NMR (400 MHz, DMSO-c/6) δ ppm 3 10 (s, 4 H) 3 74 (s, 3 H) 4 50 (s, 1 H) 7 45 (ddd,
J=7 96, 4 17, 4 04 Hz, 1 H) 7 60 (d, J=4 04 Hz, 2 H) 7 71 (d, J=7 58 Hz, 1 H) 7 76 (s, 1 H) δ 11 (s, 3 H) δ 19 (s, 1 H) 9 19 (d, J=8 84 Hz, 1 H)
Example 146
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl|-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 4-bromo-2-thiophenecarboxylic acid (3 91 g, 18 9 mmol) in dioxane/H20 (4 1, 100 mL) was added Cs2CO3 (21 7 g, 66 6 mmol), tetrakispriphenylphosphine Pd(0) (1 1 g, 0 95 mmol) and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (3 94 g, 18 94 mmol) [prepared according to the procedure of Preparation 7] The reaction mixture was heated to 85 °C in a sealed tube for 12 hours and partitioned between H20 and CHCI3 The pH of the aqueous phase was adjusted to ~3 with 6N HCI and washed several times with CHCI3 The combined organic fractions were dried (Na2SO4), concentrated under vacuum and used directly without further purification (2 84 g, 13 64 mmol, 72%) LC-MS (ES) m/z = 209 (M+H)+
b) N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)methylJethyl}-4-(1-methyl-1^/-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (183 mg, 0 88 mmol), 2-[(2S)-2-amino-3-(3,4-dichlorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (0 3 g, 0 85 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3,4-difluoro-L-phenylalanine (2 03 g, 6 74 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (528 mg, 113 mmol) in chloroform (5 mL) DIEA (0 77 mL, 4 41 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and punfied via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (149 mg, 30%) LC-MS (ES) m/z = 507 (M+H)+
c) N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-0 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (149 mg, 0 265 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (60 uL, 1 91 mmol) was added and the mixture stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (71 mg, 0 15 mmol, 57 % yield) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (400 MHz, DMSO-c/e) δ ppm 2 96 (d, J=6 06 Hz, 2 H) 3 00 - 3 06 (m, 2 H) 3 97 (s, 3 H) 4 33 -4 42 (m, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 14 (s, 1 H) 7 30 - 7 42 (m, 2 H) 7 47 (d,
J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 22 (s, 3 H) δ 35 (d, J=1 26 Hz, 1 H) 9 09 (d, J=8 59 Hz, 1 H)
Example 147
(Formula Removed)
Preparation of N-iC\S)-2-amino-1-[(3,4-dichlorophenyl)methyl]ethyl)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) N-{(1S)-2-(3,4-dichlorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (160 mg, 0 62 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(3,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (0 26 g, 0 67 mmol) [prepared according to the procedure of Preparation 6 except substituting 3,4-dichloro-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-phenylalanine (2 03 g, 6 07 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (376 mg, 0 80 mmol) in chloroform (4 mL) DIEA (0 55 mL, 3 15 mmol) was added and
the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (149 mg, 30%) LC-MS (ES) m/z = 539 (M+H)+
b) N-{(1S)-2-amino-1 -[(3,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(3,4-dichlorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (211 mg, 0 34 mmol) in Tetrahydrofuran (THF) (4 5 mL) and Methanol (0 45 mL) Hydrazine (75 uL, 2 390 mmol) was added and the mixture stirred overnight at room temperature Upon completion the mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (83 mg, 0 16 mmol, 48 % yield) LC-MS (ES) m/z = 411 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 95 - 3 07 (m, 4 H) 3 97 (s, 3 H) 4 32 - 4 43 (m, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 29 (dd, J=8 21, 1 89 Hz, 1 H) 7 47 (d, J=2 02 Hz, 1 H) 7 54 (d, J=8 08 Hz, 1 H) 7 60 (d, J=1 77 Hz, 1 H) δ 00 (d, J=1 26 Hz, 1 H) δ 22 (s, 3 H) δ 35 (d, J=1 01 Hz, 1 H) 9 11 (d, J=8 59 Hz, 1 H)
Example 148

