Title of Invention	"HIV-1 INDIAN SUBTYPE C VACCINE CONSTRUCTS FOR USE IN HUMANS
Abstract	Human Immunodeficiency Virus type 1 Indian Subtype C (HIVO1C) vaccine constructs comprising codon optimized three structural genes (two envelope gp 120 from Indian HIV-l C2 strain 29692 and Indian HIV-IC3 strain 49426 and one gag-protease from Indian HIV-1 C 49587) and two non-structural genes (tat and nef from Indian HIV-1C) mounted on to a plasmid DNA vector and a viral vector.

Full Text

Patent Application for HIV-1 Indian subtype C vaccine constructs for use in humans. FIELD OF INVENTION: This invention relates to development of H IV-1 vaccine candidates and to the process of preparation there of. In particular this invention relates to Indian HIV-1 subtype C constructs comprising HiV-1 subtype C envelope (gp120) and capsid (gag-protease), nef and tat genes cloned In plasmid DNA vector, and viral vector. BACKGROUND OF INVENTION AIDS is one of the most dreaded infections afflicting the human race today. Therefore, development of a safe and effective vaccine clearly is paramount to halting the AIDS epidemic. All living forms, particularly human beings, have an immune system, which protects the body against the invasion of various microorganisms including viruses. However, HIV invades the cells of immune system and destroys ft. Consequently virus replicates in the body unchecked. An effective vaccine against HIV can halt this march of virus in hinnan beings, which has been a goal for the scientiTic community. An effective vaccine should induce a long-lasting and robust immune response, which would pre-empt invasion of HIV in human body. Past approaches for viral vaccines such as use of attenuated live virus constructs or killed viruses pose significant safety Issues with HIV, although these have succeeded for other virus infections like poliovirus or measles virus. Alternate approach that has been employed for making HIV vaccines is Recombinant DNA technology. This approach has allowed scientists to use portions of HIV genes to Induce Immune response. These genes are mounted on a carrier DNA molecule called a vector and then injected into a recipient in whom it induces an immune response against HIV; thus provkling a high degree of safety. Simiiarty, these genes may also be mounted on a virus vector, which induce HiV-1 specric immune response in an animal when injected. OBJECTS OF INVENTION: As Object of this invention is to propose a vaccine against Indian subtype C of Human immunodeficiency Virus type 1 (HiV-1) for human behgs. Another object of this invention is to propose a vaccine for effectual combating HIV-1 subtype C virus infection. Further objects and advantages of this invention will be more apparent from the ensuing description. At the outset of the description, which follows, it Is to be understood that the ensuing description only illustrates a particular form of this invention. However, such a particular form Is only an exemplary embodiment and without intending to be understood as an exemplary embodiment of teaching of the Invention and not intended to be taken restrictively. BRIEF DESCRIPTION OF THE INVENTION: According to this invention there are provided HiV vaccine constructs based on recombinant DMA technology to combat HIV-1 subtype C infections, comprising human codon optimized structural genes (envelope and gag-protease) and non structural genes (nef and tat) of Indian strains of HIV-1 subtype C mounted on piesmid DMA vector and viral vector. In accordance only this invention, the structural genes, gp120 and gag-protease, of Indian HIV-1 subtype C are a part of nucleic acid of HlV-1 subtype C viruses. The non-structural