Title of Invention	A METHOD OF GENERATING ANALOGUES OF FKBP-LIGANDS WHICH INCORPORATE A NON-NATURAL STARTER UNIT
Abstract	The present invention relates to production of polyketides and other natural products and to libraries of compounds and individual novel compounds. One important area is the isolation and potential use of novel FKBP-ligand analogues and host cells that produce these compounds. The invention is particularly concerned with methods for the efficient transformation of strains that produce FKBP analogues and recombinant cells in which cloned genes or gene cassettes are expressed to generate novel compounds such as polyketide (especially rapamycin) FKBP-ligand analogues, and to processes foT their preparation, and to means employed therein (e.g. nucleic acids, vectors, gene cassettes and genetically modified strains).

Title of Invention

A METHOD OF GENERATING ANALOGUES OF FKBP-LIGANDS WHICH INCORPORATE A NON-NATURAL STARTER UNIT

Abstract

The present invention relates to production of polyketides and other natural products and to libraries of compounds and individual novel compounds. One important area is the isolation and potential use of novel FKBP-ligand analogues and host cells that produce these compounds. The invention is particularly concerned with methods for the efficient transformation of strains that produce FKBP analogues and recombinant cells in which cloned genes or gene cassettes are expressed to generate novel compounds such as polyketide (especially rapamycin) FKBP-ligand analogues, and to processes foT their preparation, and to means employed therein (e.g. nucleic acids, vectors, gene cassettes and genetically modified strains).

Full Text	The instant application is divided out of Indian Patent Application No. 1971/KOLNP/2004. Field of the Invention The present invention relates to novel polyketide (rapamycin) fkbp-ligand analogues and method for production thereof. One important area is the isolation and potential use of novel FKBP-ligand analogues and host cells that produce these compounds. The invention is particularly concerned with methods for the efficient transformation of strains that produce FKBP analogues and recombinant cells in which cloned genes or gene cassettes are expressed to generate novel compounds such as polyketide (especially rapamycin) FKBP-ligand analogues, and to processes for their preparation, and to means employed therein (e.g. nucleic acids, vectors, gene cassettes and genetically modified strains). Background of the invention Rapamycin (sirolimus) (Figure 1) is a lipophilic macrolide produced by Streptomyces hygroscopicus NRRL 5491 (Sehgal et al., 1975; Vezina et al., 1975; U.S. Patent No. 3,929,992; U.S. Patent No. 3,993,749) with a 1,2,3-tricarbonyl moiety linked to a pipecolic acid lactone (Paiva et al., 1991). Other related macrolides (Figure 2) include FK506 (tacrolimus) (Schreiber and Crabtree, 1992), FK520 (ascomycin or immunomycin) (Wu et al., 2000), FK525 (Hatanaka H, et al., 1989, FK523 (Hatanaka, H., et al, 1988), antascomicins (Fehr, T., et al., 1996) and meridamycin (Salituro et al., 1995). For the purpose of this invention rapamycin is described by the numbering convention of McAlpine et al. (1991) in preference to the numbering conventions of Findlay et al. (1980) or Chemical Abstracts (11th- Cumulative Index, 1982-1986 p60719CS). The versatile mode of action of rapamycin demonstrates the pharmacological value ofthe compound and emphasizes the necessity to isolate novel derivatives of the drug. Rapamycin shows moderate antifungal activity, mainly against Candida species but also against filamentous fungi (Baker ef al., 1978; Sehgal et al., 1975; Vezina et a!., 1975; U.S. Patent No. 3,929,992; U.S. Patent No. 3,993,749). Rapamycin inhibits cell proliferation by targeting signal transduction pathways in a variety of cell types, e.g. by inhibiting signalling pathways that allow progression from the G1 to the S-phase of the cell cycle (Kuo ef al., 1992). In T cells rapamycin inhibits signalling from the IL-2 receptor and subsequent autoproliferation of the T cells resulting in immunosuppression. The inhibitory effects of rapamycin are not limited to T cells, since rapamycin inhibits the proliferation of many mammalian cell types (Brunn ef al, 1996). Rapamycin is, therefore, a potent immunosuppressant with established or predicted therapeutic applications in the prevention of organ allograft rejection and in the treatment of autoimmune diseases (Kahan et al., 1991). It appears to cause fewer side effects than the standard anti-rejection treatments (Navia, 1996). 40-O-(2-hydroxy)ethyl-rapamycin (SDZ RAD, Certican, Everolimus) is a semi-synthetic analogue of rapamycin that shows immunosuppressive pharmacological effects (Sedrani, R. et al., 1996; U.S. 5,655,772).The clinical efficacy of the drug is presently under investigation in Phase III clinical trials (Kirchner et aL, 2000). The rapamycin ester CCI-779 (Wyeth-Ayerst) inhibits cell growth in vitro and inhibits tumour growth in vivo (Yu et al., 2001). The drug is currently in Phase 111 clinical trials. The value of rapamycin in the treatment of chronic plaque psoriasis (Kirby and Griffiths, 2001), the potential use of effects such as the stimulation of neurite outgrowth in PC12 cells (Lyons et al., 1994), the block of the proliferative responses to cytokines by vascular and smooth muscle cells after mechanical injury (Gregory et a/., 1993) and its role in prevention of allograft fibrosis (Waller and Nicholson, 2001) are areas of intense research (Kahan and Camardo, 2001). Recent reports reveal that rapamycin is associated with lower incidence of cancer in organ allograft patients on long-term immunosuppressive therapy than those on other immunosuppressive regimes, and that this redueed cancer incidence is due to inhibition of angiogenesis (Guba et al., 2002). It has been reported that the neurotrophic activities of immunophifin ligands are independent of their immunosuppressive activity (Steiner et al., 1997) and that nerve growth stimulation is promoted by disruption of the mature steroid receptor complex as outlined in the patent application WO01/03692. Side effects such as hyperiipidemia and thrombocytopenia as well as potential teratogenic effects have been reported (Hentges et a/., 2001; Kahan and Camardo, 2001). . The polyketide backbone of rapamycin is synthesised by head-to-tail condensation of a total of seven propionate and seven acetate units to a shikimate derived cyclohexane carboxylic acid starter unit (Paiva et al., 1991). The L-lysine derived imino acid, pipecolic acid, is condensed via an amide linkage onto the last acetate of the polyketide backbone (Paiva et el, 1993) and is followed by lactonisation to form the macrocycle. A107 kb genomic region containing the biosynthetic gene cluster has been sequenced (Schwecke ef at., 1995). Analysis of the open reading frames revealed three large genes encoding the modular polyketide synthase (PKS) (Aparicio et al., 1996; Schwecke et al., 1995). Embedded between the PKS genes lies the rapP gene encoding a protein with sequence similarity to activation domains of nonribosomal peptide synthetases and it is thought to act analogously (Konig et al., 1997). The region encoding the PKS genes is flanked on both sides by 24 additional open reading frames encoding enzymes believed to be required for the biosynthesis of rapamycin (Molnar et al., 1996). These include the following post-polyketide modification enzymes: two cytochrome P-450 monooxygenases, designated as RapJ and RapN, an associated ferredoxin RapO, and three potential SAM-dependent O-methyltransferases Rapl, RapM and RapQ. Other adjacent genes have putative roles in the regulation and the export of rapamycin (Molnar et al., 1996). The cluster also contains the gene rapL whose product RapL is proposed to catalyse the formation of the rapamycin precursor L- pipecolic acid through the cyclodeamination of L-lysine (Khaw et al., 1998; Paiva et al., 1993). The introduction of a frameshift mutation into rapL gave rise to a mutant unable to produce significant amounts of rapamycin and feeding of L-pipecolic acid to the growth medium restored wild-type levels of rapamycin production (Khaw et al., 1998). The biosynthetic precursors to the cyclohexane ring of rapamycin originate from the shikimic acid pathway (Lowden et al., 1996; Lowden et al., 2001). Other closely-related macrolides such as FK506 (tacrolimus) (Schreiber and Crabtree, 1992), FK520 (ascomycin or immunomycin) (Wu et al., 2000), antascomicin (Fehr, T., et al., 1996) and meridamycin (Salituro et al., 1995) share a common pharmacophore that interacts with FK506-binding proteins (FKBPs) (Figure 2). Thus rapamycin and related compounds for example, but without limitation, FK506, FK520, 'hyg', FK523, meridamycin, antascomicin, FK525 and tsukubamycin can be considered "FKBP-ligands". The partial sequence of the FK506 gene cluster (Motamedi et al., 1996; Motamedi et a/., 1997; Motamedi and Shafiee, 1998), the 'hyg' cluster (Ruan et al., 1997) and the complete sequence of the FK520 gene cluster have been published (Wu et al., 2000; U.S. Patent No. 6,150,513). There is significant homology between genes within these clusters and the rapamycin biosynthetic gene cluster and similarity in enzyme function (Motamedi et al., 1996). The pharmacologic actions of rapamycin characterised to date are believed to be mediated by the interaction with cytosolic receptors termed FKBPs or immunophilins. lmmunophilins (this term is used to denote immunosuppressant binding proteins) catalyse the isomerisation of cis and trans peptidyl-proline bonds and belong to a highly conserved family of enzymes found in a wide variety of organisms (Rosen and Schreiber, 1992). Two large groups of enzymes belonging to the family of immunophilins are represented by FKBPs and cyclophilins (Schreiber and Crabtree, 1992). The major intracellular rapamycin receptor in eukaryotic T-cells is FKBP12 (DiLella and Craig, 1991) and the resulting complex interacts specifically with target proteins to inhibit the signal transduction cascade of the cell. FK506, an immunosuppressive agent structurally related to rapamycin, also specifically binds to FKBP12 but it effects immunosuppression through a different mechanism (Chang et al., 1991; Sigal and Dumont, 1992). Rapamycin and FK506 compete for the same binding site, thus FK506 can have an antagonistic effect with rapamycin when the two drugs are used together (Cao et al., 1995). Analysis of the crystal structure of the FKBP12-rapamycin complex has identified a rapamycin-binding pharmacophore termed the 'binding domain' (Van Duyne et al., 1993) (see Figure 1). The 'binding domain' is required for the interaction with the immunophilin and consists, for both FK506 and rapamycin, of the C-1 to C-14 region including the ester linkage, the pipecolinyl ring, the dicarbonyl and the hemiketal ring (see Figure 2). The interaction is characterised by many hydrophobic contacts and some hydrogen bonds including one to the hydroxyl group on the cyclohexane ring. The pipecolinyl ring (C2 to N7) makes the deepest penetration into the protein where it is surrounded by highly conserved aromatic amino acid, residues lining the hydrophobic binding cavity. Both the C1 and the CB carbonyl groups are involved in hydrogen bonding and the C9 carbonyl group protrudes into a pocket formed by three completely conserved aromatic amino acid residues (one tyrosine and two phenylalanine acid residues) in FKBP12. The domain of the immunophilin-ligand complex