(Formula Removed)
Preparation of N-iH S)-2-amino-1-rf2.6-difluorophenyl]methyl]ethyl)-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) ^-{(IS^^.e-difluorophenylJ-l-KI.S-dioxo-l.a-dihydro^H-isoindolly-
yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (160 mg, 0 62 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(2,6-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (231 mg, 0 69 mmol) [prepared according to the procedure of Preparation 18] and PyBrop (353 mg, 0 75 mmol) in chloroform (8 mL) DIEA (0 64 mL, 3 66 mmol) was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and purified via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (149 mg, 0 21 mmol, 30%) LC-MS (ES) m/z = 507 (M+H)+
b) N-{(1S)-2-amino-1 -[(2,6-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-
yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,6-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (168 mg, 0 32 mmol) in Tetrahydrofuran (THF) (3 6 mL) and Methanol (0 4 mL) Hydrazine (70 uL, 2 23 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (101 mg, 0 214 mmol, 68%) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (400 MHz, DMSO-
d6) δ ppm 2 92 - 3 03 (m, 3 H) 3 17 (m, 1 H) 3 97 (s, 3 H) 4 46 (m, 1 H) δ 47 (d, J=1 77 Hz, 1 H) 7 05 (t, J=7 83 Hz, 2 H) 7 27 - 7 38 (m, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 26 Hz, 1 H) δ 23 (d, J=1 26 Hz, 4 H) δ 92 (d, J=8 59 Hz, 1 H)
Example 149
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2.5-difluorophenyl]methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (257 mg, 0 93 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (476 mg, 0 81 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanme (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (535 mg, 1 14 mmol) in Chloroform (15 mL) DIEA (0 808 mL, 4 63 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and
purified via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (225 mg, 34%) LC-MS (ES) m/z = 507 (M+H)+
b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (225 mg, 0 31 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (0 8 mL) Hydrazine (60 uL, 1 91 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH) The compound was further punfied on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCl3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (90 5 mg, 0 19 mmol, 63%) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 95 - 3 01 (m, 2 H) 3 03 - 3 10 (m, 2 H) 3 92 - 3 98 (m, 3 H) 4 41 - 4 51 (m, 1 H) δ 47 (d, J=1 77 Hz, 1 H) 7 05 - 7 13 (m, 1 H) 7 20 (td, J=9 09, 4 55 Hz, 1 H) 7 27 (ddd, J=9 09, 5 81, 3 28 Hz, 1 H) 7 47 (d, J=1 77 Hz, 1 H) 7 99 (d, J=1 52 Hz, 1 H) δ 18 (s, 3 H) δ 29 (d, J=1 26 Hz, 1 H) 9 03 (d, J=8 84 Hz, 1 H)
Example 150
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2,4-difluorophenyl)methyl]ethyl)--4-(1 -methyl-1 H-pyrazol-5-yl)-2-trnophenecarboxamide
a) N-{(1 S>-2-(2,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (222 mg, 0 80 mmol) [prepared according to the procedure of Example 146], 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (331 mg, 0 78 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (1 0 g, 4 97 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (448 mg, 0 96 mmol) in chloroform (10 mL) DIEA (700 uL, 4 01 mmol) was added and the reaction stirred overnight at room temperature The reaction mixture was adsorbed onto silica and punfied via column chromatography (25 - 75% EtOAc/Hex) affording the title compound (249 mg, 0 36 mmol, 46%) LC-MS (ES) m/z = 507 (M+H)+
b) N-{(1S)-2-amino-1 -[(2,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-
yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (249 mg, 0 36 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (1 mL) Hydrazine (80 uL, 2 55 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/NH^OH) The compound was further punfied on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (81 mg, 0 18 mmol, 50%) LC-MS (ES) m/z = 377 (M+H)+, 1H NMR Example 151
(Formula Removed)
Preparation of N-((^ S)-2-amino-1-(f3-(trifluoromethyl)phenyl]methyltethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxarnide
a) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a 125 mL sealed flask was added methyl 4-bromo-5-methyl-2-thiophenecarboxylate (1 56 g, 6 64 mmol) [Prepared according to the procedure of Preparation 10], 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 67 g, 8 03 mmol) [prepared according to the procedure of Preparation 7], K2CO3 (2 76 g, 19 97 mmol) and Pd(PtBu3)2 (170 mg, 0 33 mmol) in 1,4-Dioxane (27 ml) and water (7 ml) The reaction mixture was heated to 85 °C in a sealed tube for 3 hours, cooled to room temperature and partitioned between H20 and CHCl3 The organic fraction was dried (Na2SO4), adsorbed onto silica and purified via
column chromatography (0-15%EtOAc/Hexane) (385 mg, 1 4 mmol, 30%) LC-MS (ES) m/z = 237 (M+H)+
b) 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a 100 mL round-bottomed flask was added methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 34 g, 5 67 mmol) in Tetrahydrofuran (THF) (31 ml) 6N NaOH (31 ml, 186 mmol) was added and the reaction mixture stirred at 70 °C overnight The reaction mixture was neutralized by slow addition of 6N HCI and partitioned between CHCI3 and H2O The layers were separated, the organic layer dried with Na2SO4 and solvent removed The resulting solid was used without further purification (0 71 g, 2 81 mmol, 96%) LC-MS (ES) m/z = 223 (M+H)+
c) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-
(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (201 mg, 0 91 mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (301 mg, 0 87 mmol) [Prepared according to Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 14 95 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalan!ne] and PyBrop (519 mg, 1 11 mmol) in chloroform (9 mL) DIEA (790 uL, 4 52 mmol)
was added and the mixture stirred overnight at room temperature The reaction mixture was adsorbed onto silica and punfied via column chromatography (25 -70% EtOAc/Hex) affording the title compound (247 mg, 45%) LC-MS (ES) m/z = 553 (M+H)+
d)/S/-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (374 mg, 0 64 mmol) in Tetrahydrofuran (THF) (6 mL) and Methanol (600 uL) Hydrazine (125 uL, 3 98 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (135 mg, 0 27 mmol, 42 % yield) LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (400 MHz, DMSO-c/e) δ ppm 2 37 (s, 3 H) 2 95 - 3 11 (m, 4 H) 3 78 (s, 3 H) 4 32 - 4 42 (m, 1 H) δ 34 (d, J=1 77 Hz, 1 H) 7 48 - 7 56 (m, 3 H) 7 58 - 7 61 (m, 1 H) 7 67 (s, 1 H) δ 04 (s, 1 H) δ 21 (s, 3 H) δ 98 (d, J=8 59 Hz, 1 H)
Example 152
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-
fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyra2ol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (201 mg, 0 91 mmol) [prepared according to the procedure of Example 95], 2-{(2S)-2-amino-3-[3-
(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (301 mg, 0 87 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (519 mg, 1 11 mmol) in Chloroform (9 mL) DIEA (790 uL, 4 52 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (186 mg, 32%) LC-MS (ES) m/z = 553 (M+H)+
b) N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-
pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -[(4-fluorophenyl)methyl]ethylH-0 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (185 mg, 0 34 mmol) in Tetrahydrofuran (THF) (10 mL) and Methanol (1 mL) Hydrazine (63 uL, 2 0 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (101 mg, 0 24 mmol, 72%) LC-MS (ES) m/z = 393 (M+H)+, 1H NMR (400 MHz, DMSO-
of6) δ ppm 2 90 - 3 1 (m, 4 H) 3 85 (s, 3 H) 4 33 (s, 1 H) δ 48 (d, J=1 77 Hz, 1 H)
7 10 (t, J=8 84 Hz, 2 H) 7 32 (dd, J=8 46, 5 68 Hz, 2 H) 7 55 (d, J=2 02 Hz, 1 H)
8 19 (s, 3 H) δ 23 - 8 28 (m, 1 H) 9 25 (d, J=8 59 Hz, 1 H)
Example 153
(Formula Removed)
Preparation of N-((1S)-2-amino-1-lf3-(trifluoromethyl)phenyl]methyl)ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (226 mg, 0 93 mmol) [prepared according to the procedure of Example 95], 2-{(2S)-2-amino-3-[3-
(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (519 mg, 1 349 mmol) [prepared according to Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop
' (515 mg, 1 1 mmol) in chloroform (10 mL) DIEA (820 uL, 4 70 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (379 mg, 69%) LC-MS (ES) m/z = 573 (M+H)+
b) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 5-chloro-N-((1S)-2-(1,3-dioxo-
1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-fnetny|-1H-pyrazol-5-yl)-2-thiophenecarboxamide (378 mg, 0 64 mmol) in Tetrahydrofuran (THF) (10 mL) and Methanol (1 mL) Hydrazine (122 uL, 3 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (222 mg, 0 41 mmol, 64%) LC-MS (ES) m/z = 443 (M+H)\ 1H NMR (400 MHz, DMSO-cfe) δ ppm 3 05 (d, J=6 82 Hz, 4 H) 3 84 (s, 3 H) 4.37 (d, J=5 05 Hz, 1 H) δ 46 (d, J=1 77 Hz, 1 H) 7 49 - 7 57 (m, 3 H) 7 58 - 7 61 (m, 1 H) 7 67 (s, 1 H) δ 20 (s, 3 H) δ 24 (s, 1 H) 9 31 (d, J=8 84 Hz, 1 H)
Example 154
(Formula Removed)
reparation of /SM(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-5-methyl-4-(1 -methyl-1/Y-pyrazol-5-yl)-2-thiophenecarboxarmde
a) N-{(1 S>2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-
fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (200 mg, 0 90 mmol) [Prepared according to the procedure of Example 151], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (288 mg, 0 86 mmol) [Prepared according to Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (512 mg, 1 09 mmol) in Chloroform (9 mL) DIEA (790 uL, 4 52 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 -70% EtOAc/Hex) affording the title compound (162 mg, 32%) LC-MS (ES) m/z = 503 (M+H)+
b)N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(4-fluorophenyl)methyl]ethyl}-5-rnethyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (162 mg, 0 29 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (300 uL) Hydrazine (58 uL, 1 85 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The compound was further purified on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (222 mg, 0 41 mmol, 64%) LC-MS (ES) m/z = 373 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 2 38 (s, 3 H) 2 89 - 3 02 (m, 4 H) 3 79 (s, 3 H) 4 26 - 4 48 (m, 1 H) δ 36 (d, J=1 77 Hz, 1 H) 7 10 (t, J=8 72 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 52 (d, J=1 77 Hz, 1 H) δ 02 (s, 1 H) δ 17 (s, 3 H) δ 88 (d, J=8 59 Hz, 1 H)
Example 155
(Formula Removed)
eparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-
fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (200 mg, 0 90 mmol) [Prepared according to the procedure of Example 151], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-
- isomdole-1,3(2H)-dione (291 mg, 0 87 mmol) [Prepared according to the procedure of preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenyla!anine] and PyBrop (512 mg, 1 09 mmol) in Chloroform (9 mL) DIEA (790 uL, 4 52 mmol) was added and the mixture stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (250 mg, 50%) LC-MS (ES) m/z = 503 (M+H)+
b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (250 mg, 0 45 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (400 uL) Hydrazine (66 uL, 2 10 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHC^/MeOH/Nh^OH) The compound was further punfied on reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) affording the TFA salt which was neutralized on silica (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (142 mg, 0 31 mmol, 70%) LC-MS (ES) m/z = 373 (M+Hf, 1H NMR (400 MHz, DMSO-d8) δ ppm 2 38 (s, 3 H) 2 92 - 3 04 (m, 4 H) 3 79 (s, 3 H) 4 30 -4 43 (m, 1 H) δ 36 (d, J=1 77 Hz, 1 H) 7 02 (td, J=8 53, 2 15 Hz, 1 H) 7 13 (t, J=7 83 Hz, 2 H) 7 26 - 7 35 (m, 1 H) 7 52 (d, J=2 02 Hz, 1 H) δ 04 (s, 1 H) δ 19 (s, 3 H) δ 93 (d, J=8 34 Hz, 1 H)
Example 156
(Formula Removed)
reparation of N-((1S)-2-amino-1-{[2-(trifluoromethylbhenyllmethyl)ethyl)-4-(4-cycloDropyl-1-rnethyl-1H-pyrazol-5-yl)-2-tr>tophenecarboxamicle
a) methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
BS (747 mg, 4 20 mmol) was added in portions to a 50 mi_ sealed tube reactor containing methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (860 mg, 3 48 mmol) [prepared according to the procedure of Example 37] in Tetrahydrofuran (THF) (17 mL) at room temperature The mixture was heated to 70 °C for 1 5 hours, cooled to room temperature and partitioned between CHCI3 and H2O The organic layer was dned with is^SC^, adsorbed onto silica and purified via column chromatography (20 - 40% EtOAc / hexanes) affording the title compound (867 mg, 83%) LC-MS (ES) m/z = 303 (M+H)+
b) methyl 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
o a 20 mL sealed tube reactor was added methyl 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (505 mg, 1 68 mmol), cyclopropylboronic acid (447 mg, 5 20 mmol), Cesium Carbonate (1 90 g, 5 84 mmol) and PdCI2(dppf)-CH2CI2Adduct (43 6 mg, 0 05 mmol) in Tetrahydrofuran (THF) (8 5 mL) The
( reaction was heated to 70 °C for 1 5 hours, cooled and partitioned between CHCI3 and H20 The organic layer was dned with Na2SO4, adsorbed onto silica and punfied via column chromatography (20 - 40% EtOAc / Hexane) affording the title compound (0 42 g, 1 60 mmol, 95%) LC-MS (ES) m/z = 251 (M+Hf
c) 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
o a 100 mL round-bottomed flask was added methyl 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (0 42 g, 1 60 mmol) in Tetrahydrofuran (THF) (8 ml) 6N NaOH (8 ml, 48 0 mmol) was added slowly and the reaction stirred at 70 °C overnight The reaction was cooled and partitioned between CHCI3 and H2O The pH of the aqueous layer was adjusted to - 3 by the addition of 6N HCI The layers were separated, the organic layer dried with Na2SO4 and solvent removed affording the title compound (0 42 g, 1 60 mmol, 95%) which was used without further purification LC-MS (ES) m/z = 249 (M+H)+
d) 4-(4-cyclopropyl-1 -methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-cyclopropyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (105 mg, 0 42 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (152 mg, 0 39 mmol) [prepared according to Preparation 6] and PyBrop (246 mg, 0 52 mmol) in Chloroform (6 mL) DIEA (370 uL, 2 19 mmol) was added and the mixture stirred overnight at room temperature The mixture was adsorbed onto silica and punfied
via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (171 mg, 66%) LC-MS (ES) m/z = 579 (M+H)+
e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-cyclopropyl-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-cyclopropyl-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (102 mg, 0 18 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (2 mL) Hydrazine (40 uL, 1 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (65 mg, 0 12 mmol, 66 % yield) LC-MS (ES) m/z = 449 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 0 45 - 0 54 (m, 2 H) 0 76 - 0 83 (m, 2 H) 1 62 -1 71 (m, 1 H) 3 03 - 3 21 (m, 4 H) 3 82 (s, 3 H) 4 46 - 4 56 (m, 1 H) 7 21 (s, 1 H) 7 42 (t, J=7 45 Hz, 1 H) 7 53 (t, J=7 45 Hz, 1 H) 7 66 (dd, J=19 96, 7 58 Hz, 2 H) 7 95 (d, J=1 26 Hz, 1 H) δ 18 (s, 3 H) δ 24 (d, J=1 26 Hz, 1 H) 9 11 (d, J=9 09 Hz, 1 H)
Example 157
(Formula Removed)
reparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxarnide
a) methyl 4-(4-ethenyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
o a 5 mL sealed tube reactor was added methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (473 mg, 1 57 mmol) [prepared according to the procedure of Example 156], pyridine - tnethenylboroxine (1 1) (666 mg, 2 77 mmol), Pd(PtBu3)2 (16 8 mg, 0 03 mmol) and Cs2CO3 (1 72 g, 5 28 mmol) in 1,4-Dioxane (6 3 ml.) and water (1 6 mL) The reaction was heated at 70 °C for 2 hours and partitioned between CHCI3 (75 mL) / H2O (75 mL) The organic layer was dried with Na2SO4, adsorbed onto silica and punfied via column chromatography (25-70% EtOAc/Hexane) affording the desired product LC-MS (ES) m/z = 249 (M+H)+
b) methyl 4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
o a 100 mL round-bottomed flask was added methyl 4-(4-ethenyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate and 10% Pd/C in ethyl acetate (15 mL) The mixture was evacuated slightly, refilled with H2 from a balloon and stirred vigorously under an atmosphere of H2 for 1 hour The reaction was filtered through a 0 2 urn PTFE membrane filter and used without further punfication (153 mg, 0 60 mmol, 87%) LC-MS (ES) m/z = 251 (M+H)+
c) 4-(4-ethyl-1-methyl-1 W-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
o a 100 mL round-bottomed flask was added methyl 4-(4-ethyl-1 -methyl-1H-pyrazol-5-yl}-2-thiophenecarboxylate (192 mg, 0 77 mmol) in Tetrahydrofuran (THF) (4 mL) 6N NaOH (4 mL, 24 0 mmol) was added slowly, the reaction stirred at 70 °C overnight The reaction was cooled to room temperature, partitioned between CHCI3 and H20 and the pH of the aqueous layer adjusted to pH 3 by the addition of 6N HCI The layers were separated, the organic layer dried with Na2SO4 and solvent removed affording the title compound (181 mg, quant) used without further purification LC-MS (ES) m/z = 237 (M+H)+
d) A/~((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (106 mg, 0 45 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (164 mg, 0 43 mmol) [prepared according to Preparation 6] and PyBrop (254 mg, 0 54 mmol) in Chloroform (6 mL) DIEA (400 uL, 2 29 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (182 mg, 0 32 mmol, 71%) LC-MS (ES) m/z = 567 (M+H)+
e) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-
1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methy!-1H-pyrazol-5-yl)-2-thiophenecarboxamide (101 mg, 0 18 mmol) in
Tetrahydrofuran (THF) (5 mL) and Methanol (2 mL) Hydrazine (40 uL, 1 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (65 mg, 0 12 mmol, 68%) LC-MS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 10 (t, J=7 45 Hz, 3 H) 2 44 (q, J=7 41 Hz, 2 H) 2 94 - 3 17 (m, 4 H) 3 80 (s, 3 H) 4 41 - 4 57 (m, 1 H) 7 37 - 7 45 (m, 2 H) 7 53 (t, J=7 45 Hz, 1 H) 7 66 (dd, J=19 96, 7 58 Hz, 2 H) 7 88 (d, J=1 01 Hz, 1 H) δ 16 (s, 4 H) 9 10 (d, J=8 84 Hz, 1 H)
Example 158
(Formula Removed)
reparation of N-((1S)-2-amino-H[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid
(Formula Removed)
CS (1 355 g, 10 15 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (2 0 g, 8 46 mmol) [prepared according to the procedure of Preparation 10] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture
was heated to 70 °C for 2h 6N NaOH (28 ml, 168 mmol) was added and the mixture stirred at 70 °C for an additional 2h The mixture was cooled to room temperature and partitioned between CHCI3 and H20 The pH of the aqueous layer was adjusted to ~ 3 by the addition of 6N HCI The aqueous phase was washed several times with DCM and the combined organic fractions were dried with Na2SO4 and concentrated affording the title compound (2 36 g, 9 19 mmol, quant) LC-MS (ES) m/z = 257 (M+H)+
b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-
thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (181 mg, 0 70 mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione (250 mg, 0 65 mmol) [Prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (399 mg, 0 85 mmol) in chloroform (8 mL) DIEA (620 uL, 3 55 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 -70% EtOAc/Hex) affording the title compound (319 mg, 0 50 mmol, 71%) LC-MS (ES) m/z = 587 (M+H)+
c) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-
1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-ch!oro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-H[3-(trifluoromethyl)phenyl}methyl}ethyl)-5-methyl-2-thiophenecarboxamide (319 mg, 0 50 mmol) in Tetrahydrofuran (THF) (4 9 mL) and Methanol (0 5 mL) Hydrazine (119 uL, 3 79 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (204 mg, 0 39 mmol, 79%) LC-MS (ES) m/z = 457 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 33 (s, 3 H) 2 95 - 3 10 (m, 4 H) 3 71 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 49 -7 61 (m, 3 H) 7 66 (s, 1 H) 7 69 (s, 1 H) 7 94 (s, 1 H) δ 16 (s, 3 H) δ 90 (s, 1 H)
Example 159
(Formula Removed)
reparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid
(Formula Removed)
S (1 84 g, 10 33 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (2 g, 8 46 mmol) [prepared according to the procedure of Preparation 10] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture
was heated to 70 °C for 1h 6N NaOH (28 ml, 168 mmol) was then added and the mixture stirred at 70 °C for 2h The mixture was partitioned between CHCI3 and H2O and the aqueous layer was made acidic with 6N HCI The aqueous phase was washed several times with CHCI3 and the organic fractions were combined, dried over Na2SO4 and concentrated affording the title compound (2 68 g, 8 9mmol, quant) LC-MS (ES) m/z = 302 (M+H)+
b) 4-(4-bromo-1 -methyl-1 tf-pyrazol-5-yl)-/v"-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-bromo-1 -methyl- 1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (256 mg, 0 85 mmol), 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (1272 mg, 3 80 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine]and PyBrop (485 mg, 1 03 mmol) in Chloroform (8 5 mL) DIEA (750 uL, 4 29 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (319 mg, 0 50 mmol, 71%) LC-MS (ES) m/z = 583 (M+H)+
c) N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-
pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (133 mg, 0 21 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (50 uL, 1 59
mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (90 mg, 0 17 mmole, 83%) LC-MS (ES) m/z = 453 (M+H)+, 1H NMR (400 MHz, DMSO-de) δ ppm 2 33 (s, 3 H) 2 82 - 3 08 (m, 4 H) 3 72 (s, 3 H) 4 24 - 4 39 (m, 1 H) 7 11 (t, J=8 84 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 69 (s, 1 H) 7 89 (s, 1 H) δ 03 - 8 25 (m, 3 H) δ 73 - 8 90 (m, 1 H)
Example 160
(Formula Removed)
reparation of N-{(1S)-2-amino-1-[(4-fluorophenv0methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (276 mg, 1 08 mmol) [Prepared according to the procedure of Example 158], 2-[(2S)-2-amino-3-(4-
fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (317 mg, 0 95 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (612 mg, 1 31 mmol) in Chloroform (14 mL) DIEA (940 uL, 5 38 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (319 mg, 0 50 mmol, 71%) LC-MS (ES) m/z = 537 (M+H)+
c) AV-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (145 mg, 0 25 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (60 uL, 1 91 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (88 mg, 0 19 mmol, 77%) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-cfe) δ ppm 2 34 (s, 3 H) 2 81 - 3 10 (m, 4 H) 3 72 (s, 3 H) 4 25 - 4 40 (m, 1 H) 7 10 (t, J=8 84 Hz, 2 H) 7 31 (dd, J=8 21, 5 68 Hz, 2 H) 7 69 (s, 1 H) 7 94 (s, 1 H) δ 15 (s, 3 H)8 85(s, 1 H)
Example 161
(Formula Removed)
reparation of N-[(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-f4-chloro-1-methyl-1H-Dvrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-N-{(1 S>-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (187 mg, 0 73 mmol) [prepared according to the procedure of Example 158], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (233 mg, 0 70 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine]and PyBrop (412 mg, 0 88 mmol) in Chloroform (9 mL) DIEA (640 uL, 3 66 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (180 mg, 0 30 mmol, 42%) LC-MS (ES) m/z = 537 (M+H)+
b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-
pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -[(3-fiuorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (186 mg, 0 31 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (76 uL, 2 42 mmol) was added and the reaction starred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (108 mg, 0 231, 74%) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 34 (s, 3 H) 2 91 - 3 03 (m, 4 H) 3 71 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 02 (td, J=8 59, 2 02 Hz, 1 H) 7 13 (t, J=7 07 Hz, 2 H) 7 26 - 7 36 (m, 1 H) 7 69 (s, 1 H) 7 95 (s, 1 H) δ 15 (s, 3 H) δ 88 (d, J=6 32 Hz, 1 H)
Example 162
(Formula Removed)
reparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (191 mg, 0 63 mmol) [prepared according to the procedure of Example 159], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (209 mg, 0 62 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (359 mg, 0 77 mmol) in chloroform (7 mL) DIEA (560 pL, 3 21 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (171 mg, 0 29 mmol, 46%) LC-MS (ES) m/z = 583 (M+H)+
b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (171 mg, 0 29 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (66 uL, 2 10 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified by column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (123 mg, 0 26 mmol, 88%) LC-MS (ES) m/z = 453 (M+H)+, 1H NMR (400 MHz, DMSO-cfe) S ppm 2 33 (s, 3 H) 2 91 - 3 03 (m, 4 H) 3 72 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 02
(td, J=8 46, 2 02 Hz, 1 H) 7 12 (d, J=7 33 Hz, 2 H) 7 27 - 7 35 (m, 1 H) 7 64 - 7 71 (m, 1 H) 7 92 (s, 1 H) δ 14 (s, 3 H) δ 79 - 8 93 (m, 1 H)
Example 163
(Formula Removed)
reparation of N-(( 1 S)-2-amino-Hf3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1I3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[3-(trifiuoromethyl)phenyl]methyl}ethyl)-5-methyl-2-
thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (180 mg, 0 60 mmol) [prepared according to the procedure of Example 159], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (203 mg, 0 58 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (340 mg, 0 72 mmol) in Chloroform (6 mL) DIEA (530 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was
adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (259 mg, 0 41 mmol, 69%) LC-MS (ES) m/z = 633 (M+H)+
b) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide(259 mg, 0 41 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (90 uL, 2 87 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (172 mg, 0 33 mmol, 80%) LC-MS (ES) m/z = 503 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 32 (s, 3 H) 3 03 (d, J=6 06 Hz, 4 H) 3 71 (d, J=5 81 Hz, 3 H) 4 31 - 4 41 (m, 1 H) 7 49 - 7 56 (m, 2 H) 7 60 (d, J=6 82 Hz, 1 H) 7 64 - 7 71 (m, 2 H) 7 93 (d, J=12 88 Hz, 1 H) δ 18 (s, 3 H) δ 88 - 8 99 (m, 1 H)
Example 164
(Formula Removed)
reparation of N-((1S)-2-amino-1-(r3-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) methyl 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate
(Formula Removed)
BS (2 03 g, 11 41 mmol) was added in portions to a 75 mL sealed tube reactor containing methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 1 g, 8 89 mmol) [prepared according to the procedure of Preparation 10] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 70 °C for 1 hour The reaction mixture was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4, the reaction mixture adsorbed onto silica and punfied via column chromatography (15 - 40% EtOAc/Hex) affording the title compound (2 57 g, 8 15 mmol, 92%) LC-MS (ES) m/z = 316(M+H)+
b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate
(Formula Removed)
o a 350 mL sealed flask reactor was added methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (2 57 g, 8 15 mmol), tnmethylboroxine (2 27 ml, 16 31 mmol), K2CO3 (3 47 g, 25 1 mmol) and Pd(dppf)CI2 (426 mg, 0 83 mmol) in N,N-Dimethylformamide (DMF) (41 ml) The reaction was heated at 110 °C for 1 hour The mixture was partitioned between CHCU / H20, organic layer separated and dried with Na2SO4 The resulting material was adsorbed onto silica and purified via column chromatography (0-15% EtOAc/Hexane) affording the title compound (1 3 g, 4 76 mmol, 58%) LC-MS (ES) m/z = 251 (M+H)+
c)4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thtophenecarboxylic acid
(Formula Removed)
o a 100 mL round-bottomed flask was added methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylate (1 31 g, 5 23 mmol) in Tetrahydrofuran (THF) (25 mL) 6N NaOH (30 mL, 180 mmol) was added slowly and the reaction stirred at 70 °C overnight The reaction was cooled to room temperature, partitioned between CHCI3 and H2O and the pH of the aqueous layer adjusted to pH 3 by the addition of 6N HCI The layers were separated, the organic layer was dried with Na2SO4 and the solvent was removed affording the title compound (1 3 g, 5 5 mmol, quant) which was used without further purification LC-MS (ES) m/z = 237 (M+H)+
d) 4-(1,4-dimethyl-1 tf-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (170 mg, 0 68 mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (256 mg, 0 67 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (387 mg, 0 83 mmol) in chloroform (7 mL) DIEA (600 uL, 3 44 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (311 mg, 0 55 mmol, 80%) LC-MS (ES) m/z = 567 (M+H)+
e) ^-((IS^-amino-HfS-^rifluoromethyl)phenylJmethylJethylH^I^-dimethyl-IH-
pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-thiophenecarboxarnide (311 mg, 0 55 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 4 mL) Hydrazine (122 uL, 3 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto siUca gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (234 mg, 0 44 mmol, 79%) LC-MS (ES) m/z = 437 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 87 (s, 3 H) 2 26 (s, 3 H) 3 03 (d, J=6 82 Hz, 4 H) 3 62 (s, 3 H) 4 31 -4 41 (m, 1 H) 7 38 (s, 1 H) 7 49 - 7 56 (m, 2 H) 7 58 - 7 61 (m, 1 H) 7 65 (s, 1 H) 7 87 (s, 1 H) δ 20 (s, 3 H) δ 89 (d, J=8 59 Hz, 1 H)
Example 165
(Formula Removed)
reparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (207 mg, 0 83 mmol) [prepared according to the procedure of Example 164], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (279 mg, 0 83 mmol) [Prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (469 mg, 1 00 mmol) in chloroform (8 mL) DIEA (730 uL, 4 18 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (209 mg, 0 36 mmol, 43%) LC-MS (ES) m/z =517 (M+H)+
b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (201 mg, 0 39 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (86 uL, 2 74 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (163 mg, 0 34 mmol, 87%) LC-MS (ES) m/z = 387 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 88 (s, 3 H) 2 27 (s, 3 H) 2 87 - 3 09 (m, 4 H) 3 17 3 63 (s, 3 H) 4 28 -
4 45 (m, 1 H) δ 97 - 7 06 (m, 1 H) 7 13 (t, J=7 20 Hz, 2 H) 7 27 - 7 35 (m, 1 H) 7 38 (s, 1 H) 7 89 (s, 1 H) δ 20 (s, 3 H) δ 88 (d, J=7 58 Hz, 1 H)
Example 166
(Formula Removed)
reparation of N-{(1S)2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (253 mg, 1 02 mmol) [prepared according to the procedure of Example 164], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (335 mg, 1 00 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dirnethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (574 mg, 1 23 mmol) in chloroform (10 mL) DIEA (930 uL, 5 32 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (132 mg, 0 25 mmol, 24%) LC-MS (ES) m/z = 517 (M+H)+
b) N-{(1 S>2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (132 mg, 0 26 mmol) in Tetrahydrofuran (THF) (2 mL) and Methanol (1 mL) Hydrazine (57 uL, 1 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (95 5 0 5 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (104 mg, 0 22 mmol, 84%) LC-MS (ES) m/z = 387 (M+Hf, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 88 (s, 3 H) 2 27 (s, 3 H) 2 84 - 3 11 (m, 4 H) 3 63 (s, 3 H) 4 24 - 4 39 (m, 1 H) 7 10 (t, J=8 72 Hz, 2 H) 7 31 (dd, J=8 21, 5 68 Hz, 2 H) 7 38 (s, 1 H) 7 87 (s, 1 H)8 18(s, 3H)8 83(s, 1 H)
Example 167
(Formula Removed)
reparation of /vW(1S)-2-amino-1-[(3-fluorophenv0methyflethylM-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thioprienecarboxarnide
a) 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid
(Formula Removed)
BS (1 243 g, 6 98 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 47 g, 5 73 mmol) [Prepared according to the procedure of Example 151] in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 70 °C for 1h 6N NaOH (20 ml, 120 mmol) was then added and the mixture stirred at 70 °C for an additional 2h The mixture was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4 and concentrated affording the title compound which was used without further purification (385 mg, 1 4 mmol, 30%) LC-MS (ES) m/z = 302 (M+H)+
b) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1>3-dioxo-1,3-dihydro-2H-isoindol-2-yi)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 4-(4-bromo-1 -methyl- 1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (204 mg, 0 60 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (215 mg, 0 64 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 7 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (380 mg, 0 81 mmol) in chloroform (6 mL) DIEA (570 uL, 3 26 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (247 mg, 45%) LC-MS (ES) m/z = 603 (M+H)+
c)N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (133 mg, 0 22 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 2 mL) Hydrazine (50 uL, 1 59 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (145 mg, 0 30 mmol, 66 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 91 - 3 03 (m, 4 H) 3 77 (s, 3 H) 4 30 - 4 41 (m, 1 H) 7 04 (td, J=8 53, 2 15 Hz, 1 H) 7 12 (d, J=7 07 Hz, 2 H) 7 28 - 7 36 (m, 1 H) 7 74 (s, 1 H) δ 02-8 14 (m, 4H)9 06(s, 1 H)
Example 168
(Formula Removed)
reparation of N-((1S)-2-amino-1-{[3-(trifluoromethyltohenyl]methyltethyiy5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-
2W-isomdol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-
thiophenecarboxamide
(Formula Removed)
o a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (264 mg, 0 95 mmol) [prepared according to the procedure of Example 96], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (306 mg, 0 80 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (450 mg, 0 96 mmol) in chloroform (7 mL) DIEA (660 pi, 3 78 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (303 mg, 0 44 mmol, 56%) LC-MS (ES) m/z = 607 (M+H)+
b) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl )-2-th lophenecarboxa mide
To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (303 mg, 0 50 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 5 mL) Hydrazine (120 uL, 3 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (177 mg, 0 31 mmol, 61 % yield) LC-MS (ES) m/z = 479 (M+H)+, 1H NMR (400 MHz,
DMSO-d6) δ ppm 2 97 - 3 08 (m, 4 H) 3 76 (s, 3 H) 4 28 - 4 44 (m, 1 H) 7 50 - 7 61 (m, 3 H) 7 66 (s, 1 H) 7 71 - 7 75 (m, 1 H) δ 10 (s, 4 H) 9 16 (d, J=8 59 Hz, 1 H)
Example 169
(Formula Removed)
eparation of N-(((S)-2-aminch14f3-(trifluoromethyQphenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide
a) 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)pheriyl]methyl}ethyl)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (183 mg, 0 54 mmol) [prepared according to the procedure of Example 167], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (201 mg, 0 52 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanme] and PyBrop (298 mg, 0 64 mmol) in chloroform (5 mL) DIEA (470 pL, 2 69 mmol) was
added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (246 mg, 0 36 mmol, 69%) LC-MS (ES) m/z = 653 (M+H)+
d) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (246 mg, 0 38 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (0 083 mL, 2 64 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (134 mg, 0 22 mmol, 57 % yield) LC-MS (ES) m/z = 523 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 3 04 (d, J=4 55 Hz, 4 H) 3 76 (s, 3 H) 4 29 - 443 (m, 1 H) 7 50 -7 61 (m, 3 H) 7 66 (s, 1 H) 7 70 - 7 75 (m, 1 H) δ 06 - 8 18 (m, 4 H) 9 17 (s, 1 H)
Example 170
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethylM-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide
a) 4-(4-bromo-1 -methyl- 1tf-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (340 mg, 1 00 mmol) [prepared according to the procedure of Example 1671, 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (374 mg, 1 12 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (626 mg, 1 34 mmol) in chloroform (10 mL) DIEA (980 uL, 5 61 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (229 mg, 0 35 mmol, 31%) LC-MS (ES) m/z = 603 (M+H)+
b)N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (229 mg, 0 38 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 2 mL) Hydrazine (90 uL, 2 87 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (99
mg, 0 17 mmol, 45 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-c(6) δ ppm 2 90 (d, J=6 82 Hz, 2 H) 2 95 - 3 06 (m, 2 H) 3 77 (s, 3 H) 4 27 -4 39 (m, 1 H) 7 11 (t, J=8 72 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 74 (s, 1 H) δ 01 - 8 21 (m, 4 H) 9 06 (s, 1 H)
Example 171
(Formula Removed)
Preparation of N-K1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (320 mg, 1 16 mmol) [prepared according to the procedure of Example 168], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (318 mg, 0 95 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (535 mg, 1 14 mmol) in Chloroform (9 5 mL) DIEA (840 pi, 4 81 mmol) was added
and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (106 mg, 0 16 mmol, 17%) LC-MS (ES) m/z = 557 (M+H)+
b)N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (106 mg, 0 19 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 5 mL) Hydrazine (45 uL, 1 43 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (65 mg, 0 12 mmol, 65 % yield) LC-MS (ES) m/z = 429 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 82 - 3 10 (m, 4 H) 3 77 (s, 3 H) 4 27 - 4 38 (m, 1 H) 7 11 (t, J=8 72 Hz, 2 H) 7 26 - 7 35 (m, 2 H) 7 68 - 7 76 (m, 1 H) δ 10 (s, 4 H) 9 11 (d, J=7 33 Hz, 1 H)
Example 172
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2.5-difluoroDhenyl]methyl]ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thtophenecarboxamide
a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-
dioxc^1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (219 mg, 0 85 mmol) [prepared according to the procedure of Example 158], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (290 mg, 0 82 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (481 mg, 1 03 mmol) in chloroform (8 5 mL) DIEA (750 uL, 4 29 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (246 mg, 0 44 mmol, 52%) LC-MS (ES) m/z = 555 (M+H)+
b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyi-1 H-
pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-thiophenecarboxamide (246 mg, 0 44 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (100 uL, 3 19 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (147 mg, 0 28 mmol, 64 % yield) LC-MS (ES) m/z = 425 (M+H)\ 1H NMR (400 MHz, DMSO-d6) δ ppm 2 34 (s, 3 H) 2 93 - 3 07 (m, 4 H) 3 71 (s, 3 H) 4 34 - 4 50 (m, 1 H)
7 04 - 7 14 (m, 1 H) 7 19 (td, J=9 03, 4 67 Hz, 2 H) 7 69 (s, 1 H) 7 93 (s, 1 H) δ 14 (s, 3 H) δ 87 (d, J=8 59 Hz, 1 H)
Example 173
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl)-5-methyl-4-(1-methyl-1N-pyrazol-5-yl)-2-triiophenecarboxamide
a) N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (171 mg, 0 77 mmol) [prepared according to the procedure of Example 151], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (270 mg, 0 77 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (436 mg, 0 93 mmol) in chloroform (7 5 mL) DIEA (680 uL, 3 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (246 mg, 0 44 mmol, 52%) LC-MS (ES) m/z = 521 (M+H)+
b)N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (243 mg, 0 47 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (0 103 mL, 3 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (132 mg, 0 27 mmol, 58 % yield) LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 2 38 (s, 3 H) 2 87 - 3 10 (m, 4 H) 3 78 (s, 3 H) 4 36 - 4 47 (m, 1 H) δ 35 (d, J=1 77 Hz, 1 H) 7 05 - 7 13 (m, 1 H) 7 16 - 7 28 (m, 2 H) 7 52 (d, J=1 52 Hz, 1 H) δ 00 (s, 1 H) δ 16 (s, 3 H) δ 88 (d, J=8 59 Hz, 1 H)
Example 174
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a) N-{(1S)-2-(2,5-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxylic acid (208 mg, 0 88 mmol) [prepared according to the procedure of Example 164], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (288 mg, 0 82 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (503 mg, 1 07 mmol) in Chloroform (8 5 mL) DIEA (770 uL, 4 41 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (292 mg, 0 55 mmol, 62%) LC-MS (ES) m/z = 535 (M+H)+
b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyM H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide (292 mg, 0 55 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (1 mL) Hydrazine (120 uL, 3 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHC^/MeOH/Nh^OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (163 mg, 0 32 mmol, 59 % yield) LC-MS (ES) m/z = 405 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 88 (s, 3 H) 2 27 (s, 3 H) 2 94 - 3 06 (m, 4 H) 3 63 (s, 3 H)4 35 -4 49 (m, 1 H) 7 05 - 7 12 (m, 1 H) 7 16 - 7 27 (m, 2 H) 7 38 (s, 1 H) 7 86 (s, 1 H) δ 16 (s, 3 H) δ 83 (d, J=8 84 Hz, 1 H)
Example 175
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-[(2,5-difluorophenyl]methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1-
[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (235 mg, 0 85 mmol) [prepared according to the procedure of Example 96], 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (290 mg, 0 82 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (479 mg, 1 02 mmol) in chloroform (8 5 mL) DIEA (742 uL, 4 25 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (174 mg, 0 30 mmol, 36%) LC-MS (ES) m/z = 575 (M+H)+
b) N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-
methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (174 mg, 0 30 mmol) in Tetrahydrofuran (THF) (3 6 mL) and Methanol (1 mL) Hydrazine (70 uL, 2 23 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (115 mg, 0 21 mmol, 70 % yield) LC-MS (ES) m/z = 445 (M+Hf, 1H NMR (400 MHz, DMSO-Oe) δ ppm 2 88 - 3 09 (m, 4 H) 3 76 (s, 3 H) 4 33 - 4 48 (m, 1 H) 7 06 - 7 15 (m, 1 H) 7 20 (td, J=9 09, 4 55 Hz, 2 H) 7 74 (s, 1 H) δ 10 (s, 1 H) δ 13 (s, 3 H) 9 14 (d, J=8 84 Hz, 1 H)
Example 176
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a 350 mL sealed flask reactor was added methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (3 45 g, 11 46 mmol) [prepared according
to the procedure of Example 156], tnmethylboroxme (2 7 ml, 19 40 mmol), K2CO3 (4 75 g, 34 4 mmol) and Pd(dppf)CI2 (599 mg, 1 17 mmol) in N,N-Dimethylformamide (DMF) (57 mL) The reaction was heated at 110 °C for 1 hour, cooled to room temperature and partitioned between CHCI3 / H2O The organic layer was separated, dned with Na2SO4, adsorbed onto silica and punfied via column chromatography (0-30%EtOAc/Hexane) affording the title compound (2 07 g, 8 76 mmol, 76%) LC-MS (ES) m/z = 251 (M+H)+
b) methyl 4-(3-chloro-1,4-dimethyl-1 A7-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
NCS (1 78 g, 13 09 mmol) was added in portions to a 125 mt_ sealed tube reactor containing methyl 4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 07 g, 8 76 mmol) in Tetrahydrofuran (THF) (40 ml) at room temperature The mixture was heated to 100 °C for 1 hour Upon completion the product was partitioned between CHCI3 and H2O, the organic layer dried with Na2SO4, solvents removed by vacuum distillation affording the title compound (2 18 g, 7 97 mmol, 91%) which was used without further purification LC-MS (ES) m/z = 271 (M+H)+
c)4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a 100 mL round-bottomed flask was added methyl 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (2 15 g, 7 94 mmol) in Tetrahydrofuran (THF) (30 ml) 6N NaOH (30 mL, 180 mmol) was added slowly and the reaction stirred at 70 °C overnight The reaction was cooled to room temperature, partitioned between CHCI3 and H2O and the pH of the aqueous layer
adjusted to - 3 by the addition of 6N HCI The layers were separated, the organic layer dried with Na2SO4 and solvent removed affording the title compound (1 35 g, 5 26 mmol, 66%) which was used in the next step without further punfication LC-MS (ES) m/z = 257 (M+H)+
d) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-/S/-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (294 mg, 114 mmol), 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (409 mg, 1 22 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine]and PyBrop (645 mg, 1 38 mmol) in chloroform (10 mL) DIEA (1 mL, 5 73 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (534 mg, 0 92 mmol, 81%) LC-MS (ES) m/z = 537 (M+H)+
c) N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (534 mg, 0 994 mmol) in Tetrahydrofuran (THF) (9 mL) and Methanol (1 mL) Hydrazine (220 uL, 7 01 mmol) was added and the reaction stirred overnight at room temperature The
jfeaction mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (354 mg, 0 70 mmol, 70 % yield) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 99 (s, 3 H) 2 91 - 3 02 (m, 4 H) 3 79 (s, 3 H) 4 30 - 4 41 (m, 1 H)
7 10 (t, J=8 84 Hz, 2 H) 7 27 - 7 36 (m, 2 H) δ 01 (d, J=1 26 Hz, 1 H) δ 15 (s, 3 H)
8 21 (d, J=1 26 Hz, 1 H) 9 04 (d, J=8 34 Hz, 1 H)
Example 177
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methynethyl}-4-(3-chloro-1,4-dtmethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2tf-isomdol-2-yl)-1-[(3-fiuorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (291 mg, 1 13 mmol) [prepared according to the procedure of Example 176], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (409 mg, 1 22 mmol) [prepared according to the procedure of Preparation 6 except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl]-2-(trifluoromethyl)-l_-phenylalanine] and PyBrop (654 mg, 1 39 mmol) in chloroform (10 mL) DIEA (1 mL, 5 73 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (427 mg, 0 76 mmol, 67%) LC-MS (ES) m/z = 537 (M+H)+
b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (427 mg, 0 79 mmol) in Tetrahydrofuran (THF) (7 5 mL) and Methanol (1 mL) Hydrazine (175 uL, 5 58 mmol) was added and the solution stirred at 25 °C overnight The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (296 mg, 0 59 mmol, 74 % yield) LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 99 (s, 3 H) 2 95 - 3 06 (m, 4 H) 3 79 (s, 3 H) 4 33 - 4 45 (m, 1 H) 7 02 (td, J=8 59, 2 02 Hz, 1 H) 7 09 - 7 18 (m, 2 H) 7 26 - 7 36 (m, 1 H) δ 01 (d, J=1 01 Hz, 1 H) δ 16 (s, 3 H) δ 22 (s, 1 H) 9 07 (d, J=8 34 Hz, 1 H)
Example 178
(Formula Removed)
Preparation of N-U1 S)-2-amino-1-(cvdohexvlmethyl)ethyri-4-(3-chloro-1.4-dimethyl-1H-pyrazol-5-vD-2-thiophenecarboxamide
a) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1-[(1,3-dioxo-1,3-
dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (150 mg, 0 58 mmol) [prepared according to the procedure of Example 176], 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (176 mg, 0 54 mmol) [prepared according to the procedure of Preparation 6, except substituting 3-cyclohexyl-N-{[(1,1-dimethylethyl)oxy]carbonyl}-L-alanine (5g, 18 4 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (336 mg, 0 72 mmol) in chloroform (6 mL) DIEA (520 pL, 2 98 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (336 mg, 0 61 mmol, quant) LC-MS (ES) m/z = 526 (M+H)+
b) N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(3-chloro-1,4-dimethyl-1H-pyrazol-
5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-cyclohexyl-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (366 mg, 0 697 mmol) in Tetrahydrofuran (THF) (6 5 mL) and Methanol (1 mL) Hydrazine (155 uL, 4 94 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (173 mg, 0 35 mmol, 50 % yield) LC-MS (ES) m/z = 395 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 0 80 - 0 92 (m, 1 H) 0 92 - 1 01 (m, 1 H) 1 13 (d, J=6 57 Hz, 2 H) 1 22 (d, J=12 88 Hz, 1 H) 1 29 (s, 1 H) 1 32 -1 43 (m, 1 H) 1 48 -1 56 (m, 1 H) 1 58 (d, J=5 05 Hz, 1 H) 1 63 (s, 3 H) 1 73 -1 84 (m, 1 H) 1 99 (s, 3 H) 2 94 (d, J=5 31 Hz, 2 H) 3 78 (s, 3 H) 4 22 - 4 36 (m, 1 H) δ 03 (s, 1 H) δ 05 (s, 3 H) δ 19 (s, 1 H) δ 80 (d, J=8 59 Hz, 1 H)
Example 179
(Formula Removed)
Preparation of N-((1S)-2-amino-1-[[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (238 mg, 0 93 mmol) [prepared according to the procedure of Example 176], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (355 mg, 0 92 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (5 0 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (532 mg, 1 13 mmol) in chloroform (9 5 mL) DIEA (820 uL, 4 70 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (448 mg, 0 72 mmol, 78%) LC-MS (ES) m/z = 587 (M+H)+
b) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (468 mg, 0 80 mmol) in Tetrahydrofuran (THF) (7 5 mL) and Methanol (1 mL) Hydrazine (175 uL, 5 58 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (321 mg, 0 58 mmol, 72 % yield) LC-MS (ES) m/z = 457 (M+H)+, 1H NMR (400 MHz,
DMSO-d6) δ ppm 1 98 (s, 3 H) 3 05 (d, J=7 07 Hz, 4 H) 3 77 (s, 3 H) 4 33 - 4 44 (m, 1 H) 7 49 - 7 57 (m, 2 H) 7 58 - 7 62 (m, 1 H) 7 66 (s, 1 H) δ 01 (d, J=1 26 Hz, 1 H) δ 11 (s, 3 H) δ 17 (d, J=1 26 Hz, 1 H) 9 02 (d, J=8 59 Hz, 1 H)
Example 180
(Formula Removed)
Preparation of A/4(1S)-2-amino-1-[(2,5-difluorophenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (147 mg, 0 61 mmol), 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (216 mg, 0 61 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (341 4 mg, 0 73 mmol) in chloroform (6 mL) DIEA (530 ul_, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70%
EtOAc/Hex) affording the title compound (233 mg, 0 43 mmol, 71%) LC-MS (ES) m/z = 541 (M+H)+
b) N-{(1S)-2-amino-1 -[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (233 mg, 0 43 mmol) in Tetrahydrofuran (THF) (5 mL) and Methanol (1 mL) Hydrazine (95 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHC^/MeOH/Nh^OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (165 mg, 0 32 mmol, 75 % yield) LC-MS (ES) m/z = 411 (M+HV\ 1H NMR (400 MHz, DMSO-d6) δ ppm 2 88 - 3 14 (m, 4 H) 3 85 (s, 3 H) 4 37 - 4 50 (m, 1 H) δ 48 (d, J=1 77 Hz, 1 H) 7 09 (t, J=8 34 Hz, 1 H) 7 19 (dt, J=9 09, 4 55 Hz, 1 H) 7 29 (ddd, J=8 84, 5 68, 3 16 Hz, 1 H) 7 55 (d, J=1 52 Hz, 1 H) δ 22 (s, 3 H) δ 27 (s, 1 H) 9 32 (d, J=8 84 Hz, 1 H)
Example 181
(Formula Removed)
Preparation of N-K1 S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-rnethyl-2-thiophenecarboxarnide
The title compound was prepared according to the procedure of Example 109, except substituting 2-[(2S)-2-amino-3-(3-fiuorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (184 mg, 0 55 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione [prepared according to Preparation 6] LC-MS (ES) m/z = 401 (M+H)+, 1H NMR (400 MHz, DMSO-d) δ ppm 1 04 (t, J=7 33 Hz, 3 H) 2 13 - 2 33 (m, 5 H) 2 86 - 3 08 (m, 4 H) 3 60 (s, 3 H) 4 27 - 4 43 (m, 1 H) δ 96 - 7 07 (m, 1 H) 7 11 (d, J=6 32 Hz, 2 H) 7 30 (s, 1 H) 7 43 (s, 1 H) 7 85 (s, 1 H) δ 19 (s, 3 H) δ 85 (s, 1 H)
Example 182
(Formula Removed)
