Title of Invention	NOVEL PRIMERS AND METHOD FOR AMPLIFICATION
Abstract	The present invention relates to a pair of oligonucleotide primers for amplifying cIlSP60 gene comprising SEQ ID NO. 1 and 2.

Full Text

FIELD OF INVENTION The present invention relates to novel oligonucleotide primers useful for amplification and cloning of chlamydial heat shock protein 60 (cHSP60) gene. BACKGROUND OF THE PRESENT INVENTION Invasion of the human host with genital tract infection causing bacterial species like Chlamydia trachomatis results in the mounting of an immune response leading to a stressful condition for the host. This leads to a response in the form of up-regulation of heat shock proteins (HSP) in both chlamydiae and the host during the infection. The involvement of chlamydial heat shock protein (cHSP) been implicated in pathogenesis of immune response. Furthermore, the gene for cHSP60 has been isolated and sequenced from a Chlamydia trachomatis genomic library using molecular genetic techniques (Cerrnoe et. al. 1991, Infect. Immun. 1, 79-90; GenBank accession number M58027). The primers disclosed in Cerrnoe ct. al. are degenerate primers which greatly reduces the specificity of the PCR amplification. In case of the primers known so far there is a problem of primers annealing to each other leading to formation of primer dimers and hence leading to no or inaccurate amplification. Primer design also involves incorporation of sites for restriction enzymes that may further interfere with the desired hybridization. Degenerate primers generally generate signals besides the correct one (false positives) which greatly effects the specificity of amplification. Additionally, it is important to know how many copies of the DNA target sequence are necessary to generate a positive signal (limit of detection or sensitivity), which indicates the likelihood of amplifying a sequence homologous to the true target sequence. Chlamydiae are known to be intracellular parasites and current tests emphasize the importance of collecting cellular material from the specimen. When utilizing these tests, an extraction method is required in order to separate the chlamydial antigen from the cellular material when an immunological test is performed. Thus, presently available diagnostic tests for chlamydia are based upon detecting the presence of major outer membrane protein (MOMP) or lipopolysaccharide (LPS). Diagnostic tests based upon cellular material arc undesirable since they require culturing of cells which is time consuming and they require processing of cellular material which is also time consuming and complex. Immunological techniques that detect Chlamydial antigens (like cHSP60) are attractive alternatives to cell culture for the diagnosis Chlamydia trachomatis infection, since such tests arc rapid and controllable and do not require viable organisms. Additionally, microscopic examination of cell culture can be circumvented as the diagnosis involves direct assessment of smears with conjugated monoclonal antibodies. Presently available diagnostic tests for chlamydia are based upon detecting the presence of major outer membrane protein (MOMP) or lipopolysaccharide (LPS) which are non specific. Accordingly, the present invention provides primers that are highly specific to target cHSP60 gene. OBJECTS OF THE INVENTION The main object of the present invention is to develop oligonucleotide primers for amplification and cloning of chlamydial heat shock protein 60 (cHSP60) gene from Chlamydia trachomatis. STATEMENT OF THE INVENTION The present invention relates to a pair of oligonucleotide primers for amplification of cHSP60 gene. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the amplification of cHSP60 gene using the primers of present invention. M - 500 bp DNA ladder; 1 and 2 - amplified cHSP60 gene. Figure 2 shows the characterization of the PCR fragment containing cHSP60 gene by restriction digestion. Ml and M2 - 1 kb DNA ladder; M3 - 500 bp DNA ladder; M4 - 100 bp DNA ladder; 5 and 6 - undigested PCR product; 7 - EcoRl digested (416 bp, 432 bp, 797 bp); 8 HindllI digested (337 bp, 403 bp, 895 bp) Figure 3 shows sensitivity of primers for amplification of cHSP60 gene from varying concentrations of the template DNA. 1 - 5,ng; 2 - 10 ng; 3 - 25 ng; 4 - 50 ng; 5 - 75 ng; 6 - 100 ng; 7 - 125 ng; 8 - 500 bp DNA ladder Figure 4 shows the characterization of pQE-30 vector containing the cHSP60 gene by restriction digestion. Ml - Lambda DNA/HindIII marker; M2 - 1 kb ladder; M3 - 100 bp ladder; 1 and 3 Supercoiled DNA; 2 and 4 - Linear DNA after digestion with BamH1(5 kb); 5 - EcoRdigested product (3.8 kb, 800 bp, 432 bp) Figure 5 shows (a) the expression analysis of cFISP60 using various concentrations of the inducer and (b) confirmation of the protein by monoclonal antibodies for cIISP60 by western blotting. 