interacting with the target protein projects away from FKBP. The target of the rapamycin-FKBP12 complex has been identified in yeast as TOR (target of rapamycin) (Alarcon et a/., 1999) and the mammalian protein is known as FRAP (FKBP-rapamycin associated protein) or mTOR (mammalian target of rapamycin) (Brown et a/., 1994). These proteins show significant similarity to the phosphotransferase domains of phosphatidylinositol 3- kinases and the observation that a point mutation in the FKBP12-rapamycin binding domain (FRB) of mTOR abolishes mTOR kinase activity provides evidence for the involvement of FRB in the function of the kinase domain (Vilella-Bach et al., 1999). The crystal structure of FKBP12-rapamycin with a truncated form of mTOR containing the FRB domain (Chen ef at., 1995) has been obtained thus defining the 'effector' domain of rapamycin (Choi et al., 1996; Liang et al., 1999). The analysis of the crystal structure revealed that protein-protein contacts are relatively limited compared to the interaction between rapamycin and each protein. No hydrogen bonds between rapamycin and FRB were identified. Interaction is concentrated in a series of hydrophobic contacts between the triene region of rapamycin and mainly aromatic residues of FRB (Liang et al., 1999). The most deeply buried atom of rapamycin is the methyl attached to C23 (see Figure 2). The C23 to C34 region and the cyclohexyl ring of rapamycin make superficial hydrophobic contacts with FRB. A small conformational change in rapamycin was evident between the binary and the ternary complexes (Liang et al., 1999). Divergences between the biological effects of C16 methcxy group rapamycin analogues and their ability to bind FKBP12 were detected and the location of the C16 subsfrtuents at the interfacial space between FKBP12 and mTOR was postulated (Luengo et al., 1995). The analysis of the crystal structure of FKBP12 with the non- immunosuppressive 28-Omethyl rapamycin revealed a significant difference in the orientation of the cyclohexyl ring which may result in disruption of mTOR binding (Kallen et al., 1996). Rapamycin impacts signalling cascades within the cell through the inhibition of the p70S6k kinase, a serine/threonine kinase in higher eukaryotes which phosphorylates the ribosomal protein S6 (Ferrari et al., 1993; Kuo et al., 1992). The S6 protein is located in the ribosomal 40S subunit and it is believed to be an important functional site involved in tRNA and mRNA binding. A regulatory function for mRNA translation through S6 phosphorylation by p70S6k has been postulated (Kawasome et al., 1998). Rapamycin inhibits protein synthesis through its effect on other growth related events, including the activity of cyclin-dependent kinases, phosphorylation of cAMP-responsive element modulator (CREM) and phosphorylation of the elongation factor binding protein 4E-BB1 (PHAS1) (Hung et al., 1996). The drug induces the accumulation of the dephosphorylated species of 4E-BP1 that binds to the translation initiation factor elF-4E, thus, suppressing translation initiation of cap-dependent mRNAs (Hara et al., 1997; Raught et al., 2001). A link between mTOR signalling and localized protein synthesis in neurons; the effect on the phosphorylation state of proteins involved in translational control; the abundance of components of the translation machinery at the transcriptional and translational levels; control of amino acid permease activity and the coordination of the transcription of many enzymes involved in metabolic pathways have been described (Raught et al., 2001). Rapamycin sensitive signalling pathways also appear to play an important role in embryonic brain development, learning and memory formation (Tang et al., 2002). Research on TOR proteins in yeast also revealed their roles in modulating nutrient-sensitive signalling pathways (Hardwick et al., 1999). Similarly, mTOR has been identified as a direct target for the action of protein kinase B and of having a key role in insulin signalling (Shepherd et al., 1998; Nave et al., 1999). Mammalian TOR has also been implicated in the polarization of the actin cytoskeleton and the regulation of translational initiation (Alarcon et al., 1999). Phophatidylinositol 3-kinases, such as mTOR, are functional in several aspects of the pathogenesis of tumours such as cell-cycle progression, adhesion, cell survival and angiogenesis (Roymans and Siegers, 2001). Most immunophilins do not appear to be directly involved in immunosuppressive activities and relatively little is known concerning their natural ligands although candidates for natural ligands of the FKBPs termed FKBP- associated proteins (FAP) such as FAP48 and FAP1 have been reported. The specific interaction of FAPs with FKBPs during the formation of complexes was prevented by rapamycin in a dose-dependent manner (Chambraud et al., 1996; Kunz et al., 2000). Immunophilins appear to function in a wide range of cellular activities such as protein folding; assembly and trafficking of proteins; co- regulation of molecular complexes including heat shock proteins; steroid receptors; ion channels; cell-to-cell interactions and transcription and translation of genes (Galat 2000; Hamilton and Steiner 1998). All immunophilins possess the protein folding property of peptidyl-prolyl cis-trans isomerisation and several immunophilins are found located in the endoplasmic reticulum, a principal site of protein synthesis in the cell. In addition to FKBP12 (U.S. 5,109,112) other immunophilins include FKBP12.6 (U.S. 5,457,182), FKBP13 (Hendrickson et al., 1993; U.S. 5,498,597), FKBP25 (Hung and Schreiber, 1992; Jin et al., 1992), FKBP14.6 (U.S. 5,354,845), FKBP52 (U.S. 5,763,590), FKBP60 (Yem et al., 1992) and FKBP65 (Patterson et al., 2000). The multitude of the FKBP's which are present in different cell types also underline the utility of isolating novel FKBP-ligand analogues with potentially changed binding and/or effector domains. Pharmacokinetic studies of rapamycin and rapamycin analogues have demonstrated the need for the development of novel rapamycin compounds that may be more stable in solution, more resistant to metabolic attack and have improved bio- availability. Modification using chemically available positions on the molecule has been addressed, however, this approach has limited utility as the sites available for chemical modification are limited and there is less ability to selectively modify a particular position. Biological approaches to producing novel rapamycin analogues have been less successful due to the difficulties encountered in working with the organism (Lomovskaya et al., 1997; Kieser et al., 2000) despite the availability of the sequence of the biosynthetic gene cluster of rapamycin from S. hygroscopicus (Schwecke et al., 1995). A range of synthesised rapamycin analogues using the chemically available sites of the molecule has been reported. The description of the following compounds Was adapted to the numbering system of the rapamycin molecule described in Figure 1. Chemically available sites on the molecule for derivatisation or replacement include C40 and C28 hydroxyl groups (e.g. U.S. 5,665,772; U.S. 5,362,718), C39 and C16 methoxy groups (e.g. WO96/41807; U.S. 5,728,710), C32, C26 and C9 keto groups (e.g. U.S. 5,378,836; U.S. 5,138,051; U.S. 5,665,772). Hydrogenation at C17, C19 and/or C21, targeting the triene, resulted in retention of antifungal activity but loss of immunosuppression (e.g. U.S. 5,391,730; U.S. 5,023,262). Significant improvements in the stability of the molecule (e.g. formation of oximes at C32, C40 and/or C28, U.S. 5,563,145, U.S. 5,446,048), resistance to metabolic attack (e.g. U.S. 5,912,253), bioavailability (e.g. U.S. 5,221,670; U.S. 5,955,457; WO98/04279) and the production of prodrugs (e.g. U.S. 6,015,815; U.S. 5,432,183) have been achieved through derivatisation. However, chemical modification requires significant quantities of rapamycin template and, as a base and acid labile compound, it is difficult to work with. Where chemical derivatisation can be group selective, it is often difficult to be site selective. Consequently, chemical modification invariably requires multiple protective and deprotecive steps and produces mixed products in variable yields. The isolation of rapamycin analogues using biological methods such as biotransformation and phage-based genetic modification has also been described, isolation of minor metabolites from both mutant strains and rapamycin producing strains has provided small quantities of a number of rapamycin analogues. These strains are often low yielding and produce mixtures of rapamycin analogues. The isolation of 27-O-desmethylrapamycin and 27-desmethoxyrapamycin was reported from the culture supernatant of S. hygroscopicus NCIMB 40319 (Box et al., 1995). The antifungal activity of 27-O-desmethylrapamycin was lower than that of rapamycin but the inhibition of FKBP12 PPIase activity seemed to be increased. The inhibition of ConA-stimuiated proliferation of murine splenic T cells and the inhibition of UPS- stimulated proliferation of murine splenic B cells was decreased when compared to rapamycin (Box et al, 1995). Similarly, antifungal activities of the rapamycin derivatives prolylrapamycin, 27-O-desmethylrapamycin and 27- desmethoxyrapamycin were lower than that of rapamycin (Wong et al., 1998). Rapamycin analogues (16-O-desmethylrapamycin, 27-O-desmethylrapamycin, 39-O- desmethylrapamycin, 16,27-O-bisdesmethylrapamycin, prolylrapamycin, 26-O- desmethylprolylrapamycin, 9-deoxorapamycin, 27-desmethoxyrapamycin, 27- desmethoxy-39-O-desmethylrapamycin, 9-deoxo-27-desmethoxyrapamycin, 28- dehydrorapamycin, 9-deoxo-27-desmethoxy-39-O-desmethylrapamycin) were also isolated from Actinoplanes sp N902-109 after the addition of cytochrome P450 inhibitors and/or precursor feeding to the culture or after biotransformation of isolated rapamycin (Nishida et al., 1995). The use of such inhibitors, however, only allows the targeting of a particular enzyme function and is not site selective. Rational production of a single selected analogue is not possible via this method. The resulting production of mixtures of rapamycin analogues rather than a single desired product also impacts yield. The mixed lymphocyte reaction (MLR) inhibitory activity of the compounds was assessed and little effect on the activity was detected after the loss of the methyl group at C27 or/and C16. In addition, 9-deoxorapamycin showed a more significant decrease in activity and the loss of the methoxy group at C27, the hydroxy group at C28 and the substitution of a pipecolinyl group for a prolyl group resulted in a reduction in potency (Nishida et al., 1995). Similarly, biotransformation of rapamycin and the isolation of 16,39-O-bisdesmethylrapamycin have been reported (WO 94/09010). The retention of inhibitory activity in cell proliferation assays with compounds modified in the cyclohexyl ring, e.g. 39-O- desmethylrapamycin and C40 modifications such as SDZ RAD, identify this region of the molecule as a target for the generation of novel rapamycin analogues. Novel rapamycin analogues were reported after feeding cyclohexanecarboxylic acid, cycloheptanecarboxylic acid, cyclohex-1-enecarboxylic acid, 3- methylcyclohexanecarboxylic acid, cyclohex-3-enecarboxylic acid, 3- hydroxycyclohex-4-enecarboxylic acid and cyclohept-1-enecarboxylic acid to cultures of S. hygmscopicus thus demonstrating the flexibility in the loading module of the rapamycin polyketide synthase (PAS. Lowden, PhD dissertation, University of Cambridge, 1997). These