Preparation of N-|(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl|-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared according to the procedure of Example 109, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (207 mg, 0 62 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione [prepared according to Preparation 6] LC-MS (ES) m/z = 401 (M+H)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 1 04 (t, J=7 20 Hz, 3 H) 2 25 (s, 5 H) 2 88 - 3 00 (m, 4 H) 3 61 (s, 3 H) 4 25 - 4 40 (m, 1 H) 7 01 - 7 17 (m, 2 H) 7 26 - 7 35 (m, 2 H) 7 42 (s, 1 H) 7 82 (s, 1 H) δ 17 (s, 3 H) δ 81 (s, 1 H)
Example 183
(Formula Removed)
Preparation of N-(C\ S)-2-amincM-{r3-(trifluoromethyl)phenyl]methyltethyiy4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared according to the procedure of Example 109, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (158 mg, 0 41 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione [prepared according to Preparation 6] LC-MS (ES) m/z = 451 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 04 (t, J=l 33 Hz, 3 H) 2 24 (s, 5 H) 3 03 (d, J=6 32 Hz, 4 H) 3 59 (s, 3 H) 4 35 (s, 1 H) 7 42 (s, 1 H) 7 46 - 7 57 (m, 2 H) 7 59 (d, J=6 57 Hz, 1 H) 7 64 (s, 1 H) 7 84 (s, 1 H) δ 20 (s, 3 H) δ 88 (s, 1 H)
Example 184
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) methyl 5-methyl-2-furancarboxylate
(Formula Removed)
To a 200 mL round-bottomed flask with condenser was added 5-methyl-2-furancarboxylic acid (2 5 g, 19 82 mmol) in Methanol (100 mL) H2SO4 (10 5 mL, 197 mmol) was added slowly at room temperature The reaction mixture was heated to 50 °C overnight The reaction mixture was cooled to 0 °C and a saturated solution of NaHCO3 was added to neutral pH followed by 5N NaOH to pH 10 CHCI3 was added and the organic phase was separated, dned with Na2SO4 and concentrated affording the title compound (2 3 g, 16 3 mmol, 82%) LC-MS (ES) m/z = 141 (M+H)+
b) methyl 4-bromo-5-methyl-2-furancarboxylate
(Formula Removed)
To a solution of methyl 5-methyl-2-furancarboxylate (2 33 g, 16 29 mmol) and aluminum chloride (3 3 g, 24 75 mmol) in chloroform (50 ml) at room temperature was added Br2 (1 1 ml, 21 35 mmol) The resulting solution was stirred at room temperature in a 150 mL sealed tube reactor for 2 hours Upon completion, the solution was cooled in an ice bath, H2O added and reaction partitioned between CHCI3 / H2O The organic layer was washed with NaHCC^ and then Na2S2O3 The organic layer was dried with Na2SO4, concentrated, adsorbed onto silica and purified via column chromatography (0-20% EtOAc/Hexanes) affording the title compound (2 13 g, 9 72 mmol, 60%) LC-MS (ES) m/z = 221 (M+H)+
c) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
To a 5 mL sealed flask reactor was added methyl 4-bromo-5-methyl-2-furancarboxylate (1 13 g, 5 16 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (1 31 g, 6 30 mmol) [prepared according to the procedure of Preparation 7], K3PO4 (3 87 g, 18 23 mmol) and Pd2(dba)3 (153 mg,
0 17 mmol) and P(OMe)3 (32 uL, 0 27 mmol) in 1,4-Dioxane (23 mL) The reaction was heated at 95 °C for 4 hours, cooled to room temperature and partitioned between CHCI3 / H20 The organic layer was separated, dned with Na2SO4, adsorbed onto silica and purified via column chromatography (0-15%EtOAc/Hexanes) affording the title compound (967 mg, 4 39 mmol, 85%) LC-MS (ES) m/z = 271 (M+H)+
d) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid
(Formula Removed)
NCS (709 mg, 5 31 mmol) was added in portions to a 150 mL sealed tube reactor containing methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (967 mg, 4 39 mmol) in Tetrahydrofuran (THF) (20 mL) at room temperature The mixture was heated to 70 °C for 1 hour 6N NaOH (20 mL, 120 mmol) was then added and the mixture stirred at 70 °C for an additional 2h The mixture was partitioned between CHCI3 and H2O and the pH of the aqueous phase was adjusted to -3 with 6N HCI The organic layer was separated, dried with Na2SO4 and concentrated affording the title compound (1 13 g, 4 41 mmol, quant) which was used without further purification LC-MS (ES) m/z = 241 (M+H)+
e) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (244 mg, 0 95 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (320 mg, 0 95 mmol)
[prepared according to the procedure of Preparation 6, except substituting N-{[{ 1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 0 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (533 mg, 1 14 mmol) in chloroform (9 mL) DIEA (830 uL, 4 75 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (242 mg, 0 465 mmol, 49%) LC-MS (ES) m/z = 521 (M+H)+
f) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide (238 mg, 0 46 mmol) in Tetrahydrofuran (THF) (3 6 mL) and Methanol (1 mL) Hydrazine (100 uL, 3 19 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (157 mg, 0 32 mmol, 71 % yield) LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 31 (s, 3 H) 2 91 - 3 03 (m, 4 H) 3 73 (s, 3 H) 4 36 - 4 49 (m, 1 H) 7 03 (t, J=7 71 Hz, 1 H) 7 07 - 7 14 (m, 2 H) 7 29 - 7 37 (m, 1 H) 7 39 (s, 1 H) 7 67 (s, 1 H) δ 14 (s, 3 H) δ 65 (d, J=8 59 Hz, 1 H)
Example 185
(Formula Removed)
Preparation of N-(C\ S)-2-amino1-{[2-(trifluoromethyDphenyl]methyltethyl)-5-(methyloxv)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 5-(methyloxy)-2-thiophenecarboxylic acid
(Formula Removed)
2-(methyloxy)thiophene (1 01 g, 8 85 mmol) was added slowly over 15 mm to a 100 mL round-bottomed flask containing 2 5M nBuLi in hexanes (3 8 mL, 9 50 mmol) in Tetrahydrofuran (THF) (40 mL) at -78 °C After warming to room temperature and stirring for 2h, the mixture was cooled to -35 °C and crushed solid CO2 was added The mixture warmed to room temperature over 3 hours and was cooled in an ice bath and quenched with NH4CI(sat) The cold reaction mixture was partitioned between CHCU / H20, the aqueous layer was made acidic with 6N HCI The separated organic layer was dned with Na2SO4 and concentrated affording the title compound (1 3 g, 8 05 mmol, 91%) which was used without further purification LC-MS (ES) m/z = 159 (M+H)+
b) methyl 5-(methyloxy)-2-thiophenecarboxylate
(Formula Removed)
To a 200 mL round-bottomed flask fitted with a condenser was added 5-(methyloxy)-2-thiophenecarboxylic acid (1 3 g, 8 22 mmol) in Methanol (40 mL) H2SO4 (5 mL, 94 mmol) was added slowly at room temperature and the reaction stirred at 50 °C overnight The mixture was cooled to 0 °C and sat NaHCO3 was added to neutral pH followed by 5N NaOH to pH 10 The mixture was partitioned between H20 / CHCI3 and the organic phase was separated and dried over
Na2SO4 The solution was adsorbed onto silica and punfied via column chromatography (5-50% EtOAc/Hexanes) affording the title compound (827 mg, 4 56 mmol, 56%) LC-MS (ES) m/z = 173 (M+H)+
c) methyl 4-bromo-5-(methyloxy)-2-thiophenecarboxylate
(Formula Removed)
NBS (903 mg, 5 07 mmol) was added in portions to a 5 mL sealed tube reactor containing methyl 5-(methyloxy)-2-thiophenecarboxylate (0 73 g, 4 23 mmol) in N,N-Dimethylformamide (DMF) (20 mL) at room temperature and the reaction stirred for 1 hour Additional NBS (249 mg) was added and after 1h at room temperature the product was partitioned between CHCI3 and H2O The organic layer was dned with Na2SO4, adsorbed onto silica and purified via column chromatography (0-25% EtOAc/Hexanes) affording the title compound (825 mg, 3 19 mmol, 75%) LC-MS (ES) m/z = 252 (M+H)+
d) methyl 5-(methyloxy)-4-(1 -methyl-1 f/-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a 350 mL sealed flask reactor was added methyl 4-bromo-5-(methyloxy)-2-thiophenecarboxylate (772 mg, 3 07 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (773 mg, 3 72 mmol) [prepared according to the procedure of Preparation 7], K2CO3 (1 419 g, 10 27 mmol) and Pd(Pt-Bu3)2 (103 mg, 0 20 mmol) in 1,4-Dioxane (12 mL) and Water (3 mL) The reaction was heated at 85 °C for 2 hours The mixture was partitioned between CHCI3 / H20 and the aqueous layer made acidic with 6N HCI The separated organic layer was dried over Na2SO4 and evaporated The resulting material was adsorbed onto silica and purified via column chromatography (0-50%EtOAc/Hexane) affording the title compound (967 mg, 4 39 mmol, 85%) LC-MS (ES) m/z = 253 (M+H)+
e) 5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a 100 mL round-bottomed flask was added methyl 5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (203 mg, 0 805 mmol) in Tetrahydrofuran (THF) (4 mL) 6N NaOH (4 mL, 24 0 mmol) was added slowly, the reaction mixture stirred overnight at 70 °C The mixture was neutralized by addition of 6N HCI and partitioned between CHCI3 and H2O The layers were separated, the organic layer dried over Na2SO4 and concentrated affording the title compound (152 mg, 0 64 mmol, 79%), which was used in the next step without further purification LC-MS (ES) m/z = 239 (M+Hf
f) /v-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (148 mg, 0 62 mmol), 2-{(2S)-2-amino-3-
[2-(trifluoromethyl)phenyl]propylMH-isomdole-1,3(2H)-dione (242 mg, 0 63 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (356 mg, 0 76 mmol) in Chloroform (6 mL) DIEA (550 uL, 3 15 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (303 mg, 0 51 mmol, 82%) LC-MS (ES) m/z = 569 (M+H)+
g) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1-
methyl-1f/-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added N-((1S)-2-(1,3-dioxo-1,3-
dihydro-2Hnsomdol-2-yl)-H[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(rnethyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (303 mg, 0 51 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (110 uL, 3 50 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (122 mg, 0 23 mmol, 45 % yield) LC-MS (ES) m/z = 439 (M+H)+, 1H NMR (400 MHz, DMSO-of6) δ ppm 2 93 - 3 02 (m, 1 H) 3 03 - 3 14 (m, 3 H) 3 82 (s, 3 H) 3 98 (s, 3 H) 4 41 - 4 53 (m, 1 H) δ 32 (s, 1 H) 7 38 - 7 49 (m, 2 H) 7 52 - 7 63 (m, 2 H) 7 68 (d, J=7 58 Hz, 1 H) δ 01 (s, 1 H) δ 17 (s, 3 H) δ 93 (d, J=8 84 Hz, 1 H)
Example 186
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-/v'-{(1S^2-(1,3-dloxo-1,3-dlhydro-2W-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (248 mg, 0 97 mmol) [prepared according to the procedure of Example 184], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (321 mg, 0 96 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (557 mg, 1 19 mmol) in chloroform (9 5 mL) DIEA (840 uL, 4 81 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (167 mg, 0 26 mmol, 67%) LC-MS (ES) m/z = 521 (M+H)+
b) N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-py razol-5-yl )-5-methy l-2-f u ra nca rboxa m id e
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-2-furancarboxamide (144 mg, 0 27 mmol) in Tetrahydrofuran (THF) (2 5 mL) and Methanol (1 mL) Hydrazine (60 uL, 1 91 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (100 mg, 0 21 mmol, 74 % yield) LC-MS (ES) m/z = 391 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 31 (s, 3 H) 2 83 - 2 93 (m, 2 H) 2 94 - 3 04 (m, 2 H) 3 73 (s, 3 H)
4 32 - 4 44 (m, 1 H) 7 12 (t, J=8 59 Hz, 2 H) 7 25 - 7 33 (m, 2 H) 7 35 (s, 1 H) 7 67 (s, 1 H) δ 07 (s, 3 H) δ 57 (d, J=8 59 Hz, 1 H)
Example 187
(Formula Removed)
Preparation of N-((1S)-2-amincM4f3-(trifluoromethy0phenyl]methyl}ethyl)-4-(4-chloro-1-methyHH-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-
furancarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (230 mg, 0 90 mmol) [prepared according to the procedure of Example 184], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (348 mg, 0 90 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (502 mg, 1 07 mmol) in chloroform (8 5 mL) DIEA (790 uL, 4 52 mmol) was added and the reaction stirred overnight at room temperature The mixture
was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (247 mg, 0 43 mmol, 48%) LC-MS (ES) m/z = 571 (M+H)+
b) N-((1S)-2-amino-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-2-furancarboxamide (247 mg, 0 433 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (95 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (206 mg, 0 38 mmol, 88 % yield) LC-MS (ES) m/z = 441 (M+H)+, 1H NMR (400 MHz, DMSO-d) § ppm 2 30 (s, 3 H) 2 97 - 3 08 (m, 4 H) 3 71 (s, 3 H) 4 35 - 4 49 (m, 1 H) 7 36 (s, 1 H) 7 54 (dt, J=19 20, 7 20 Hz, 3 H) 7 62 - 7 68 (m, 2 H) δ 14 (s, 3 H) δ 65 (d, J=8 84 Hz, 1 H)
Example 188
(Formula Removed)
Preparation of N-((1S)-2-amino-14[2-(trifluoromethyl]phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxvV2-thiophenecarboxamide
a) 4-(4-chloro-1 -methyl-1 W-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid
(Formula Removed)
NCS (382 mg, 2 80 mmol) was added in portions to a 50 mL sealed tube reactor containing methyl 5-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (642 mg, 2 54 mmol) [prepared according to the procedure of Example 185] in Tetrahydrofuran (THF) (12 mL) at room temperature The mixture was heated to 70 °C for 1 hour The reaction was cooled to room temperature, 6N NaOH (10 mL, 60 0 mmol) was added and the mixture stirred an additional 3h at 70 °C The mixture was partitioned between CHCI3 and H2O and the aqueous layer was made acidic with 6N HCI The organic layer was dried over Na2SO4 and concentrated affording the title compound (759 mg, 2 51 mmol, 98%) which was used without further purification LC-MS (ES) m/z = 273 (M+H)+
b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (85 mg, 0 31 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (119 mg, 0 31 mmol) [prepared according to the procedure of Preparation 6] and PyBrop (180 mg, 0 384 mmol) in chloroform (3 5 mL) DIEA (270 uL, 1 54 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70%
EtOAc/Hex) affording the title compound (94 mg, 0 14 mmol, 45%) LC-MS (ES) m/z = 603 (M+H)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-criloro-1 -methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1 S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-2-thiophenecarboxamide(94 mg, 0 16 mmol) in Tetrahydrofuran (THF) (2 mL) and Methanol (1 mL) Hydrazine (35 uL, 1 12 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (27 mg, 0 05 mmol, 31 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 93 - 3 14 (m, 4 H) 3 73 (s, 3 H) 4 00 (s, 3 H) 4 41 - 4 54 (m, 1 H) 7 43 (t, J=7 45 Hz, 1 H) 7 57 (ddd, J=14 59, 7 58, 7 39 Hz, 2 H) 7 62 - 7 65 (m, 1 H) 7 69 (d, J=7 83 Hz, 1 H) 7 82 - 7 89 (m, 1 H) δ 12 (s, 3 H) δ 80 (d, J=9 09 Hz, 1 H)
Example 189
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2,5-difluorophenyl]methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) methyl 5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a 350 mL sealed flask reactor was added methyl 4-bromo-5-chloro-2-thiophenecarboxylate (409 mg, 1 60 mmol) [prepared according to the procedure of Example 95], 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (388 mg, 1 75 mmol) [prepared according to the procedure of Preparation 17], K2CO3 (676 mg, 4 89 mmol) and Pd(PtBu3)2 (32 mg, 0 06 mmol) in 1,4-Dioxane (6 mL) and water (1 5 mL) The reaction was heated at 85 °C for 3 hours The reaction was partitioned between CHCI3 / H20 and the pH of the aqueous layer was adjusted to -3 with 6N HCI The separated organic layer was dried with Na2SO4, adsorbed onto silica and purified via column chromatography (10-65% EtOAc/Hexanes) affording the title compound (106 mg, 0 39 mmol, %), LC-MS (ES) m/z = 271 (M+H)+
b) 5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a 100 mL round-bottomed flask was added methyl 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (106 mg, 0 39 mmol) in Tetrahydrofuran (THF) (2 mL) 6N NaOH (2 mL, 12 00 mmol) was added slowly and the reaction mixture stirred overnight at 70 °C The reaction was cooled to room temperature, partitioned between CHCI3 and H2O and the pH of the aqueous layer was adjusted to ~ 3 by the addition of 6N HCI The layers were separated, the organic layer dried over Na2SO4 and concentrated affording the desired compound (96 mg, 0 37 mmol, 95%) LC-MS (ES) m/z = 257 (M+H)+
c) 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-
yl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (96 mg, 0 37 mmol), 2-[(2S)-2-amino-3-(2,5-difluorophenyl)propyl]-1H-isoindo!e-1,3(2H)-dione (125 mg, 0 40 mmol) [prepared according to the procedure of Preparation 18 except substituting 2,5-difluoro-L-phenylalanine (3 02 g, 15 0 mmol) for 2,6-difluoro-L-phenylalanine] and PyBrop (225 mg, 0 48 mmol) in chloroform (4 mL) DIEA (330 uL, 1 89 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and purified via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (98 mg, 0 13 mmol, 34%) LC-MS (ES) m/z = 535 (M+H)+
d) N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 5-chloro-N-{(1S)-2-(2,5-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (98 mg, 0 18 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (40 uL, 1 27 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH40H)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (52 mg, 0 10 mmol, 56 % yield) LC-MS (ES) m/z = 425 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 1 94 (s, 3 H) 2 87 - 3 09 (m, 4 H) 3 69 (s, 3 H) 4 42 (d, J=6 32 Hz, 1 H) 7 10 (ddd, J=12 00, 8 34, 3 41 Hz, 1 H) 7 20 (td, J=9 16, 4 67 Hz, 1 H) 7 27
(ddd, J=8 97, 5 56, 3 16 Hz, 1 H) 7 39 (s, 1 H) δ 06 (s, 1 H) δ 13 (s, 3 H) 9 13 (d, J=8 84 Hz, 1 H)
Example 190
(Formula Removed)
Preparation of N-{(1S)-2-amlno-H(3-fluorophenv0methyl]yethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxvV2-thlopheneca^^boxamlde
a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-(methyloxy)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (220 mg, 0 81 mmol) [prepared according to the procedure of Example 188], 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (281 mg, 0 84 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-3-fluoro-L-phenylalanine (5 03 g, 17 8 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (472 mg, 1 0 mmol) in Chloroform (8 mL) DIEA (710 uL, 4 07 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed
onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (281 mg, 0 51 mmol, 63%) LC-MS (ES) m/z = 553 (M+H)+
b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-iso/ndol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-5-(methyloxy)-2-thiophenecarboxamide (281 mg, 0 51 mmol) in Tetrahydrofuran (THF) (4 5 mL) and Methanol (1 mL) Hydrazine (120 uL, 3 82 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (145 mg, 0 28 mmol, 55 % yield) LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 86 - 3 04 (m, 4 H) 3 71 (s, 3 H) 4 02 (s, 3 H) 4 31 - 4 41 (m, 1 H) 7 00 - 7 07 (m, 1 H) 7 11 (d, J=7 58 Hz, 2 H) 7 28 - 7 36 (m, 1 H) 7 64 (s, 1 H) 7 73 - 7 78 (m, 1 H) 7 98 (s, 3 H) δ 54 (s, 1 H)
Example 191
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide
a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyI}-5-(methyloxy)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (208 mg, 0 76 mmol) [prepared according to the procedure of Example 188], 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (257 mg, 0 77 mmol) [prepared according to the procedure of Preparation 6, except substituting N-{[(1,1-dimethylethyl)oxy]carbonyl}-4-fluoro-L-phenylalanine (4 95 g, 17 5 mmol) for N-{[(1,1-dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (435 mg, 0 93 mmol) in chloroform (7 6 mL) DIEA (670 uL, 3 84 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (238 mg, 0 43 mmol, 56%) LC-MS (ES) m/z = 553 (M+H)+
b) N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-
pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-(methyloxy)-2-thiophenecarboxamide (238 mg, 0 43 mmol) in Tetrahydrofuran (THF) (4 mL) and Methanol (1 mL) Hydrazine (95 uL, 3 03 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and punfied via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (113 mg, 0 22 mmol, 50 % yield) LC-MS (ES) m/z = 423 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 82 - 2 92 (m, 2 H) 2 93 - 3 03 (m, 2 H) 3 71 (s, 3 H) 4 02 (s, 3 H) 4 26 - 4 37 (m, 1 H) 7 11 (t, J=8 46 Hz, 2 H) 7 26 - 7 32 (m, 2 H) 7 64 (s, 1 H) 7 69 -7 84 (m, 1H) 7 95 (s, 3 H) δ 45 - 8 52 (m, 1H)
Example 192
(Formula Removed)
Preparation of N-((1 S>2-amino-1-lf3-(trifluoromethyl)phenyl]methyltethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxv)-2-thiophenecarboxamide
a) 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1)3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl3methyl}ethyl)-5-(methyloxy)-2-
thiophenecarboxamide
(Formula Removed)
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxylic acid (210 mg, 0 77 mmol) [prepared according to the procedure of Example 188], 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (294 mg, 0 764 mmol)
[prepared according to the procedure of Preparation 6, except substituting N-{[( 1,1-dimethylethyl)oxy]carbonyl}-3-(trifluoromethyl)-L-phenylalanine (4 98 g, 15 0 mmol) for N-{[(1,1 -dimethylethyl)oxy]carbonyl}-2-(trifluoromethyl)-L-phenylalanine] and PyBrop (442 mg, 0 94 mmol) in chloroform (7 6 mL) DIEA (670 uL, 3 84 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica and punfied via column chromatography (25 - 70% EtOAc/Hex) affording the title compound (238 mg, 0 43 mmol, 56%) LC-MS (ES) m/z = 603 (M+H)+
b) N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide
To a 50 mL round-bottomed flask was added 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-2-thiophenecarboxamide (203 mg, 0 34 mmol) in Tetrahydrofuran (THF) (3 mL) and Methanol (1 mL) Hydrazine (80 uL, 2 55 mmol) was added and the reaction stirred overnight at room temperature The mixture was adsorbed onto silica gel and purified via column chromatography (90 10 1 CHCI3/MeOH/NH4OH)
The neutral compound was dissolved in MeOH (2 mL), treated with excess 2M HCI in Et20 and concentrated affording the HCI salt of the title compound (86 mg, 0 15 mmol, 44 % yield) LC-MS (ES) m/z = 473 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 2 92 - 3 08 (m, 4 H) 3 70 (s, 3 H) 4 01 (s, 3 H) 4 30 - 4 42 (m, 1 H)
7 50 - 7 60 (m, 3 H) 7 61 - 7 66 (m, 2 H) 7 73 - 7 81 (m, 1H) δ 00 (s, 3 H) δ 52 -
8 68(m, 1H)
Example 193
(Formula Removed)
Preparation of N-(C\ S)-2-amino-1-fr2-(trifluoromethyl]phenyl]methyl|ethyl)--4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 4-chloro-5-(1-methyi-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of 5-bromo-4-chloro-2-thiophenecarboxylic acid (482 mg, 2 mmol) in dioxane/H20 (4 1, 10 mL) was added 1,1'-
bis(diphenylphosphino)ferrocenedichloro Palladium (II) dichloromethane complex (16 3 mg, 0 02 mmol), potassium carbonate (828 mg, 6 mmol) and 5-(5,5-dimethyl-1,3,2-dooxabonnan-2-yl)-1-methyl-1H-pyrazole (832 mg, 4 mmol)[prepared according to Preparation 7] The reaction mixture was heated to 80 °C in a sealed tube for 20 hrs The reaction mixture was poured into H2O (100 mL) and extracted with DCM The organic layer was dried over Na2SO4, concentrated and purified using silica (EtOAc / hexane (0 - 45% gradient)) affording the title compound as a white solid (401 7 mg, 83%) LC-MS (ES) m/z= 243 (M+H)+
b) 4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of 4-chloro-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (121 mg, 0 5 mmol) and N-chlorosuccinimide (67mg, 0 5 mmol) in THF (5 mL) was stirred in a sealed tube at 70 °C After 4 hrs, the solution was concentrated and partitioned between DCM and H20 The aqueous layer was extracted several times with DCM The organic fractions were combined, concentrated and azeotropically dried with toluene to give the title compound as a brown oil (136 mg, 98%) LC-MS (ES) m/z= 278 (M+H)+
c) 4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-rV-((1S)-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (136 1 mg, 0 49 mmol), 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (179 mg, 0 51 mmol)[prepared according to Preparation 6], dnsopropylethyl amine (260 uL, 1 5 mmol) in DCM (5 mL) was added PyBrop (341 mg, 0 75 mmol) in one portion After 1h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, gradient 0- 50% ethyl acetate / hexane) affording the title compound (242 mg, 82%) as a white solid LCMS (ES) m/z = 607 (M+H)+
d) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a solution of 4-chloro-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (242 mg, 0 4 mmol) in THF-MeOH (11,4 mL) was added hydrazine (75 uL, 2 42 mmol) After 12h, the solution was concentrated The resulting residue was partitioned between DCM and H2O The organics were washed three times with water and acidified to pH ~ 1 with 6N aqueous HCI solution The resulting mixture was extracted with water The aqueous fractions were combined and concentrated to afford the di-HCI salt of the desired product as a light yellow solid (77 mg, 40%) LCMS (ES) m/z 477 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 08-3 11 (m, 4 H) 3 75 (s, 3 H) 4 50 (br s , 1 H) 7 45 (t, J=6 95 Hz, 1H)7 55-7 63(m, 2H) 7 71 (d, J=7 83 Hz, 1 H) 7 78 (s, 1 H) δ 02 - 8 10 (m, 3 H) δ 12 (s, 1 H) 9 12 (d, J=9 09 Hz, 1 H)
Example 194
(Formula Removed)
Preparation of N-(C\ S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-chloro-5-M-bromo-1-methyl-1H-pyrazol-5-yl)-2-triioprienecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 193, except substituting N-bromosuccinimide (89 mg, 0 5 mmol) for and N-chlorosuccinimide LCMS (ES) m/z 522 (M+H)+, 1H NMR (400 MHz, DMSO-d6) δ ppm 3 0-3 13 (m, 4 H) 3 76 (s, 3 H) 4 50 (br s , 1 H) 7 46 (d, J=7 58 Hz, 1 H) 7 55 - 7 66 (m, 2 H) 7 71 (d, J=7 83 Hz, 1 H) 7 78 (s, 1 H) δ 04 (br s,4H)
Example 195
(Formula Removed)
Preparation of N-\C\ S)-2-amino-1-(3-pyridinylmethyl)ethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a light yellow solid according to the procedure of Example 6, except substituting 4-bromo-2-thiophenecarboxylic acid (62 mg, 0 3 mmol) for 5-bromo-2-thiophenecarboxylic acid and substituting 2-[(2S)-2-amino-3-(3-pyndinyl)propyl]-1H-isoindole-1,3(2H)-dione -HCI (84 mg, 0 3 mmol)[prepared according to Preparation 19] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione-HCI LC-MS (ES) m/z = 342 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 17 (dd, J=13 89, 10 86 Hz, 1 H) 3 33 - 3 36 (m, 2 H) 3 36 - 3 44 (m, 1 H) 3 96 (s, 3 H) 4 70 (dd, J=14 02, 6 19 Hz, 1 H) δ 47 (s, 1 H) 7 51 (s, 1 H) 7 88 (d, J=1 26 Hz, 1 H) 7 94 (s, 1 H) δ 02 (t, J=6 32 Hz, 1 H) δ 61 (d, J=7 83 Hz, 1 H) δ 76 (br s , 1 H) δ 89 (br s , 1 H)
Example 196
(Formula Removed)
Preparation of N-[(1/?)-2-amino-1-phenylethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (83 mg, 0 4 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl [(2R)-2-amino-2-phenylethyl]carbamate (94 mg, 0 4 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z = 327 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 44 (d, J=4 29 Hz, 1 H) 3 63 (br s , 1 H) 4 18 (s, 3 H) δ 47 (dd, J=10 36, 4 55 Hz, 1 H) δ 88 (d, J=2 78 Hz, 1 H) 7 38 (d, J=7 07 Hz, 1 H) 7 44 (t, J=7 33 Hz, 2 H) 7 55 (d, J=7 83 Hz, 2 H) δ 08 (d, J=2 53 Hz, 1 H) δ 18 (d, J=1 26 Hz,1 H) δ 42 (d, J=1 26 Hz, 1 H)
Example 197
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-phenylethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 20, except substituting 4-bromo-2-thiophenecarboxylic acid (83 mg, 0 4 mmol) for 4,5-dibromo-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (94 mg, 0 4 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 327 (M+H)\ 1H NMR (400 MHz, MeOD) δ
ppm 3 44 (d, J=2 78 Hz, 1 H) 3 60 (br s , 1 H) 4 06 (br s , 3 H) δ 47 (dd, J=10 36, 4 29 Hz, 1 H) δ 70 (br s , 1 H) 7 38 (d, J=6 82 Hz, 1 H) 7 44 (t, J=7 20 Hz, 2 H) 7 53 (d, J=7 58 Hz, 2 H) 7 79 (br s , 1 H) δ 04 (br s ,1 H) δ 32 (br s , 1 H)
Example 198
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-phenylethyl]-5-methyl-4-n-methyl-1H-Dvrazol-5-vl)-2-thiophenecarboxamide
a) methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-methyl-2-thiophenecarboxylate (2g, 8 51 mmol)[prepared in Preparation 10], potassium carbonate (5 88 g, 42 5 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2 12 g, 10 21 mmol)[prepared according to Preparation 7] and bis(tn-t-
butylphosphme)palladium(O) (0 22 g, 0 43 mmol) in 1,4-Dioxane (35 ml) and H20 (7 ml) was stirred at 80 °C in a sealed tube for 1h The reaction mixture was then partitioned between H20-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dried over Na2SO4, concentrated and punfied via column chromatography (silica, 25% EtOAc in hexanes) affording methyl 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate This reaction was run in several batches (1g, 3 x 2g) which were combined for workup and purification affording the title compound (5 5 g, 78% combined yield) as a viscous yellow oil LC-MS (ES) m/e 236 (M+H)+
b) 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (94 mg, 0 4 mmol) in 6N sodium hydroxide (0 67 ml, 4 mmol) and tetrahydrofuran (4 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~3 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording the desired product (67 mg, 0 3 mmol, 75 % yield) as a yellow oil LC-MS (ES) m/e 223 (M+H)+
c) 1,1 -dimethylethyl [(2S)-2-({[5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-2-phenylethyl]carbamate
(Formula Removed)
To a solution of 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (67 mg, 0 3 mmol), 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (71 mg, 0 3 mmol) [prepared according to the procedure of Preparation 1] and diisopropylethylamine (0 16 ml, 0 9 mmol) in DCM at 25 °C was added bromo-tris-pyrrolidino-phosphonium hexafluorophosphate (210 mg, 0 45 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound (87 mg, 0 2 mmol, 65 % yield) as a yellow foam LC-MS (ES) m/e 441 (M+H)+
d) N-[(1S)-2-amino-1-phenylethyl]-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
To a solution of 1,1 -dimethylethyl [(2S)-2-({[4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (87 mg, 0 2 mmol) in DCM (2
mL) was added 4N HCI solution in dioxane (0 5 mL, 2 mmol) which stirred at ambient temperature for 15 h The solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (26 mg, 0 06 mmol, 32%) LC-MS (ES) m/z 341 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 49 (br s , 3 H) 3 43 (d, J=4 80 Hz, 1 H) 3 55 (d, J=10 36 Hz, 1 H) 3 95 (s, 3 H) δ 41-5 43 (m, 1 H) δ 66 (d, J=2 27 Hz, 1 H) 7 38 (d, J=7 07 Hz, 1 H) 7 44 (t, J=7 33 Hz, 2 H) 7 48 - 7 53 (m, 2 H) 7 94 - 8 02 (m, 2 H)
Example 199
(Formula Removed)
Preparation of N-[(1S)-2-amino-1 -phenylethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-vlV5-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (89 mg, 0 4 mmol) [prepared according to Example 198] for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid and substituting 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (94 mg, 0 4 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 375 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 38-2 41 (m, 1H), 3 38 (d, J=1 52 Hz, 1 H) 3 49 (d, J=10 86 Hz, 1 H) 3 73 (br s , 3 H) δ 41 (d, J=3 54 Hz, 1 H) 7 30 - 7 50 (m, 5 H) 7 54 - 7 62 (m, 1 H) 7 81 (br s,1H)
Example 200
(Formula Removed)
Preparation of N-\( 1 S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-vlV5-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 24, except substituting 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (168 mg, 0 5 mmol) [prepared according to Example 198] for4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, N-bromosuccinimide (88 5 mg, 0 5 mmol) for N-chlorosuccmimide and 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate (71 mg, 0 3 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl (3-amino-4-phenylbutyl)carbamate LC-MS (ES) m/z 341 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 39 (d, J=4 04 Hz, 3 H) 3 42 (br s , 1 H) 3 55 (br s , 1 H) 3 75-3 78 (m, 3 H) δ 45 (m, 1 H) 7 37 (d, J=7 07 Hz, 1 H) 7 40 - 7 46 (m, 2 H) 7 49 (br s , 2 H) 7 59 -7 68 (m, 1 H) 7 80 - 7 88 (m, 1 H)
Example 201
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-vl)-2-thiophenecarboxamide
a) methyl 5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (2 56 g, 10 00 mmol)[prepared according to Example 95], 5-(5,5-dimethyl)-1,3,2-dioxabonnan-2-yl)-1-methyl-1H-pyrazole (3 88 g, 20 0 mmol)[prepared according to Preparation 7], potassium carbonate (4 15 g, 30 0 mmol) and 1,1'-bis(diphenylphosphino)ferrocenedichloro palladium (II) dichloromethane complex (0 073 g, 0 1 mmol) in 1,4-Dioxane (12 mL) and water (3 00 mL) were heated at 80 °C in a sealed tube After 3 hrs, another batch of 5-(5,5-dimethyl)-1,3,2-
dioxabonnan-2-yl)-1-methyl-1H-pyrazole (1 94 g, 10 0 mmol) and 1,1'-bis(diphenylphosphino)ferrocenedichloro palladium (II) dichloromethane complex (0 073 g, 0 1 mmol) were added After 2 hr, the mixture was concentrated and punfied by silica gel eluting with 0-35% ethyl acetate / hexane affording the title compound as a yellow solid (1 74 g, 3 35 mmol, 34%) LC-MS (ES) m/z 257 (M+H)+
b) 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (304 mg, 118 mmol) in 6N sodium hydroxide (2 ml, 12 mmol) and Tetrahydrofuran (10 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~3 and then washed several times with DCM The combined organic fractions were dned over Na2SO4 and concentrated affording the desired product (276 mg, 1 14 mmol, 96 % yield) as a yellow oil LC-MS (ES) m/e 244 (M+H)+
c) 1,1 -dimethylethyl [(2S)-2-({[5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-
thienyl]carbonyl}amino)-2-phenylethyl]carbamate
(Formula Removed)
To a solution of 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (60 mg, 0 25 mmol), 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (58 mg, 0 25 mmol) [prepared according to the procedure of Preparation 1] and dnsopropylethylamine (0 12 ml, 0 75 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (190 mg, 0 41 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column
chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound (90 mg, 0 20 mmol, 79 % yield) as a colorless oil LC-MS (ES) m/e 461 (M+H)+
d) N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a solution of 1,1-dimethylethyl [(2S)-2-({[5-chloro-4-( 1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (90 mg, 0 20 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 5 mL, 2 mmol) After 15 h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (63 mg, 0 14 mmol, 74%) LC-MS (ES) m/z 361 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 41 (dd, J=13 01, 4 17 Hz, 1 H) 3 63 (d, J=10 86 Hz, 1 H) 4 08 (s, 3 H) δ 45 (dd, J=10 48, 4 17 Hz, 1 H) δ 87 (d, J=2 27 Hz, 1 H) 7 36 (d, J=7 33 Hz, 1 H) 7 42 (t, J=7 33 Hz, 2 H) 7 54 (d, J=7 07 Hz, 2 H) δ 14 (d, J=2 27 Hz, 1 H) δ 27 (s, 1 H)
Example 202
(Formula Removed)
Preparation of N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate (63 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyljcarbamate LC-MS (ES) m/z = 379 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 40 (dd, J=13 01, 4 42 Hz, 1 H) 3 66 (d, J=2 02 Hz, 1 H) 4 03 - 4 15 (m, 3 H) δ 46 (dd, J=10 36, 4 29 Hz, 1 H) δ 84 (d, J=2 53 Hz, 1H) 7 15 (t, J=8 72 Hz, 2 H) 7 60 (dd, J=8 59, 5 05 Hz, 2 H) δ 10 (d, J=2 53 Hz, 1 H) δ 29 (s, 1 H)
Example 203
(Formula Removed)
Preparation of N-[2-arrnno-1-(4-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(4-chlorophenyl)ethyl]carbamate (45 mg, 0 17 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyljcarbamate LC-MS (ES) m/z = 396 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 40 (d, J=4 55 Hz, 1 H) 3 58 (d, J=10 36 Hz, 1 H) 3 98 (s, 3 H) δ 41 (d, J=4 55 Hz, 1 H) 6 71 (s, 1 H) 7 43 (dt, J=4 74, 2 31 Hz, 2 H) 7 47 - 7 56 (m, 2 H)
7 92 (or s, 1 H)8 13(s, 1 H)
Example 204
(Formula Removed)
Preparation of N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(3-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate LC-MS (ES) m/z = 396 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ ppm 3 41 (dd, J=12 76, 4 93 Hz, 5 H) 3 36 - 3 47 (m, 3 H) 3 63 (s, 2 H) 3 59 (d, J=10 61 Hz, 6 H) 3 95 (s, 9 H) 4 02 (d, J=3 03 Hz, 15 H) δ 41 (dd, J=9 09, 3 79 Hz,
8 H) δ 67 (d, J=2 27 Hz, 3 H) 6 78 (br s , 4 H) 7 33 - 7 49 (m, 23 H) 7 56 (br s , 7
H) δ 06 (br s , 8 H) δ 16 (d, J=16 93 Hz, 6 H)
Example 205
(Formula Removed)
Preparation of N-[2-amino-1-(2-chlorophenyl]ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 201, except substituting 1,1-dimethylethyl [2-amino-2-(2-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate LC-MS (ES) m/z = 396 (M+H)\ 1H NMR (CD3OD, 400 MHz) δ ppm 3 39 (br s , 1 H) 3 56 (d, J=10 86 Hz, 1 H) 4 05 (d, J=3 03 Hz, 3 H) δ 87 (dd, J=10 74, 3 41 Hz, 1 H) 6 81 (br s , 1 H) 7 39 (br s , 2 H) 7 50 (d, J=6 57 Hz, 1 H) 7 70 (d, J=7 07 Hz, 1 H) δ 04 (br s , 1 H) δ 26 (br s , 1 H)
Example 206
(Formula Removed)
Preparation of Ay-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazel-5-yl)-2-thiophenecarboxamide
a) 1,1-dimethylethyl [2-({[4-chloro-5-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-(4-fluorophenyl)ethyl]carbamate
(Formula Removed)
To a solution of 4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (67 mg, 0 24 mmol) [prepared according to Example 193], 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate (61 mg, 0 24 mmol) [prepared according to the procedure of Preparation 16], dnsopropylethyl amine (126 uL, 0 72 mmol) in DCM (5 mL) was added PyBrop (168 mg, 0 36 mmol) in one portion After 1 h, the reaction contents were partitioned between H20/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SC"4, concentrated and purified via column chromatography (silica, gradient 0- 50% ethyl acetate / hexane) affording the title compound (93 mg, 0 18 mmol, 76%) as a white solid LCMS (ES) m/z = 514 (M+H)+
b) N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
To a solution of 1,1-dimethylethyl [2-({[4-chloro-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-2-(4-fluorophenyl)ethyl]carbamate (90 mg, 0 17 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 43 mL, 1 75 mmol) After 15h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (39 6 mg, 0 09 mmol, 52%) LC-MS (ES) m/z 414 (M+H)+, 1HNMR (400 MHz, MeOD) δ ppm 3 42 (d, J=2 78 Hz, 1 H) 3 56 (br s , 1 H) 3 79 (s, 3 H) δ 43 (dd, J=10 23, 4 67 Hz, 1 H) 7 11 - 7 22 (m, 2 H) 7 49 - 7 57 (m, 2 H) 7 60 (s, 1 H) 7 93 (br s , 1 H)
Example 207
(Formula Removed)
Preparation of N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyl]carbamate (57 mg, 0 24 mmol) [prepared according to the procedure of Preparation 1] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 396 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 3 42 (br s , 1 H) 3 57 (d, J=11 12 Hz, 1H) 3 80 (s, 3 H) δ 44 (dd, J=10 36, 4 29 Hz, 1 H) 7 37 (d, J=2 53 Hz, 1 H) 7 40 - 7 47 (m, 2 H) 7 48 - 7 55 (m, 2 H) 7 60 (s, 1 H) 7 95 (br s , 1 H)
Example 208
(Formula Removed)
Preparation N-[(1S)-2-amino-1-phenylethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide
a) 4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid
(Formula Removed)
o a solution of methyl 5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (300 mg, 1 169 mmol)[prepared according to the procedure of Example 193] in THF (10 ml) was added N-bromosuccinimide (212 mg, 1 19 mmol) The mixture was sealed and heated at 70 °C After 2h, a solution of 6N NaOH (2 0 ml, 6 0 M, 11 84 mmol) was added in one portion The resulting mixture
stirred for an additional 2h and was partitioned between DCM-H2O The pH of the aqueous phase was adjusted to ~3 and extracted several times with DCM The combined organic fractions were dried over Na2SO4, concentrated affording the title compound as a colorless oil (105 mg, 28%) LC-MS (ES) m/z= 322 (M+H)+
b) 1,1 -dimethylethyl [(2S)-2-({[4-(4-bromo-1 -methyl-1 N-pyrazol-5-yl)-5-chloro-2-
thienyl]carbonyl}amino)-2-phenylethyl]carbamate
(Formula Removed)
o a solution of 4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxylic acid (80 mg, 0 25 mmol), 1,1-dimethylethyl [(2S)-2-amino-2-phenylethyljcarbamate (59 mg, 0 25 mmol) [prepared according to the procedure of Preparation 1], dnsopropylethyl amine (128 uL, 0 75 mmol) in DCM (5 mL) was added PyBrop (168 mg, 0 36 mmol) in one portion After 3h, the reaction contents were partitioned between H2O/DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dned over Na2SO4, concentrated and purified via column chromatography (silica, gradient 0- 50% ethyl acetate / hexane) affording the title compound (110 mg, 0 18 mmol, 73%) as a white solid LCMS (ES) m/z = 540 (M+H)+
c) N-[(1S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-
2-thiophenecarboxamide
To a solution of 1,1-dimethylethyl [(2S)-2-({[4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (81 mg, 0 15 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 38 mL, 1 5 mmol) After 15h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as a white solid (18 3 mg, 0 04 mmol, 26%) LC-MS (ES) m/z 440 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 40 (d, J=13 89 Hz, 1H) 3 60 (br s , 1
H) 3 80 (br s , 3 H) 5 38 - 5 50 (m, 1 H) 7 37 (d, J=7 33 Hz, 1 H) 7 43 (t, J=7 45 Hz, 2 H) 7 52 (d, J=7 58 Hz, 2 H) 7 61 (s, 1 H) δ 02 (br s , 1 H)
Example 209
(Formula Removed)
reparation N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [2-amino-2-(3-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 430 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 45 (d, J=5 56 Hz, 2 H) 3 72 - 3 81 (m, 3 H) δ 86 (dd, J=9 22, 4 42 Hz, 1H) 7 41 (d, J=2 02 Hz, 2 H) 7 48 - 7 55 (m, 1 H) 7 58 (br s , 2 H) 7 83 (s, 1 H)
Example 210
(Formula Removed)
reparation N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [2-amino-2-(3-chlorophenyl)ethyl]carbamate (67 mg, 0 25 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 430 (M+H)+, 1HNMR (400 MHz, MeOD) δ ppm 3 44 (d, J=3 54 Hz, 1 H) 3 55 (d, J=10 61 Hz, 1 H) 3 80 (s, 3 H) δ 42
(dd, J=10 36, 4 29 Hz, 1 H) 7 35 - 7 49 (m, 3 H) 7 55 (s, 1 H) 7 59 (s, 1 H) 7 95 (d, J=14 40 Hz, 1 H)
Example 211
(Formula Removed)
reparation N-(2-aminoethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl (2-aminoethyl)carbamate (58 mg, 0 36 mmol)for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 320 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 3 17 (d, J=5 81 Hz, 2 H) 3 66 (br s , 2 H) 3 78 (s, 3 H) 7 60 (s, 1 H) 7 66(s, 1H)
Example 212
(Formula Removed)
reparation rV-[2-amino-1-(4-chlorophenyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 206, except substituting 1,1-dimethylethyl [2-amino-2-(4-chlorophenyl)ethyl]carbamate (65 mg, 0 24 mmol) [prepared according to the procedure of Preparation 16] for 1,1-dimethylethyl [2-amino-2-(4-fluorophenyl)ethyl]carbamate LC-MS (ES) m/z 431 (M+H)+, 1HNMR (400 MHz, MeOD) δ ppm 3 43 (d, J=4 55 Hz, 1 H) 3 53 (d, J=10 11 Hz, 1 H) 3 79 (s, 3 H) δ 43
(dd, J=10 36, 4 55 Hz, 1H) 7 43 - 7 47 (m, 2 H) 7 48 - 7 53 (m, 2 H) 7 60 (s, 1 H) 7 94(s,1 H)
Example 213
(Formula Removed)
reparation N-IY1 S)-2-amino-1 -(cyclohexvlmethyl)ethyl]-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thioprienecarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 99, except substituting 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione (73 mg, 0 25 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z375 (M+H)+,1H NMR (400 MHz, MeOD) δ ppm 0 91- 0 99 (m, 1H), 1 01-1 10 (m , 1 H) 1 39-1 47 (m , 3 H) 1 37-1 48 (m, 2H) 1 65-1 77 (m, 5 H) 1 89 (br s, 1 H)2 10 (s, 3 H)2 45 (s, 3 H) 3 07 -3 16 (m, 2 H) 3 91 - 3 98 (m, 3 H) 4 42 (br s , 1 H) 7 91 (br s , 1 H) δ 24 (s, 1 H)
Example 214
(Formula Removed)
reparation N-[(1S)-2-amino-1-phenylethyl]-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
a)1,1-dimethylethyl[(2S)-2-({[4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate
(Formula Removed)
o a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thtophenecarboxylic acid (110 mg, 0 4 mmol) [prepared in Experiment 99], 2-[(2S)-2-amino-4-methylpentyl]-1H-isoindole-1,3(2H)-dione (99 mg, 0 4mmol) [prepared according to the procedure of Preparation 1] and dnsopropylethylamine (0 2 ml, 1 2 mmol) in DCM at 25 °C was added bromo-tns-pyrrolidino-phosphonium hexafluorophosphate (280 mg, 0 6 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound (113 mg, 0 22 mmol, 56 % yield) as a colorless oil LC-MS (ES) m/e 506 (M+H)+
d) N-[(1S)-2-amino-1 -phenylethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
To a solution of 1,1-dimethylethyl [(2S)-2-({[4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thienyl]carbonyl}amino)-2-phenylethyl]carbamate (99 mg, 0 22 mmol) in DCM (2 mL) was added 4N HCI solution in dioxane (0 5 mL, 2 mmol) After 15 h, the solution was extracted with water three times The aqueous fractions were combined and concentrated to afford the di-HCI salt of the title compound as an off-white solid (40 mg, 0 11 mmol, 52%) LC-MS (ES) m/z 355 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 99 - 2 14 (m, 3 H) 2 43 (s, 3 H) 3 39 (d, J=9 85 Hz, 1 H)) 3 60 (d, J=9 85 Hz, 1 H) 3 92 (br s , 3 H) δ 44 (d, J=8 84 Hz, 1 H) 7 36 (d, J=2 53 Hz, 1 H) 7 43 (t, J=5 94 Hz, 2 H) 7 49 - 7 57 (m, 2 H) δ 03 (br s , 1 H) δ 14 (br s , 1H)
Example 215
(Formula Removed)
reparation N-[(1S)-2-amino-1 -methylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamicle
The title compound was prepared as an off-white solid according to the procedure of Example 106, except substituting 2-[(2S)-2-aminopropyl]-1H-isoindole-1,3(2H)-dione (74 mg, 0 36 mmol)for2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 333 (M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 1 37 (d, J=6 82 Hz, 3 H) 3 11 - 3 14 (m, 2 H) 3 79 (s, 3 H) 4 38 - 4 40 (m, 1 H) 7 60 (br s , 1 H) 7 83 (d, J=2 27 Hz, 1 H)
Example 216
(Formula Removed)
reparation N-{(1S)-2-amino-1-f3-(trifluoromethyl)phenyl]ethyl)--4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 100, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (348 mg, 1 0 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 471 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 24 (t, J=7 33 Hz, 3 H) 2 54 (d, J=8 84 Hz, 2 H) 2 74 (q, J=7 24 Hz, 2 H) 3 05 - 3 16 (m, 1 H) 3 26 (d, J=4 80 Hz, 1 H) 3 66 - 3 79 (m, 3 H) 4 54 (br s , 1 H) 7 47 - 7 56 (m, 2 H) 7 57 - 7 76 (m, 4 H)
Example 217
(Formula Removed)
reparation N-[(1S)--1-(aminomethyl)-3-methylbutyll-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)--2-thiophenecarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 106, except substituting 2-[(2S)-2-amino-4-methylpentyl]-1H-isoindole-1,3(2H)-dione (99 mg, 0 4 mmol) for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 376 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 0 99 (t, J=6 44 Hz, 6 H) 1 42 (s, 1 H) 1 63 -1 80 (m, 2 H) 3 04 (br s , 1 H) 3 14 (d, J=3 54 Hz, 1 H) 3 80 (s, 3 H) 4 42 (br s , 1 H) 7 59 (s, 1 H) 7 84 (d, J=6 06 Hz, 1 H)
Experiment 218
(Formula Removed)
reparation N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
a) methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate
(Formula Removed)
o a solution of methyl 5-ethyl-4-( 1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (600 mg, 2 40 mmol) [prepared according to Example 98] in Tetrahydrofuran (THF) (10 ml) was added N-bromosuccinimide (512 mg, 2 88 mmol) The mixture stirred in a sealed tube at 70 °C for 2h The reaction mixture was then concentrated and purified with silica gel using a 0-5% gradient (ethyl
acetate / hexane) to afford the title compound as an off-white solid LC-MS (ES) m/z 330 (M+H)+
b) methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate
(Formula Removed)
solution of methyl 4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (635 mg, 1 93 mmol), potassium carbonate (1 33 g, 9 64 mmol), PdCI2(dppf) (141 mg, 0 19 mmol) and tnmethylboroxine (0 54 ml, 3 86 mmol) in N.N-dimethylformamide (3 ml) was stirred at 110 °C in a sealed tube for 2h This reaction mixture was concentrated and partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4, concentrated and purified via column chromatography (10-50% EtOAc in hexanes) affording the title compound (488 mg, 96%) as a yellow oil LCMS (ES) m/e 265 (M+H)+
c) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid
(Formula Removed)
solution of methyl 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylate (488 mg, 1 85 mmol) in 6N sodium hydroxide (3 08 ml, 18 5 mmol) and Tetrahydrofuran (10 ml) was stirred at 70 °C in a sealed tube for 1h The resulting solution was cooled and then partitioned between H2O-DCM The aqueous phase was adjusted to pH -4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording the title compound as a yellow foam (448 mg, 1 79 mmol, 96 % yield) as a yellow oil LCMS (ES) m/e 251 (M+H)+
d) 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-
yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-ethyl-2-thiophenecarboxamide
(Formula Removed)
o a solution of 4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxylic acid (250 mg, 1 0 mmol), 2-{(2S)-2-amino-3-[4-(fluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (313 mg, 1 05 mmol)[prepared according to the procedure of Preparation 6] and dusopropylethylamine (0 52 ml, 3 mmol) in DCM at 25 °C was added bromo-tris-pyrrohdino-phosphonium hexafluorophosphate (746 mg, 1 6 mmol) in one portion The solution stirred at 25 °C for 12h and was then partitioned between H20-DCM The aqueous phase was washed several times with DCM and the combined organic fractions were dried over NaaSCU, concentrated and purified via column chromatography (silica, 30-70% EtOAc in hexanes) yielding the title compound as a yellow solid (490 mg, 0 92 mmol, 92 % yield) as a yellow foam LCMS (ES) m/e 531 (M+H)+
e) N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide
To a solution of 4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(4-fluorophenyl)methyl]ethyl}-5-ethyl-2-thiophenecarboxamide (400 mg, 0 75 mmol) in methanol (8 ml) at 25 °C was added hydrazine (0 12 ml, 3 77 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was transferred to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as a yellow solid LC-MS (ES) m/z 401 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 1 28 (t, J=7 58 Hz, 3 H) 2 07 (s, 3 H) 2 75 (m, 2 H) 3 02 (d, J=6 32 Hz, 2 H) 3 22 (br s , 2 H) 3 92 (d, J=2 27 Hz, 3 H) 4 53 (br s , 1 H) 7 02 (t, J=8 59 Hz, 2 H) 7 34 (m, 2H), 7 80 (s, 1 H) δ 13 - 8 25 (m, 1 H)
Example 219
(Formula Removed)
reparation N-[(1S)-2-amino-1-[(3.4-difluorophenyl)methyi1ethyl)--5-methyl-4-(1-methy[-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 103, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 391 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 44 (s, 3 H) 2 91 - 3 02 (m, 2 H) 3 16 (d, J=10 11 Hz, 1 H) 3 24 (dd, J=13 14, 3 54 Hz, 1H) 3 82 (s, 3 H) 4 50 (d, J=3 54 Hz, 1 H) δ 44 (d, J=2 02 Hz, 1H) 7 05 - 7 13 (m, 1 H)7 15-7 25 (m, 2H), 7 67-7 70 (m, 2 H)
Example 220
(Formula Removed)
reparation N-{(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 102, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 425 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 40 (s, 3 H) 2 95 - 3 03 (m, 2 H) 3 23 - 3 26 (m, 2 H) 3 76 (br, s, 3H) 4 96 - 4 52 (m, 1H), 7 07-7 15 (m, 2H) 7 22 -7 28 (m, 1H)7 55-7 77(m, 2H)
Example 221
(Formula Removed)
reparation N-|(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 104, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isomdole-1,3(2H)-dione LC-MS (ES)m/z411 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 3 02 (d, J=7 33 Hz, 2 H) 3 24 (d, J=6 82 Hz, 2 H) 4 01 (d, J=7 58 Hz, 3 H) 4 52 (d, J=7 07 Hz, 1 H) δ 78 (d, J=11 87 Hz, 1 H) 7 08 -7 21 (m, 1 H) 7 26 - 7 28 (m, 1 H) 7 94 - 8 08 (m, 2 H)
Example 222