1 - uninduced; 2-0.5 mM; 3-1.0 mM; 4-1.5 mM; 5 - 2.0 raM DETAILED DESCRIPTION OF THE PRESENT INVENTION Accordingly, the present invention provides novel primers comprising SEQ ID NO. 1 and SEQ ID NO. 2 for amplification and cloning of cHSP60 gene (GenBank accession number M58027) from Chlamydia trachomatis. The primers have been uniquely designed so as to allow highly selective amplification of the full length if the cHSP60 gene. Sites for restriction enzymes have also been introduced at 5' end of each primer for convenient cloning from pGEM-T easy vector to pQE-30 expression vector. The primer sequences arc described below and the underlined sequence highlights the site for restriction enzymes Xmal in SEQ ID NO. 1 and Sail in SEQ ID NO. 2. Forward primer (SEQ ID NO. 1) 5'- TCCCCCCGGGATGGTCGCTAAAAACATTAAA-3' Xmal Reverse primer (SEQ ID NO. 2) 5' -ACGCGTCGACTTAATAGTCCATTCCTGCGCC-3' Sail The said cHSP60 gene can be amplified using primers of SEQ ID NO. 1 and SEQ ID NO. 2 by polymerase chain reaction (PGR). After 40 cycles of DNA amplification, agarose electrophoresis the fragment containing the gene of interest may be purified and isolated. The purified PCR product containing cHSP60 gene may be cloned and expressed in a suitable host. The recombinant protein may be purified and utilized in a dot blot assay by coating it on a nitrocellulose membrane pad and detecting presence of anti cFISP60 antibodies in scrum of patients suffering from urogenital infection. Since the sequence cloned and employed in the assay are substantially free of primer dimers or contaminants/extraneous sequences, the assay is more sensitive and yields accurate results. In fact the primers are so sensitive that they can detect and amplify the cHSP60 gene from as low as 10 ng of template DNA. The following examples are intended to illustrate but not limit the scope of invention. EXAMPLES Example 1 DNA amplification by polymerase chain reaction using novel primers A unique primer set with their restriction endonuclease sites was designed to amplify cIISP60 gene (GenBank accession number M58027). The oligonucleotides used as primers were synthesized by Microsynth, Balgach, Switzerland. The PCR reaction mixture (50 µl) consisted of 20 pinoles of each primer, 1 ul of Chlamydia target DNA and PCR reaction buffer [50 mmol/1 KC1; 10 mmol/1 Tris HC1; 1.5 mmol/1 MgCl2; 0.01 % w/v gelatin; 200 µM each of dATP, dGTP, dTTP, dCTP and one unit of Taq Polymerase (Promega)]. Samples were subjected to 40 cycles of DNA amplification in a thermocycler (Eppendorf mastercycler) using the following program: 1 min of denaturation at 95 °C (except for the first cycle, which was 5 min), 1 min of primer annealing at 58 °C, and 2 min of primer extension at 72 °C. After the last cycle, all samples were incubated for 10 min at 72 °C to ensure that the final extension step was complete. The amplified PCR product so obtained was confirmed on 1 % agarose gel stained with ethidium bromide and visualized under a UV transilluminator (Figure 1). The band of interest was incised from the gel with a scalpel and the DNA was purified using the QIAGEN gel extraction kit. The PCR product containing the amplified gene was also characterized by restriction enzyme digestion with EcoR1 and Hindi]] (Figure 2). Accordingly, as expected based on the sequence of the gene, the gel pattern yielded fragments of sizes 416 bp, 432 bp and 797 bp when digested with EcoRX and fragments of sizes 337 bp, 403 bp and 895 when digested with Hind]]]. Sensitivity of these primers to amplify the cHSP60 gene from lowest concentration of the template DNA was also determined. Varying concentrations (10-125 ng) of C. trachomatis plasmid positive patients DNA were used as template for PCR and the sensitivity was visualized over 1 % agarose gel after 40 cycles of amplification. The primers were found to be highly sensitive for the target DNA and could amplify the gene of interest from the template DNA as low as 10 ng in concentration (Lane 2, Figure 3). Primer Specificity was confirmed using Basic Local Alignment Search Tool (BLAST) (ht(p:/Awvw.ncbi.nlm.nih.gov/blasl/Blast.egi) which shows 100 % identity with cHSP gene, further, PCR products of five samples were sequenced to prove the primers used for present invention are specific for clfSP60. BLAST results of both forward and reverse primers are presented