novel rapamycin analogues were produced in competition with the natural starter, 4, 5-dihydroxycyclohex-1-enecarboxylic acid, resulting in reduced yields and mixed products. The isolation of recombinant S. hygroscopicus strains producing various rapamycin analogues, using biological methods mediated by phage technology (Lomovskaya et al., 1997), has been reported. In the presence of added proline derivatives, a S. hygroscopicus rapL deletion mutant synthesized the novel rapamycin analogues prolylrapamycin, 4-hydroxyprolylrapamycin and 4- hydroxyprolyl-26-desmethoxy-rapamycin (Khaw et al., 1998). Similarly, the novel rapamycins 3-hydroxy-prolyl-rapamycin, 3-hydroxy-pro!yl-26-desmethoxy-rapamycin, and trans-3-aza-bicyclof3,1,0]hexane-2-carboxylic acid rapamycin have been identified as described in WO98/54308. The activity of prolylrapamycin and 4- hydroxyprolyl-26-desmethoxy-rapamycin was assessed in proliferation assays and the inhibitory activity of the latter compound was significantly less than that of rapamycin (Khaw et al., 1998). The deletion of five contiguous genes, rapQONML (responsible for post-polyketide modifications at C16, C27 and production of L- pipecolic acid) and their replacement with a neomycin resistance marker in S. hygroscopicus ATCC29253 using phage-based methology resulted in the production of 16-O-desmethyl-27-desmethoxyrapamycin when fed with pipecolic acid (Chung et al., 2001). No complementation of this deletion mutant has been demonstrated using this technology. Furthermore, the site-specific functionality of rapM and rapQ remains unclear, therefore, rational design of rapamycin analogues requiring methylation at C16-OH or C27-OH has not been enabled. The phage-based methodology suffers from a number of drawbacks as described in more det all below. It offers a difficult and protracted process of obtaining engineered strains and has a reduced versatility in comparison to the methodology disclosed within this current patent. Conventional approaches to manipulate rapamycin modifying genes using biological methods comprise the mutation or deletion of individual genes in the chromosome of a host strain or/and the insertion of individual genes as extra copies of homologous or heterologous genes either individually or as gene cassettes (WO01/79520, WO 03/048375). However, the isolation of novel rapamycin analogues using such biological methods has been limited due to the difficulties in transforming the rapamycin-producing organism S. hygroscopicus. It has been reported that the commonly used methods of transformation with plasmid DNA or conjugal transfer were Unsuccessful with the rapamycin producing strain (Lomovskya et al., 1997, Schweke et al., 1995, Kieser et al., 2000). The current state of the art uses the methodology of Lomovskya et al. (1997), a work intensive phage based method that is severely limited by the size of the cloned DNA fragments transferred into S. hygroscopicus (Kieser et al., 2000). This technology is limited to the transfer of a maximum of 6.4 kb of cloned DNA. Thus, when complementing a deletion mutant using this technology the artisan is limited to the inclusion of -2 functional genes in addition to desired promoter, regions of homology and resistance marker. The genetic information for the rapamycin biosynthetic gene cluster has been available since 1995 (Schwecke et al., 1995), however, limited progress in this area has been made (Khaw et al., 1998; Chung et al., 2001; WO01/34816). Summary of the Invention The present invention provides recombinant methods for the efficient transformation of strains that contain a biosynthetic cluster encoding an FKBP tigand, for example but without limitation Streptomyces hygroscopicus subsp. hygroscopicus NRRL 5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC14891, Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces tsukubaensis No.9993 FERM BP-927, Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429, Steptomyces sp. MA 685B ATCC 55098, Steptomyces sp. MA 6848, said methods comprising: (a) constructing a conjugative deletion plasmid in an £ coli strain that is dam , dcm or dam and dcm . - (b) generation of spores from said strain suitable for conjugation wherein said strain is grown at a humidity of between 10% and 40% and the spores are harvested at between 5 and 30 days; (c) . conjugating the E. co// strain of step (a) with the spores from step (b) on a medium that comprises per litre: i) 0.5g to 5g corn steep powder, ii) 0.1 g to 5g Yeast extract, iii) 0.1 g to 10g calcium carbonate; and iv) 0.01 g to 0.5 g iron sulphate; said media additionally containing BACTO-agar and starch and having been dried to result in 1-20% weight loss; and (d) optionally culturing the strain under conditions suitable for polyketide production. In a preferred embodiment the methods are used for the transformation of Streptomyces hygroscopicus subsp. hygroscopicus (e.g. NRRL 5491), Actinoplanes sp. N9Q2-109 (e.g. FERM BP-3832), Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus {e.g. MA 6475 ATCC 14891), Streptomyces hygroscopicus var. ascomyceticus {e.g. MA 6678 ATCC 55087), Streptomyces hygroscopicus var. ascomyceticus (e.g.MA 6674), Streptomyces hygroscopicus var. ascomyceticus {e.g. ATCC 55276), Streptomyces tsukubaensis No.9993 (e.g. FERM BP-927), Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. {e.g. DSM 4137), Streptomyces sp. (e.g. DSM 7348), Micromonospora n.sp. A92- 306401 (e.g. DSM 8429) or Streptomyces sp. (e.g. MA 6858 ATCC 55098). In a more preferred embodiment the methods are used for the transformation of: S. hygroscopicus subsp. hygroscopicus (e.g. NRRL 5491) or S. hygroscopicus var. ascomyceticus (e.g. ATCC 14891). In a still more highly preferred embodiment the methods are used for the transformation of the rapamycin producer S hygroscopicus subsp. hygroscopicus (e.g. NRRL 5491). Therefore the present invention also provides a recombinant strain that contains biosynthetic clusters that encode FKBP-ligands where one or more auxiliary genes have been deleted or inactivated using the methods as described herein. In a further aspect, the present invention provides recombinant methods and materials for expressing combinations of polyketide modification enzymes so as to produce novel polyketide analogues. In a specific embodiment, the present invention provides recombinant methods and materials for expressing the combinations of enzymes responsible for post-PKS modification and/or precursor supply from biosynthetic clusters that encode FKBP-ligands for example but without limitation rapamycin, FK506, FK520, FK523, FK525, antascomicin, meridamycin, tsukubamycin and analogues therof and methods for the production of analogues in recombinant host cells. In a preferred embodiment the recombinant methods and materials are used for expressing the combinations of enzymes responsible for post- PKS modification and/or precursor supply in the biosynthesis of rapamycin, FK520, FK506 and 'hyg' and methods for the production of rapamycin, FK520, FK506 and 'hyg' analogues in recombinant host cells. In a more highly preferred embodiment the recombinant methods and materials are used for expressing the combinations of enzymes responsible for post-PKS modification and/or precursor supply in the biosynthesis of rapamycin and methods for the production of rapamycin analogues in recombinant host cells. Broadly, the present invention is concerned with the alteration of a gene system which has a core portion responsible for the production of a basic product, and a multiplicity of modifying genes responsible for effecting relatively small modifications to the basic product- e.g. effecting glycosylation, oxidation, reduction, alkylation, dealkylation, acylation or cyclisation of the basic product, and a multiplicity of precursor supply genes which are involved in the production of particular precursor compounds (e.g. pipecolate; 4,5 dihydroxycyclohex-1-ene carboxyiic acid). Thus the basic product may be a modular polyketide and the modifying genes may be concerned with glycosylation and/or other modifications of a polyketide chain, and the precursor supply genes may be involved in the production and/or incorporation of natural or non-natural precursors (e.g. pipecolate and/or 4,5 dihydroxycyclohex-1- ene carboxyiic acid in the rapamycin system). The core portion may not function properly or even at all in the absence of a precursor supply gene (unless a natural or unnatural precursor compound is supplied or is otherwise available). In one aspect the invention provides methods for the alteration of a gene system with a core portion that cannot function due to a deletion or inactivation of a precursor supply gene. Suitable gene systems include, but are not limited to, the rapamycin, antascomicin, FK520, FK506, 'hyg', FK523, meridamycin, FK525 and tsukubamycin biosynthetic clusters. In this aspect of the invention, the precursor supply gene lacking is preferably rapK or a homologue of rapK (e.g. fkbO in the FK506 or FK520 gene clusters). The gene system is preferably the rapamycin cluster. The precursor supply gene lacking is more preferably rapK. This aspect of the invention provides methods for the efficient production of a multiplicity of basic products through the incorporation of natural or non-natural precursors (e.g. 4,5- dihydroxycyclohex-1-ene carboxyiic acid). Methods may also embody further aspects as set out below. Another type of system is a non-ribosomal peptide ("NRP") system where the basic product is a peptide and the modifying genes are genes responsible for modifications to a peptide (glycosylation, reduction etc), and the precursor supply genes are genes involved in the production of unusual amino acid residues to be incorporated in the peptide. Systems can also be of mixed type, e.g. having a polyketide part and a part with a different biosynthetic origin, e.g. NRP. Indeed, rapamycin can be regarded as an example of this since the pipecolate residue is an amino acid residue added by an enzyme similar to ones found in NRP systems. These modifying genes and precursor supply genes may be regarded as "auxiliary genes" for polyketide synthesis and the term "auxiliary genes" as used herein may refer to modifying genes, precursor supply genes or both. The alteration of the gene system involves the creation of a functioning altered system in which the set of auxiliary genes has been altered. Thus one or more auxiliary genes (and preferably two or more, three or more, four or more, five or more, six or more or seven or more) may have been deleted (or rendered non- functional) and/or replaced by different genes. This may involve a "deletion system" comprising nucleic acid encoding a gene system lacking a multiplicity of functional auxiliary genes. This deletion system can then be complemented with one or more functional auxiliary genes (which may be the same as or different from the genes they replace). This can be carried out combinatorially, a deletion system being complemented by a multiplicity of different genes and sets of genes. An altered system which differs from the natural system in lacking one or more modifying functions could be produced (a) by producing a deletion system and restoring by complementation less than all of the deleted genes; or (b) by selectively deleting or inactivating genes of an existing system. In an altered system produced according to (b) genes may be inactivated by site-directed mutagenesis of an active site important in the protein function (active site point mutation), by truncation of