(Formula Removed)
reparation N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 106, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [Prepared according to the procedure of Preparation 6] for 2-[(2S)-2-amino-3-cyclohexylpropyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 446 (M+H)+, 1H
NMR (400 MHz, MeOD) δ ppm 2 95 - 3 05 (m, 2 H) 3 22 - 3 23 (m, 2 H) 3 79 (s, 3 H) 4 52 (br s , 1 H) 7 08 - 7 21 (m, 2 H) 7 27 - 7 26 (m, 2 H) 7 60 (s, 1 H) 7 83 (br s,1H)
Example 223
(Formula Removed)
reparation N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 99, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (332 mg, 1 05 mmol) [prepared according to Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 405 (M+Hf, 1H NMR (400 MHz, MeOD) δ ppm 2 09 (s, 15 H) 2 42 (s, 3 H) 3 04 (d, J=7 07 Hz, 2 H) 3 27 (d, J=4 80 Hz, 2 H) 3 88 - 4 01 (m, 3H) 4 54 (br s , 1 H) 7 08 - 7 21 (m, 2 H) 7 29 (d, J=7 58 Hz, 1 H) 7 92 (br s , 1H) δ 15 - 8 26 (m, 1 H)
Example 224
(Formula Removed)
reparation N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
a) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
solution of methyl 4-bromo-2-furancarboxylate (470 mg, 2 29 mmol), potassium carbonate (1584 mg, 11 46 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (525 mg, 2 52 mmol)[prepared according to Preparation 7] and bis-(tn-t-butylphosphine)Palladium (0) (58 6 mg, 0 12 mmol) in 1,4-dioxane (9 55 ml) and water (1 9 ml) was stirred at 80 °C After 1 hr, the solution was partitioned between H2O-DCM and the aqueous phase was washed several times with DCM The combined organic fractions were dned over Na2SO4, concentrated and punfied via column chromatography (30% EtOAc in hexanes) affording the title compound (124 mg, 0 60 mmol, 26 % yield) as a white powder LCMS (ES) m/e 206 (M+H)+
b) methyl 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
solution of methyl 4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (412 mg, 2 0 mmol) and N-chlorosuccinimide (267 mg, 2 0 mmol) in DMF (10 mL) was heated at 75 °C for 30 minutes Another batch of N-chlorosuccinimide (267 mg, 2 0 mmol) was added After 1 hr, the mixture was concentrated and purified using silica gel and elutmg with 0-55% ethyl acetate / hexane to afford the title compound as a white solid (225 mg, 0 82 mmol, 71 % yield) LCMS (ES) m/e 276 (M+H)+
c) 5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid
(Formula Removed)
solution of methyl 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylate (224 mg, 0 82 mmol) in 6N sodium hydroxide (1 36 ml, 8 2 mmol) and tetrahydrofuran (5 ml) was stirred at 70 °C in a sealed tube for 1h The
resulting solution was cooled and then partitioned between H20-DCM The aqueous phase was adjusted to pH ~4 and then washed several times with DCM The combined organic fractions were dried over Na2SO4 and concentrated affording the title compound (201 mg, 0 77 mmol, 94 % yield) as a yellow oil LCMS (ES) m/e 262 (M+H)+
d)5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S>-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-furancarboxamide
(Formula Removed)
o a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid (200 mg, 0 77 mmol)[prepared according to the procedure of Preparation 6], 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione (254 mg, 0 80 mmol) and N,N-diisopropylethylamine (0 40 ml, 2 30 mmol) in DCM (10 ml) was added bromo-tris-pyrrohdino-phosphonium hexafluorophosphate (536 mg, 115 mmol) After stirring at ambient temperature for 20 hrs, the mixture was concentrated and purified with silica gel column elutmg with gradient (0-50% ethyl acetate/hexanes) to afford the title compounds as an off-white foamy solid (304 mg, 0 54 mmol, 71% yield) LCMS (ES) m/e 560(M+H)+
e) /S/-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
To a solution of 5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-furancarboxamide (304 mg, 0 54 mmol) in methanol (5 ml) at 25 °C was added hydrazine (0 08 ml, 2 7 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as a yellow solid LC-MS (ES) m/z 430(M+H)+, 1H NMR (400 MHz,
MeOD) δ ppm 2 91 - 3 05 (m, 2 H) 3 17 - 3 28 (m, 2 H) 3 81 (s, 3 H) 4 57 (d, J=9 60 Hz, 1 H) 7 12 (br s , 1 H) 7 18-7 28 (m , 2 H) 7 36-7 39 (m, 1 H) 7 58 (s, 1 H)
Example 225
(Formula Removed)
reparation N-[(1S)-2-amino-1-[(3,4-difluoroDhenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 127, except substituting 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (147 mg, 0 46 mmol) [prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z395 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 90 - 3 06 (m, 2 H) 3 18-3 24 (m, 2 H) 3 98 (d, J=17 68 Hz, 3 H) 4 52 - 4 64 (m, 1 H) δ 67 (d, J=1 77 Hz, 1 H) 7 19 (dd, J=10 11, 8 59 Hz, 2 H) 7 26 (td, J=9 73, 2 27 Hz, 1 H) 7 51 (d, J=19 96 Hz, 1 H) 7 93 (br s , 1 H)
Example 226
(Formula Removed)
reparation A/4(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
a) methyl 4-bromo-5-methyl-2-furancarboxylate
(Formula Removed)
ethyl 4,5-dibromo-2-furancarboxylate (3 7 g, 13 03 mmol) [prepared according to Example 127] and trans-dichlorobis(priphenylphosphine)Palladium (II) (0 46 g, 0 65 mmol) were combined in THF (50ml) to give a yellow suspension A THF solution of methylzinc chlonde (11 40 ml, 22 81 mmol) was added dropwise at room temperature After stirring at ambient temperature for 20h, the solution was concentrated and punfied using silica gel and eluting with 0-30% ethyl acetate / hexane to generate the title compound as a white solid (1 45 g, 6 61 mmol, 51% yield) LC-MS (ES) m/z 220 (M+H)+
b) 5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid
(Formula Removed)
o a solution of methyl 4-bromo-5-methyl-2-furancarboxylate (500 mg, 2 28 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (950 mg, 4 57 mmol)[prepared according to Preparation 7] and potassium carbonate (315 mg, 2 28 mmol) in 1,4-dioxane (8 mL) and water (2 0 mL) was added bis(tn-t-butylphosphine)Palladium (0) (117 mg, 0 23 mmol) The mixture was heated to 80 °C and after 15h the reaction mixture was concentrated The residue was partitioned between DCM and water The organic layer was concentrated and dissolved in tetrahydrofuran (THF) (8 0 mL) The solution was treated with 6N aqueous solution of sodium hydroxide (3 80 mL, 22 83 mmol) and heated to 75 °C After 15h, the reaction mixture was concentrated and partitioned between DCM and water The aqueous layer was acidified to pH ~ 3 with 2N HCI aqueous solution and extracted several times with DCM The organic fractions were combined and concentrated to afford the title compound as a yellow solid (401 mg, 1 95 mmol, 85% yield) LC-MS (ES) m/z 207 (M+H)+
c)N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
o a solution of 5-methyl-4-( 1 -methyl- 1H-pyrazol-5-yl)-2-furancarboxylic acid (200 mg, 0 97 mmol), 2-[(2S)-2-amino-3-(2,4-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (322 mg, 1 02 mmol)[prepared according to the procedure of Preparation 6] and N,N-dnsopropylethylamine (0 51 ml, 2 91 mmol) in DCM (10 ml) was added bromo-tns-pyrrohdino-phosphonium hexafluorophosphate (678 mg, 1 46 mmol) After stirring at ambient temperature for 20h, the mixture was concentrated and purified using silica gel and eluting with a 0-50% ethyl acetate/hexane gradient to afford the title compound as an off-white foamy solid (181 mg, 0 36 mmol, 37% yield) LCMS (ES) m/e 505 (M+H)+
e)N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
To a solution of N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
(176 mg, 0 35 mmol) in methanol (5 ml) at 25 °C was added hydrazine (0 22 ml, 0 7 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1 % NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as an off-white solid
LC-MS (ES) m/z 430(M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 91 - 3 05 (m, 2 H) 3 17 - 3 28 (m, 2 H) 3 81 (s, 3 H) 4 57 (d, J=9 60 Hz, 1 H) 7 12 (br s , 1 H) 7 18-7 28 (m , 2 H) 7 36-7 39 (m, 1 H) 7 58 (s, 1 H)
Example 227
(Formula Removed)
reparation N-K1S)-2-amino-1-[(3.4-drfluorophenyl]methyl]ethylM-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid
(Formula Removed)
o a solution of 5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxylic acid (150 mg, 0 73 mmol)[prepared in Example 126] in THF (10 ml) was added N-chlorosuccinimide (97 mg, 0 73 mmol) After stirring at 70 °C for 20h in a sealed tube, the mixture was partitioned between H20-DCM and the pH of the aqueous phase was adjusted to ~4 The aqueous phase was washed several times with DCM and the combined organic fractions were dried over Na2SO4 and concentrated affording the title compound as an off-white foamy solid (152 mg, 0 63 mmol, 87% yield) LC-MS (ES) m/z 241 (M+H)+
b) 4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-
dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-5-methyl-2-furancarboxamide
(Formula Removed)
o a solution of 4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylic acid (150 mg, 0 62 mmol), 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (207 mg, 0 65 mmol)[prepared according to the procedure of Preparation 6] and N,N-dnsopropylethyl amine (0 33 ml, 1 87 mmol) in DCM (10 ml) was added bromo-tris-pyrrohdino-phosphonium
hexafluorophosphate (436 mg, 0 94 mmol) After stirring at ambient temperature for 20h, the mixture was concentrated and punfied using silica gel and eluting with a gradient of 0-50% ethyl acetate/hexane to afford the title compound as an off-white foam (200 mg, 0 35 mmol, 57% yield) LC-MS (ES) m/z 539 (M+H)+
c) AK(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
To a solution of 4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-{(1S}-2-(3,4-dlfluorophenyl)-1-[(1,3-dlOxo-1,3-dlhydro-2H-lsolndol-2-yl)methyl]eth^^ furancarboxamide (210 mg, 0 39 mmol) in methanol (5 ml) at 25 °C was added hydrazine (0 02 ml, 0 78 mmol) dropwise After 12h, the solution was concentrated, dry loaded onto silica and purified by column chromatography (5% MeOH in DCM (1% NH4OH)) The free base was converted to the HCI salt by addition of excess 4M HCI in dioxane (1 ml) to the residue in MeOH (2 ml) affording the HCI salt of the title compound as an off-white solid LC-MS (ES) m/z 409(M+H)\ 1H NMR (400 MHz, MeOD) δ ppm 2 38 (s, 3 H) 2 98 (d, J=9 35 Hz, 1 H) 3 01 (d, J=5 56 Hz, 1 H) 3 23 (dd, J=13 01, 8 97 Hz, 2 H) 3 73 - 3 83 (m, 3 H) 4 56 (d, J=9 35 Hz, 1H) 7 17 (s, 1 H) 7 18 - 7 32 (m, 3 H) 7 57 (s, 1 H)
Example 228
(Formula Removed)
reparation of N-[(1S)-2-amino-1-[(3,4-difluorophenv0methyl]ethyl}-5-chloro-4-(1.4-dimethyl-1H-pyrazol-5-vn-2-furancarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 118, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (253 mg, 0 8 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H>-dione LC-MS (ES) m/z 409
(M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 05 - 2 15 (m, 3H) 2 91 - 3 07 (m, 2 H) 3 16 - 3 26 m , 2 H) 3 91 (br s , 3 H) 4 57 - 4 59 (m , 1 H) 7 09 - 7 31 (m, 3 H) 7 51 (br s , 1 H) δ 07 (br s , 1 H)
Example 229
(Formula Removed)
reparation of N-{(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl}-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
The title compound was prepared as a yellow solid according to the procedure of Example 119, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (302 mg, 0 95 mmol)[prepared according to the procedure of Preparation 6] for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 389 (M+H)+, 1H NMR (400 MHz, MeOD) δ ppm 2 04 - 2 15 (m, 3 H) 2 35 - 2 47 (m, 3 H) 2 99 - 3 02 (m„ 2 H) 3 18 - 3 24 (m, 2 H) 3 86 - 3 96 (m, 3 H) 4 56 - 4 62 (m, 1H) 7 16-7 26 (m, 4H)8 07(s, 1 H)
Example 230
N-inS)-2-amino-1-[(3-f1uorophenyl)methyl]ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-ylV2-thiophenecarboxamide
(Formula Removed)
) 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
o a solution of 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (220 mg, 0 857 mmol) [from Example 92] in DCM (5 mL) at 25 °C was added PyBrOP (440 mg, 0 857 mmol) in one portion, followed by addition of DIPEA (1 5 mL, 8 59 mmol) After 10 mm, diamine 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione (256 mg, 0 857 mmol) was added to above solution After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (0 39 g, 81%) as a white solid LC-MS (ES) m/z = 537 (M+H)+
b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
t RT, NH2NH2 (0 11 mL, 3 54 mmol) was added to 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (380 mg, 0 708 mmol) in MeOH (4 mL) After 10h, the solvent was removed under vaccum to give a residue, which was dissolved in DCM (15 mL), and washed with H20 (10 mL x 3)
To the above DCM solution was added aqueous HCI (12 N, 2 95 mL, 35 4 mmol) After 1h, the aqueous phase was separated, and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (160 mg, 47%) as a white solid LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 9 18-8 8(m, 1H), 8 28-8 08 (m, 4H), 8 04 (s, 1H), 7 27-7 43 (m, 1),
7 08-7 24 (m, 2H), 6 91-7 08 (m, 1H), 4 4-4 34 (m, 1H), 4 14 (q, J = 7 3 Hz, 2H), 3 15-2 80 (m, 4H), and 1 29 (t, J = 7 3 Hz, 3H)
Example 231
N-(nS)-2-amino-1-ff3-(trifluoromethyl]phenyl]methyl)ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
he title compound was prepared as an off-white solid according to the procedure of Example 230, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (339 mg, 0 97 mmol)for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 457 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 92 (br s, 1H), 7 89-7 80 (m, 1H), 7 63-7 59 (m, 3H), 7 56-7 48 (m, 2H), 4 61-4 53 (m, 1H), 4 21-4 15 (m, 2H), 3 46-3 21 (m, 2H), 3 18-3 02 (m, 2H), and 1 35 (t, J = 7 3 Hz, 3H)
Example 232 rV-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-vl)-2-thiophenecarboxamide
(Formula Removed)
he title compound was prepared as an off-white solid according to the procedure of Example 230, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (584 mg, 1 95 mmol) for 2-[(2S)-2-
amino-3-(3-fluoropheny:)oropyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 407 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 93 (d, J = 1 3 Hz, 1H), 7 85 (d, J = 1 3 Hz, 1H), 7 59 (s, 1H), 7 34-7 31 (m, 2H), 7 05-7 01 (m, 2H), 4 52 (m, 1H), 4 19 (q, J = 7 3 Hz, 2H), 3 26-3 12 (m, 2H), 3 05-2 94 (m, 2H), and 1 36 (t, J = 7 3 Hz, 3H)
Example 233
A/4(1S>-2-amino-1-[(3.4-difluorophenyl]fnethyl]ethyl)-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
he title compound was prepared as an off-white solid according to the procedure of Example 230, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isomdole-1,3(2tf)-dione (200m g, 0 63 mmol) for 2-[(2S>-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 425(M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 8 88 (d, J = 8 3 Hz, 1H), 8 16-8 06 (m, 4H), 7 71 (s, 1H), 7 39-7 30 (m, 2H), 7 12 (m, 1H), 4 35 (m, 1H), 4 14 (q, J = 7 1 Hz, 2H), 3 08-2 87 (m, 4H), and 1 29 (t, J = 7 1 Hz, 3H)
Example 234
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-(4-bromo-1-ethyl-1H-pyrazol-5-vlV2-thiophenecarboxamide
(Formula Removed)
4-(4-bromo-1 -ethyl-1 W-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
he title compound was prepared as an off-white solid according to the procedure of Example 93, except substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2W)-dione (149 mg, 0 50 mmol) for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z = 582 (M+H)+
b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-ethyl-1H-pyrazol-
5-yl)-2-thiophenecarboxamide
(Formula Removed)
he title compound was prepared as an off-white solid according to the procedure of Example 230(b), except substituting A/~{(1S)-2-amino-1-[{3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (240 mg, 0 41 mmol) for 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide LC-MS (ES) m/z = 452(M+H)+,
1H NMR (d6-DMSO, 400 MHz) δ ppm 9 24-8 85 (m, 1H), 8 26-8 13 (m, 4H), 8 03 (s, 1H), 7 03 (s, 1H), 7 34 -7 29 (m, 1H), 7 16-7 13 (m, 2H), 7 05-7 00 (m, 1H), 4 39 (m, 1H), 4 14 (q, J = 7 3 Hz, 2H), 3 06-2 96 (m, 4H), and 1 28 (t, J = 7 3 Hz, 3H)
Example 235 N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1N-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
Methyl 5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
o a solution of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (300 mg, 1 17 mmol) in THF (2 mL) was added Na2CO3 (2M, 1 76 mL, 3 52 mmol), Pd(dppf)CI2 (86, 0 117 mmol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (313 mg, 1 41 mmol) The reaction mixture was heated to 80 °C in a sealed tube under N2 After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-50%) to afford the title compound (0 272 g, 82%) as a light yellow syrup LC-MS (ES) m/z = 271 (M+H)+
b) Methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
ethyl 5-chloro-4-[(1Z)-1-(1-ethyl-2-methylidenehydrazino)-1-propen-1-yl]-2-thiophenecarboxylate (260 mg, 0 96 mmol) and 1-chloro-2,5-pyrrolidmedione (154 mg, 1 15 mmol) in THF (4 mL) were heated at 70 °C under N2 for 2 h, concentrated and punfied on silica (EtOAc/Hex, 10-30%) to afford the title compound (0 281g, 83%) as a syrup LC-MS (ES) m/z = 305 (M+H)+
c)5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
a solution of methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (260 mg, 0 85 mmol) in THF/H2O (4 mL/1 mL) was added KOH (478 mg, 8 52 mmol) The reaction mixture was heated to 50° C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly without further purification
d) 5-chloro-4-(4-chloro-1-ethyl-1 tf-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-
thiophenecarboxamide
(Formula Removed)
o a solution of 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (~0 85 mmol) in DCM (5 mL) at 25 °C was added bromo-tns-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (477 mg, 1 02 mmol) in one portion, followed by the addition of DIPEA (0 744 mL, 4 26 mmol) After stirring for 10 mm, diamine 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1 3(2H)-dione (356 mg, 1 02 mmol) was added to the above solution
After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (0 416 g, 79%) as a white solid LC-MS (ES) m/z = 621 (M+H)+
e)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
-Chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (410 mg, 0 66 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (1 04mL, 33 mmol) The reaction was stirred over 5h at RT, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 95 -5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water and neutralized by aminonium hydroxide The mixture was extracted with DCM (5 mL x 3), dned over Na2SO4 and concentrated to give a free base of the title compound, which was dissolved in MeOH (2 mL), and treated with HCI (4 M in dioxane, 1 6 mL) After stirring overnight, the reaction solution was concentrated to give the title compound (160 mg, 42 %) as a di-HCI salt LC-MS m/z = 491 (M+H)+,1H NMR (d6-DMSO, 400 MHz) δ ppm 9 34 (J = 8 8 Hz, 1H), 8 38-8 03 (m, 3H), 7 77 (s, 1H), 7 69-7 59 (m, 2H), 7 53 (dd, J = 7 3, 7 3 Hz, 1H), 7 42(dd, J = 7 6, 7 6 Hz, 1H), 4 48 (m, 1H), 4 13-4 00 (m, 2H), 3 17-2 90 (m, 4H), and 1 29 (m, 3H)
Example 236
N-((1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
) 5-chloro4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-
2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyljethyl}-2-thiophenecarboxamide
(Formula Removed)
o a solution of 5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid (180 mg, 0 618 mmol) [from Example 235(c)] in DCM (5 mL) at 25 °C was added PyBrOP in one portion, followed by addition of DIPEA (0 54 mL, 3 09 mmol) After stirring for 10 mm, 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (203 mg, 0 68 mmol) was added to above solution in one portion After stirring for 2h, the solution was concentrated and punfied via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (285 mg, 77%) as a white solid LC-MS (ES) m/z = 571 (M+H)+
b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -ethyl-1 H-
pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
At RT, NH2NH2(0 15 ml, 4 78 mmol) was added to 5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (280 mg, 0 49 mmol) in MeOH
(5 mL) After 10h the solvent was removed under vaccum The resulting residue was dissolved in DCM (15 mL), and washed with H20 (10 mL x 3) To the DCM solution was added HCI (12 N, 1 0 mL) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the tilte compound (179 mg, 67 5%) as an off-white solid LC-MS (ES) m/z = 441 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 72-7 67 (m, 1H), 7 62 (s, 1H), 7 35-7 29 (m, 1H), 7 14-7 17 (m, 2H), 7 00-6 96 (m, 1H), 4 53 (m, 1H), 4 14-3 97 (m, 2H), 3 37-3 15 (m, 2H), 3 07-2 97 (m, 2H), and 1 33 (t, J = 7 1 Hz, 3H)
Example 237 /N/-K1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-Dvrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound (190 mg, 70%) was prepared as an off-white solid according to the procedure of Example 236, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2f/)-dione (231 mg, 0 77 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 441(M+H)\ 1H NMR (d4-MeOD, 400 MHz, no calibration of chemical shift of MeOD solvent peak) δ ppm 6 09 (s, 1H), 6 08 (s, 1H), 5 78-5 75 (m, 2H), 5 53-5 48 (m, 2H), 2 96 (m, 1H), 2 51 (m, 2H), 1 71-1 67 (m, 1H), 1 62-1 54 (m, 1H), 1 49-1 38 (m, 2H), and -0 21 (t, J = 7 3 Hz, 3H)
Example 238 N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound (228 mg, 58 2%) was prepared as an off-white solid according to the procedure of Example 236, excepv substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (156 mg, 0 45 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 491(M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 66-7 49 (m, 6H), 4 60-4 47 (m, 1H), 4 09-4 01 (m, 2H), 3 36-3 18 (m, 2H), 3 16-3 01 (m, 2H), and 1 33 (t, J = 7 1 Hz, 3H)
Example 239
N-((1S)-2-amino-1 -f[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1 -methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide
(Formula Removed)
a) methyl 4-bromo-5-iodo-2-thiophenecarboxylate
(Formula Removed)
At -78 °C, nBuLi (2 05 mL, 5 13 mmol) was added to a solution of methyl 4,5-dibromo-2-thiophenecarboxylate (1 4 g, 4 67 mmol) in THF (10 mL) After the mixture was stirred for 30 mm, l2 (1 185 g, 4 67 mmol) was added in 3 mL THF After the resulting solution was stirred at -78 °C for 1 h, it was quenched with Na2S203 at -78 °C, and warmed to RT The reaction mixture was extracted with DCM, dried over Na2SO4, and concentrated The crude product was purified on silica (EtOAc/Hex, 0-10%) to give the title compound (1 3 g, 56 %) as a yellow solid LC-MS (ES) m/z 348(M+H)+
b) methyl 4-bromo-5-(trifluoromethyl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-5-iodo-2-thiophenecarboxylate (500 mg, 1 44 mmol), copper (I) iodide (137 mg, 0 72 mmol) and potassium fluoride (251 mg, 4 32 mmol) in DMF/HMPA (5 ml/5 mL) was added methyl
difluoro(fluorosulfonyl)acetate (1 1g, 5 76 mmol) The mixture was heated at 70 °C under N2 in a sealed tube After 1h, the reaction was quenched with NH4CI (sat'd) (2 mL), extracted with ether (5 mL x 5) and washed with distilled water (5 mL x 5) The combined organic phase was dried over Mg2SO4 and purified on silica (EtOAc/Hex, 20-50%) to afford the title compound (0 82 g) containing a 60% inseparable impurity LC-MS m/z (ES) 290 (M+H)+
c) methyl 4-(1 -methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylate
(Formula Removed)
A mixture of methyl 4-bromo-5-(trifluoromethyl)-2-thiophenecarboxylate (0 8 g, 40% purity, 1 11 mmol), 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (0 299 g, 1 434 mmol), tetrakis (0 128 g, 0 11 mmol) and K2CO3 (0 459 g, 3 32 mmol) in dioxane/H20 (5 mL/1 mL) was heated to 70° C in a sealed tube After 12h, the reaction mixture was concentrated under vacuum and punfied on silica (EtOAc/Hex, 40-60%) to afford the title compound (0 25 g, 70%) as a light yellow solid LC-MS (ES) m/z 291 (M+H)+
d)4-(1-methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylate (250 mg, 0 77 mmol), in THF/H20 (3 mL/0 3 mL), was added KOH (217 mg, 3 88 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were concentrated under vacuum to give crude acid (235 mg, 80% pure) which was used directly in the next step without further purification LC-MS (ES) 277 (M+H)+
e) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-( 1 -methyl-1 H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide
(Formula Removed)
At room temperature, a mixture of 4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxylic acid (235 mg, 80% punty, 0 68 mmol), phosphoniumhexafluorophosphate (PyBrOP) (381 mg, 0 19 mmol), DIPEA (0 59 mL, 3 4 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyi]propyl}-1H-isoindole-1,3(2H)-dione (261 mg, 0 75 mmol) in DCM (5 mL) was stirred for 2h The reaction solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (386 mg, 86%) as a white solid LC-MS (ES) 607 (M+H)+
f)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide
(Formula Removed)
N-((1S)-2-(1,3-dioxo-1,3-dihydro-2/y-isoindol-2-yl)-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide (150 mg, 0 25 mmol) was dissolved in MeOH (5 mL) and was treated with NH2NH2 (0 76 mL, 24 2 mmol) The reaction was stirred over 5 h, concentrated and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 95 -5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water, and aminonium hydroxide (0 32 mL, 30% wt%, 2 46 mmol) was added The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4 and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH (2 mL), and treated with HCI (4 M in dioxane, 0 62 mL, 2 48 mmol) After stirnng overnight, the reaction solution was concentrated to give the title compound (90 mg, 66%) as a white solid LC-MS (ES) m/z 477 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 8 00 (d, J = 1 1 Hz, 1H), 7 77 (d, J = 1 8 Hz, 1H), 7 72 (d, J = 7 8 Hz, 1H), 7 59-7 52 (m, 2H), 7 44 (d, J = 7 4 Hz, 1H), 6 57 (d, J = 2 0 Hz, 1H), 4 67 (m, 1H), 3 87 (s, 3H), and 3 37-3 14 (m, 4H)
Example 240 N-((1S)-2-amino-1-{r2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole
(Formula Removed)
To a suspension of NaH (4 3 g, 60%, 108 mmol) in THF (200 mL) at RT was added 4-methyl-1 H-pyrazole (6 8 g, 83 mmol) dropwise After 30 mm, Etl (8 03 mL, 99 mmol) was added dropwise After the reaction was complete (2h), the reaction solution was diluted with saturated aqueous NH4CI and extracted with ether The ether fractions, were washed with water (3 x 100 mL), and dried over MgSO4
At 0°C, to the above ether solution of 4-methyl pyrazole was added n-BuLi (36 4 mL, 2 5 M in Hexane, 91 mmol) dropwise The reaction solution was stirred for 1 hour at RT and then cooled to -78 °C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-isopropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (18 49 g, 99 mmol) After 15 mm at -78°C, the reaction was allowed to warm to 0°C over 1hour The reaction was diluted with saturated NH4CI solution and extracted with DCM The organics were dried over Na2SO4 and concentrated under vacuum to afford 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (16 g, 80% purity) as a syrup which was used without further purification LC-MS (ES) m/z 155 (M+H)+ for [RB(OH)2]
b) methyl 4-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A mixture of methyl 4-bromo-2-thiophenecarboxylate (300 mg, 1 36 mmol), 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (449 mg, 1 9 mmol), Pd(Ph3P)4 (157mg, 0 136 mmol), and K2CO3 (536 mg, 4 07 mmol) was heated at 70 °C for 2h, concentrated and purified on silica (EtOAc/Hex, 10-30%) to afford the title compound (0 27 g, 79%) as a syrup LC-MS m/z = 251 (M+H)+
c) 4-(1-ethyl-4-methyl-1 H-pyrazoI-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of methyl 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (270 mg, 1 08 mmol) in THF/H20 (2 mL/0 4 mL) was added KOH (303 mg, 1 79 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid (240 mg), which was used directly in the next step without further purification LC-MS m/z = 237 (M+H)+
d)N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a mixture of 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (240 mg, 1 02 mmol) and bromo-tris-pyrrohdino
phosphoniumhexafluorophosphate (Pybrop) (568 mg, 1 22 mmol) was added DIPEA (1 77 ml, 10 16 mmol) After 10 mm, 2-{(2S,4Z)-2-amino-4-[(1E)-1-(trifluoromethyl)-1-propen-1-yl]-4,6-heptadien-1-yl}-1H-isoindole-1,3(2H)-dione (425 mg, 1 22 mmol) was added After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (365 mg, 63%) as a white solid LC-MS (ES) m/z 567 (M+H)+
e)N-((1S)-2-amin(>H[2Hi:t.fluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl}-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazo!-5-yl)-2-thiophenecarboxamide (365 mg, 0 64 mmol) was dissolved in MeOH (8 mL) and was treated with NH2NH2 (0 1 mL, 3 22 mmol) The reaction was stirred over 5 h, concentrated and punfied by reverse-phase HPLC (C18 column H20/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water, and aminonium hydroxide (4 18 mL, 30% wt%, 32 2 mmol) was added The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4 and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH (2 mL) and treated with HCI (4 M in dioxane, 3 22 mL, 12 88 mml) After stirring overnight, the reaction solution was concentrated to give the title compound (190 mg, 56 7%) as a white solid LC-MS (ES) m/z 437 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 8 96 (m, 1H), 8 17-8 04 (m, 4H), 7 87 (s, 1H), 7 69 (d, J = 7 6 Hz, 1H), 7 62 (m, 1H), 7 53 (dd, J = 7 3, 7 3 Hz, 1H), 7 42 (d, J = 7 6 Hz, 1H), 7 38 (s, 1H), 4 50 (m, 1H), 4 09 (q, J = 7 3 Hz, 2H), 3 18-2 98 (m, 4H), 2 00 (s, 3H), and 1 27 (t, J = 7 3 Hz, 3H)
Example 241
(N-{(1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-vl)-2-thiophenecarboxamide
(Formula Removed)
a) N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-
fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (125 mg, 0 53 mmol) [from Example 240(c)] in DCM (5 mL) at 25 °C was added bromo-tris-pyrrohdino phosphoniumhexafluorophosphate(PyBrOP) in one portion (350 mg, 0 75 mmol), followed by addition of DIPEA (0 7 ml, 4 0 mmol) After 10 mm, 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (180 mg, 0 60 mmol) was added to above solution After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (258 mg, 94%) as a white solid LC-MS(ES)m/z 517(M+H)+
b) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1 H-pyrazol-
5-yl)-2-thiophenecarboxamide
(Formula Removed)
At RT, NH2NH2 (0 1 mL, 3 19 mmol) was added to N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (252 mg, 0 49 mmol) in MeOH (5 ml) After 10h, the solvent was removed under vacuum The resulting residue was dissolved in DCM (10 mL) and washed with H2O (10 mL x 3)
To the above DCM solution was added HCI (36%, 2 mL) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was
removed under high vacuum to give the title compound (170 mg, 72%) as an off-white solid LC-MS(ES) m/z 387 (M+H)+ NMR (de-DMSO, 400 MHz) S ppm 8 87 (d, J = 8 9 Hz, 1H), 8 08 (br s, 2H), 8 01 (s, 1H), 7 08 (s, 1H), 7 37 (s, 1H), 7 35-
7 29 (m, 1H), 7 16-7 10 (m, 2H), 7 05-7 00 (m, 1H), 4 38 (m, 1H), 4 07 (q, J = 7 3
Hz, 2H), 3 04-2 94 (m, 4H), 2 00 (s, 3H), and 1 26 (t, J = 7 3 Hz, 3H)
Example 242
N-((1S)-2-amino-1-^3-(trifluoromethyl]Dhenyl]methyltethyl)-4-M-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenev,3rboxamide
(Formula Removed)
The title compound (180 mg, 67%) was prepared as an off-white solid according to the procedure of Example 241, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (220 mg, 0 63 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione LC-MS (ES) m/z 437 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 8 96 (d, J = 8 84 Hz, 1H),
8 15 (m, 2H), 8 04 (d, J =1 3 Hz, 1H), 7 86 (d, J = 1 3 Hz, 1H), 7 69-7 49 (m, 4H),
7 36 (s, 1H), 4 39 (m, 1H), 4 09 (q, J = 7 1 Hz, 2H), 3 11-3 00 (m, 4H), 1 99 (s, 3H),
and 1 25 (t, J = 7 1 Hz, 3H)
Example 243
A/4(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-vl V-2-thiophenecarboxa mide
(Formula Removed)
The title compound was prepared as an off-white solid according to the procedure of Example 241, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (160 mg, 0 536 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 387 (M+H;+ NMR (d6-DMSO, 400 MHz) δ ppm 8 90 (d, J = 8 6 Hz, 1H), 8 13 (m, 2H), 8 03 (d, J =1 3 Hz, 1H), 7 87 (d, J = 1 3 Hz, 1H), 7 38-7 30 (m, 3H), 7 12-7 08 (m, 2H), 4 36 (m, 1H), 4 07 (q, J = 7 1 Hz, 2H), 3 07-2 97 (m, 2H), 2 96-2 88 (m, 2H), 2 00 (s, 3H), and 1 25 (t, J = 7 1 Hz, 3H)
Example 244
/\/4(1S)-2-amino-1-[(3,4-difluorophenyl]methyl]ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound (210 mg, 72%) was prepared as an off-white solid according to the procedure of Example 241, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (240 mg, 0 76 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 405 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 8 99 (d, J = 8 34 Hz, 1H), 8 16 (m, 2H), 8 09 (d, J =1 0 Hz, 1H), 7 87 (d, J = 1 0 Hz, 1H), 7 40-7 30 (m, 3H), 7 13 (br s, 1H), 4 36 (m, 1H), 4 08 (q, J = 7 3 Hz, 2H), 3 06-2 99 (m, 2H), 2 96-2 33 (m, 2H), 2 00 (s, 3H), and 1 26 (t, J = 7 3 Hz, 3H)
Example 245 N-(( 1 S)-2-amino-1 -n2-(trifluorc>i-nethyltohenyl]methyl)ethyl)-5-chloro-4-( 1 -ethyl-4-methyl-1H-pyrazol-5-yl)--2-thioDhen3carboxamide
(Formula Removed)
a) Methyl 5-chloro-4-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A mixture of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (230 mg, 0 9 mmol), 1-ethyl-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (425 mg, 1 8 mmol), PdCI2(dppf) (65 9 mg, 0 09 mmol), and sodium carbonate (2N aq, 1 35 mL, 2 7 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube Afte 5h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 40-60%) to afford the title compound (241 mg, 92%) as a light yellow solid LC-MS (ES) m/z = 285 (M+H)+
b) 5-chloro-4-(1 -ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of methyl 5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (260 mg, 0 90 mmol) in THF/H20 (2 mL/2 mL) was added KOH (201 mg, 3 6 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were
concentrated under vacuum to give crude 5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, which was used directly without further punfication LC-MS (ES) m/z 271 (M+Hf
c) 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To the above acid in DCM (5 mL) at 25 °C was added bromo-tns-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (542 mg, 1 16 mmol) in one portion, followed by addition of DIPEA (0 16 mL, 0 90 mmol) After 10 mm, 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (312 mg, 0 90 mmol) was added in one portion After 2h, the reaction solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (278 mg, 49 % for two steps) as a white solid LC-MS (ES) m/z 601 (M+H)+
d)N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
5-Chloro-/S/-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (255 mg, 0 42 mmol) was dissolved in MeOH (2mL) and was treated with NH2NH2 (0 13 mL, 4 2 mmol) The reaction was stirred over 5 h, concentrated and purified by reverse-phase HPLC (C18 column H20/CH3CN, 95-
5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissolved in water and aminonium hydroxide was added The mixture was extracted with DCM (5 mL x 3), dned over Na2SCv and coi.oentrated to give a free base of the title compound The free base compound was dissolved in MeOH (1 mL) and treated with HCI (4 M in dioxane, 2 1 mL) After stirring overnight, the mixture was concentrated to give 120 mrj of the title compound (120 mg, 49%) as an off-white solid LC-MS (ES) m/z 471 (M+H)+, 1H NMR (d4-MeOD, 400 MHz) δ ppm 7 91 (br s, 2h), 7 71 (m, 1H), 7 59 (m, 1H), 7 53 (m, 1H), 7 44 (m, 1H), 4 65 (m, 1H), 4 21 (m, 2H), 3 37-3 14 (m, 4H), 2 07 (s, 3H), and 1 40 (m, 3H)
Example 246
A/4nS)-2-amino-1-[(3-fluoroDhenyl]methyl]ethyl)-5-chloro-4-n-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a)5-chloro-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-
fluorophenyl)methylJethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of 5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (130 mg, 0 48 mmol) [from Example 245(b)] in DCM (5 mL) at 25 °C was added PyBrOP (250 mg, 0 54 mmol) in one portion, followed by addition of DIPEA (0 7 mL, 4 01 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3-
fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (150 mg, 0 50 mmol) was added to above solution After 2h, the reaction mixture was concentrated and punfied via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (210 mg, 79%) as a white solid LC-MS m/z (ES) 551 (M+H)+
b) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyi}-5-chloro-4-(1 -ethyl-4-methyl-1H-pyrazol-5-y!)-2-thiophenecarboxamide
(Formula Removed)
At RT, NH2NH2 (0 1 mL, 3 19 mmol) was added to 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethylH-(1-ethyl-4-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide (201 mg, 0 36 mmol) in MeOH (3 mL) After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (10 mL) and washed with H2O (10 mL x 3) To the DCM solution was added HCI (36%, 2 mL) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (101 mg, 53%) as an off-white solid LC-MS (ES) m/z 421 (M+H)+, 1H NMR (dg-DMSO, 400 MHz) S ppm 9 02 (d, J = 8 3 Hz, 1H), 8 08 (s, 2H), 7 97 (s, 1H),7 42(s, 1H), 7 32(m, 1H), 7 15-7 09 (m, 1H), 7 06-7 01 (m, 1H), 4 35 (m, 1H), 3 95 (m, 2H), 3 05-2 98 (m, 2H), 2 96-2 88 (m, 2H), and 1 92 (s, 3H), and 1 24 (t, J = 6 6 Hz, 3H)
Example 247
N-{(1S)-2-amino-1-[(3.4-difluorophenyl]methyl]ethyl]-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound (95 mg, 50 2%) was prepared according to the procedure of Example 246, except substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (152 mg, 0 48 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H}-dione LC-MS (ES) m/z 439 (M+H)+,1H NMR (d6-DMSO, 400 MHz) δ ppm 9 10 (d, J = 8 6 Hz, 1H), 8 13 (s, 2H), 8 03 (s, 1H), 7 42 (s, 1H), 7 39-7 30 (m, 2H), 7 15-710 (m, 1H), 4 33 (m, 1H), 3 95 (m, 2H), 3 05-2 99 (m, 2H), 2 96-2 88 (m, 2H), 1 92, and 1 24 (t, J = 6 3 Hz, 3H)
Example 248
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl]ethyl)-4-(1,4-diethyl-1H-pyrazol-5-yl)-2-trnophenecarpoxamide
(Formula Removed)
a) Methyl 4-(4-ethenyl-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A mixture of methyl 4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (200 mg, 0 64 mmol), Pd(Ph3P)4 (73 3 mg, 0 06 mmol), and tnbutyl(ethenyl)stannane (302 mg, 0 95 mmol) was heated at 90 °C for 1 h under N2
in a sealed tube The mixture was purified on Silica (10%-20% EtOAc in Hex) to give the title compound (151 mg, 76%) LC-MS (ES) m/z 263 (M+H)+
b) Methyl 4-(1,4-diethyl-1H-pyrazo1-5-yl)-2-thiophenecarboxylate
(Formula Removed)
Pd/C (12 mg, 10%) was added to a solution of ethyl 4-(4-ethenyl-1 -ethyl- 1H-pyrazol-5-yl)-2-thiophenecarboxylate (150 mg, 0 57 mmol) in EtOH The air in the system was removed by vacuum The reaction mixture was stirred for 10h under a balloon of hydrogen gas The reaction was diluted with MeOH (2 mL) and filtered through Celite Concentration of the reaction solution gave the title compound (149 mg, 94%) as a yellow oil LC-MS (ES) m/z 265 (M+H)+
c) 4-(1,4-diethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-
1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of methyl 4-(1,4-diethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (149 mg, 0 56 mmol) in THF/H2O (5 mL/5 mL) was added KOH (158 mg, 2 82 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H20, the pH was adjusted to 3 The mixture was extracted with DCM (5mL x 3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly without of further purification LC-MS (ES) m/z 251 (M+H)+
To the above acid in DCM (5 mL) at 25 °C was added bromo-tris-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (315 mg, 0 68 mmol) in one portion,
followed by the addition of DIPEA (0 98 mL, 5 64 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione (196 mg, 0 56 mmol) After 2h, the solution was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (0 315 g, 94%) as a white solid LC-MS (ES) m/z 581 (M+Hf
d) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-diethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
4-(1,4-diethyl-1 H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (310 mg, 0 53 mmol) was dissolved in MeOH (1 mL) and was treated with NH2NH2 (0 34 mL, 10 68 mmol) The reaction was stirred over 5 h, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water (2 mL) and aminonium hydroxide (3 47 mL, 30%, 26 7 mmol) was added The mixture was extracted with DCM (5 mL x 3), dried over Na2SO4 and concentrated to give a free base of the tile compound The free base was dissolved in MeOH (1 mL) and treated with HCI (4 M in dioxane, 2 1 mL) After stirring overnight, the reaction solution was concentrated to give the title compound (140 mg, 48%) as an off-white solid LC-MS (ES) m/z 451 (M+H)+, 1H NMR (d6-DMSO, 400 MHz) δ ppm 8 25-8 23(m, 1H), 8 16-8 14 (m, 1H), 8 10-8 08 (m, 1H), 7 71-7 67 (m, 1H), 7 65-7 61 (m, 1H), 7 52-7 47 (m, 1H), 7 44-7 39 (m, 1H), 4 69 (m, 1H), 4 45-4 37 (m, 2H), 3 39-3 18 (m, 4H), 2 63-2 55 (m, 2H), 1 49-1 44 (m, 3H), and 1 24-1 19 (m, 3H)
Example 249
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-{1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) methyl 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
Method A
To a solution of methyl 4-bromo-5-chloro-2-thiophenecarboxylate (500 mg, 1 96 mmol) in THF(10 mL) was added aqueous Na2CO3(2N, 3mL, 6 0 mmol), PdCI2(dppf) (143 mg, 0 196 mmol) and 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (522 mg, 2 35 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 10-20%) to afford the title compound (410 mg,77%) as a tan solid LC-MS (ES) m/z 271 (M+H)+
Method B
To a 250 mL sealed flask was added 1,4-dimethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (10 43 g, 47 0 mmol), potassium carbonate (16 23 g, 117 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (10 g, 39 1 mmol) and bis(tn-t-butylphosphine)palladium(0) (1 6 g, 3 13 mmol) in 1,4-dioxane (120 mL) and H20 (20ml) After stirring for 90 mm at 70 °C, the reaction solution was diluted with DCM (100 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was purified on silica gel (hexanes/EtOAC, 10-30%) to give the title compound (7 6 g, 72%) as a tan solid LC-MS (ES) m/z 271 (M+H)+
b) 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
To a solution of methyl 5-chloro-4-(1,4-omethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (7 6 g, 28 1 mmol) in THF/H2O (30 mL/5 mL) was added KOH (4 72 g, 84 mmol) The reaction mixture was heated to 50 °C for 1 h After the mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (50 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid (6 8 g, 94%), which was used directly in the next step without further purification LCMS (ES) m/z 257 (M+H)+
c) 5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-N-{( 1 S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
To a 500 mL round-bottomed flask was added 5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid (6 8 g, 26 5 mmol), 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (8 69 g, 29 1 mmol), N,N-drisopropyl ethylamine (14 mL, 80 mmol) and Pybrop (18 52 g, 39 7 mmol) in dichloromethane (DCM) (100 mL) After stirring at RT for 1h, the reaction solution was washed with H2O (2 x 100mL) and the organic layer was dried Na2SO4, filtered and concentrated The crude product was added to a silica gel column and was eluted with (EtOAc/hexanes, 1 1) to give the title compound (6 1g, 42 9%) as a white solid LCMS (ES) m/z 537 (M+H)+
d) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-
pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
At RT, NH2NH2(4 mL, 127 mmol) was added to 5-ch.oro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (5 2 g, 9 68 mmol) in MeOH (30 ml) After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (200 mL) and washed with H2O (50 mL x 5)
To the above DCM solution was added HCI (36%, 50 mL, 600 mmol) After 1h, the aqueous phase was separated and washed with DCM (50 ml x 5) Water was removed under high vacuum to give the title compound (3 8 g 79%) as a white solid LC-MS (ES) m/z 407 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 8 75 (d, J = 8 8 Hz, 1H), 7 88 (s, 1H), 7 85 (m, 1H), 7 34-7 29 (m, 1H), 7 15-7 09 (m, 2H), 7 00-6 95 (m, 1H), 4 54 (m, 1H), 3 88 (s, 3H), 3 26-3 18 (m, 2H), 3 09-2 98 (m, 2H), and 2 08 (s, 3H)
Example 250
N-((1S)-2-amino-1-{[3-(trifluoromethyl]phenyl]methyl}ethyl)-5-chloro-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound was prepared as a white solid (180 mg, 68%) according to the procedure of Example 249, except substituting 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (209 mg, 0 6 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/7 457 (M+H), NMR (d4-MeOD, 400 MHz) δ ppm 7 94 (s, 1H), 7 90 (s, 1H), 7 65-
7 60 (m, 2H), 7 55-7 48 (m, 2H), 4 55 (m, 1), 3 89 (s, 3H), 3 37-3 27 (m, 2H), 3 16-3 06 (m, 2H), and 2 08 (s, 3H)
Example 251
N-{(1S)-2-amino-1-[(4-fluorophenyl]methyl]ethyl)-5-chloro-4-(1.4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
The title compound was prepared as white solid (95 mg, 39%) according to the procedure of Example 249, except substituting 2-[(2S)-2-amino-3-(4-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (584 mg, 1 96 mmol) for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z407 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 81 (s, 2H), 7 35-7 31 (m, 2H), 7 06-7 01 (m, 2H), 4 51 (m, 1H), 3 89 (s, 3H), 3 25-3 16 (m, 2H), 3 05-2 94 ( m, 2H), and 2 07 (s, 3H)
Example 252 N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
a) methyl 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
To a solution of methyl 4-biomo-2-furancarboxylate (500 mg, 2 439 mmol) in THF (5 mL) was added aqueous Na2CO3 (2N, 3 6 mL, 7 2 mmol), PdCI2(dppf) (160 mg, 0 22 mmol), and 1-ethyl-4-methyl-5-(4,4,3,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (700 mg, 2 96 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-40%) to afford the title compound (460 mg, 76 %) as a light yellow solid LC-MS (ES) m/z 235 (M+H)+
b) N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
To a solution of methyl 4-(1-ethyl~4-methyl-1 H-pyrazol-5-yl)-2-furancarboxylate (210 mg, 0 90 mmol) in THF/H2O (5mL/0 5 mL) was added KOH (200 mg, 3 56 mmol) The reaction mixture was heated to 50 °C for 4 h After the mixture was concentrated and diluted with H2O (2 mL), the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly in the next step without further purification LC-MS (ES) m/z 221 (M+H)+
To the crude 4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxylic acid in DCM (5 mL) at 25 °C was added PyBrOP (370 mg, 0 79 mmol) in one portion, followed by the addition of DIPEA (0 8 mL, 4 58 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (220 mg, 0 74 mmol) was added to the reaction solution After 2h, the reaction mixture was concentrated
and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (164 mg, 54%) as a white solid LC-MS (ES) m/z 501 (M+H)+
c) N-[(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-4-(1 -ethyl-4-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
At RT, NH2NH2 (0 1 mL, 3 19 mmol) was added to a solution of N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamide (150 mg, 0 3 mmol) in MeOH (5 mL)
After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (10 mL) and washed with H2O (10 mL x 3)
To the DCM solution was added HCI (36%, 1 mL, 12 mmol) After 1h, the aqueous phase was separated, and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (80 mg, 57%) as an off-white solid LC-MS (ES) m/z 371 (M+H)+, NMR (d4-MeOD, 400 MHz) S ppm 8 19 (s, 1H), 8 05 (s, 1H), 7 44 (s, 1H), 7 32 (m, 1H), 7 16-7 08 (m, 2H), 6 97 (m, 1H), 4 62 (m, 1H), 4 37 (q, J = 7 1 Hz, 2H), 3 38-3 18 (m, 2H), 3 10-2 99 (m, 2H), 2 15 (s, 3H), and 1 46 (t, J = 7 1 Hz, 3H)
Example 253 N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}--4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
a) methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
To a solution of methyl 4-brcmo-2-furancarboxylate (1 0 g, 4 88 mmol) in THF (20 mL) was added aqueous Na2CO3(2N, 8 mL, 16 mmoL), PdCI2(dppf) (0 35 g, 0 49 mmol) and 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 3 g, 5 85 mmol) The reaction mixture was heated to 70° C in a sealed tube After 2h, the reaction mixture was concentrated under vacuum and purified on silica (EtOAc/Hex, 20-40%) to afford the title compound (0 8 g, 74 5%) as a light yellow solid LC-MS (ES) m/z = 221 (M+H)+
b) methyl 4-(4-chloro-1-ethyl-1N-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
A mixture of methyl 4-(1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate (300 mg, 1 36 mmol) and NCS (218 mg, 1 63 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube After 5h, the reaction mixture was concentrated and purified via column chromatography (silica, 10-20% EtOAc/Hexane) affording the title compound (260 mg, 75%) as a white solid LC-MS (ES) m/z 255 (M+H)+
c) 4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-
2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-furancarboxamide
(Formula Removed)
To a solution of methyl 4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-furancarboxylate (250 mg, 0 98 mmol) in THF/H2O (5mL/0 5 mL) was added KOH (200 mg, 3 56 mmol) The reaction mixture was heated to 50° C for 4 h After the
mixture was concentrated and diluted with H2O (2 mL), the pH was adjusted to 3 The mixture was extracted with DCM (5mL x3) The collected organic layers were concentrated under vacuum to give a crude acid, which was used directly without further punfication LC-MS (ES) m/z 241 (M+H)+
To the above crude acid in DCM (5 mL) at 25 °C was added PyBrOP (550 mg, 1 18 mmol) in one portion, followed by the addition of DIPEA (0 7 mL, 4 01 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (322 mg, 1 08 mmol) was added to the reaction solution After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 20-50 % EtOAc/Hexane) affording the title compound (360 mg, 70 %) as a white solid LC-MS (ES) m/z 521 (M+H)+
d) N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl)-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
At RT, NH2NH2 (0 15 mL, 4 78 mmol) was added to a solution of 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-furancarboxamide (350 mg, 0 67 mmol) in MeOH (5 mL) After 10h, the solvent was removed under vacuum The resulting residue was taken into DCM (15 mL) and washed with H2O (10 mL x 3)
To the above DCM solution was added HCI (36%, 2 mL, 23 7 mmol)) After 1h, the aqueous phase was separated and washed with DCM (10 ml x 3) Water was removed under high vacuum to give the title compound (260 mg, 78%) as an off-white solid LC-MS (ES) m/z 391 (M+H)+ NMR (d6-DMSO, 400 MHz) δ ppm 8 70 (m, 1H), 8 29 (s, 1H), 8 02 (m, 2H), 7 70 (s, 1H), 7 50-7 45 (m, 1H), 7 36-7 30 (m, 1H), 7 14-7 08 (m, 2H), 7 06-7 01 (m, 1H), 4 43 (m, 1H), 4 16 (q, J = 7 3 Hz, 2H), 3 04-2 88 (m, 4H), and 1 30 (t, J = 7 3 Hz, 3H)
Example 254