genes are required for the replication of the virus. The sequence of these genes Is modified to human codon frequency without changing the amino acid sequence. The codon optimized structural genes are synthesized and then mounted on a plasmid DNA vector or a virus vector, which carry these genes to the ceil inside the human body. These genes are then processed by the cell to produce proteins without affecting the cellular functions. According to this invention there are also provided methods for constructing plasmid DNA vaccine and recombinant viral vector vaccine constructs using codon optimized envelope gp120, gag-protease, nef and tat genes of Indian HIV-1 subtype C, eliciting HiV-1 specific immune response in mice as well as monkeys by Injecting these vaccine constructs in these animals . DETAILED DESCRIPTION OF THE INVENTION: 1. Amplification of envetope gp120 gene, gag-protease gene, nef gene and tat gene of HIV-1 subtype C {Indian strain) present in the peripheral blood of three infected asymptomatic individuals. Polymerase chain reaction (PCR) technique was employed to amplify 1.4 kb gp120 gene region and 1.8 kb gag-protease gene region from the DNA isolated from the peripheral blood mononuclear cells (PBIMCs) of three HIV infected asymptomatic Individuals using appropriately designed primers. Briefly, PBMCs were isolated from the peripheral blood by ficoll-hypaque density gradient centrifugation. DNA was extracted from the PBMCs by lysing the cells with proteinase K treatment at 72C followed by precipitation of DNA with ethanol. The DNA was purified with spin columns and dissolved in TE buffer at pH8.0. For gene ampiffication a reaction mix constituting of buffer, forward and reverse primers, dNTPs (dATP, dGTP, dCTP, dTTP), MgCb and Taq DNA polymerase, was added to heat denatured template DNA (DNA extracted from PBMCs). The mixture was placed in a thermocycler. PCR cycling conditions were as follows: denaturatlon for 20 sec at 92°C, annealing for 40 sec at 52°C, extension for 4 min at 68*'C. This regime was followed for 25 cycles foilowed by final extension at 72°C for 15 minutes. The amplified DMA was prec^itated with ethanoi and then purified by gel electrophoresis. These amplified DNA preparations represented two envelope gp 120 genes and one gag-protease gene, one nef gene and one tat gene. 2. Smquencing The five amplified genes were sequenced by direct sequencing reaction using primer walking strategy. DNA of these amplified genes were purified by ethanoi precipitation and sequencing reaction was put up for each DNA preparation using the Big Dye terminator Kit and cycle sequencing was carried out in PCR System2400. The sequence data obtained were then sorted, aligned and analysed. Thereafter, it was subjected to codon optimization as per human codon frequency manually. 3. Codon-Optimization These five genes were codon optimized as per human codon frequency to get better expression and ellcltation of solid immune response in humans. White doing codon optimization care was taken not to disturb the amino acid code. In gag-protease gene ail the 'INS' sequences were remove withhout disturbing the amino acid sequence and also sequence from nt 1276 to nt 1477 was left without optimization (Stem-ioop-Stem). 4. Construction of Codon Optimized genes The codon optimized genes were constructed by using the PCR amplification method. The constructed genes were then sequenced in an automated sequencer. The sequence data of the synthesized genes were then compared with the expected sequence and both sequences had a 100% homology. The codon optimbied genes were named as: env-9p120-29692CO, env-gp120-49426CO, gag-protease49S87CO, IND-tatCO, IND-nefCO. 