the gene through a frameshift mutation, by an in-frame deletion of a section of the gene important to its function, such as an active site; partial deletion or inactivation by point mutation. These could all be carried out by double recombination and selecting for the mutant genotype, or by single recombination. In a preferred embodiment the altered system is produced by method (a). Such methods could also be used in producing a deletion system. The "complementation" approach (a) is preferably homologous, in that the "restored" genes are from the same gene cluster, however, heterologous complementation, wherein the "restored" genes are sslected from a different biosynthetic cluster that encodes FKBP-ligands, is also contemplated by the present invention. In a preferred embodiment the "restored" genes are essentially the same as the deleted genes, or are variants thereof, which perform similar functions. In a further aspect of the invention, an altered system with a deleted (or non- functional) precursor supply gene can be fed with alternative precursors so that it produces variant products. As applied to a polyketide synthase ("PKS") system, one preferred type of embodiment is a method for producing polyketides comprising: (a) providing a strain of an organism which contains one or more PKS genes expressible to produce a functioning PKS which can generate a polyketide in the organism, for example PKS genes that encode a FKBP-ligand, the organism lacking one or more (and preferably a plurality) of functional auxiliary genes naturally associated with said PKS genes which encode gene products capable of effecting respective modifications of the polyketide; and (b) effecting complementation by causing said organism to express one or more auxiliary genes, the expressed modifying genes constituting an incomplete set of auxiliary genes naturally associated with said PKS genes and/or comprising one or more variant auxiliary genes; and (c) culturing said strain and optionally isolating the polyketide analogues produced. The step of providing a strain of an organism containing one or more PKS genes may include a step of providing nucleic acid encoding a gene cluster comprising said one or more PKS genes and lacking said one or more auxiliary genes; and introducing said nucleic acid into the organism. The PKS genes are preferably rapamycin genes. The auxiliary genes which are lacking are preferably one or more of rapK, rap], rapQ, rapM, the contiguous genes rapN and O (herein designated as rapN/O), rapL and rapJ. In specific embodiments contemplated by the present invention: i) one auxiliary gene is lacking, for example rapK; rapl; rapQ; rapM; rapL, rapN/O or rapJ is lacking; preferably where one auxiliary gene is lacking it is selected from the group consisting of rapK; rapl; fapQ; rapM; rapN/O and rapJ; ii) two auxiliary genes are lacking for example: rapKrapl; rapKrapQ; rapKrapM; rapKrapN/O; rapKrapL; rapKrapJ; rapklrapQ; raplrapM; rapIrapNAD; raplrapL; raplrapJ; rapQrapM; rapQrapN/O; rapQrapL; rapQrapJ; rapMrapN/O; rapMrapL; rapMrapJ; rapN/OrapL; rapN/OrapJ or rapLrapJ are lacking; iii) three auxiliary genes are lacking for example: rapKraplrapQ; rapKraplrapM; rapKrapl rapN/O; rapKraplrapl; rapKraplrapJ; rapKrapQrapM; rapKrapQRapN/O; rapKrapQrapL; rapKrapQrapJ; rapKrapMrapN/O; rapKrapMrapL; rapKrapMrapJ; rapKrapN/OrapL; rapKrapN/OrapJ; rapKrapLrapJ; rap'mpQrapM; raplrspQrepN/O; raplrapQrapL; raplrapQrapJ; rapIrapMrapN/O; raplrapMrapL; rapl rapMrapJ; raplrapN/OrapL; raplrapN/OrapJ; raplrapLrapJ; rapQrapMrapN/O; rapQrapMrapL; rapQrapMrapJ; rapQrapN/OrapL; rapQrapN/OrapJ; rapQrapLrapJ; rapMrapN/OrapL; rapMrapN/OrapJ; rapMrapLrap or rapN/OrapLrapJ are lacking iv) four auxiliary genes are lacking, for example: rapKraplrapQrapM; rapKraplrapQrapN/O; rapKraplrapQrapL; rapKraplrapQrapJ; rapKrapIrapMmpN/O; rapKraplrapMrapL; rapKraplrapMrapJ; rapKraplrapN/OrapL; rapKraplrapN/OrapJ; rapKraplrapLrapJ; rapKrapQrapMrapN/O; rapKrapQrapMrapL; rapKrapQrapMrapJ; rapKrapQrapN/OrapL; rapK, rapQ, rapN/O, rapJ; rapKrapQrapLrapJ; rapKrapMrapN/OrapL; rapKrapMrapN/OrapJ; rapKrapMrapLrapJ; rapKrapN/OrapLrapJ; raplrapQrapMrapN/O; raplrapQrapMrapL; rapl rapQrapMrapJ; raplrapQrapN/OrapL; raplrapQrapN/OrapJ; raplrapQrapLrapJ; raplrapMrapN/OrapL; raplrapMrapN/OrapJ; raplrapMrapLrapJ; raplrapN/OrapLrapJ; rapQrapMrapN/OrapL; rapQrapMrapN/OrapJ; rapQrapMrapLrapJ; rapQrapN/OrapLrapJ or rapMrapN/OrapLrapJ are lacking; v) five auxiliary genes are lacking, for example: rapKraplrapQrapMrapN/O; rapKraptrapQrapMrapL; rapKraplrapQrapMrapJ; . rapKraplrapQrapN/OrapL; rapKraplrapQrap N/OrapJ; rapKraplrapQrapLrapJ;rapKraplrapMrapN/OrapL; rapKraplrapMrapN/OrapJ;rapKraplrapMrapLrapJ; rapKraplrapN/OrapLrapJ; rapKrapQrapMrapN/OrapL; - rapKrapQrapMrapN/OrapJ; rapKrapQrapMrapLrapJ; rapKrapQrapN/OrapLrapJ;rapKrapMrapN/OrapLrapJ; raplrapQrapMrapN/OrapL;raplrapQrapMrapN/OrapJ; raplrapQrapN/OrapLrapJ; raplrapMrapN/OrapLrapJ; rapQrapMrapN/OrapLrapJ or raplrapQrapMrapLrapJ are lacking; vi) six auxiliary genes are lacking for example: rapKraplrapQrapMrapN/OrapL; rapKraplrapQrapMrapN/OrapJ; rapKrapirapQrapMrapLrapJ; rapKraplrapQrapN/OrapLrapJ; rapKraplrapMrapN/OrapLrapJ; rapKrapQrapMrapN/OrapLrapJ or raplrapQrapMrapN/OrapLrapJ are lacking; or vii) seven auxiliary genes are lacking, e.g. rapKraplrapQrapMrapN/OrapLrapJ are lacking. The expression "lacking one or more functional auxiliary genes" covers both the lack of a gene and the presence of a gene but in a non-functioning state, e.g. because it has been specifically disabled. In one aspect, the invention provides a novel and expeditious route to the efficient incorporation of natural or non-natural precursors into FKBP-ligands. These include, but are not limited to, the rapamycin, antascomicin, FK520, FK506, hyg', FK523, meridamycin, FK525 and tsukubamycin polyketide synthase/non-ribosomal peptide synthase systems, the invention thus provides novel analogues of their respective natural products. In specific aspect, the invention provides a novel and expeditious route to the efficient incorporation of natural or non-natural precursors providing novel rapamycin analogues. Therefore in one-aspect the present invention provides a method of generating analogues of. FKBP-ligands which incorporate a non-natural starter unit, . said method comprising: (a) generating a recombinant strain in which at least the rapK homologue has been deleted or inactivated; and (b) feeding a non-natural starter unit to said strain In a preferred embodiment the recombinant strain is generated using the methods of the present invention. In further aspects the invention provides libraries of compounds and individual compounds available using such systems. Thus a typical compound is a variant of a compound naturally produced by a gene system which has a eore portion responsible for the production of a basic product, and a multiplicity of auxiliary genes responsible for effecting relatively small modifications to the basic product, the variant being producible by a system altered so that one or more of the auxiliary genes are absent, non-functional, or replaced by functional variants. A preferred class of compounds is rapamycin analogues corresponding to products of a rapamycin system wherein one or more of the genes selected from the group consisting of rapK, rapl, rapQ, rapM, rapN, rapO, rapL and rapJ genes are absent, non-functional or variant. In a further aspect, the present invention provides novel FKBP-analogues, in a preferred embodiment the present invention provides novel rapamycin analogues. Such compounds may have one or more useful properties, for example but without [imitation, utility as immunosuppressants, antifungal agents, anticancer agents, neuroregenerative agents, or agents for the treatment of psoriasis, rheumatoid arthritis, fibrosis and other hyperproliferative diseases. Definitions: As used herein the term "modifying gene(s)" includes the genes required for post-polyketide synthase modifications of the polyketide, for example but without limitation cytochrome P-450 monooxygenases, ferredoxins and SAM-dependent O- methyltransferases. In the rapamycin system these modifying genes include rapN/O, rapM, rapl, rapQ, and rapJ but a person of skill in the art will appreciate that PKS systems related to rapamycin (for example but without limitation: FK506, FK520, antascomicin, 'hyg', FK523, meridamycin, FK525 and tsukubamycin) will have homoiogues of at least a subset of these genes, some of which are discussed further below. As used herein the term "precursor supply gene(s)" includes the genes required for the supply of the natural or non-natural precursors, the genes required for the synthesis of any naturally or non-naturally incorporated precursors and the genes required for the incorporation of any naturally or non-naturally incorporated precursors. For example but without limitation in the rapamycin system these genes include rapL, rapK and rapP but a person of skill in the art will appreciate that PKS systems related to rapamycin (for example but without limitation: FK506, FK520, antascomicin, 'hyg', FK523, meridamycin, FK525 and tsukubamycin) will have homoiogues of these genes, some of which are discussed further below. As used herein, the term "auxiliary gene(s)" includes references to modifying genes, precursor supply genes or both modifying genes and precursor supply genes. As used herein, the term "precursor" includes the natural starter units (i.e. 4,5-dihydroxycyclohex-1-ene carboxylic acid), non-natural starter units, and naturally incorporated amino acids (i.e. pipecolic acid) and non-naturally incorporated amino acids As used herein the term "non-natural starter unif refers to any compounds which can be incorporated as a starter unit in polyketide synthesis that are not the starter unit usually chosen by that PKS. As used herein, the term "FKBP-ligands" refers to compounds that bind to the immunophilin FKBP, such compounds preferentially contains an a, B-diketo amide where the B-keto is masked as an hemi-acet al. Such compounds include, without limitation, rapamycin, FK520, FK506, antascomicin, hyg', FK523, meridamycin, FK525 and tsukubamycin, As used herein, the term "biosynthetic clusters that encode FKBP- ligands" includes but is not limited to the gene clusters which direct the synthesis of rapamycin, FK506, FK520, 'hyg', FK523, antascomicin, meridamycin, FK525 and tsukubamycin. As used herein the term "strains that contain biosynthetic clusters that encode FKBP-ligands" includes but is not limited to: Streptomyces hygrvscopicus subsp. hygrvscopicus (e.g. NRRL 5491), Actinoplanes sp. N902-109 (e.g. FERM BP- 3832), Streptomyces sp. AA6554, Streptomyces hygroscophus var. ascomyceticus MA 6475 (e.g. ATCC 14891), Streptomyces hygrvscopicus var. ascomyceticus MA 6678 (e.g. ATCC 55087), Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus (e.g. ATCC 55276), Streptomyces tsukubaensis No.9993 (e.g. FERM BP-927), Streptomyces hygrvscopicus subsp. yakushimaensis, Streptomyces sp. (e.g. DSM4137), Streptomyces sp. (e.g. DSM 7348), Micromonospora n.sp. A92-306401 (e.g. DSM 8429) or Streptomyces sp. MA 6858 (e.g. ATCC 55098). As used herein, the term urapK homologue" refers to homologues of the rapamycin gene rapKfrom other biosynthetic clusters that encode FKBP-ligands, for example but without limitation: the fkbO gene from the FK520 cluster, the fkbO gene from the FK506 cluster and the Orf5 in the 'hyg' cluster. Such rapK homologues perform the same function as rapK in the synthesis of these related FKBP-ligands, namely they are