(Formula Removed)
N-[2-amino-1-(phenylmethyl)ethyl]-3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) methyl 4-bromo-3-([(trifluoromethyl)sulfonyl]oxy}-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-3-{[(trifluoromethyl)sulfonyl]oxy}-2-thiophenecarboxylate (0 948 g, 4 0 mmol) in CH2CI2 (5 mL) and pyridine (1 mL) at 0 °C was added Tf20 (1 0 mL, 6 0 mmol) The mixture was stirred for 1 h, poured onto ice water (10 mL) and extracted with CH2CI2 (5 mL x 3) The collected organic layers were dried (Na2SO4) and concentrated to give a red syrup which was used directly in the next step without further purification LC-MS (ES) m/z 370 (M+H)+
b) methyl 4-bromo-3-methyl-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-3-{[(trifluoromethyl)sulfonyl]oxy}-2-thiophenecarboxylate (825 mg, 2 25 mmol) in dioxane/H2O (5 mL/1 mL) was added K2CO3 (930 mg, 6 75 mmol), tetrakispriphenylphosphine Pd(0) (260 mg, 0 22 mmol), and methylboronic acid (175 mg, 2 91 mmol) The reaction mixture was heated to 70° C in a sealed tube for 12h The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 9 1) to give the title compound (441 mg, 84%) as a brown solid LC-MS (ES) m/z 236 (M+H)+
c) methyl 4-[1-(dimethylamino)ethenyl]-3-methyl-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-3-methyl-2-thiophenecarboxylate (300 mg, 1 27 mmol) in dioxane/H2O (5 mL/1 mL) was added K2CO3 (525 mg, 3 80 mmol), tetrakispriphenylphosphme Pd(0) (15 mg, 0 01 mmol), and 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (345 mg,1 7 mmol) The reaction mixture was heated to 70 °C in a sealed tube for 2h The reaction solution was concentrated under vacuum and purified on silica gel (hexanes/EtOAc, 9 1 to 4 1) to give the title compound (270mg, 90%) LC-MS (ES) m/z 237 (M+Hf
d) 1,1-dimethylethyl [2-({[3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of methyl 4-[1-(dimethylamino)ethenyl]-3-methyl-2-thiophenecarboxylate (50 mg, 0 21 mmol) in THF/H2O (2 mL/0 5 mL) was added KOH (122 mg, 2 1 mmol) The resulting mixture was heated to 50 °C for 2h The THF was removed under vacuum and the aqueous layer was acidified with 6 N HCI to pH 3 and extracted with CH2CI2 (5 mL x 3) The organic fractions was dried over Na2SO4 and concentrated to give the crude 3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid, which was used directly in the next step
To a solution of the crude 3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylic acid in DCM (2 mL) was added PyBrop (0 14 g, 0 3 mmol) and DIPEA (0 1 mL, 0 57 mmol) After 15 mm, 1,1-dimethylethyl (2-amino-3-phenylpropyl)carbamate was added to the reaction in one portion and stirred for 2h at RT The reaction solution was concentrated under vacuum and purified on silica gel (EtOAc /Hexane, 20-50%) to give the title compound (51 mg, 49 % for two steps) as a solid LC-MS (ES) m/z 455 (M+H)+
e) N-[2-amino-1 -(phenylmethyl)ethyl]-3-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of 1,1-dimethylethyl [2-({[3-methy!-4-(1 -methyl-1 H-pyrazol-5-ylV2-thienyl]carbonyl}amino) 3-phenylpropyl]carbamate (51 mg, 0 11 mmol) in DCM (1 mL) was added TFA (1 mL) The reaction was stirred over 5h, concentrated and punfied by reverse-phase HPLC (C18 column H2O/CH3CN, 40-10 %) to afford the bis-TFA salt of the title compound (1S mg, 41%) LC-MS (ES) m/z 355 (M+H)+ NMR (d4-MeOD, 400 MHz) δ ppm 7 64 (s, 1H) 7 56 (d, J = 1 8 Hz, 1H), 7 36-7 30 (m, 4H), 7 28-7 21 (m, 1H), 6 30 (d, J = 2 0 Hz, 1H), 4 58 (m, 1H), 3 69 (s, 3H), 3 27-3 13 (m, 2H), 3 07-2 93 (m, 2H), and 2 13 (s, 3H)
Example 255
N-((1S)-2-amino-1-([2-(trifluoromethyl]phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide
(Formula Removed)
a) methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-2-thiophenecarboxylate (1 0 g, 4 5 mmol) in dioxane/H2O (5 1,12 mL) was added K2CO3 (1 86 mg, 13 5 mmol), tetrakispriphenylphosphine Pd(0) (300 mg, 0 25 mmol), and 1-methyl-5-(4,4,5,5-
tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1 23 g, 5 9 mmol) The reaction mixture was heated to 75° C in a sealed tube for 2h The reaction mixture was concentrated and punfied on silica gel (EtOAc/Hex 10-40%) to give the title compound (701 mg, 70%) as a white solid LC-MS (ES) m/z 223 (M+H)+
b) methyl 4-(4-iodo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (700 m g, 3 15 mmol) in THF (5 mL) was added NIS (922 mg, 4 09 mmol) in one portion The reaction mixture was stirred at 75 °C for 10 h, and then cooled to room temperature The reaction mixture was concentrated and punfied on silica gel (EtOAc/Hex 10-20%) to give the title compound (470 mg, 43%) as an off white solid LC-MS (ES) m/z 350 (M+H)+
c) methyl 4-[1-methyl-4-(trifluoromethyl)-1 H-pyrazol-5-yl]-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-(4-iodo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate (470 mg, 1 35 mmol), copper (I) iodide (256 mg, 1 35 mmol) and potassium fluoride (78 mg, 1 35 mmol) in anhydrous DMF/HMPA (2 ml/2 mL) was added triethyl(trifluoromethyl)silane (745 mg, 4 04 mmol) The mixture was heated to 70 °C under N2 in a sealed tube After 10h, the reaction was quenched with NH4CI (sat'd) (2 mL), extracted with ether (5 mL x 5) and washed with distilled water (5 mL x 5) The combined organic phase was dned over Mg2SO4 and purified on silica (EtOAc/Hex, 10-30%) to afford the title compound (0 29 g, 74%) as a yellow syrup LC-MS (ES) m/z 291 (M+H)+
d)N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-
2-thiophenecarboxamide
(Formula Removed)
To a solution of methyl 4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenerarboxylate (150 mg, 0 52 mmol) in THF/H2O (2 mL/0.5 mL) was added KOH (116 mg, 2 0 mmol) The reaction mixture was heated to 50 °C for 2 h After the mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid, which was used directly in the next step without further purification LC-MS (ES) m/z 277 (M+H)+
To the above acid in DCM (5 mL) at 25 °C was added bromo-tris-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (279 mg, 0 59 mmol) in one portion, followed by the addition of DIPEA (0 5 mL, 2 87 mmol) and 2-[(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (174 mg, 0 5 mmol) After 2h, the solution was concentrated and purified via column chromatography (silica, 1-10 % MeOH/CHCI3) affording the title compound (0 21 g, 67% for 2 steps) LC-MS (ES) m/z 607 (M+H)+
e) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-[1 -methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide
(Formula Removed)
N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide (210 mg, 0 35 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2(0 5 mL, 15 9 mmol) The reaction was stirred over 10 h, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 40-
10%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water, and neutralized with aminonium hydroxide The mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH and treated with HCI (aq) After stirring overnight, the reaction was concentrated to give the title compound (95 mg, 57%) as a white solid LC-MS LC-MS (ES) m/z 477 (M+H)+ NMR (d6-DMSO, 400 MHz) δ ppm 8 92 (d, J = 9 1 Hz, 1H), 8 06 (m, 4H), 7 99 (s, 1H), 7 69 (d, J = 7 6 Hz, 1H), 7 59 (d, J = 7 6 Hz, 1H), 7 53 (m, 1H), 7 43 (m, 1H), 4 49 (m, 1H), 3 83 (s, 3H), and 3 14-2 99 (m, 4H)
Example 256
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-proopl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) 1-propyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole
(Formula Removed)
To a suspension of NaH (60% in mineral oil, 4 0 g, 100 mmol) in THF (200 mL) was added 1H-pyrazole (6 8 g, 100 mmol) at 0 °C portionwise After stirring at RT for 1h, Prl (17 85 g, 105 mmol) was added dropwise at 0 °C The reaction mixture was stirred for 10h and monitored by LC-MS m/e = 111 (M+H)+ After the reaction was complete, Nal was removed by filtration The resulting 1-propyl-1H-pyrazole containing THF solution was used directly in the next step
To the above THF solution of 1 -propyl- 1H-pyrazole was added n-BuLi (2 5M in Hexane, 40 rnL, 100 mmol) at -78°C, The reaction solution was stirred for 2 hours at RT and then re-cooleo to -78°C [J Heterocyclic Chem 41, 931 (2004)] To the reaction solution was added 2-i$opropoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (18 6 g, 100 mmol) After 20 min at -78°C, the reaction was quenched with saturated NH4CI solution and exacted with DCM The organics were dried over Na2SO4 and concentrated under vacuum to afford the title compound as a brown solid which was used directly without furthei punfication LC-MS (ES) m/z 154 (M+H)+for [RB(OH)2]
b) methyl 4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a solution of methyl 4-bromo-2-thiophenecarboxylate (221 mg, 1 0 mmol) in dioxane/H2O (5 1,6 mL) was added K2CO3 (414 mg, 3 0 mmol), tetrakispriphenylphosphme Pd(0) (60 mg, 0 05 mmol), and 1-propyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (404 mg, 1 5 mmol) The reaction mixture was heated to 70° C in a sealed tube for 2h The reaction mixture was concentrated and punfied on silica gel (EtOAc/Hex 10-40%) to give the title compound (176 mg, 70%) as a white solid LC-MS (ES) m/z 251 (M+H)+
c) N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-propyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
To a solution of methyl 4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(160 mg, 0 64 mmol) in THF/H2O (2 mL/1 mL) was added KOH (151 mg, 2 56 mmol) The reaction mixture was heated to 50 °C for 2 h After the mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid, which was used directly in the next step without further purification LCMS (ES) m/z = 237 (M+H)+
To the above acid in DCM (2 mL) at 25 °C was added bromo-tns-pyrrolidmo phosphoniumhexafluorophosphate (PyBrOP) (298 mg, 0 64 mmol) in one portion, followed by the addition of DIPEA (0 2 mL, 1 15 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (208 mg, 0 6 mmol) After 1h, the solution was concentrated and purified via column chromatography (silica, 1-10 % MeOH/CHCI3) affording the title compound (0 22 g, 61% for 2 steps) LC-MS (ES) m/z 567 (M+H)+
d) N-((1S)-amino-1-{[2-(trifluoromethyl)phenyl]methyl]ethyl)-4-(1-propyl-1H-
pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (220 mg, 0 36 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (0 3 mL, 9 56 mmol) The reaction was stirred over 10 h, concentrated and punfied by reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water and neutralized with aminonium hydroxide The mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a free base of the title compound The free base compound was dissolved in MeOH (2 mL) and treated with HCI (4M in dioxane) After stirring overnight, the reaction solution was concentrated to give the title compound (112 mg, 57%) as an off white solid LC-MS (ES) m/z 437 (M+H)+, NMR (d6-DMSO, 400 MHz) δ ppm 9 06-8 99 (m, 1H), 8 23-8 02 (m, 4H), 7 92 (br s, 1H), 7 69 (d, J = 7 8 Hz, 1H), 7 62-7 49 (m, 3H), 7 42 (m,
1H), 4 50 (m, 1H), 4 20 (m, 2H), 3 15-2 99 (m, 4H), 1 74 (m, 2H), and 0 80 (t, J = 7 3 Hz, 3H)
Example 257
N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyllmethyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
a) methyl 4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A mixture of methyl 4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (250 mg, 1 0 mmol) and NCS (200 mg, 1 5 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 10% EtOAc/Hexane) affording the title compound (199 mg, 70%) as a white solid LC-MS (ES) m/z 285 (M+H)+
b) 4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide
(Formula Removed)
To a solution of methyl 4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (199 mg, 0 7 mmol) in THF/H2O (2 mL/0 5 mL) was added KOH (100 mg, 1 7 mmol) The leaction mixture was heated to 50 °C for 2 h After tne mixture was concentrated and diluted with H2O, the pH was adjusted to 3 The mixture was extracted with DCM (5 mL x 3) The collected organic layers were concentrated under vacuum to give the crude acid, which was used directly in the next step without further punfication LC-MS (ES) m/z 271 (M+H)+
To the above acid in DCM (5 mL) at 25 °C was added bromo-tns-pyrrolidino phosphoniumhexafluorophosphate (PyBrOP) (326 mg, 0 7 mmol) in one portion, followed by the addition of DIPEA (0 3 mL, 1 15 mmol) and 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (232 mg, 0 7 mmol) After 10 mm, the solution was concentrated and purified via column chromatography (silica, 1-10 % MeOH/CHCI3) affording the title compound (312 mg, 74% for 2 steps) LC-MS (ES) m/z 601 (M+H)+
c) N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
(Formula Removed)
4-(4-Chloro-1-propyl-1H-pyrazol-5-yl)-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-2-thiophenecarboxamide (312 mg, 0 52 mmol) was dissolved in MeOH (2 mL) and was treated with NH2NH2 (0 5 mL, 15 9 mmol) The reaction was stirred over 10 h, concentrated and purified by reverse-phase HPLC (C18 column H2O/CH3CN, 95-5%) to afford the bis-TFA salt of the title compound The bis-TFA salt was dissovled in water and neutralized with aminonium hydroxide The mixture was extracted with DCM, dried over Na2SO4, and concentrated to give a free base of the tile compound The free base compound was dissolved in MeOH (2 mL) and treated with HCI (aq) After stirring overnight, the reaction was concentrated to give the title compound (185 mg, 66%) as an off white solid LC-MS (ES) m/z 471 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 92 (m, 2H), 7 74-7 68 (m, 1H), 7 60 (s, 1H), 7 58-7 51 (m, 2H), 7 45-7 41 (m,
1H), 4 67 (m, 1H), 4 15 (t, J = 7 1 Hz, 2H), 3 37-3 09 (m, 4H), 1 77 (m, 2H), and 0 82 (t, J = 7 6 Hz, 3H)
Example 258
N-{(1S)-2-amino-1-[(3.4-difluorophenyl]methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)2-thiophenecarboxamide
(Formula Removed)
a) methyl 5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
To a 100 mL sealed flask was added 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 61 g, 11 74 mmol), potassium carbonate (3 25 g, 23 48 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (2 g, 7 83 mmol) and bis(tn-t-butylphosphine)palladium(0) (0 4 g, 0 78 mmol) in 1,2-dimethoxyethane (DME) (50 mL) and H2O (10 ml) After stirring for 3h at 70 °C, the reaction solution was diluted with DCM (100 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was purified on silica gel [EtOAc/hexanes, 10-30% ] to give the product [1 8 g, 85%] as an off white solid LC-MS (ES) m/z 271 (M+Hf
b) methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
Methyl 5-chloro4-(1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxylate (1 8 g,
6 65 mmol) and NCS (1 3 g, 9 74 mmol) in THF (10 mL) were heated to 70 °C
under N2 for 2 h The reaction solution was concentrated and purified on silica
(EtOAc/Hex, 10-30%) to afford the title compound (1 5 g, 74%) as a syrup LC-MS
(ES) m/z 305 (M+H)+
b) N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecaiboxamide
(Formula Removed)
The title compound (290 mg, 58 4 %) was prepared as an off-white solid according to the procedure of Example 236, except substituting 5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-thiophenecarboxamide (526 mg, 1 662 mmol) for 5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide LC-MS (ES) m/z 459 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 76 (m, 1H), 7 62 (s, 1H), 7 28-7 22 (m, 1H),
7 20-7 10 (m, 2H), 4 52 (m, 1H), 4 07 (m, 2H), 3 27-3 16 (m 2H), 3 05-2 94 (m, 2H),
and 1 34 (m, 3H)
Example 259
(Formula Removed)
N-{(1S)-2-amino-1-[(3.4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxamide
(Formula Removed)
a) methyl 5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
To a 100 mL sealed flask was added 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 61 g, 11 74 mmol), potassium carbonate (3 25 g, 23 48 mmol), methyl 4-bromo-5-chloro-2-furancarboxylate (1 85 g, 8 33 mmol) and bis(tri-t-butylphosphme)palladium(0) (0 16 g, 0 31 mmol) in 1,2-Dtmethoxyethane (DME) (30 mL) and H2O (5 mL) After stirring for 2h at 75 °C, the reaction solution was diluted with DCM (100 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was punfied on silica gel [EtOAc/hexanes, 10-30%] to give the product (0 8 g, 50 1%) as an off-white solid LC-MS (ES) m/z 255 (M+H)+
b) methyl 5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-furancarboxylate
(Formula Removed)
A mixture of methyl 5-chloro-4-(1-ethyl-1 H-pyrazol-5-yl)-2-furancarboxylate (800 mg, 3 14 mmol) and NCS (600 mg, 4 49 mmol) in THF (5 mL) was heated to 70 °C in a sealed tube After 2h, the reaction mixture was concentrated and purified
via column chromatography (silica, 10-20% EtOAc/Hexane) affording the title compound (710 mg, 78%) as a white solid LC-MS (ES) m/z 289 (M+H)+
c)5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1-[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-2-furancarboxamide
(Formula Removed)
To a solution of methyl 5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxylate (480 mg, 1 66 mmol) in THF/H2O (5mL/1 mL) was added KOH (460 mg, 8 20 mmol) The reaction mixture was heated to 50° C for 4 h After the mixture was concentrated and diluted with H2O (2 mL), the pH was adjusted to 3 The mixture was extracted with DCM (10 mL x3) The collected organic layers were concentrated under vacuum to give a crude acid (420 mg, 92%), which was used directly without further purification LC-MS (ES) m/z 275 (M+H)+
To the above acid (400 mg) in DCM (5 mL) at 25 °C was added PyBrOP (881 mg, 1 89 mmol) in one portion, followed by the addition of DIPEA (1 5 mL, 8 59 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (506 mg, 1 60 mmol) was added After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 30-50 % EtOAc/Hexane) affording the title compound (655 mg, 79%) as a white solid LC-MS (ES) m/z 573 (M+H)+
c) N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yI)-2-furancarboxamide