5. Cloning of Codon Optimized genes in ptesmid vector After synthesis, the five genes were cloned into mammaKan expresion v ector. The resultant plasmids, NK-29892CO, NK-49428CO and NK-49687CO, NK-iND-tatCO and NK-IND-nefCO, were then tested for In vitro expresslon in293T ceils of human origin. 293T ceHs were transfected with these piasmids. After 72 hours, the transfected cells were examined for the expression of these genes by immunobiotting. Specific bands of the expressed antigens were detected both in cell lysate and culture supernatant. Further confirmation of the expression of codon optimized genes by transmission electron microscopy shows the presence of virus like particles and a thin Him of gp120 antigen around the cell membrane. 6. Cloning of codon optimized genes in virus vector After synthesis, the five genes were also cloned in Piasmidjhuttle vector, pSC65. The resultant recombinant piasmids were used to construct recombinant MVA carrying HIV-1 Indian subtype C structural genes: W-29692CO, W 49426CO, W-49ft87CO, W-IND-tatCO and W-IND-nefCO. These recombinants were used for in vitro expression in cell culture system (BHK-21 cells) by western blot assay, p-24 antigen assay, indirect immunofiuorescent assay (IFA) and transmission electron microscopy (TEM). The western blot showed corresponding HIV speciflc proteins, IFA showed an apple green fluorescence on tiie surface of Infected BHK-21 ceils and TEM siiowed budding of virus Nice particles from the infected ceils. 7. immunogenMy studies in monfieys Prime boost strategy was employed to immunize Macaca radiata (bonnet monkeys). HiV-1 plasmid DNA vaccine constructs were used for priming the animals with single dose of recombinant plasmids constructs, NK-29692CO, NK-49426CO, NK-49687CO, NK-IND-tatCO and NK-INDnefCO Iniradermally. Four weeks later a single boosting dose with recombinant MVA constructs, W-28692CO, W-49428CO, W-49587CO, W-IND-tatCCO and W-IND-nefCO were given intradermaily. Thereafter, HIV-1 subtype C specific immune response against HIV-1 proteins was assayed in these animals. Both arms of immune response, antibody and cellular, were assayed by ELISA and ELISPOT raspectiveiy. The immunized animals developed a robust HiV-1 subtype C speciflic antibody as well as cell mediated immune responses, which could be demonstrated even after 42 weeics of Immunization. These data suggest that these vaccine candidates have immense potential as HiV-1 subtype C vaccine candidates for use In humans. 7. Protocol PROTOCOL REMOVE 1 Human immunodeficiency Vincs type 1 Indian Subtype C NIV-IC vaccine construct comprising codon optimist three structural genes; two envelope gp 120 gene sequences of Indian IIlV-1 subtype C strains 29692 (Accession no 101 1 19) and 49426 (Accession no AY7752833, one gag-protease gene sequence from lndian HIV-1 subtype C strain 49527 ((Accession no 533140), one tat gene consensus sequence (derived fiom tat gene sequence of Indian MIV-1 subtype /C viruses with accession nos. AB023804, AF067154, AF067155. AF067157, AF067158, AF064159. AF286223. AF28623 1. AF286232. AY49708, AY049709. AY049710. AY049711) and onc nef gene consensrls sequence (derivcd l'ro~n net' gene scqucnces of lnaim HIV-I subtype C viruses with the accession nos DQ398877, 130398875, DQ398878. 