below: BLAST result for forward primer Features in this part of subject sequence: chaperonin GroEL Score = 42.1 bits (21), Except = 2e-05, Identities = 21/21 (100 %), Gaps = 0/21 (0 %), Strand = Plus/Minus Query 11 ATGGTCGCTAAAAACATTAAA 31 MM! IMI Illllll Sbjct 4 504 36 ATGGTCGCTAAAAACATTAAA 4 50416 BLAST result for reverse primer Features in this part of subject sequence: chaperonin GroEL Score = 42.1 bits (21), Except = 2e-05, Identities = 21/21 (100 %), Gaps = 0/21 (0 %), Strand = Plus/Plus Query 11 TTAATAGTCCATTCCTGCGCC 31 I I III I I I I II II | I | | | | | | Sbjct 4 4 8802 TTAATAGTCCATTCCTGCGCC 448822 Example 2 Cloning ofcHSP60 gene in pGEM-T easy vector The purified PCR product containing the putative cHSP60 gene was ligated with pGEM-T easy vector (Promega). The ligation mixture (10 µl) consisted of 5 µ1 ligation buffer (2X), DNA insert, 1 µl pGEM-T easy vector (50 ng), 1 µ1 DNA ligasc and 3µl sterile distilled water. The ligation mixture was incubated overnight at 4 °C and on the following day 10µl of the ligation mixture was transformed in E. coli DH5a competent cells. Plasmids from overnight culture were isolated and subjected to restriction digestion with Xmal and .SalI. The reaction consisted of 9 ul sterile distilled water; 1.5 ul reaction buffer (10X); 4 µl plasmid: 0.5 µl Xmal I Sail and was incubated at 37 °C for 1 h. The digested product (1655 bp) was cut from the gel with a scalpel and the DNA was purified with QIAGEN gel extraction kit. Example 3 Cloning ofcHSP60 gene inpQE-30 vector The pQE-30 vector was chosen in order to append C-terminal histidinc tag (6XIIis) to the recombinant protein for convenient purification. Both the amplified insert and the pQK-30 vector was cut with appropriate restriction enzymes (Xmal and SalI) and ligatcd using T4 DNA ligase (New England Biolabs). The ligated product containing insert was transformed into Ml 5 (pREP4) E. coli cells (Qiagen) using standard protocols (CaCl2 and heat shock treatment). The transformed cells were plated on 1.5 % agar containing 25 mg/ml kanamycin (Mi Media) and 100 mg/ml ampicillin (Hi Media). Colonies were screened for the presence of an insert of the predicted size by DNA amplification. Oligonucleotides used were the primer-promoter region and the primer reverse sequencing for pQE vectors (Qiagen). Bacterial cells from each colony tested were grown overnight in 1.5 ml Luria Broth (LB) medium containing kanamycin (25 mg/ml) and ampicillin (100 mg/ml). Glycerol stocks were prepared upon identification of recombinant clones. The identity of positive clones was confirmed by nucleotide sequencing in both orientations of the entire DNA insert. Nucleotide sequences were analyzed with the basic local alignment and search tool (BLAST) software. They were translated into protein sequences and compared with known sequences in ExPASy. Thus the cHSP60 gene was placed under the influence of Isopropyl P-D-1-thiogalactopyranoside (IPTG) inducible T5 promoter with a lac operator to provide tight regulation of expression in E. coli. pQE-30 vector carrying the cHSP60 gene was also characterized by restriction digestion with Bamlil and EcoRl (Figure 4). Based on the orientation of the gene in the vector and its sequence, the gel pattern yielded a linear DNA fragment upon digestion with BamHl and fragments of sizes 3.8 kb, 800bp and 432 bp upon digestion with EcoR\. Example 4 Purification of 6XHis tag recombinant protein Purification of the recombinant HSP60 with a C-terminal 6XHis tag was performed to check the molecular weight. 10 ml of culture medium was inoculated with overnight cultures of recombinant clones. Expression of the protein was induced by adding 1 mM IP'FG. Purification was performed under denaturing conditions to isolate any tagged proteins, independent of their solubility within the cell, as per Qiagen protocol (The TM QIAexpressionist , A handbook for high-level expression and purification of 6xHis~taggyd proteins). Ni-NTA spin columns(Qiagen) were used for purification and the eluted proteins were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGK) and the gels were stained using coomassie blue R-250. Example 5 Large-scale expression and purification of 6XHis tag recombinant protein under native conditions A small inoculate of glycerol stock was added to 25 ml of LB medium containing kanamycin (25 mg/ml) and ampicillin (100 mg/ml) and was incubated overnight at 37 °C. This overnight seed culture was subsequently transferred to 500 ml of LB medium containing kanamycin (25 mg/ml) and ampicillin (100 mg/ml), incubated at 37 °C for about 1 h, and induced with 1 mM