At RT, NH2NH2 (0 5 mL, 15 93 mmol) was added to a solution of 5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindo!-2-yl)mbthyl]ethyl}-2-furancarboxamide (610 mg, 1 06 mmol) in MeOH (5 mL) After I0h, the solvent was removed under vacuum The resulting residue was taken into DCM (20 mL) and washed with H20 (20 mL x 3)
To the DCM solution was added HCI (36%, 10 mL, 120 mmol) After 1h, the aqueous phase was separated and washed with DCM (30 ml x 3) Water was removed under high vacuum to give the tilte compound (410 mg, 87%) as an off-white solid LC-MS (ES) m/z 443 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 61 (s, 1H), 7 36 (s, 1H), 7 29-7 10 (m, 3H), 4 57 (m, 1H), 4 09 (q, J = 7 3 Hz, 2H), 3 27-3 23 (m, 1H), 3 20-3 14 (m, 1H), 3 06-3 01 (m, 1H), 2 97-2 92 (m, 1H), and 1 36 (t, J = 7 3 Hz, 3H)
Example 260
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamtde
a) 1,1 -dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
A mixture of 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (prepared according to Preparation 22 except substituting
2-[(2S)-2-amino-3-pherv/lpropyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3- (2,4-dichlorophenyl)propylHH-isoindole-1,3(2H)-dione) (236 mg, 0 537 mmol), 1-methyl-5-(tnbutylstannanyl)-1H-1,2,3-tr azole (200 mg, 0 537 mmol) (prepared according to patent IPN WO97/01553), pd(PPh3)2Cl2 (37 7 mg, 0 054 mmol), TRIETHYLAMINE (74 9 pi, 0 537 mmol) and toluene (3 ml) was degassed by N2 and sealed The reaction mixture was heated at 110 °C for 4 hr LC/MS showed the reaction was completed The reaction mixture was concentrated and punfied via column chromatography (silica, 70% EtOAc in hexane) to give the title product (120 mg, 51%) LCMS (ES) m/z = 442 2 (M+H)
b) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
A solution of 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (60 mg, 0 14 mmol) in TFA-DCM (4ml, 1 3) was stirred at rt for 1 h LCMS showed the reaction was completed The reaction mixture was concentrated and the residue was punfied by reverse phase HPLC (5%-65% acetonitnle in water with 0 1% TFA) to give 42 2 mg (67%) of the TFA salt as a white solid LCMS (ES) m/z 342 2 (M+H)\ 1H NMR (400 MHz, METHANOL-d) δppm 8 06 (d, J=1 52 Hz, 1H), 7 87-7 91 (m, 2H), 7 34-7 21 (m, 5H), 4 55 (m, 1H), 4 19 (s, 3H), 3 30-3 21 (m, 1H), 3 09-3 18 (m, 1H), 3 01 (d, J=7 6Hz, 2H)
Example 261
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide
a) 1,1-Dimethylethyl [(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol- 5-yl)-2-thienyl]carbony!}arnino)-3-phenylpropyl]carbamate
(Formula Removed)
To a solution of 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenyipropyl]carbamate (70 mg, 0 16 mmol) in 2 ml of DMF was added NCS (42 3 mg, 0 32 rrmol) The reaction mixture was heated at 50 °C for 2 hr and then diluted with 50 ml of EtOAc The organic layer was washed with H2O and concentrated to give the title product as a crude mixture, which was used in next step without purification LCMS (ES) m/z = 5102 (M+H)
b)N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
A solution of 1,1-dimethylethyl [(2S)-2-({[5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (crude from a) in TFA-DCM (4ml, 1 3) was stirred at rt for 1h The reaction mixture was concentrated and the residue was punfied by reverse phase HPLC (5%-65% acetonitnle in water with 0 1% TFA) to give 10 mg (12% two steps) of white solid as TFA salt LCMS (ES) m/z 410 0/412 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 62 (s, 1H), 7 32-7 25 (m, 5H), 4 55 (m, 1H), 4 02 (s, 3H), 3 21 (m, 1H), 3 10 (m, 1H),2 98(d,2H)
Example 262
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluoronhciiyl)propyl]carbamate (123mg, 0 27mmol) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LCMS (ES) m/z 360 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 05 (d, J=1 6 Hz, 1H), 7 89-7 91 (m, 2H), 7 33-7 30 (m, 2H, 7 06-7 02 (m, 2H), 4 55 (m, 1H), 4 20 (s, 3H), 3 23 (m, 1H), 3 17 (m, 1H), 2 99 (m, 2H)
Example 263
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethylM-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
a) 1,1-Dimethylethyl[(2S)-3-(3,4-difluorophenyl)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)propyl]carbamate
(Formula Removed)
A solution of 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-di-fluorophenyl)propyl]carbamate (50 mg, 0 11 mmol), 1-methyl-5-(4,4,5,5-
tetramethyl-1,3,2-dioxaboro!an-2-yl)-1H-1,2,3-triazole (44 mg, 0 21 mmol), Na2CO3 (2N, 0 1ml) and PddppfCI2 (8 6 mg, 0 01 mmol) in 3 ml of 1,4-dioxane was irndiated in MW reactor at 150 °C for 20 mm The crude reaction mixture was purified by column chromatography (silica, 70% EtOAc in hexane) to give the title product (29 mg, 46%) LCMS (ES) m/z = 478 2 (M+H)
b) N-(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared according to Example 260 b) except substituting 1,1-dimethylethyl [(2S)-3-(3,4-difluorophenyl)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}arnino)propyl]carbamate (29mg, 0 06mmol) for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl 3-phenylpropyl]carbamate LCMS (ES) m/z 378 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 07 (d, J=1 6 Hz, 1H), 7 88-7 91 (m, 2H), 7 23-7 09 (m, 3H), 4 55 (m, 1H), 4 20 (s, 3H), 3 24 (m, 1H), 3 15 (m, 1H), 2 98 (m, 2H)
Example 264
(Formula Removed)
Preparation of N-{nS)-2-amino-1-[(4-fluorophenv0methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-1,2.3-triazol-5-y0-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-(4-fluorophenyl)propyl]carbamate (68 mg, 0 15 mmol) for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyljcarbamate LCMS (ES) m/z 428 0/430 0 (M+H)+, 1H NMR (400 MHz,
METHANOL-d4) δppm 7 66 (s, 1H), 7 30 (m, 2H), 7 04 (m, 2H), 4 55 (m, 1H), 4 02 (s, 3H, 3 21-3 10 (m, 2H), 2 98 (m, 2H)
Example 265
(Formula Removed)
]Preparation N-{f1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-4-n-methyl-1f/-1.2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3-fluorophenyl)propyl]carbamate (300mg, 0 66mmol) for 1,1-dimethylethyi [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 360 2 (M+H)\ 1H NMR (400 MHz, METHANOL-cW) δppm 8 06 (d, J=1 6 Hz, 1H), 7 90 (m, 2H), 7 33-7 30 (m, 1H), 7 13-7 09 (m, 2H), 6 98-6 95 (m, 1H), 4 55 (m, 1H), 4 19 (s, 3H), 3 24 (m, 1H), 3 17(m, 1H), 3 04-2 99 (m, 2H)
Example 266
(Formula Removed)
Preparation N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,5-difluorophenyl)propyl]carbamate(300mg, 0 66mmol)for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 378 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 06 (d, J=1 6 Hz, 1H), 7 91 (m, 2H), 6 96-6 93 (m, 2H), 6 84-6 83 (m, 1H), 4 55 (m, 1H), 4 19 (s, 3H), 3 24 (m, 1H), 3 19 (m, 1H), 3 05-2 98 (m, 2H)
Example 267
(Formula Removed)
Preparation N-{(1S)-2-amino-1-[(3-trifluoromethylphenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3-(trifluoromethyl)phenyl)propyl]carbamate (500 mg, 0 99 mmol)for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 410 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 06 (d, J=1 2 Hz, 1H), 7 97 (s, 1H), 7 91 (s, 1H), 7 72 (d, J=1 2Hz, 1H)7 54(m, 2H), 7 44 (m, 1H), 4 55 (m, 1H), 4 21 (s, 3H), 3 30-3 10 (m, 4H)
Example 268
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-1,2.3-triazol-5-yl)-2-thiophenecarbox3mide
The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-(3-fluorophenyl)propyl]carbamate (50mg, 0 11mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 428 0/430 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 63 (s, 1H), 7 33 (m, 1H), 7 12-7 07 (m, 3H), 4 55 (m, 1H), 4 02 (s, 3H), 3 23-2 98 (m, 4H)
Example 269
(Formula Removed)
Preparation of N-((1S)-2-amino-1-[(2-(trifluoromethyl)phenyl)methyl]ethyl}-5-chloro-4-( 1 -methyl-1H-1,2.3-triazol-5-yl)-2-th lophenecarboxamide
a) methyl 5-chloro-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A mixture of 1-methyl-5-(tnbutylstannanyl)-1H-1,2,3-triazole (2 0 g, 5 37 mmol), methyl 4-bromo-5-chloro-2-thiophenecarboxylate (1 25 g, 4 9 mmol), Pd(PPh3)2CI2 (171 mg, 0 244 mmol), TRIETHYLAMINE (0 68 ml, 4 89 mmol) and toluene (3 ml) was heated at 110 °C for 4hr under N2 The reaction mixture was purified via column chromatography (silica, 50%-70% EtOAc in hexane) to give the title compound as a white solid (400 mg, 32%) LCMS (ES) m/z 258 2 (M+H)+
b) 5-Chloro-4-(1-methyl-1H-1,2,3-trazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
A solution of methyl 5-chloro-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate (400 mg, 1 55 mmol) and 1N LiOH (2 0 ml, 2 0 mmol) in THF (6 ml) was stirred at rt overnight After removal of THF, the residue was diluted with 10 ml of H2O and washed with DCM (10ml x 2) The aqueous layer was acidified to pH 3 with 1N HCI and then extracted with EtOAc (30 ml x 4) The organic layers were combined and concentrated to give 370 mg of the title compound as a white solid LCMS (ES) m/z 244 0 (M+H)+
c) 5-Chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1 -{[2-
(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
solution of 5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid (370mg, 1 52mmol), 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione (from Preparation 6, 529mg, 1 52 mmol), PyBrop (708 mg, 1 52 rnmol) and DIPEA (2 65 ml, 15 2 mmol) in 20 ml of DCM was stirred at rt for 2hr The reaction mixture was diluted with 50 ml of DCM and washed with H2O, 0 1N HCI and bnne The organic layer was concentrated and the residue was purified via column chromatography (silica, 50%-70% EtOAc in hexane) to give the title compound as a white solid (700mg, 80%) LCMS (ES) m/z 574 0 (M+H)+
d) N-{(1S)-2-amino-1-[(2-(trifluoromethyl)phenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-thiophenecarboxamide
A solution of 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2--thiophenecarboxamide (700 mg, 1 22 mmol) and hydrazine (0 19 mL, 6 1 mmol) in 5 mL of MeOH was stirred at rt overnight, diluted with 200 ml of H20 and extracted with DCM (100 ml x2) The combined organic layers were concentrated and the resulting solid was dissolved in 6N HCI (50 ml) The aqueous layer was washed with DCM (50 ml x2) The organic layers were discarded and the remaining aqueous solution was concentrated to give the product as an HCI salt (490mg, 75%) LCMS (ES) m/z 444 0 (M+H)+, 1H NMR (400 MHz, METHANOL-cW) δppm 8 10(m, 1H), 7 92 (m, 1H), 7 73 (m, 1H), 7 57 (m, 1H), 7 44 (m, 1H), 4 65 (m, 1H), 4 17(s,3H), 3 25-3 11 (m, 4H)
Example 270
(Formula Removed)
reparation of N-[(1S)-2-amino-1-^Dhenylmethyl)ethyl]-5-methyl-4-n-methyl-1fy-1,2.3-triazol-5-yl)-2-thiophenecarboxarrnde
The title compound was prepared as an off-white solid according to the procedure of Example 269, except substituting methyl 4-bromo-5-methyl-2-thiophenecarboxylate (from Preparation 10) for methyl 4-bromo-5-chloro-2-miophenecarboxylate and 2-{(2S)-2-amino-3-phenylpropyl}-1 H-isoindole-1,3(2H)-dione (preparation 5) for 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 356 2 (M+Hf, 1H NMR (400 MHz, METHANOL-d4) δppm 8 60 (s, 1H), 8 01 (s, 1H), 7 34-7 21 (m, gM), 4 55 (m, 1H), 4 26 (s, 3H), 3 25 (m, 2H), 3 03 (m, 2H), 2 21 (s, 3H)
Example 271
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2-(trifluoromethyl)phenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2.3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 261, except substituting N-{(1S)-2-amino-1-[(2-(trifluoromethyl)phenyl) methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide (120 mg, 0 27 mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 478 0/ 480 0(M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 79 (s, 1H), 7 73(d, J=7 6Hz, 1H), 7 56 (m, 2H), 7 45 (m, 1H), 4 65 (m, 1H), 4 05 (s,3H), 3 29-3 10 (m, 4H)
Example 272
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 261, excent substituting 1,1-dimethylethyl [(2S)-2-({[5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyljcarbamate (prepared in Example 270) for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyljcarbamate LCMS (ES) m/z 390 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 72(s, 1H), 7 31-7 22 (m, 5H), 4 55 (m, 1H), 3 99 (s, 3H), 3 19 (m, 2H), 3 02 (m, 2H), 2 41 (s, 3H)
Example 273
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3.5-difluorophenyl]methyl]ethyl}-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
a) Methyl 4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
The title compound was prepared according to the procedure of Example 269 a), except substituting methyl 4-bromo-2-thiophenecarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate LCMS (ES) m/z 224 0 (M*H)+
b) methyl 4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate
(Formula Removed)
A solution of methyl 4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate (500 mg, 2 24 mmol) and NCS (1196 mg, 8 96 mmol) in N,N-Dimethylformamide (DMF) (10 ml) was heated at 50 °C for 2hr The reaction mixture was diluted with 50 ml of EtOAc The organic layer was washed with H2O (50 ml x 2) and brine (50 ml), and then concentrated to give 460 mg of a crude mixture, which was used in next step without further separation LCMS (ES) m/z 258 0 (M+H)+
c) 4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid
(Formula Removed)
The title compound was prepared following the procedure of Example 269 b), except substituting methyl 4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylate for methyl 4-(1-methyl-1H-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecarboxylate LCMS (ES) m/z 244 0(M+H)+
d) N-{(1S)-2-amino-1 -[(3,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared following the procedure of Example 269 c-d), except substituting 4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid for 4-(1-methyMH-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecaroxylic acid and substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 412 0/414 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 13 (m, 1H), 8 06 (m, 1H), 6 97 (m, 2H), 6 82 (m, 1H), 4 55 (m, 1H), 4 16 (s, 3H), 3 26 (m 2H), 3 04 (m, 2H)
Example 274
(Formula Removed)
Preparation of N-(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared following the procedure of Example 273, except substituting 2-[(2S)-2-amino-3-(3,4-drfluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione (82 mg, 0 15 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 412 0/414 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 12 (d, J=1Hz,1H), 8 05 (d, J=1Hz,1H) 7 30-7 10 (m, 3H), 4 55 (m, 1H), 4 16 (s, 3H), 3 26 (m 2H), 2 99 (m, 2H)
Example 275
(Formula Removed)
Preparation of N-(1S)-2-amino-1-[(2-(trifluoromethyl)pheoyl)methyl]ethyl]-4-(4-chloro-1-methyl-1H-1.2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared following the procedure of Example 274, except substituting 2-[(2S)-2-amino-3-(2-(trifluoromethyl)phenyl)propyl]-1H-isoindole-1,3(2H)-dione (130 mg, 0 23 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 444 0/446 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 13(d, J=1Hz,1H), 8 09 (d, J=1Hz,1H), 7 72 (m, 1H), 7 56 (m, 2H), 7 43 (m, 1H), 4 60 (m, 1H), 4 17 (s, 3H), 3 26-3 15(m, 4H)
Example 276
(Formula Removed)
Preparation of N-(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1 ,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared following the procedure of Example 273, except substituting 2-[(2S)-2-amino-3-(4-chlorophenyl)propyl]-1 H-isoindole-1,3(2/-/)-dione (73 mg, 0 14 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 410 0/412 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 12(d, J=1Hz,1H), 8 03 (d,J=1Hz,1H), 7 31 (m, 4H), 4 55 (m, 1H), 4 15 (s, 3H), 3 26 (m 2H), 3 05 (m, 2H)
Example 277
(Formula Removed)
Preparation of N-(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared following the procedure of Example 273, except substituting 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (67 mg, 0 12 mmol) for 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1H-isomdole-1,3(2H)-dione LCMS (ES) m/z 444 0/448 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 8 12(d, J=1Hz,1H), 8 03 (d, J=1Hz, 1H), 7 49 (d, 1H), 7 38 (d, 1H), 7 25 (m, 1H), 4 60 (m, 1H), 4 16 (s, 3H), 3 30-3 09 (m, 4H)
Example 278
(Formula Removed)
Preparation N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 263, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(cycolhexyl)propyl]carbamate (300 mg, 0 67 mmol) for 1,1 -dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate LCMS (ES) m/z 348 2 (M+H)+, 1H NMR (400
MHz, METHAN0L-d4) δppm 8 09(d, J=1Hz,1H), 8 03 (d, J=1Hz, 1H), 7 91 (s, 1H), 4 48 (m, 1H), 4 22 (s, 3H), 3 20 (m 1H), 3 05 (m, 1H), 2 00-0 95 (m, 13H)
Example 279
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-
cycolhexylpropyl]carbamate (50 mg, 0 11 mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1 -methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 416 0/418 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 74(s, 1H), 4 48 (m, 1H), 4 04 (s, 3H), 3 40-2 95 (m 2H), 1 90-0 95 (m, 13H)
Example 280
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 269, except substituting 2-[(2S)-2-amino-3-cyclohexylpropyl]-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[3-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione LCMS (ES) m/z 382 2 (M+Hf, 1H NMR (400 MHz, METHANOL-d4) δppm 7 93 (s, 1H), 7 81 (m, 1H), 4 43 (m, 1H), 4 10 (s, 3H), 3 17 (m 1H), 3 05 (m, 1H), 2 00-0 90 (m, 13H)
Example 281
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl]ethyl]-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as an off white solid according to the procedure of 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-cycolhexylpropyl]carbamate (100mg, 0 22mmol) for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate, and the amount of NCS was reduced to 1eq LCMS (ES) m/z 382 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm8 15(d, J=1Hz, 1H), 8 08 (d, J=1Hz,1H), 4 45 (m, 1H), 4 16 (s, 3H), 3 14 (m 1H), 3 05 (m, 1H), 2 00-0 90 (m, 13H)
Example 282
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl]ethyl]-5-chloro-4-(4-bromo-1-methyl-1 H-1 ^.S-triazol-S-vD^-thiophenecarboxamide
A solution or 1,1-dimethylethyl [(2S)-2-({[5-chloro-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}ainino)-3-cyclohexylpropyl]carbamate (140mg, 0 29 mmol, prepared in Example 280) and NBS (103 mg, 0 58 mmol) in 2 mL of DMF was neated at 100 CC for 2 hours The reaction mixture was punfied by reverse phase HPLC (5-65% acetonitnle in H20 with 1% TFA) to give the title compound 14 1mg (8%) as a white solid LCMS (ES) m/z 462 0 (M+H)\ 1H NMR (400 MHz, METHANOL-d4) δppm 7 75 (s, 1H), 4 43 (m, 1H), 4 05 (s, 3H), 3 17 (m 1H), 3 05 (m, 1H), 2 00-0 90 (m, 13H)
Example 283
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(phenylmethyl]ethyl]-5-n-methyl-1ry-1,2.3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(5-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl]carbamate (270 mg, 0 62 mmol) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-th lenyl )ca rbonyl]am ino}-3-phenylpropyl)carbamate LCMS (ES) m/z 342 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 96 (s, 1H), 7 75 (d, J=3 6Hz, 1H), 7 47 (d, J=3 6Hz, 1H), 7 31-7 22 (m, 5H), 4 55 (m, 1H), 4 21 (s, 3H), 3 20(m, 2H) 2 99 (m, 2H)
Example 284
Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-(4-chloro-1-methyl-1H-1.2.3-triazol-5-yl)-2-thiophenecorboxamide
The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1 dimethylethyl [(2S)-2-({[5-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate (68 mg, 0 15 mmol)for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-i,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate LCMS (ES) m/z 376 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δ ppm 7 82 (m, 1H), 7 55 (d, J=3 6Hz, 1H), 7 47 (d, J=3 6Hz, 1H), 7 32-7 23 (m, 5H), 4 55 (m, 1H),4 19 (s, 3H), 3 20(m, 2H), 3 02 (m, 2H)
Example 285
(Formula Removed)
Preparation of N-(C\ S)-2-amino-1-{r2-(trifluoromethyOphenyl]methyl}ethyO-5-methyl-4-(1-methyl-1 H-1.2.3-triazol-5-yl)-2-furancarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 269, except substituting methyl 4-bromo-5-methyl-2-furanocarboxylate (ref Bach, T , Kruger, L Synlett 1998, 1185-1186) for methyl 4-bromo-5-chloro-2-thiophenecarboxylate LCMS (ES) m/z 408 2 (M+H)+, 1H NMR (400 MHz, METHANOL-^) δppm 8 09 (s, 1H), 7 71 (m, 1H), 7 55 (m, 2H), 7 43 (m, 2H), 4 68 (m, 1H), 4 13 (s, 3H), 3 25-3 15 (m, 4H), 2 48 (s, 3H)
Example 286
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)ph6nvnmethyl}ethyl)-4-(1-methyl-1 H-1.2,3-triazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-furanyl)carbonyl]amino}-3-(2-(trifluoromethyl)phenyl)propyl]carbamate (200 mg, 0 4 mmol)for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LCMS (ES) m/z 394 2 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δ ppm 8 23 (s, 1H), 7 93 (s, 1H), 7 71 (d, 1H), 7 54 (m, 2H), 7 43 (m, 2H), 4 75 (m, 1H), 4 18 (s, 3H), 3 30-3 10(m, 4H)
Example 287
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to the procedure of Example 261, except substituting 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furanyl]carbonyl}amino)-3-(2-(trifluoromethyl)phenyl)propyl]carbamate (90 mg, 0 18 mmol) for 1,1-dimethylethyl
[(2S)-2-({[4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamane LCMS (ES) m/z 462 0/464 0 (M+H)+, 1H NMR (400 MHz, METHANOL-d4) δppm 7 73 (m, 1H), 7 56 (m, 2H), 7 45 (m, 1H), 7 40 (s, 1H), 4 75 (m, 1H), 4 05 (s, 3H), 3 30-3 10 (,n, 4H)
Example 268
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[3-fluorophenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 269, except substituting methyl 4-bromo-5-methyl-2-furanocarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate and 2-{(2S)-2-amino-3-[3-fluorophenyI]propyl}-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LCMS (ES) m/z 358 2 (M+H)\ 1H NMR (400 MHz, METHANOL-cW) δppm 8 47 (s, 1H), 7 44 (s, 1H), 7 35 (m, 1H), 7 15 (m, 2H), 6 96 (m, 1H), 4 65 (m, 1H), 4 22 (s, 3H), 3 25 (m, 2H), 3 04(m, 2H), 2 49 (s, 3H)
Example 289
(Formula Removed)
Preparation of N-((1S)-2-amino-14f3.5-difluorophenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2.3-triazol-5-yl)-2-furancarboxamide
The title compound was prepared as an off-white solid according to the procedure of Example 269 except substituting methyl 4-bromo-5-methyl-2-furanocarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate and 2-{(2S}-2-amino-3-[3,5-difluorophenyl]propyl}-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isomdole-1,3(2H)-dione LCMS (ES) m/z 376 2 (M+H)+, 1H NMR (400 MHz, METHANOL-c(4) δppm 8 30 (s, 1H), 7 43 (s, 1H), 6 95 (m, 2H), 6 82 (m, 1H), 4 53 (m, 1H), 4 18 (s, 3H), 3 25 (m, 2H), 3 07(m, 2H), 2 48 (s, 3H)
Example 290
(Formula Removed)
Preparation of N-[(1S)-2-amino-H(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 261, except substituting [(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide (prepared according to Example 263) for 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate and following Example 269 for deprotection LCMS (ES) m/z 446 0/448 0 (M+H)+, 1H NMR (400 MHz, METHANOL-c/4) δppm 7 88 (s, 1H), 7 20-7 15 (m, 3H), 4 53 (m, 1H), 4 05 (s, 3H), 3 23 (m, 2H), 3 00 (m, 2H)
Example 291
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-1.2.4-triazol-5-yl)--2-thiophenecarboxamide
a) 1,1 -dimethylethy! [(2S)-2-({[4-(1 -methyl-1 H-1 ,2,H triazol-5-yl)-2-
thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
A suspension of 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (prepared according to preparation 22 except substituting 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione) (200 mg, 0 455 mmol), dioxabonnane (123 mg, 0 546 mmol), potassium acetate (134 mg, 1 366 mmol), and PdCI2(dppf)2 (16 7 mg, 0 023 mmol) in dry THF (3 ml) was charged into a sealed tube and heated to 80 °C for one hour 5-lodo-1-methyl-1 H-1,2,4-triazole (114 mg, 0 546 mmol), 2M sodium carbonate (0 34 ml, 0 683 mmol) and Pd(Ph3P)4 (26 3 mg, 0 023 mmol) were then added The mixture was heated at 85 °C for 2 hours The solvent was removed and the residue was punfied by biotage (70% H/E) to give the title product (120 mg, 60%)
b) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-
thiophenecarboxamide
(Formula Removed)
TFA (1 ml) was added to a solution of 1,1-dimethylethyl [(2S)-2-({[4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)-3-phenylpropyl]carbamate
(Formula Removed)
(100mg, 0 226 mmol) in DCM (5 ml) The reaction was stirred at RT for 30 mm The solvent was removed and the residue was punfied by reverse phase HPLC (10% org - 60% org) to give the title compound as a white solid (90 mg, 87%) LC-MS (ES) m/z 342 2 (M+H)+, 1H NMR (d4-M60H, 400 MHz) δ 8 23 (s, 1H), 8 03 (m, 2H), 7 22-7 31 (m, 5H), 4 60 (m, 1H), 4 08 (s, 3H), 3 10-3 20 (m, 2H), 3 00 (m, 2H)
Example 292
(Formula Removed)
Preparation of A/4(1S)-2-amino-1-[(3.4-difluorophenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxamide
a) 1,1 -dimethylethyl [(2S)-3-(3,4-difluorophenyl)-2-({[4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)propyl]carbamate
(Formula Removed)
This intermediate was prepared according to the procedure of Example 291
a) except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-
thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamatefor 1,1-
dimethylethyl ((2S)-2-{[(4-bromo-2-thlenyl)carbonyl]amino}-3-
phenylpropyl)carbamate LC-MS (ES) m/z = 478 2 (M+H)+
b) /v-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-
1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
A solution of 1,1-dimethylethyl [(2S)-3-(3,4-difluorophenyl)-2-({[4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thienyl]carbonyl}amino)propyl]carbamate (279 mg, 0 497 mmol) and NCS (133 mg, 0 993 mmol) in N,N-Dimethylformamide (DMF) (3 ml) was heated at 110 °C for 1 hr The crude reaction mixture was concentrated and the residue was punfied by flash column chromatography on silica gel (DCM MeOH NH4OH 9 1 1) to give the product as a free base, which was treated
with 0 13 mL of 2N HCI aq (2 eq ) to give 75 mg of HCI salt as an off-white solid LC-MS (ES) m/z = 412 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8 80 (s, 1H), 8 18 (s, 1H), 7 3-7 1 (m, 3H), 4 54 (m, 1H), 4 11 (s, 3H), 3 26 (d, J = 7 Hz, 2H), 3 03 (d, J = 8 Hz, 2H)
Example 293
(Formula Removed)
Preparation of N-{nS)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared an off-white solid according to the procedure of Example 291 except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate for 1,1-dimethylethyl((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final product was purified by flash column chromatography on silica gel (DCM MeOH NH4OH 9 1 1) to give a free base, which was treated with 2N HCI aq solution to give the HCI salt LC-MS (ES) m/z = 378 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 8 78 (s, 1H), 8 50 (d, J = 2Hz, 1H), 8 36 (d, J = 2Hz, 1H), 7 3-7 1 (m, 3H), 4 57 (m, 1H), 4 23 (s, 3H), 3 27 (d, J = 8 Hz, 2H), 3 04 (d, J = 8 Hz, 2H)
Example 294
(Formula Removed)
Preparation of N-[(1 S,2S)-2-amino-3-hydroxy-1-phenylpropylV5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
a) 1,1-dimethylethyl [(1S,2S)-2-amino-1-({[(1,1-dimethylethyl)(dimethyl)silyl]oxy}methyl)-2-phenylethyl]carbamate
(Formula Removed)
he title compound was prepared according to Preparation 1 except substituting 1,1-dimeihylethyl [(1R,2R)-1-({[(1,1-
dimethylethyl)(dimethy!)siyl]oxy}methyl)-2-hydroxy-2-phenylethyl]carbarnate(ref Veeresa, G , Datta, Apurba Stereoselective synthesis of chloramphenicol from D-senne Tetrahedron Letters (1998\ 39(46), 8503-8504 ) for 1,1-dimethylethyl (2-hydroxy-2-phenylethyl)carbamate
b) N-[(1S,2S)-2-amino-3-hydroxy-1-phenylpropyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
This intermediate was prepared according to the procedures of Example 261, except substituting 1,1-dimethylethyl [(1S,2S)-2-amino-1-({[(1,1-dimethylethyl)(dimethyl)silyl]oxy}methyl)-2-phenylethyl]carbamate for 1,1-dimethylethyl (2-amino-2-phenylethyl)carbamate LC-MS (ES) m/z = 425 0/427 0 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 86 (s, 1H), 7 59 (s, 1H), 7 56-7 38 (m, 5H), 5 50(m, 1H), 3 91-3 84 (m, 3H)
Example 295
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide
a) Methyl 4-bromo-5-chloro-2-furancarboxylate
(Formula Removed)
Isopropylmagnesium chloride (1 20 ml, 2 40 mmol) was added dropwise to a solution of methyl 4,5-dibromo-2-furancarboxylate (568 mg 2 0 mmol) in Tetrahydrofuran (THF) (16 ml) at 0 °C The resulting mixture was stirred at this temperature for 30 mm and then cooled to -78 °C A solution of hexylchloroethane (568 mg, 2 401 mmol) in THF (1 mL) was added dropwise, and the resulting mixture was stirred at this temperature for 1 hr The reaction was quenched with addition of NH4CI (sat aq) and the resulting mixture was stirred at rt overnight Ether and water were added and the aqueous layer was discarded The organic layer was washed with brine, dried (Na2SO4) and concentrated to give 0 34 g of the product containing its isopropyl ester
b) N-t(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide
The title compound was prepared according to the procedure of Example 273, except substituting methyl 4-bromo~5-chloro-2-furancarboxylate for methyl 4-bromo-2-thiophenecarboxylate, and substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isoindole-1,3(2H)-dione The final product was purified by RP-HPLC and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z = 412 0/414 0 (M+H)+, 1H NMR (CD3OD, 400 MHz) δ 7 44 (s, 1H), 7 33 (m, 1H), 7 14-7 07 (m, 2H), 6 98 (m, 1H), 4 55 (m, 1H), 4 05 (s, 3H), 3 25-2 98 (m, 4H)
Example 296
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
a) 1,1-dimethylethyl ((2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-
ph enylpropy I )ca rba mate
A solution of 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate (prepared according to Preparation 22), except substituting 2-[(2S)-2-amino-3-phenylpropyl]-1H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-'2,4-dichlorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (200 mg, 0 455 mmol) and NCS (61 mg, 0 455 mmol) in DMF (3 ml) was heated at 50 °C in a sealed tube for 2 hours The solvent was removed and the residue was purified by biotage (30% Hex/EtOAc) to give the title product (140 mg, 65%)
b) N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-
yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according the procedure of Example 291, except substituting 1,1-dimethylethyl ((2S)-2-{[(4-bromo-5-chloro-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LC-MS (ES) m/z 376 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 12 (s, 1H), 7 74 (s, 1H), 7 31-7 35 (m, 5H), 4 58 (m, 1H), 3 94 (s, 3H), 3 35 (m, 2H), 3 05 (m, 2H)
Example 297
(Formula Removed)
Preparation of N-((1S)-2-amino-1-([2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamate for 1,1 -dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-
phenylpropyl)carbamate, LC-MS (ES) m/z 410 2 (M+H)\ 1H NMR (d4-MeOH, 400 MHz) δ 8 33 (m, 2H), 7 73 (m, 1H), 7 41-7 56 (m, 4H), 4 70 (m, 1H), 4 13 (s, 3H), 3 36(m, 2H), 3 18(m, 2H)
Example 298
(Formula Removed)Preparation of N-[(1S)--2-amino-1-[(4-fluorophenyl)methyl]ethyl)-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 24 (s, 1H), 8 06 (m, 2H), 7 29-7 34 (m, 2H), 7 01-7 05 (m, 2H), 4 66 (m, 1H), 4 08 (s, 3H), 3 23 (m, 2H), 3 15 (m, 2H)
Example 299
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(4-fluorophenyl]methyl]ethyl)-5-chloro-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxarrnde
The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-
difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC to give the title compound as a white solid LC-MS (ES) m/z 394 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 10 (s, 1H), 7 70 (s, 1H), 7 28-7 31 (m, 2H), 7 01-7 06 (m, 2H), 4 56 (m, 1H), 3 92 (s, 3H), 3 21 (m, 2H), 2 96 (m, 2H)
Example 300
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-cyclohexylpropyl)carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropylCarbamate LC-MS (ES) m/z 348 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 27 (m, 1H), 8 13 (s, 1H), 8 02 (s, 1H), 4 56 (m, 1H), 4 11 (s, 3H), 3 16 (m, 1H), 3 02 (m, 1H), 1 17-1 95 (m, 13H)
Example 301
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-(cyclohexvlmethyl)ethyl]-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-cyclohexylpropyl)carbamate for 1,1-dimethylethyl[(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC to
give the title compound as a white solid LC-MS (ES) m/z 382 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 10 (s, 1H), 7 82 (s, br, 1H), 4 42 (m, 1H), 3 94 (s, 3H), 3 16-3 30 (m, 1H), 2 98-3 10 (m, 1H), 1 06-1 96 (m, 13H)
Example 302
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl)ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamatefor 1,1 -dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate, The final compound was purified by RP-HPLC to give the title compound as a white solid LC-MS (ES) m/z 444 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 20 (s, brJH), 7 86 (s, br, 1H), 7 71 (m, 1H), 7 42-7 56 (m, 3H), 4 63 (m, 1H), 3 96 (s, 3H), 3 09-3 27 (m, 4H)
Example 303
(Formula Removed)
Preparation of N-{(1S)--2-amino-1-[(3-fluorophenyl)methyl]ethyl|-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3-fluorophenyl)propyl]carbamatefor 1,1-dimethylethyl
((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 24 (s, 1H), 8 02 (m, 2H), 7 30 (m, 1H) 7 06-7 13 (m, 2H), 6 96 (m, 1H), 4 63 (m, 1H), 4 08 (s, 3H), 3 09-3 27 (m, 4H)
Example 304
(Formula Removed)
Preparation of N-[(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-([(4-bromo-2-thienyl)carbonyl]amino}-3-(3-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-
difluorophenyl)propyl]carbamate, The final compound was purified by RP-HPLC to give the title compound as a white solid LC-MS (ES) m/z 394 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 10 (s, 1H), 7 70 (s, 1H), 7 31 (m, 1H), 6 97-7 11 (m, 3H), 4 52 (m, 1H), 3 92 (s, 3H), 2 96-3 26 (m, 4H)
Example 305
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{r3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-
thienyl)carbonyl]amino}-3-[3-(trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 410 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 81 (s, 1H), 8 51 (d, J=1Hz, 1H), 8 39 (d, J-1Hz, 1H), 7 64 (m, 2H), 7 50 (m, 2H), 4 66 (m, 1H), 4 23 (s, 3H), 3 30 (m, 2H), 3 15(m, 2H)
Example 306
(Formula Removed)
Preparation of N-(C\ S)-2-amino-1-{r3-(trifluoromethyl]Dhenyllmethyl)ethyl)-5-chloro-4-(1 -methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example 292, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-[3-(trifluoromethyl)phenyl]propyl}carbamatefor 1,1-dimethylethyl[(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate The final compound was punfied by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 440 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 53 (s, 1H), 8 02 (s, 1H), 7 50-7 64 (m, 4H), 4 56 (m, 1H), 4 03 (s, 3H), 3 10-3 27 (m, 4H)
Example 307
(Formula Removed)
Preparation of N-inS)-2-amino-1-[(3.5-difluorophenyl)methyl]ethy[M-n-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example
291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-
thienyl)carbonyl]arrl,no}-3-(3,5-difluorophenyl)propyl]carbamate for 1,1-
dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-
phenylpropyl)carbamate, The findi compound was purified by RP-HPLC, and
converted to HCI salt with 2N HCI aqueous solution LCVS (ES) m/z 378 2
(M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 68 (s, 1H), 8 47 (d, J=1Hz, 1H), 8 35 (d,
J=1 Hz, 1H), 6 96 (m, 2H), 6 80 (m,1 H), 4 60 (m, 1H), 4 21 (s, 3H), 3 28 (m, 2H),
3 08 (m, 2H)
Example 308
(Formula Removed)
Preparation of N-l(1S)-2-amino-1-[(3.5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example
292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-
thienyl)carbonyl]amino}-3-(3,5-difluorophenyl)propyl]carbamate for 1,1-
dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-
difluorophenyl)propyl]carbamate, The final compound was purified by RP-HPLC,
and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 412 0
(M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 44 (s, 1H), 7 98 (s, 1H), 6 96 (m, 2H),
6 82 (m, 1H), 4 66 (m, 1H), 4 01 (s, 3H), 3 20-3 25 (m, 2H), 3 02-3 05 (m, 2H)
Example 309
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluorometnyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-thiophenecarboxainide
a) 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonyl]amino}-3-[2-
(trifluoromethyl)phenyl]propyl}carbamate
(Formula Removed)
This intermediate was prepared according to Preparation 22, except substituting 4-bromo-5-methyl-2-thiophenecarboxylic acid (Bioorganic & Medicinal Chemistry Letters (2002), 12(3), 491-495) for 4-bromo-2-thiophenecarboxylic acid, and substituting 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1H-isomdole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(2,4-dichlorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione
b) N-((1S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-
1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonyl]amino}-3-[2-
(trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 424 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 68 (s, 1H), 8 04 (s, 1H), 7 70 (m, 1H), 7 58 (m, 1H), 7 52 (m, 1H), 7 43 (m, 1H), 4 65 (m, 1H), 4 05 (s, 3H), 3 16-3 28 (m, 4H), 2 59 (s, 3H)
Example 310
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl]-4-(1-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(2-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 60 (s, 1H), 8 43 (d, J=1Hz, 1H), 8 24 (d, J=1Hz, 1H), 7 37 (m, 1H), 7 27 (m, 1H), 7 08 (m, 2H), 4 66 (m, 1H), 4 19 (s, 3H), 3 27 (m, 2H), 3 10 (s, 2H)
Example 311
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{[2-(trifluoromethyl]phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 260, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonylJamino}-3-[2-
(trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 360 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 31 (s, 1H), 7 94 (s, 1H), 7 70 (m, 1H), 7 56 (m, 2H), 7 43 (m, 1H), 4 65 (m, 1H), 4 19 (s, 3H), 3 15-3 28 (m, 4H), 2 50 (s, 3H)
Example 312
(Formula Removed)
Preparation of N-((1S)-2-amino-1-{r2-(triflUoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1 -methyl-1 H-1,2.3-triazol-5-yl)-5-methyl-2 thiophenecarboxamide
The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-5-methyl-2-thienyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamate for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 458 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 70 (m, 2H), 7 55 (m, 2H), 7 44 (m, 1H), 4 67 (m, 1H), 3 99 (s, 3H), 3 12-3 21 (m, 4H), 2 42 (s, 3H)
Example 313
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-1,2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-fluorophenyl)propyl]carbamate for 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-
difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 394 2
(M+H)+, 1H NMR (d4-MeOH, 400 MHz) S 8 49 (s, 1H), 7 95 (s, 1H), 7 27-7 36 (m, 2H), 7 06-7 13 (m, 2H), 4 61 (m, 1H), 4 03 (s, 3H), 3 02-3 25 (m, 4H)
Example 314
(Formula Removed)
Preparation of N-((1S)-2-amino-1-f[2-(trifluoromethyl)phenyl]methyl)ethyl)-4-(1-methyl-1 H-1,2.4-triazol-5-yl)-2-furancarboxamide
The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl {(2S)-2-{[(4-bromo-2-furanyl)carbonyl]amino}-3-[2-(trifluoromethyl)phenyl]propyl}carbamatefor 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 394 2 (M+H)\ 1H NMR (d4-MeOH, 400 MHz) δ 8 50 (s, 1H), 8 43 (s, 1H), 7 71 (m, 1H), 7 61 (s, 1H), 7 54 (m, 2H), 7 42 (m, 1H), 4 66 (m, 1H), 4 14 (s, 3H), 3 25 (m, 2H), 3 14 (m, 2H)
Example 315
(Formula Removed)
Preparation of N-((1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example 260, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-
thienyl)carbonyl]amino}-3-(2,4-dichlorophenyl)propyl]carbamate(from Preparation 22) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt wth 2N HCI aqueous solution LC-MS (ES) m/z 410 0 (M+Hf, 1HNMR (J4-MeOH, 400 MHz) δ 8 23 (s, 1H), 8 14 (m, 2H), 7 47 (d, J=1Hz, 1H), 7 41 (d, J=1Hz, 1H), 7 25 (m, 1H), 4 68 (m, 1H), 4 30 (s, 3H), 3 11-3 28 (m, 4H)
Example 316
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example 291, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(2,4-dichlorophenyl)propyl]carbamate (from Preparation 22) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 410 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 71 (s, 1H), 8 47 (d, J=1Hz, 1H), 8 34 (d, J=1Hz, 1H), 7 45(m, 2H), 7 23 (m, 1H), 4 71 (m, 1H), 4 23 (s, 3H), 3 14-3 22 (m, 4H)
Example 317
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2.4-dichlorophenyl]methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1.2,4-trtazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amiiio}-3-(2,4-dichlorophenyl)propyl]carbamatefor 1,1-dimethylethyl[(2S)-2-{[(4-bromo-2-thienyi)carbonyl]amino}-3-(3,4-difluorophenyl)propyl]carbamate The final compound was punfied by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 446 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 65 (s, 1H), 3 11 (s, 1H), 7 44 (m, 2H), 7 25 (m, 1H), 4 68 (m, 1H), 4 08 (s, 3H), 3 10-3 23 (m, 4H)
Example 318
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(2,4-dichlorophenyl)propyl]carbamate (from Preparation 21) for 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 480 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 80 (m, 1H), 7 48 (m, 1H), 7 39 (m, 1H), 7 27 (m, 1H), 4 66 (m, 1H), 4 05 (s, 3H), 3 08-3 14 (m, 4H)
Example 319
(Formula Removed)
Preparation of N-{(1S)-2-y mino-1-[(4-chlorophenyl)methyl]ethyl)--4-(1-methyl-1 H-1.2,4-triazol-5-yl)--2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example
291, except substituting 1,1-dimethylethyl K2S)-2-{[(4-bromo-2-
thienyl)carbonyl]amino}-3-(4-chlorophenyl)propyl]carbamate for 1,1 -dimethylethyl
((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate The final
compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI
aqueous solution LC-MS (ES) m/z 376 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ
8 68 (s, 1H), 8 46 (d, J=1Hz, 1H), 8 29 (d, J=1Hz, 1H), 7 27-7 34 (m, 4H), 4 57 (m,
1H), 4 21 (s, 3H), 3 25 (m, 2H), 3 04 (m, 2H)
Example 320
(Formula Removed)
Preparation of N-i(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-n-methyl-1 H-1.2.4-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example
292, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-
thienyl)carbonyl]amino}-3-(4-chlorophenyl)propyl]carbamate for 1,1 -dimethylethyl
[(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(3,4-
difluorophenyl)propyl]carbamate The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 410 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 47 (s, 1H), 7 97 (s, 1H), 7 30 (m, 4H), 4 60 (m, 1H), 4 03 (s, 3H), 3 22 (m, 2H), 3 00 (m, 2H)
Example 321
(Formula Removed)
Preparation of N4(1S)-2-arr i,icM-[(3.5-difluorophenv0methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-1.2,3-triazol-5-yl)-2-thiop:-.enecarboxamide
The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-?-thienyl)carbonyl]amino}-3-(3,5-difluorophenyl)propyl]carbamatefor 1,1-dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 446 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 80 (s, 1H), 6 95 (m, 2H), 6 84 (m, 1H), 4 62 (m, 1H), 4 04 (s, 3H), 3 20 (m, 2H), 3 01 (m, 2H)
Example 322
(Formula Removed)
Preparation of N-i(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-1.2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to Example 261, except substituting 1,1-dimethylethyl [(2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-(4-chlorophenyl)propyl]carbamate for 1,1 -dimethylethyl ((2S)-2-{[(4-bromo-2-thienyl)carbonyl]amino}-3-phenylpropyl)carbamate, The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 444 0 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) S 7 73 (s, 1H), 7 30 (m, 4H), 4 66 (m, 1H), 4 04 (s, 3H), 3 18 (m, 2H), 2 99 (m, 2H)
Example 323
(Formula Removed)
Preparation of N-((1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl)-5-chloro-4-(1.4-dimethyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide
a) 4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarbox> he acid
(Formula Removed)
This intermediate was prepared according to the procedures of Example 269 a) and b) except substituting 1,4-dimethyl-5-(tnbutylstannanyl)-1H-1,2,3-triazole (from Preparation 21) for 1-methyl-5-(tnbutylstannanyl)-1H-1,2,3-triazole and substituting methyl 4-bromo-2-thiophenecarboxylate for methyl 4-bromo-5-chloro-2-thiophenecarboxylate LC-MS (ES) m/z 224 2 (M+H)+
b) 4-(1,4-Dimethyl-1 H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-
isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
This intermediate was prepared according to the procedure of Example 269
c) except substituting 4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic
acid for 5-chloro-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxylic acid, and
substituting 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isomdole-1,3(2H)-dione
for 2-{(2S)-2-amino-3-[2-(trifluoromethyl)phenyl]propyl}-1 H-isoindole-1,3(2H)-dione
LC-MS (ES) m/z 504 2 (M+H)+
c) 5-chloro-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isomdol-2-yl)-1-[(3-fIuorophenyl)methyl]ethyl}-2-thiophenecarboxamide
(Formula Removed)
A solution of 4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide (254 mg, 0 454 mmol), and NCS (60 6 mg, 0 454 mmol) in N,N-Dimethylformamide (DMF) (5 mL) to was heated at 40 °C overnight The reation mixture was taken into EtOAc, which was washed with H20 3X and brine, dried (Na2SO4) and concentrated The residue was punfied on a 25g Biotage column, which was eluted with 50-100% EtOAc /hexane to give 76 mg (28%) of product as a white foamy solid and 63 mg of recovered starting material LC-MS (ES) m/z 538 0 (M+H)+
d) N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 269 d), except substituting 5-chloro-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide for 5-chloro-N-((1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide The final compound was purified by RP-HPLC, and converted to HCI salt with 2N HCI aqueous solution LC-MS (ES) m/z 408 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 88 (m, 1H), 7 30 (m, 1H), 7 10 (m, 2H), 6 96 (m, 1H), 4 65 (m, 1H), 4 10 (s, 3H), 3 21 (m, 2H), 3 03 (m, 2H), 2 06 (s, 3H)
Example 324
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3-fluorophenyl]methyl]ethyl}-4-(1.4-dimethyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedures of Example 323 a), b) and d), except substituting 4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-AA-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide for 5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-N-{(1S)-2-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-1-[(3-fluorophenyl)methyl]ethyl}-2-thiophenecarboxamide LC-MS (ES) m/z 374 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 09 (d, J=1Hz, 1H), 8 06 (d, J=1Hz, 1H), 7 31 (m, 1H), 7 16 (m, 1H), 6 96 (m, 1H), 4 56 (m, 1H), 4 20 (s, 3H), 3 23 (m, 2H), 3 05 (m, 2H), 2 47 (s, 3H)
Example 325
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3,5-difluorophenyl]methyl]ethyl}-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedures of Example 323 a), b) and d), except substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 392 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 8 13 (m, 2H), 6 99 (m, 2H), 6 79 (m, 1H), 4 59 (m, 1H), 4 22 (s, 3H), 3 26 (m, 2H), 3 06 (m, 2H), 2 49 (s, 3H)
Example 326
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3.5-difluorophenyl]methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 323, except substituting 2-[(2S)-2-amino-3-(3,5-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 426 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 88 (s, 1H), 6 96 (m, 2H), 6 82 (m, 1H), 4 62 (m, 1H), 4 07 (s, 3H), 3 22 (m, 2H), 3 05 (m, 2H), 2 34 (s, 3H)
Example 327
(Formula Removed)
Preparation of N-{(1S)-2-amino-1-[(3,4-difluorophenvl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1.2.3-triazol-5-yl)-2-thiophenecarboxamide
The title compound was prepared as a white solid according to the procedure of Example 323, except substituting substituting 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1 H-isoindole-1,3(2H)-dione for 2-[(2S)-2-amino-3-(3-fluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione LC-MS (ES) m/z 426 2 (M+H)+, 1H NMR (d4-MeOH, 400 MHz) δ 7 87 (s, 1H), 7 12-7 26 (m, 3H), 4 62 (m, 1H), 4 08 (s, 3H), 3 21 (m, 2H), 3 00 (m, 2H), 2 36 (s, 3H)
Example 328
(Formula Removed)
N-((1S)-2-amino-1-[(3.4 difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
a) methyl 4-bromo-5-methyl-2-furancarboxylate
(Formula Removed)
To a solution of methyl 4,5-dibromo-2-furancarboxylate (4 5 g, 15 85 mmol) and BIS(TRIPHENYLPHOSPHINE)PALLADIUM(ll) CHLORIDE (0 38 g, 0 541 mmol) in THF (100 mL) at RT was added chloro(methyl)zinc (15 mL, 30 mmol) dropwise After stirring for 10h, the reaction was quenched with NH4CI (sat'd) (50 mL) The mixture was extracted with EtOAc (50 mL x 3), and the collected organic layers were dried over MgSO4 Solvent was removed under vaccum and the resulting residue was punfied via column chromatography (silica, EtOAc/Hex 10-20%) to give the title compound (2 5 g, 72%) as a white solid LC-MS (ES) m/z 220 (M+H)+
b) methyl 4-(1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxylate
(Formula Removed)
To a 100 mL sealed flask was added 1-ethyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1 H-pyrazole (2 2 g, 9 91 mmol), potassium carbonate (2 84 g, 20 54 mmol), methyl 4-bromo-5-methyl-2-furancarboxylate(1 5 g, 6 85 mmol) and BIS(TRI-T-BUTYLPHOSPHINE)PALLADIUM(0) (0 175 g, 0 34 mmol) in 1,2-dimethoxyethane (6 mL) and H2O (1 mL) After stirring for 2h at 72 °C, the reaction
solution was diluted with DCM (50 mL) and washed with H2O The organic layer was dried Na2SO4, filtered and concentrated The residue was punfied on silica gel [EtOAC/hexanes, 10-30%] to give the product [1 1 g, 68 6%] as an off white solid LC-MS (ES) m/z 235 (M+H)+
c; methyl 4-(4-ch!oro-1-ethyl-1 H-pyrazol-5-yl)-5-methyl-2-forancarboxylate
(Formula Removed)
A mixture of methyl 4-(1-ethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (950 mg, 4 06 mmol) and NCS (650 mg, 4 87 mmol) in THF (10 mL) was heated at 70 °C in a sealed tube After 2h, the reaction mixture was concentrated and purified via column chromatography (silica, 10-20% EtOAc/Hexane) affording the title compound (970 mg, 89%) as a white solid LC-MS (ES) m/z 269 (M+H)+
d) 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-furancarboxamide
(Formula Removed)
To a solution of methyl 4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxylate (500 mg, 1 86 mmol) in THF/H2O (5mL/1 mL) was added KOH (500 mg, 8 91 mmol) The reaction mixture was heated to 50° C for 4 h The mixture was concentrated, diluted with H2O (2 mL) and the pH was adjusted to 3 The mixture was extracted with DCM (10 mL x 3) The collected organic layers were concentrated under vacuum to give a crude acid (460 mg, 97%), which was used directly without of further purification LC-MS (ES) m/z 255 (M+H)+
, To the above acid (221 mg, 0 869 mmol) in DCM (5 mL) at 25 °C was
added PyBrOP(480 mg, 1 03 mmol) in one portion, followed by addition of DIPEA (1 0 mL, 5 73 mmol) After 10 mm, 2-[(2S)-2-amino-3-(3,4-difluorophenyl)propyl]-1H-isoindole-1,3(2H)-dione (250 mg, 0 79 mmol) was added to the reaction solution After 1h, the reaction mixture was concentrated and purified via column chromatography (silica, 30-50 % EtOAc/Hexane) affording the title compound (401 mg, 92%) as a white solid LC-MS (ES) m/z 553 (M+H)+
e)N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide
(Formula Removed)
At rt, NH2NH2 (0 5 mL, 15 93 mmol) was added to 4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-N-{(1S)-2-(3,4-difluorophenyl)-1 -[(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)methyl]ethyl}-5-methyl-2-furancarboxamide (260 mg, 0 47 mmol) in MeOH (5 mL)
After 48h, the solvent was removed under vaccum The resulting residue was taken into DCM (20 mL), and washed with H2O (20 mL x 3)
To the DCM solution was added HCI (36%, 10 mL, 120 mmol) After 1h, the aqueous phase was separated, and washed with DCM (30 ml x 3) Water was removed under high vacuum to give the title compound (140 mg, 69 7%) as an off-white solid LC-MS (ES) m/z 423 (M+H)+, NMR (d4-MeOD, 400 MHz) δ ppm 7 59 (s, 1H), 7 27-7 16 (m, 3H), 7 13-7 08 (m, 1H), 4 56 (m, 1H), 4 06 (q, J = 7 3 Hz, 2H), 3 26-3 22 (m, 1H), 3 17-311 (m, 1H), 3 05-3 00 (m, 1H), 2 97-2 91 (m, 1H), 2 36 (s, 3H), and 1 33 (t, J = 7 3 Hz, 3H)
Example 329 - Capsule Composition An oral dosage form for administering the present invention is produced by filing a standard two piece hard gelatin capsule with the ingredients in the proportions shown in Table I, below
Table I
(Table Removed)
Example 330 - Intertable Parenteral Composition An injectable form for administering the present invention is produced by stirring 1 5% by weight of N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide (Compound of Example 2) in 10% by volume propylene glycol in water
Example 331 - Tablet Composition The sucrose, calcium sulfate dihydrate and an Akt inhibitor as shown in Table II below, are mixed and granulated in the proportions shown with a 10% gelatin solution The wet granules are screened, dried, mixed with the starch, talc and stearic acid,, screened and compressed into a tablet
Table II
(Table Removed)
While the preferred embodiments of the invention are illustrated by the above, it is to be understood that the invention is not limited to the precise instructions herein disclosed and that the right to all modifications coming within the scope of the following claims is reserved