essential for the supply of the natural starter unit. Preferably, such rapK homologues have at least 40% sequence identity, preferably at least 60%, at least 70%, at least 80%, at least 90% or at least 95% sequence identity to the sequence of rapK as shown in Figure 27 (SEQ ID NO: 13). Det alled Description of the Invention In one aspect, the present invention provides a novel and expeditious method for the transformation of S. hygroscopicus. The use of phage technology for the isolation of genetically modified strains of S. hygroscopicus has previously been described (Khaw et al., 1998; Lomovskaya et al., 1997). However, no method other than transection has ever been reported for the introduction of DNA into the rapamycin producing strain S. hygroscopicus. Indeed, it has been stated previously that the commonly used methods of transformation with plasmid DNA or conjugal transfer were unsuccessful with the rapamycin-producing strain (Lomovskaya et al., 1997, Kieser et al., 2000; Schweke et al., 1995). In the present invention, surprisingly a conjugation protocol to successfully transform S. hygroscopicus was established as described in Example 1. The methodology was exemplified by the isolation of the deletion mutant in S. hygroscopicus MG2-10 (Example 2) and by the expression of genes and gene combinations as described in Examples 3, 5 and 15. Therefore, in one aspect the present invention provides a method for producing a recombinant strain that contains biosynthetic clusters that encode FKBP- ligands where one or more auxiliary genes have been deleted or inactivated said method comprising: (a) construction of a conjugative plasmid in an E coli strain that is dam dcm or dam and dcm ; (b) generation of spores from said strain suitable for conjugation wherein said strain is grown at a humidity of between 10% and 40% and the spores are harvested at between 5 and 30 days; (c) conjugating the E. coli strain of step (a) with the spores from step (b) in a medium that comprises per litre: i) 0.5g to 5g corn steep powder, ii) 0.1g to 5g Yeast extract, iii) 0.1g to 10g calcium carbonate; and iv) 0.01 g to 0.5 g iron sulphate; said media additionally containing BACTO-agar and starch and having been dried to result in 1-20% weight loss; and (d) optionally culturing the strain under conditions suitable for polyketide production. Preferably the E coli strain of step (a) is dam' and dcm". Preferably, in step (b) the spores are harvested at between 10 and 25 days or at between 14 and 21 days. In another embodiment, in step (b) the strain is grown at a humidity of between 10 and 20%. In a specific embodiment the starch in the media in step (c) used is wheat starch. In preferred embodiments the media used in step (c) comprises 1g to 4g corn steep powder, 1g to 4g Yeast extract, 1g to 5g calcium carbonate; and 0.2g to 0.4 g iron sulphate per litre. In a more preferred embodiment the media comprises per litre: 2.5g com steep powder, 3g Yeast extract, 3g calcium carbonate; and 0.3g iron sulphate; The complementation strategy disclosed in this invention provides an expeditious method to assess and identify the function of each auxiliary gene i.e. rapK, rapQ, rapN/O, rapM, rapL, rapJ and/or rapl in rapamycin biosynthesis. The gene product RapK has previously been identified as an interesting candidate for a pteridine-dependent dioxygenase that could also catalyse an oxidative step in the biosynthesis of rapamycin (Molnar et al., 1996). The homologous gene fkbO was identified in the biosynthetic gene cluster of FK506 and due to the structural similarity of rapamycin and FK506 a role for rapKin the oxidation of the C9 OH group was postulated (Motamedi et al., 1996). The findings in Examples 3,4 and 6, describing the rapK-dependent production of pre-rapamycin by S. hygroscopicus MG2- 10[pSGsetrapK] suggests that RapK has at least an additional function in rapamycin biosynthesis. In another aspect, therefore, the methods of the present invention led to the elucidation of the function of RapK, namely that the expression of the rapK gene is essential for the accumulation of any cyclised macrolide product. In a further aspect, the present invention describes the complementation of S. hygroscopicus MG2-10 with fkbO, the homologue of rapK from the FK520 cluster, with the surprising observation of fkbO dependent production of pre-rapamycin by S. hygroscopicus MG2-10[pMG169-1] (Example 11). It can be seen by one skilled in the art that fkbO fulfils a similar function in the production of FK520 as rapK and fkbO in the production of pre-rapamycin. Further, one skilled in the art will appreciate that other homologues of rapK, including but not limited to, fkbO in the FK506 cluster, fkbO in the FK520 cluster and Orf5 in the 'hyg' cluster also fulfil the same function. In a further aspect of the invention, homologues of rapK in biosynthetic clusters that encode FKBP-ligands, including, but not limited to, FK506, FK520, FK525, antascomicin, FK523, tsukubamycin, and 'hyg' can be deleted or inactivated, providing strains unable to make their respective known natural products. Similarly, the complementation strategy outlined above provides an expeditious method to investigate the function, specificity and order for the expressed products of auxiliary genes in the biosynthesis of other polyketides or non-ribosomal peptides. In a preferred class of embodiment, the present invention provides a method for the production of a recombinant host strain capable of producing rapamycin analogues, further involving the construction of genomic delations, including but not limited to rapQONMLKJl introduced into S. hygroscopicus and complementation or partial complementation by expressing single genes or combinations of genes, including but not limited to rapK, rap/, rapQ, rapM, the contiguous genes rapN and O (herein designated as rapN/O), rapL and rapJ, in gene cassettes. Further, the invention provides a method of producing said rapamycin analogues by culturing said recombinant host strain, and optionally isolating the rapamycin analogues produced. Thus, the recombinant strain MG2-10lpSGsetrapK], produced by complementation of the genomic deletion strain S. hygroscopicus MG2-10, with rapK, was cultured to produce 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre- rapamycin). In a further aspect of this class of the invention, the strategy involves the integration of a vector comprising a sub-set of genes including, but rot limited to, rapK, rapl, rapQ, rapM, rapN, rapO, rapL and rapJ into the S. hygroscopicus deletion mutant above. Such.integration may be performed using a variety of available integration functions including but not limited to: OC31 -based vectors, vectors based on pSAM2 integrase (e.g. in pPM927 (Smovkina et al., 1990)), R4 integrase (e.g. in pAT98 (Matsuura et al., 1996)), $VWB integrase (e.g. in pKT02 (Van Mellaert et al., 1998)), 4>BT1 integrase ((e.g. pRT801) Gregory et al., in press) and L5 integrase (e.g. Lee et at., 1991). In some cases this may need alteration of the host strain by addition of the specific attB site for the integrase to enable high efficiency integration. Replicating vectors could also be used, either as replacements to, or in addition to 0C31-based vectors. These include, but are not limited to, vectors based on plJ101 (e.g. plJ487, Kieser et al., 2000), pSG5 (e.g. pKC1139, Bierman et al., 1992) and SCP2te.g. plJ698, Kieser et al., 2000). This methodology has been exemplified herein by the use of the ΦBT1 and ΦC31 site-specific integration functions. Although the introduction of gene cassettes into S. hygroscopicus has been exemplified in the present invention using the ΦBT1 and the ΦC31 site-specific integration functions, those skilled in the art will appreciate that there are a number of different strategies described in the literature, including those mentioned above that could also be used to introduce such gene cassettes into prokaryotic, or more preferably actinomycete, host strains. These include the use of alternative site- specific integration vectors as described above and in the following articles (Kieser et al., 2000; Van Mellaert et al., 1998; Lee ef at., 1991; Smovkina et al., 1990; Matsuura et al., 1996). Alternatively, plasmids containing the gene cassettes may be integrated into a neutral site on the chromosome using homologous recombination sites. Further, for a number of actinomycete host strains, including S. hygroscopicus, the gene cassettes may be introduced on self-replicating plasmids (Kieser et al., 2000;WO98/01571). In a further aspect of this class, the invention provides gene cassettes for the complementation of the recombinant S. hygroscopicus deletion strains. Methods of constructing gene cassettes and their heterologous use to produce hybrid glycosylated macrolides have been previously described (Gaisser et al., 2002; WO01/79520, WO 03/048375). The cloning method used to isolate the gene cassettes of the present invention differs significantly from the approach previously described in that the gene cassette is assembled directly in an expression vector rather than pre-assembling the genes in pUC18/19- plasmids, thus providing a more rapid cloning procedure. The approach is exemplified as described in Example 3,4, 5, 9 and 15. As described herein, a suitable vector (for example but without limitation pSGLitl) can be constructed for use in the construction of said gene cassettes, where a suitable restriction site (for example but without limitation Xba\), sensitive to dam methylation is inserted 5' to the gene(s) of interest and a second restriction site (for example Xba\) can be inserted 3' to the genes of interest The skilled artisan will appreciate that other restriction sites may be used as an alternative to Xba\ and that the methylation sensitive site may be 5' or 3' of the gene(s) of interest. The use of gene cassettes enables the rapid and parallel generation of multiple recombinant strains deleted in any combination of modifying genes from a single S. hygroscopicus deletion strain. The cloning strategy facilitates the assembly of a library of gene cassettes in either a directed or random manner, and is therefore a powerful tool for the combinatorial production of novel rapamycin analogues including but not exclusively limited to 9-deoxo-16-O-desrnethyl-27-desrnethoxy-39- O-desmethyl-rapamycin (pre-rapamycin), 9-deoxo-16-O-desmethyl-27-O-desmethyl- 39-O-desmethyl-rapamycin, 16-O-desmethyl-27-desmethoxy-39-O-desmethyl- rapamycin, 9-deoxo-16-O-desmethyl-39-O-desmethyl-rapamycin, 9-deoxo-16-O- desmethyl-27-desmethoxy-rapamycin, 16-O-desmethyl-27-O-desmethyl-39-O- desmethyl-rapamycin , 9-deoxoi27-O-desmethyl-39-O-desmethyl-rapamycin , 9- deoxo-16-O-desmethyl-27-O-desmethyl-rapamycin , 27-O-desmethyl-39-O- desmethyl-rapamycin , 9-deoxo-16-O-desmethyl-rapamycin , 9-deoxo-39-O- desmethyl-rapamycin , 8-deoxo-15-O-desmethyl-26-desmethoxy-38-O-desmethyl- prolylrapamycin (pre-prolylrapamycin), 8-deoxo-1 &-O-desmethyl-26-O-desmethyl-38- O-desmethyl-prolylrapamycin, 15-O-desmethyl-26-desmethoxy-38-O-desmethyl- prolylrapamycin, 8-deoxo-26-desmethoxy-38-O-desmethyi-prolylrapamycin, 8- deoxo-15-O-desmethyl-38-O-desmethyl-prolylrapamycin , 8-deoxo-15-O-desmethyl- 26-desmethoxy-proIylrapamycin, 15-O-desmethyl-26-O-desmethyl-3B-O-desmethyi- prolylrapamycin , 8-deoxo-26-O-desmethyI-38-O-desmethyl-prolylrapamycin , 8- deoxo-15-O-desmethyl-26-O-desmethyl-prolylrapamycin , 15-O-desmethyl-38-O- desmethyl-prolylrapamycin , 15-O-desmethyl-26-O-desmethyl-prolylrapamycin , 15- O-desmethyi-26-desmethoxy-prolylrapamycir., 26-desmethoxy-38-O-desmethyl- prolylrapamycin , 26-O-desmethyl-38-O-desmethyl-prolylrapamycin , 8-deoxo-15-O- desmethyl-prolylrapamycin , 8-deoxo-26-O-desmethyl-prolylrapamycin , 8-deoxo-38- O-desmethyl-prolylrapamycin , 15-O-desmethyl-prolylrapamycin , 38-O-desmethyl- prolylrapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy- rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyI-39-desmethoxy-rapamycin, 16-O-desmethyl-27-desmethoxy-39-desmethoxy-rapamycin, 9-deoxo-27- desmethoxy-39-desmethoxy-rapamycin, 9-deoxo-16-O-desmethyl-39-desmethoxy- rapamycin , 16-O-desmethyl-27-O-desmethyl-39-desmethoxy-rapamycin , 9-deoxo- 27-O-desmethyl-39-desmethoxy-rapamycin, 16-O-desmethy!