IPTG for about 3.5 h with vigorous shaking. The E. coli culture was pelleted by using an centrifuging at 4000 X g for 20 rnin at 4 °C. Pellets were washed with phosphate buffer saline (PBS) and frozen at -20 °C until used. Pellets were thawed and resuspended in lysis buffer (50 mM Na2HP04/NaH2P04 buffer, pH 8.0; 300 mM NaCl; 10 mM imidazole; I mM phenylmefhylsulfonyl fluoride; 20 mM 2-mercaptoethanol and 1 mg/ml lysozyme. The cell suspension was sonicated for 6X10 sec on ice to ensure complete resuspension and the lysate was then centrifuged at 10000 X g for 30 min at 4 °C to pellet the cell debris. Past protein liquid chromatography (FPLC) equipment (Pharmacia Amersham) was used to purify proteins under native conditions by nickel chelate affinity chromatography (Qiagen Ni-NTA Superflow resin) Size exclusion chromatography was performed at room temperature using a FPLC system (Pharmacia Amersham) equipped with a Superdex-200 HR 10/30 column. The column was equilibrated with atleast 3 bed volumes of 50 mM Tris-HCl (pH 8.0) supplemented with 150 mM NaCl prior to each run and a typical flow rate of 0.35 ml/min was maintained. Absorbance at 280 nm was measured to monitor elution of the protein from the column. The protein estimation was performed using Bradford Assay (Sigma). Purified proteins were subsequently characterized by SDS-PAGE and immunoblotting separated into aliquots. and frozen at -80 °C (Figure 5). Various concentrations of IPTG (0.5-2 mM) were used as inducer and the cell extracts obtained from the E. coli culture was analyzed be gel electrophoresis and the presence of cHSP was confirmed by using monoclonal antibody by western blotting. Upon addition of no inducer (Lane 1, Figure 5) a very faint band of the protein appeared confirming that its expression was under strict regulatory control. Example 6 Development of Dot Blot assay Purified chlamydial heat shock protein 60 was coated on nitrocellulose membrane padv, adhered to plastic combs at a concentration of 20 ng/pad and blocked with 5 % skimmed milk in 0.01 M PBS overnight. The combs were then washed in 0.01 M PBS with 0.5 % twecn-210 (PBS-T) dried and incubated with optimally diluted sera (1:200) in PBS-T at 37 °C for 1 h. After 3 washes the combs were incubated with anti-human IgG horse radish peroxidase conjugate at 37 °C for 1 h, washed 4 times and incubated with diaminobenzidinc (DAB) substrate for a few seconds. The enzyme substrate reaction was terminated by washing under tap water. Formation of a clear dot indicated a positive reaction against chlamydial antigen for both positive and negative cases. WE CLAIM: 1. A pair of oligonucleotide primers comprising SEQ ID NO. 1 and 2 for amplification of cHSP60 gene. 2. A method of amplifying cHSP60 gene by polymerase chain reaction (PCR) with a reaction mixture comprising: primers of SEQ ID NO. 1 and 2 and incubating the same to obtain the amplified sequence. 3. The method as claimed in claim 2, wherein amplification is performed for 35-45 cycles. 4. The method as claimed in claim 2, wherein amplification by PCR includes a step of denaturation of the template DNA which is performed at a temperature in the range of 92-98 °C for 0.5-2 min. 5. The method as claimed in claim 2, wherein amplification by PCR includes a step of primer annealing to the cHSP60 gene which is performed at a temperature in the range 45-65 °C for 0.5-2 min. 6. The method as claimed in claim 2, wherein amplification by PCR includes a step of primer extension which is performed at a temperature in the range of 65-75 °C for 1 -3 min. 7. The method as claimed in claim 4, wherein after the last cycle, sample is incubated for 5-15 min at a temperature in the range of 65-75 °C to ensure that the final extension step is complete. 8. Novel primers for and method for amplification of heat shock protein 60 (IISP60) gene substantially as herein described with reference to the foregoing examples and accompanying drawings.

Documents:

1861-DEL-2008-Abstract-(29-05-2013).pdf

1861-del-2008-abstract.pdf

1861-DEL-2008-Claims-(29-05-2013).pdf

1861-del-2008-claims.pdf

1861-DEL-2008-Correspondence Others-(14-03-2012).pdf

1861-del-2008-Correspondence Others-(19-04-2012).pdf

1861-DEL-2008-Correspondence-Others-(29-05-2013).pdf

1861-del-2008-correspondence-others.pdf

1861-del-2008-description (complete).pdf

1861-del-2008-drawings.pdf

1861-del-2008-form-1.pdf

1861-del-2008-Form-18 (09-09-2008).pdf

1861-del-2008-form-2.pdf

1861-del-2008-form-26.pdf

1861-del-2008-form-3.pdf

1861-del-2008-form-5.pdf

1861-del-2008-GPA-(19-04-2012).pdf

1861-DEL-2008-GPA-(29-05-2013).pdf