What is claimed is:
1. A compound of Formula (I):
(Formula Removed)

R41 and R42 are independently selected from: hydrogen,
halogen, C1-4alkyl, substituted C1-4alkyl, C1-4alkyloxy, substituted
C1-4alkyloxy, furan, substituted fruan, thiophene and substituted
thiophene,
where Q and Y are independently selected from: nitrogen and
-C(R70 )-, and Z is selected from: nitrogen and
-C(R48 )-, provided that at least one and at most 2 of Q, Y and Z are
nitrogen, and R30 is selected from: C1-4alkyl and C1-4alkyl
substituted with form one to three fluorine atoms,
where R is selected from: hydrogen, and halogen, and
R48 is selected from: hydrogen, C1-4alkyl, substituted C1-4alkyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl, cylcoalkyl, substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, and halogen;
R43 is selected from: hydrogen, halogen, C1-4alkyl, substituted C1-4alkyl,
C1-4alkyloxy, substituted C1-4alkyloxy, furan and thiophene;
R44 is absent or selected from: -(CR60 R61 )mAR wherein the AR is
unsubstituted, -( CR60 R61 )mAR wherein the AR is substituted and
C1-6alkyl,
where m is 0 to 3 and AR is a cyclic or polycyclic aromatic or saturated or unsaturated non-aromatic ring containing from 3 to 16 carbon atoms and optionally containing from one to three heteroatoms, provided that when the ring is aromatic and the number of carbon atoms is 3 the ring contains at least two heteroatoms and when the ring is aromatic and the number of carbon atoms is 4 the ring contains at least one heteroatom, and
R and R are independently selected from: hydrogen and C1-4alkyl, provided that when m is 3 no more than 4 of R and R when added together are C1-4alkyl,
R45 is selected from hydrogen and C1-4alkyl;
R20 is selected from hydrogen, C1-4alkyl and hydroxy;
X is selected from O, S and NR49 ,
where R49 is selected from hydrogen and C1-4alkyl; and
n is 0 to 2 and this moiety is optionally, if applicable, substituted by hydroxyC1-4alkyl;
(Formula Removed)
provided that one and only one of R41 and R42 is
and/or a pharmaceutically acceptable salt thereof.
2. A compound of Formula (I), as defined in Claim 1, wherein:
(Formula Removed)
R41 and R42 are independently selected from: hydrogen,
halogen, C1-4alkyl, trifluoromethyl, methoxy and furan,
where Q is nitrogen, Y is selected from: nitrogen and
-C(R70 )-, and Z is selected from: nitrogen and
-C(R48 )-, provided that at most one of Y and Z are nitrogen, and
R30 is C1-4a!kyl,
where R is selected from: hydrogen, and halogen, and
R48 is selected from: hydrogen, C1-4alkyl, trifluoromethyl, phenyl,
cylcopropyl, and halogen;
R43 is selected from: hydrogen, halogen, C1-4alkyl and methoxy;
R44 is absent or selected from: -(CR60 R61 )mAAR wherein the AAR is
unsubstituted, -( CR60 R61 )mAAR wherein the AAR is substituted
and C1-6alkyl,
where m is 0 to 3 and AAR is selected from phenyl, indole, naphthalene, pyridine and cyclohexyl, and
R and R are independently selected from: hydrogen and methyl,
provided that when m is 3 no more than 4 of R and R when added together are methyl,
R45 is selected from hydrogen and C1-4alkyl;
R20 is selected from hydrogen, methyl and hydroxy;
X is selected from O, S and NR49 ,
where R49 is selected from hydrogen and methyl; and
n is 1 to 2 and this moiety is optionally substituted by hydroxylmethyl;
(Formula Removed)
provided that one and only one of R41 and R42 is
and/or pharmaceutically acceptable salts thereof.
3. A compound of Claim 1 represented by the following Formula (AA):
(Formula Removed)
wherein:
(Formula Removed)
R1 and R2 are independently selected from: hydrogen,
halogen, C1-4alkyl, furan and thiophene,