-39-desmethoxy- rapamycin , 27-desmethoxy-39-desmethoxy-rapamycin , 27-O-desmethyl-39- desmethoxy-rapamycin, 9-deoxo-39-desmethoxy-rapamycin , 8-deoxo-15-O- desmethyl-26-desmethoxy-38-desmethoxy-pro!ylrapamycin, 8-deoxo-15-O- desmethyi-26-O-desmethyl-38-desmethoxy-proIylrapamycin, 15-O-desmethyl-26- desmethoxy-38-desmethoxy-prolylrapamycin, 8-deoxo-26-desmethoxy-38- desmethoxy-prolylrapamycin, 8-deoxo-15-O-desmethyl-38-desmethoxy- prolylrapamycin, 15-O-desmethyl-26-O-desmethyl-38-desmeftioxy-prolylrapamycin , 8-deox6-26-O-desmethyl-38-desmethoxy-pro)ylrapamycin, 15-O-desmethyI-38- desmethoxy-prolylrapamycin , 26-desmethoxyr38-desmethoxy-prolylrapamycin , 26- O-desmethyl-38-desmethoxy-prolylrapamycin, 8-deoxo-38-desmethoxy- prolylrapamyctn, 38-desmethoxy-prolylrapamycin, 9-deoxo-16-O-desmethyl-27- desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36- (hydroxycyclohexenyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3- cis-methoxy-4-trans-hydroxycyclohexyl)-36-(dihydroxy cyciohexyl) rapamycin, 9- deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans- hydroxycyclohexyI)-36-(hydroxynorbomyl) rapamycin, 9-deoxo-16-O-desmethyl-27- desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-methyl-4- hydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3- cis-methoxy-4-trans-hydroxycyclohexyl)-36-(4-methylhydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans- hydroxycyclohexyl)-36-(3-fluoro-4-hydroxycyclohexyl) rapamycin, 9-deoxo-16-O- desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3- hydroxy-4-fluorocyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36- de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-chloro-4-hydroxycyciohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans- hydroxycyclohexyl)-36-(3-hydroxy-4-chlorocyclohexylJ rapamycin, 9-deoxc~16-O- desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3- cis-4-cis-dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy- 36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-trans-4-trans- dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-39-O- desmethyl rapamycin, 9-deoxo-16-O-desmethyl-270-desmethyl-36-de(3-cis- methoxy-4-trans-hydroxycyc]ohexyl)-36-(hydroxycyclohexenyl) rapamycin, 9-deoxo- 16-O-desmethyl-27-O-desmethyl-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)- 36-(hydroxynorbomyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-36- de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(4-methyl hydroxycyclohexyl) rapamycin. in a further aspect of this class, the present invention provides a system for the combinatorial production of recombinant host strains capable of producing rapamycin analogues, involving construction of a genomic deletion rapQONMLKJI introduced into S. hygroscopicus and its partial complementation by a combinatorial library of gene cassettes comprising one or a plurality of the deleted auxiliary genes rapQ, rapN/O, rapM, rapL, rapK, rapJ, and rap/. - The approach outlined comprises as a part the cloning strategy to combine genes including but not exclusively limited to rapK, rapl, rapQ, rapM, rapN/O, rapL and rapJ, and / or genes with similar gene functions, in any possible gene combination and gene order. Another aspect of the invention allows the enhancement of gene expression by changing the order of genes in a gene cassette. As applied to the preferred class, the genes may comprise one or more of rapK, rapl, rapQ, rapM, rapN/O, rapL and rapJ and / or genes with similar functions, allowing the arrangement of the genes in a multitude of permutations as outlined in Example 5. The cloning strategy outlined in this invention also allows the introduction of a histidine tag in combination with a terminator sequence 3' of the gene cassette to enhance gene expression. Those skilled in the art will appreciate other terminator sequences could be used. Another aspect of the invention describes the multiple uses of promotor sequences in the assembled gene cassette to optimise gene expression. It will now be obvious to one skilled in the art that S. hygroscopicus deletion strains, the deletion comprising, but not limited to, a gene or a sub-set of the genes rapQ, rapN/O, rapM, rapL, rapK, rapJ and rapl could be constructed. In this case, gene cassettes for complementation or partial complementation would generally comprise single genes or a plurality of genes selected from the sub-set of the genes deleted. It is well known to those skilled in the art that there are homologues to several of the rapamycin modifylng and precursor supply genes in the gene clusters of closely related systems including FK506 (Motamedi et al, 1996; Motamedi et al, 1997; Motamedi & Shafiee, 1998) and FK520 (Wu et al, 2000). These include the following as described in Table I below: Although the gene clusters of other closely related systems, including but not limited to those for the biosynthesis of FK523, meridamycin, FK525, antascomicin and tsukubamycin have not yet been sequenced, it can be anticipated that these will be shown to bear a close resemblance to those whose sequences have been determined, and, in particular, that these gene clusters will contain close homologues of several of the rapamycin modifylng and precursor supply genes. Therefore, in a further aspect of the invention, genes from heterologous gene clusters from such closely related systems, including but not limited to FK506, FK520, FK523, antascomicin, meridamycin, FK525, 'hyg' and tsukubamycin can be included in gene cassettes in place of or in addition to their rapamycin homologues for complementation and/or partial complementation of a rapamycin producer strain containing a gene deletion or deletions including but not limited to the genes rapK, rapl, rapQ, rapM, rapN/O, rapL and rapJ. It is well known to those skilled in the art that polyketide gene clusters may be expressed in heterologous hosts (Pfeifer and Khosla, 2001). Accordingly, the present invention includes the transfer of the rapamycin biosynthetic gene cluster with or without resistance and regulatory genes, either complete or containing deletions, for complementation in heterologous hosts. Methods and vectors for the transfer as defined above of such large pieces of DNA are well known in the art (Rawlings, 2001; Staunton and Weissman, 2001) or are provided herein in the methods disclosed. In this context a preferred host cell strain is a prokaryote, more preferably an actinomycete or Escherichia coli, still more preferably include, but are not limited to S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coeficolor, Streptomyces Jividans, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces rimosus, Streptomyces albus, Streptomyces griseofuscus,. Streptomyces longisporoflavus, Streptomyces venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei or Actinoplanes sp. N902-109. In another aspect, the rapamycin analogues of the invention may be obtained by a process comprising the steps of: a) constructing a deletion strain, by the methods of the invention; the deletion including, but not limited to, the genes rapK, rapQ, rapN/O, rapM, rapL, rapJ and rapl, or a sub-set thereof, b) culturing the strain under conditions suitable for polyketide production; c) optionally, isolating the rapamycin analogue intermediate produced; d) constructing a biotransformation strain containing a gene cassette comprising all or a sub-set of the genes deleted; e) feeding the rapamycin analogue intermediate in culture supernatant or isolated as in step c) to a culture of the biotransformation strain under suitable biotransformation conditions f) optionally isolating the rapamycin analogue produced. Suitable host strains for the construction of the biotransformation strain include the native host strain in which the rapamycin biosynthetic gene cluster has been deleted, or substantially deleted or inactivated, so as to abolish polyketide synthesis, or a heterologous host strain. Methods for the expressing of gene cassettes comprising one or a plurality of modifylng or precursor supply genes in heterologous hosts are described in WO 01/79520. In this context heterologous hosts suitable for biotransformation of the said FKBP-ligand analogue intermediates include, but are not limited to, S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus van ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces IMdans, Saccharopolyspora erythraea, Strsptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces rimosus, Streptomyces albus, Streptomyces griseofuscus, Streptomyces iortgisporoHavus, Streptomyces venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei, Escherichia coli and Actinoplanes sp. N902-109. The close structural relationship between rapamycin and FK506, FK520, FK523, 'hyg', meridamycin, antascomicin, FK525 and tsukubamycin, among others, and tine established homologies between genes involved in the biosynthesis of rapamycin and FK506 and FK520 (vide supra), renders obvious the application of the methods of the present invention to these closely related systems. In a further aspect, therefore, the invention includes the construction of deletion strains of the producer strains of closely related compounds, including but not limited to FK506, FK520, FK523, 'hyg', antascomicin, meridamycin, FK525 and tsukubamycin containing a gene deletion or deletions of modifylng and/or precursor supply genes, and more particularly including but not limited to genes with similar functions as rapK, rapl, rapQ, rapM, rapN/O, rapL and rapJ, and their complementation or partial complementation with a gene or gene cassettes comprising all or a sub-set of the deleted homologous genes, or their functional homologues from heterologous gene clusters, including but not limited to rapK, rapl, rapQ, rapM, rapN/O, rapL and rapJ to produce recombinant strains capable of producing polyketide analogues varylng from the parent polyketide in the incorporation of alternative precursors and/or the extent of post-PKS modification. Further, the invention provides a method of producing said polyketide analogues by culturing said recombinant host strains, and optionally isolating the polyketide analogues produced. In a further aspect, the invention provides a method for the production of recombinant host strains capable of producing polyketide FKBP-ligand analogues (other than rapamycin) varylng from the parent polyketide in the incorporation of alternative precursors and/or the extent of post-PKS modification, comprising the construction of a genomic deletion strain from which all or a portion of the auxiliary genes have been removed, and its partial complementation by a gene cassette comprising one or a plurality of the deleted genes and/or their homologues, and further a method of producing said polyketide analogues by culturing said recombinant host strain, and optionally isolating the polyketide analogues produced. It is