119398876, DQ398879, DQ398874, DQ398873) were codon optimized to human codon frequency (from A:T bias to G:C , bia.), the sequences of codon optimized genes are: i. Codon optimized ellvelope gp120 29620 gew; GC% after codon optilnizatiol~is 63% CTC;'I'~;SGTGRCCGTC~TACTACGGCCTGCCC~~TGTGGAAGGAGCCCP.AGACCACCC~CGTTCTGGC;CCAGC~~CGCC~~G::~~~~~ G A G A A G G A c G T G C A C A A C G T G T G G ~ ~ C C A C C C : A C : G C C T G ~ , C ~ ~ ~ ~ ACCGAGAACTTCAACATGTGGMGAAC~~P.CATGG~'GGACCAGAT~CACGAGGACGT~ATC~GCOTGTGGGACCAG~~C~~~~~ CCCTGCGTGAAGCTGACCCCCCTGTGCG'~GACCCTG~~~TGCCGCAACGTGAACAACACCGGCACCAACAACGTGACC~~~~~~ T A C A A C G G C A C C A G C G A G A ' ~ C ~ A G A ? + ~ T G C A G C T T C ~ G G T G T A C G ~ C C ~ G TTCTACCGCCTGGACATCGTGCCCCTGGACGAGAAGGRCAACAGCAGCAGCAGCGAGTACTACCGCCTGATCAACTGCAACACC AGCGCCATCACCCAGGCCTGCCCCAAGGTGACCTTCGACCCCATCCCCATCCACTTCTGCGCCCCCGCCGTACGCCATCCTG A . ~ G T G C A A C A A ~ A R G A C C T T C A P . C G G C A C C G G C C C C T G ~ ~ A ~ A A C G T G A G ~ A ~ ~ G T G ~ A G T G ~ A ~ ~ ~ A ~ G G ~ A T ~ ~ G ~ ~ ~ G GTGAGCACCCAGCT:;CTGCTGAAC~~C;~:AGCCTGGCCGAGG~CGAGATCATCATCCGEAGCGAGAACCTGACCAACAACGCCAAG A(:~:~~PCATCCTGCACCTGAACEF~C.ASC~~ISGAGATCI~TGTGCACCCGCCCCAACMCMCA(:CCCCCGCAG:~ATCCCCATCG~~C ~:~:C~GCC~CACCTTCTAC!;CCAA~AACGH::~T~ATCGGC:~~ACA'I'::~GC~RCC,CCCA~:T~;~.A%CAI'~:~',~;~,~,AT;CA.CGTC~~~~;:;.*JI.~GCACCCT~~CAGAAG~TGGGCGAC~A~GCTGACCSAGCACT~C~~~~AACAA~~A!~C~TCACC'~'~CGCCCCCCCCAGCGGC~CCGAC CTGGAGATCACCACCCACAC;CTTCAA(':'~GCCGCGGCGAGR"I'C:'I"~~~TACTGCAACACCAGCI;C~CT~~?'~'CAACA~C~AGC'~C;A&C. GACAAGGAGGGCAACAGCACC(:TGAGC~TCACCATCCCCTGCCGCATCAAGCAGATCATCM.CATGTCGCAGGAGGTGGGCCGC C . C C A T G ' ~ A C C ; C C C C C C C C A T C G A G C ; G C A A C A T C A C : G G C C C C ACCAAGAACAAGACCGAGACCTTCCC;CCCCCGCGGCGGCGACATC;CGCGACAACTC;GCGCAGCGAC~CTI;'ACAAGTACAAGGTG GT~:~~~~A~'CAA~~CCCCTGGGCGTC;GCC~~CCACCP?AGGCC:.~AGCGCCGCGTGGTGGAG~~GCGAGAAC~CC,~:T~A ii. Codon optilrlized cl~velopeg pl20 49426 gene; (iC% after codon optimizatiun is 62.8% CTGTGGGTGACCGTGTACTACGGCC~TGCCCCTGTGG~~AC~GAC:GCCL~~GACCACC~GT'~CTC.CGCC~GCS~CGCCAAG~~CCTAC GAGCGCGAGGTGCACNICGTGTGGCCCACCCACGCCTGCGTGCCCACCGACCCCAACCCCCAGGAGhTCGTGCTGGAGAACGTG ACCGAGAACTTCAACATGTGGAAGAACGACATCGTGAACCAGATGCACGAGGACATCATCAGCCTGTGGGACCAGAGCCTGAAG CCCTGCGTGAA~TGACCCCCCTGTGCGTGACCCTG~CTGCAGCAACGCCAACAACACCGCCACCAACAACGTGACCGCCACC AACAACGTGACCAGCGACATGAAGAACTGCAGCTTCAACGCCACCACCGAGCTGCGCGACAAGCGCCAGAAGGTGTACGCCCTG T T C T A C A A G C T G G A C A T C G T G C C C C T G A A C G A G R A G G A C A C T G C A G C A C C A G C ACCGTGACCCAGGCCTGCCCCAAGGTGAGCTTCGACCCCATCCCCATCCACTACTGCACCCCCGCCGGCTAC~;;CCATCCTGAAG T~~:AF.CAACAAGACCTTCAACGGCACCGC~CCC(~TGCCAC~CGTGAGCACCGTGCAGTGCACCCA~GGCATC~GCCCGTGGTG ~~(;~ACCCAGCTGCTGCTCAACGGCAGCCTGGCCGA~~~~GCGAGATCATCATCTGGAGCGAGAACCTGACCAACAACGTGAAGACC ATCATCGTGCACC'I'GAACGAGAC;CGT(~GAGATCGTGTGCACCCGCCCCAACAACAACACCCGCCGCAGCATCCGCATCGGCCCC G ~ ~ ~ ~ ~ ~ ACC~T~CAGAAGGTGGGCAAGAAGCTGAAGGAGCACTTCCCCAACAAGACCA'I'C~~CCTTCC;AGCCCCRCAGC:GGT:':GCC;AI;:CTG ACCGAGGGCAACAGCACCCTC;~~C;CA'I'CACCCTG~:CCTGCCCCATCAAGCAGATCATCMC~TG'~C; A~GTACGCCCCCCCCATC~~A~JGGCAACA'I'CA(:CTGCAA~;A[;CAA(:AT!:AC::T$GCCTGCTGCTGACCCGCGGCGGCGGCCC(:CCC ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ; ~ . . ( ; . ~ ~ ~ ~ ; ~ ~ ~ ~ ~ : ~ ~ T . ~ ~ ~ I . ~ : : ~ ~ ; ~ ~ ~ ; ( ; ~ : ; ;

Documents:

63-del-2004-Abstract-(07-05-2013).pdf

63-DEL-2004-Abstract-(11-07-2013).pdf

63-del-2004-Abstract-(26-04-2013).pdf

63-del-2004-abstract.pdf

63-del-2004-Claims-(07-05-2013).pdf

63-DEL-2004-Claims-(11-07-2013).pdf

63-del-2004-Claims-(26-04-2013).pdf

63-del-2004-claims.pdf

63-del-2004-Correspondence others (15-07-2013).pdf

63-DEL-2004-Correspondence Others-(31-10-2011).pdf

63-DEL-2004-Correspondence-Others-(11-07-2013).pdf

63-del-2004-Correspondence-Others-(26-04-2013).pdf

63-del-2004-correspondence-others.pdf

63-del-2004-correspondence-po.pdf

63-del-2004-description (complete).pdf

63-DEL-2004-drawings-(15-07-2013).pdf

63-del-2004-form-1.pdf

63-del-2004-form-19.pdf

63-del-2004-form-2.pdf

63-del-2004-form-3.pdf

63-del-2004-GPA-(07-05-2013).pdf