where R6 is C1-4alkyl and R7 is selected from hydrogen, C1-4alkyl
and halogen;
R3 is selected from: hydrogen, halogen, C1-4alkyl, furan and thiophene;
R4 is selected from -(CH2)maryl and -(CH2 )maryl wherein the aryl is
substituted, where m is 0 to 2;
5 R5 is selected from hydrogen and C1-4alkyl;
X is selected from O and S; and n is 0 to 2;
(Formula Removed)
provided that one and only one of R1 and R2 is and further

provided that at least one of R1, R2 and R3 is hydrogen;
and/or a pharmaceutically acceptable salt thereof.
4. A compound of claim 1 selected from:
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-
furancarboxamide;
N-(2-amino-1-phenylethyl)-5-(1-methyl-1 H-pyrazol-5-yl)-2-
thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide;
N-(2-amino-1 -phenylethyl)-4-{[(2Z)-1 -methyl-2-(2-propen-1 -
ylidene)hydrazino]methyl}-2-thiophenecarboxamide;
N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-
pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1 -(phenylmethyl)ethyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-(3-furanyl)-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-3-(methyloxy)-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamicle;
N-[3-amino-1-(phenylmethyl)propyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
4-bromo-N-[2-(methylamino)-1-phenylethyl]-5-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1 -(phenylmethyl)ethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[2-amino-1 -(phenylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-(1-methyl-4-phenyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-4-phenyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-4-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(4-bromo-1-methyl-1H-pyrazol-S-yl)-4-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1 -
methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-fluoro-1-
methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[1 -(aminomethyl)-3-phenylpropyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide;
N-[1-(aminomethyl)-3-phenylpropyl]-5-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
4-bromo-N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[3-(methylamino)-1-phenylpropyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
4-bromo-N-[2-(methylamino)-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide
N-((1S)-2-amino-1-{[4-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-1-methyl-5-(1 -methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-5-(1-methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-1-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-1H-pyrrole-2-carboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-(methylamino)-1-(phenylmethyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-N-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[1-(aminomethyl)-2-methyl-2-phenylpropyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1 -{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyI]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[4-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino1-(phenylmethyl)ethyl]-5-(1-methyl-1H-imidazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-3,4-dibromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(1 H-indol-3-ylmethyl)ethyl]-4-bromo-5-(1 -methyl-1 H-pyrazol-5-yI)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-[(2-chlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(1-naphthalenyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(1-naphthalenyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{2-amino-1-[2-(trifluoromethyl)phenyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{2-amino-1 -[2-(trifluoromethyl)phenyl]ethyl}-4-bromo-5-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyI)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-(3-amino-1-phenylpropyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-ethyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-3,4-dibromo-5-(1-methyl-1 H-pyrazol-5-
yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-N-hydroxy-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-
1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-1H-
pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-ethyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-
ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1 -{[2-(trifllioromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1 -ethyI-1H-py razol-5-y I )-2-th ioph eneca rboxa m i d e;
N-[2-amino-1-(phenylmethyl)ethyl]-3-(methyloxy)-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-fluoro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-5-methyl-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-((1 S)-2-amino-1-{[2-(triffuoromethyl)phenyl]methyl}ethyl)-5-methyl-4-[1-methyl-4-(1-methylethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-propyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-4-propyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethylH-(1,4-dimethyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-ethyl-4-(1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1-methyl-4-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-4-ethyl-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide;
N-{(1S)-2-amino-1-[(4-fIuorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3-fIuorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1H-pyrazol-5-yI)-5-ethyl-2-furancarboxam ide;
N-((1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1 S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(4-bromo-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
/S/-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difchlorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,6-difIuorophenyl)methyl]ethyl}-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1 -[(2,4-difluorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-cyclopropyl-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fIuorophenyl)methyj]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1.4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(3-f!uotophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,5-difIuorophenyl)methyl]ethyl}-5-methyi-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fIuorophenyl)methyl]ethyl}-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(3-chloro-1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(3-chloro-1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-4-(4-ethyl-1 -methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifruoromethyl)phenyl]methyl}ethyl)-4-(4-ethyl-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(methyloxy)-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-(methyloxy)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-chloro-5-(4-bromo-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(3-pyridinylmethyl)ethyl]-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1R)-2-amino-1-phenylethyl]-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-phenylethyl]-4-(1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-phenylethyl]-5-methyl-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-phenylethyl]-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-ami no 1 -(4-ch lorophenyl)ethyl]-5-chloro-4-( 1 -methyl-1 H-pyrazol-5-yl )-2-thiophenecarboxamide;
N-[2-amino-1-(3-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(2-chlorophenyl)ethyl]-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(4-fluorophenyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-phenylethyl]-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -phenylethyl]-4-(4-bromo-1 -methyl-1 H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-[2-amino-1 -(2-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1 -(3-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-(2-aminoethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1 -(4-chlorophenyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(cyclohexylmethyl)ethyl]-4-(1,4~dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-phenylethyl]-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-[(1 S)-2-amino1 -methylethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[3-(trifluoromethyl)phenyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-[(1S)-1-(aminomethyl)-3-methylbutyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyra2ol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-arrnno-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-5-methyl-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-
pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyI)phenyl]methyl}ethyl)-4-(4-chloro-1-
ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-py razol-5-yl)-2-th iophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -ethyl-1 H-pyrazol-5-yI)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1H-pyrazol-5-yl)-5-(trifluoromethyl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
(N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1 -ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fIuorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1,4-diethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifIuoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyI]ethyl}-4-(1-ethyl-4-methyl-1H-pyrazol-5-yl)-2-furancarboxamicle;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-3-methyl-4-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifiuoromethyl)phenyl]methyl}ethyl)-4-[1-methyl-4-(trifluoromethyl)-1H-pyrazol-5-yl]-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-propyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-[(3,4-difIuorophenyl)methy[]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1 -[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -ethyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-4-{1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyf)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyI}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(phenyrmethyl)ethyl]-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyI)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1H-1,2,3-triazol-5-yl)72-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(4-chloro-1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(4-bromo-1-methyl-1H-1,2,3-triazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-[(1S)-2-amino-1 -(phenylmethyl)ethyl]-5-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-methyl-4-(1 -methyl-1 H-1,2,3-triazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-methyl-4-(1-methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1 S)-2-amino-1 -(phenylmethyl)ethyl]-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(phenylmethyl)ethyl]-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-(cyclohexylmethyl)ethyl]-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1 -(cyclohexylmethyl)ethyl]-5-chloro-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-[(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-methyl-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifIuoromethyl)phenyl]methyl}ethyl)-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2-fluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-4-(1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1 -[(2,4-dichlorophenyl)methyl]ethyl}-4-(1 -methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(2,4-dichlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1 H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(4-chlorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1 -[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(1.4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-4-(1,4-dimethyl-1H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,5-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-1,2,3-triazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-[(3,4-clifluorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-4-(1-methyl-1H-1,2,4-triazol-5-yl)-2-thiophenecarboxamidej
N-[(1S,2S)-2-amino-3-hydroxy-1-phenylpropyl]-5-chloro-4-(4-chloro-1-
methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-
methyl-1H-1,2,3-triazol-5-yl)-2-furancarboxamide; and
N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-4-(4-chloro-1-ethyl-1H-
pyrazol-5-yl)-5-methyl-2-furancarboxamide;
and/or a pharmaceutically acceptable salt thereof.
5. A pharmaceutical composition comprising a compound according to claim 1, and/or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.
6. A process for preparing a pharmaceutical composition containing a pharmaceutically acceptable carrier or diluent and an effective amount of a compound of Formula (I) as described in claim 1 and/or a pharmaceutically acceptable salt thereof, which process comprises bringing the compound of Formula (I) and/or a pharmaceutically acceptable salt thereof into association with a pharmaceutically acceptable carrier or diluent.
7 A pharmaceutical combination as claimed in claim 16 for use in therapy.
8. A compound of Formula (I), as defined in Claim 1, wherein: R is selectpri from: chlorine, ethyl, methyl and methoxy;
(Formula Removed)
where Q is nitrogen, Y is -CH- and Z is -C(R48 )-, and
R30 is selected from methyl and ethyl,
where R18 is selected from: hydrogen, methyl, chlorine and bromine;

R43 is hydrogen;
R44 is -CH2-phenyl wherein the phenyl is substituted by one or two
substituents selected from fluorine and trifluoromethyl;
R45 is hydrogen;

R20 is hydrogen;
X is selected from O and S; and n is 1;
and/or a pharmaceutically acceptable salt thereof.
9, A compound of claim 3 selected from:
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-
furancarboxamide;
N-(2-amino-1-phenylethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-
thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-{[(2Z)-1-methyl-2-(2-propen-1-ylidene)hydrazino]methyl}-2-thiophenecarboxamide;
N-(2-amino-1 -phenylethyl)-4-{[(2Z)-1 -methyl-2-(2-propen-1-
ylidene)hydrazino]methyl}-2-thiophenecarboxamide;
N-(2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-
pyrazol-5-yl)-2-thiophenecarboxamide;
N-[2-amino-1-(phenylmethyl)ethyl]-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-(2-amino-1-phenylethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1 S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}etriyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methy!}ethyl)-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenyl]methyllethyl)-4-bromo-5-(1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-bromo-5-(1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide; and
N-[2-amino-1-(phenylmethyl)ethyl]-4-methyl-5-(1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
and/or a pharmaceutically acceptable salt thereof.
10. A compound of claim 1 selected from:
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(1,4-dimethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1 -methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chIoro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-5-ethyl-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[2-(trifluoromethyl)phenyl]methyl}ethyl)-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chIoro-2-thiophenecarboxamide;
N-((1S)-2-amino-1-{[3-(trifluoromethyl)phenylJmethyl}ethyl)-4-(4-bromo-1-methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1 -[(4-fIuoropheny!)methyl]ethyl}-4-(4-bromo-1 -methyl-1H-pyrazol-5-yl)-5-chloro-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-5-(methy!oxy)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-diflIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(1-methyl-
1H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1S)-2-amino-1 -[(4-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -
ethyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(1,4-dimethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difIuorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyl-1 H-pyrazol-5-yl)-2-thiophenecarboxamide; and
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-ethyI-1H-py razol-5-yl)-2-furancarboxam ide;
and/or a pharmaceutically acceptable salt thereof.
11. A compound of claim 1 selected from:
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1 H-pyrazol-5-yl)-2-furancarboxamide;
N-{(1 S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl}-4-(4-chloro-1 -methyl-1 H-pyrazol-5-yl)-5-methyl-2-thiophenecarboxamide;
N-{(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide;
N-{(1 S)-2-amino-1 -[(3,4-difluorophenyl)methyl]ethyl}-5-chloro-4-(4-chloro-1 -methyl-1H-pyrazol-5-yl)-2-furancarboxamide;
and/or a pharmaceutically acceptable salt thereof.

Documents:

http://ipindiaonline.gov.in/patentsearch/GrantedSearch/viewdoc.aspx?id=1kDYL/dJU0g/nbFDoYCJvw==&loc=+mN2fYxnTC4l0fUd8W4CAA==

« Previous Patent

Next Patent »

Patent Number

278395

Indian Patent Application Number

5058/DELNP/2009

PG Journal Number

53/2016

Publication Date

23-Dec-2016

Grant Date

21-Dec-2016

Date of Filing

04-Aug-2009

Name of Patentee

GLAXOSMITHKLINE LLC,

Applicant Address

GLAXOSMITHKLINE LLC, 2711 CENTERVILLE ROAD, SUITE 400, WILMINGTON, COUNTRY OF NEW CASTLE, DELAWARE 19808

Inventors:

#	Inventor's Name	Inventor's Address
1	MARK ANDREW SEEFELD,	1250 SOUTH COLLEGEVILLE ROAD, COLLEGEVILLE, PA 19426, USA.
2	MEAGAN B. ROUSE	1250 SOUTH COLLEGEVILLE ROAD, COLLEGEVILLE, PA 19426, USA.
3	DIRK A. HEERDING	1250 SOUTH COLLEGEVILLE ROAD, COLLEGEVILLE, PA 19426, USA.
4	SIMON PEACE,	GUNNELS WOOD ROAD, STEVENAGE, HERTFORDSHIRE SG1 2NY, U.K.
5	DINNIS S. YAMASHITA,	1250 SOUTH COLLEGEVILLE ROAD, COLLEGEVILLE, PA 19426, USA.
6	KENNETH C. MCNULTY	1250 SOUTH COLLEGEVILLE ROAD, COLLEGEVILLE, PA 19426, USA.

PCT International Classification Number

A61K 31/12

PCT International Application Number

PCT/US2008/053269

PCT International Filing date

2009-02-07

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1	60/888,586	2007-02-07	U.S.A.