well known in the art that in most cases that auxiliary genes are co-located with polyketide synthase genes in a gene cluster (Hopwood, 1997; Motamedi and Shafiee, 1998; Wu et al., 2000) thus facilitating creation of the deletion strain. The auxiliary genes to be deleted may or may not naturally form a contiguous sequence, however, once the deletion strain has been created the partial complementation by gene cassettes provides an expeditious approach to the production of recombinant strains in which one or a plurality of the said genes have been deleted. Therefore, in a further aspect, the invention provides a method for the combinatorial production of recombinant host strains capable of producing polyketide FKBP-ligand analogues (other than rapamycin) varylng from the parent polyketide in the incorporation of alternative precursors and/or the extent of post-PKS modification, comprising the partial complementation of the said genomic deletion strain by a combinatorial library of gene cassettes comprising one or a plurality of the deleted genes, and further a method of producing said polyketide analogues by culturing said recombinant host strains under conditions suitable for polyketide production, and optionally isolating the polyketide analogues produced. In this context a preferred recombinant host cell strain is a prokaryote, more preferably an actinomycete, still more preferably a strain selected from S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var. ascomyceticus, Stneptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces lividans, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Steptomyces rimosus, Streptomyces afbus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei or Actinoplanes sp. N902-109. Those skilled in the art will appreciate that the methods of the present invention could be applied to recombinant host strains in which the polyketide synthase (PKS) has been altered by genetic engineering to express a modified rapamycin or other polyketide analogue. The prior art describes several methods for the production of novel polyketides by the deletion or inactivation of individual domains (W093/13663, W097/92358), construction of hybrid polyketide synthases (WO98/01546, WO00/00618, WO00/01827) or alteration of domain specificity by site-directed mutagenesis (WO02/14482). It is well known in the art that non-ribosomal peptides are biosynthesised by Non-Ribosomal Peptide Synthases (NRPSs) via the stepwise condensation of successive amino acid building blocks, in a process analogous to that of polyketide biosynthesis (for review see Marahiel et al., 1997; Schwarzer and Marahiel, 2001). It is well known that several non-ribosomal peptides include unusual amino-acid residues (modified, proteinogenic amino acids and / or non-proteinogenic amino acids) and carboxy acids, the biosynthetic genes for which are co-located with the non-ribosomal peptide synthase genes in the non-ribosomal peptide gene cluster (Marahiel et al., 1997; Konz and Marahiel, 1999; Blanc et al., 1997). In several cases, the non-ribosomal peptide product initially released from the NRPS is further modified by a set of enzymes, including but not limited to glycosyl transferases, reductases, acylation or heterocyclic ring formation (Konz and Marahiel, 1999; Blanc et ah, 1995). These include the antibiotics chloroeremomycin, pristinamycin, vancomycin and bleomycin (Konz and Marahiel, 1999; Du et al., 2000). The genes for these post-NRPS enzymes are also typically co-located in the biosynthetic gene cluster (Marahiel et al., 1997; Schwarzer and Marahiel, 2001). Therefore, in a further aspect, the invention includes a method for the production of non-ribosomal peptide analogues, varylng from the parent non-ribosomal peptide in the incorporation of alternative precursor amino-acids and/or the extent of post-NRPS modification, comprising the construction of a genomic deletion strain from Which all or a portion of the genes encoding the native amino-acid precursor synthesis and/or post-NRPS enzymes have been removed, and its partial complementation by a gene cassette comprising one or a plurality of the deleted genes and/or their homologues, and further a method of producing said non-ribosomal peptide analogues by culturing said recombinant host strain, and optionally isolating the non-ribosomal peptide analogues produced. The post-NRPS and precursor biosynthesis genes to be deleted may or may not naturally form a contiguous sequence, however, once the deletion strain has been created the partial complementation by gene cassettes provides an expeditious approach to the production of recombinant strains in which one or a plurality of the said genes have been deleted. Therefore, in a further aspect, the invention provides a method for the combinatorial production of recombinant host strains capable of producing non-ribosomal peptide analogues varylng from the parent non-ribosomal peptide in the incorporation of alternative precursors and/or the extent of post-NRPS modification, comprising the partial complementation of the said genomic deletion strain by a combinatorial library of gene cassettes comprising one or a plurality of the deleted genes, and further a method of producing said non-ribosomal peptide analogues by culturing said recombinant host strains under conditions suitable for non-ribosomal peptide production, arid optionally isolating the non-ribosomal peptide analogues produced. In this context a preferred recombinant host cell strain is a prokaryote, more preferably an actinomycete, still more preferably a strain selected from S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var. ascomyceticus, Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces fividans, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces rimosus, Streptomyces albus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei or Actinoplanes sp. N902-109. It is well known that many actinomycetes contain multiple biosynthetic gene clusters for different secondary metabolites, including polyketides and non- ribosomally synthesised peptides. Specifically, it has been demonstrated that strains of S. hygroscopicus produce a variety of polyketides and non-ribosomally synthesised peptides in addition to rapamycin, FK506, FK520, FK523, meridamycin, FK525, antascomicin and tsukubamycin. These include, but are not limited to, elaiophylin, bialaphos, hygromycin, augustmycin, endomycin (ft, B), glebomycin, hygroscopin, ossamycin and nigericin. These additional biosynthetic gene clusters represent a competing requirement for.biosynthetic precursors and an additional metabolic demand on the host strain. In order to enhance production of the desired rapamycin, or other polyketide, analogues, it may therefore be advantageous to delete or inactivate any other biosynthetic gene clusters present in the host strain. Methods for the deletion or inactivation of biosynthetic gene clusters are well known in the art. In a further aspect of this class, the invention provides a mutasynthesis methodology for the complementation of recombinant deletion strains In a further aspect, S. hygroscopicus strains of the present invention containing a deletion of rapL may be fed with analogues of the naturally incorporated amino acid, L-pipecolic acid, to produce new analogues of rapamycin in which the pipecolyl residue is replaced. Prior art describes that a rapL mutant can be complemented by the addition of L-pipecolic acid to the culture (Khaw et al., 1998). Similarly, it was demonstrated that rapamycin analogues were isolated after the feeding and incorporation of L-pipecolic acid analogues, L-proline, L-trans-4- hydroxyproline, L-cis-4-hydroxyproline, L-cis-3-hydroxyproline, trans-3-aza-bicyclo[3, 1, 0]hexane-2-carboxylic acid (WO98/54308). Using S. hygroscopicus MG2-10 as strain background to express genes or gene cassettes encoding for post-PKS modifylng steps not including rapL or rapL homologues, a library of S. hygroscopicus strains is generated, capable of producing a plurality of modified products on feeding with L-pipecolic acid analogues. Suitable L-pipecolic acid analogues include alkyl-, halo-, hydroxy-, and amino-substituted pipecolic acids and prolines, and more particularly L-proline, L-trans-4-hydroxyproline, L-cis-4-hydroxyproline, L-cis-3- hydroxyproline, frans-3-aza-bicyclo[3,1, 0]hexane-2-carboxylic acid and L-pipecolic acid analogues demonstrated to catalyse PP-ATP exchange measured by a modification of Lipmann's method (Nielsen et al., 1991) including L-4-hydroxyproline, 1- hydroxyproline, 2-hydroxyproline, 3- hydroxyproline, frans-3-methyl-L-proline, cis- 3-methylproline, cis-3-methyl-DL-proline, c/s,fral7S-4-methylproline, cis-4-methyl-DL- proline, l/al7s-4-methy)-DL-proline, fral7s-4-aminoproline, cis-4-chloro-L-proIine, 5- iminoproline hydrochloride, cis-5-methyl-DL-proline, (+)-piperazic acid, 5- chloropipecolic acid, 5-hydroxypipecolic acid, cis-4-hydroxy-L-pipecolic acid, trans-4- hydroxy-D-pipecolic acid, 4-hydroxyallopipecolic acid, thiazolidine-4-carboxylic acid (Nielsen et al., 1991). This approach is exemplified in Example 7. The production of a limited number of novel rapamycin-analogues after feeding-close structural analogues of the natural 4,5-dihydroxycyclohex-1- enecarboxylic acid.starter.unit to cultures of S. hygroscopicus has previously been described, thus demonstrating that the loading module of the rapamycin polyketide synthase has some flexibility with respect to the starter acid (PAS. Lowden, PhD dissertation, University of Cambridge, 1997). However, these methods led to the production of a mixture of products. In a further aspect, the present invention allows for the production of rapamycin and related FKBP-ligand analogues by feeding strains of the present invention with analogues of the naturally incorporated 4,5- dihydroxycyclohex-1-enecarboxylic acid starter unit to produce rapamycin analogues incorporating alternative starter units including, but not limited to, cyclohexane carboxylic acid, 3-cis,4-trans-dihydroxycyclohexane carboxylic acid, 1-cyclohexene carboxylic acid, 3-cyclohexene carboxylic acid, cycloheptane carboxylic acid, 2- norbornane carboxylic acid, 3-hydroxycycIohexane carboxylic acid, 4- hydroxycyclohexane carboxylic acid, 3-methylcyclohexane carboxylic acid, 4- methylcyclohexane carboxylic acid, 3-(cis/trans)methoxycyclohexane carboxylic acid, 4-(cis/trans)methoxycyclohexane carboxylic acid, 4-oxo cyclohexane carboxylic acid, 3-fluoro-4-hydroxycarboxylic acid and 4-fluoro-3-hydroxycarboxylic acid, 3- cyclohexane oxide carboxylic acid, 3,4-cis-dihydroxycyclohexane carboxylic acid, 3- chloro-4-hydroxycarboxylic acid and 4-chloro-3-hydroxycarboxylic acid (and the pair of opposite diastereomers), cyclohexylpropionic acid, 4-tert-Butylcyclohexane carboxylic acid and simple esters and salts thereof. This approach is exemplified in Examples 8,19 and 20. Additionally, structural analogues of biosynthetic precursors of the 4,5- dihydroxycyclohex-1-enecarboxylic acid starter unit may be fed (Lowden et al., 2001), leading to production of novel rapamycin analogues incorporating alternative starter units. However, these methods can lead to the production of mixed groups of products; therefore, the present invention additionally provides a method for removing the competition between the endogenously produced starter unit and the alternative starter acid analogues that are fed in order to improve the efficiency of production of novel rapamycin analogues. In order to remove the competition between the endogenously produced natural starter unit and the alternative starter acid analogues fed, it is preferable to disrupt the biosynthesis of the natural 4,5-dihydroxycyclohex-1-enecarboxylic acid starter unit. This may be achieved by deletion or inactivation ef one or more of the genes involved in the biosynthesis of the natural 4,5-dihydroxycyclohex-1- enecarboxylic acid starter unit from shikimic acid (Lowden et al., 2001) or the biosynthesis of shikimic acid itself. In the latter case, it may be necessary to supplement cultures with aromatic amino acids (phenyl alanine, tyrosine, tryptophan). Alternatively, endogenous production of the natural 4,5-dihydroxycyclohex-1-ene carboxylic acid starter unit may be suppressed by the addition of a chemical inhibitor of shikimic acid biosynthesis. Such inhibitors are well known in the literature. In a further aspect the invention makes use of the surprising discovery that rapK is involved in the supply of the biosynthetic precursors), e.g. 4,5- dihydroxycyclohex-1-ene carboxylic acid starter unit of rapamycin and therefore that deletion or inactivation of rapK or a rapK homologue provides a strain lacking in competition between the natural starter unit and fed non-natural starter units. In another aspect, the invention provides, a method for the efficient incorporation of fed acids including, but not limited to those described below. Therefore in one aspect of the invention the method comprises feeding starter units of the formula where X = bond or CH2 and R1, R2, R3l R4, R5 and R6 may be the same or different and may independently be CI, F, OH, SH, H, alkyl, CN, Br, R7l OR7, C(0)R7 or HNR7 where R7 is a C1-C4 alkyl; R-, and R3, R2 and R4, R3 and R5, R4 and R6, R1 and R6, or R2 and R6 may be joined as either a substituted or unsubstituted methylene link, an ether link, a thia link or an amino link, R, and R2, R3 and R4 or R5 and R6 may be taken together as a ketone; provided that no more than 4 of R1f R2, Rs, R4, R5 or R5 may be CI; no more than 2 of R1, R2, R3, R4, R5 or R6 may be HNR7; no more than 2 of R1, R2, R3, R4, R5 or R6 may be SH and both R groups from one carbon on the ring are not OH. In a preferred embodiment the starter unit is not selected from the group consisting of: cyclohexane carboxylic acid, 3-cis,4-trans-dihydroxycyciohexane carboxylic acid, cycloheptane carboxylic acid and 3-(cis/frans)-methylcyclohexane carboxylic acid In preferred embodiments: where R1,R2, R3, R4, R5 or R6 are a combination of F and OH substitution no more than 3 of R1-6 are substituted and the remainder are H. Where R1, R2, R3, R4, R5 or R6 are a combination of CI and OH substitution no more than 3 of R1-6 are substituted and the remainder are H. Where any two of R1, R2, R3, R4, R5 or R6 are OH and any two remaining R groups are F on one carbon the remainder are H. Where two of R1 ,R2, R3l R4, R6 or R6 are CI the remainder are H. Where two of R1 ,R2, R3, R4, R5 or R6are CI, not originating from the same carbon, and a further R is OH the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is alkyl and the remainder are H; the alkyl group shall have a linear length of no greater than 3 carbons. Where one of R1, R2, R3, R4, R5 or R6 is NHR7 the remainder are H. In more highly preferred embodiments: where two of Ri, R2, R3, R4, R5 or R6 are OH and a third R group is F, the remainder are H. Where two of Rn, R2, R3, R4, R5 or R6 are F the remainder are H. Where two of R1, R2, R3l R4, R5 or R6 are OH the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH and a third R group is CI the remainder are H. Where two of R1, R2, R3, R4, Re or R6 are F, and a third R group is OH the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is SH the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is SH and a second R group is OH (not originating from the same carbon) the remainder are H. In still more higly preferred embodiments: where one of R-,, R2, R3, R4, R5 or R6 is F the remainder are H. Where of R1, R2, R3, R4, R5 or R6 are CI the remainder are H. Where one of R1, R2, R3, R4, R5 or R6, are F and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is CI and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3 ,R4, R5 or R6 is alkyl and the remainder are H; the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R1, R2\| R3, R4, R5 or R6 is alkyl and a second R group is OH (not originating from the same carbon) and remainder are H; the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. A further aspect of the invention comprises feeding starter units of the formula , where X = bond or CH2 and R1 ,R2l R3, R4, R6 and R6 may be the same or different and may independently be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7, C(O)R7 or HNR7 where R7 is a C1-C4 alkyl; R1 and R3, R2 and R4, R3 and R5, R4 and R6, R1 and R5, or R2 and R6 may be joined as either a substituted or unsubstituted methylene link, an ether link, a thia link or an amino link, R1 and R2, R3 and R4 or R5 and R6 may be taken together as a ketone; provided that no more than 4 of R1, R2, R3, R4, R5 or R6 may be CI; no more than 2 of R1 R2, R3, R4, R5 or R6 may be HNR7; no morethan 2 of R1 R2, R3, R4, R5 or R6 may be SH and both R groups from one carbon on the ring are not OH. In a preferred embodiment the starter unit is not selected from the group consisting of: 1-cyclohexene carboxylic acid and 1-cycloheptene carboxylic acid In preferred embodiments, where R1 R2, R3, R4, R5 or R6 are a combination of F and OH substitution no more than 3 of R^ are substituted and the remainder are H. Where R1, R2, R3, R4, R5 or R6 are a combination of CI and OH substitution no more than 3 of R1-6 are substituted and the remainder are H. Where any two of R1, R2. R3. R4, R5 or R6 are OH and two of the remaining R groups are F on the same carbon the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are CI the remainder are H. Where two of R1, R2, R3 R4 R5 or R6 are CI, not originating from the same carbon, and a further R group is OH the remainder are H. Where one of -R2. R3, R4, R5 or Re is alkyl and the remainder are H; the alkyl group shall have a linear length of no greater than 3 carbons. Where one of R1, R2, R3, R4, R5 or R6 is NHR7 the remainder are H. In more highly preferred embodiments: where two of R1, R2, R3, R4, R5 or R6 are OH and a third R group is F, the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are F the remainder are H. Where two of R1( R2, R3, R4, R5 or R6 are OH the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH and a third R group is CI the remainder are H. Where two of R1, R2, R3, R4, R6 or R6 are F, and a third R group is OH the remainder are H. Where one of R1, R2, R3, R^ R5 or Re is SH the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is SH and a second R group is OH (not originating from the same carbon) the remainder are H. In still more higly preferred embodiments: where one of R1, R2, R3, R4, R5 or R6 is F the remainder are H. Where of R^ R2, R3, R4, R5 or R6 are CI the remainder are H. Where one of R1, R2, R3l R4, R5 or R6, are F and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of Rit R2, R3, R4, R5 or Re is CI, a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1( R2, R3) R1, R5 or Re is alkyl and the remainder are H; the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R1, R2, R3, R4, R5 or R6 is alkyl and a second R group is OH (not originating from the same carbon) the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. A further aspect of the invention comprises feeding starter units of the formula': where X = bond or CH2, R., and R2, may be the same or different and may independently be F, CI, OH, SH, H, CN, OR7l C(O)R7, or NHR7 wherein R7 is a C1-C4 alkyl, R^ and R2 may also be taken together to form a ketone, a spirocyclopropyl group or with -OCH2-, -CH20-, -SCH2- or-CH2S-; furthermore R3, and R4 may be the same or different and may independently be be F, CI, Br, OR7, H or CN; provided that both R groups from one carbon on the ring are not OH. In a preferred embodiment the starter unit shall not be 5-cis-hydroxyl-3- cyclohexene carboxylic acid. In preferred embodiments:-Where two of R1, R2, Rs, or R4 are F the remainder are H. Where-one of R1( R2, R3, or R4 is Ci the remainder are H. Where one of R3, or R4 is F and one of R1 or R2 is OH the remainder are H. Where one of R3 or R4 is CI and one of R1 or R2 is OH the remainder are H. Where one of R1 or R2 is SH the remainder are H. Where one of R^ R2, R3, or R4 is alkyl and the remainder are H; the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R3 or R is alkyl and R1 or R2 is OH the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. In more highly preferred embodiment where one of R1, R2, R3, or R4 is F the remainder are H. Where one of R1( R2l R3, or R4 is CI the remainder are H A further aspect of the invention comprises feeding starter units of the formula where Rn, R2, R3, R, R5 or R6 may be the same or different and may independently be be be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7, C(O)R7 or HNR7 where R7 is a C1-C4 alkyl; R1 and R3, R2 and R4, R3 and R5, R4 and R6, Rn and R5, or R2 and R6 may be joined as either a substituted or unsubstituted methylene link, an ether link, a thia link or an amino link, R3 and R» or R5 and R6 may be taken together as a ketone;provided that both R groups from one carbon en the ring are not OH. In preferred embodiments: Where two of R1f R2, Rs, R4, R5 or R6 are F the remainder are H. Where two of R-,, R2, R3, R1, R5 or R6 are OH, the remainder are H. Where two of R^ R2, R3, R+, R5 or R6 are OH, and a third R group is F the remainder are H. Where two of RL R2, R3, R4, R5 or R6 are OH, and a third R group is CI the remainder are H. Where two of R^ R2, R3, R4, R5 or R6 are F and a third R group is OH the remainder are H. Where one of R1, R2, R3, R+, R5 or R6 is Br the remainder are H. Where one of Ru R2\| R$, R, R6 or R6 is Br and a second R group is OH the remainder are H In more preferred embodiments: Where one of R1, R2, R5, R4, R5 or R6 is F the remainder are H. Where one of R1( R2, Rs, R1, R5 or R6 are CI the remainder are H. Where one of R^ R2, R3, R4l R5 or Re is F and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3, R4, R6 or Re is CI and a second R group is OH (not originating from the same carbon) the remainder are H, Where one of R1f R2> R3, R4, R5 or Re is SH the remainder are H. Where one R1, R2, R3, R4, Re or Re is SH and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is alkyl and the remainder are H; the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R^ R2, R3, R4, R5 or Re alkyl and a second R group is OH (not originating from the same carbon) the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons A further aspect of the invention comprises feeding starter units of the formula where R1, R2, R3, R4, R5 or R6 may be the same or different and may independently be be be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7, C(O)R7 or HNR7 where R7 is a C1-C4 alkyl; R1 and R3, R2 and R4, R3 and R5, R4 and R6l R1 and R5, or R2 and R6 may be joined as either a substituted or unsubstituted methylene link, an ether link, a thia link or an amino link, R3 and R4 or R5 and R6 may be taken together as a ketone;provided that both R groups from one carbon on the ring are not OH. In preferred embodiments: where R1F R2, R3, R4, R5 or R6 are a combination of F and OH substitution no more than 3 of R^ are substituted and the remainder are H. Where R1, R2, R3, R4, R5 or R6 are a combination of CI and OH substitution no more than 3 of R^ are substituted and the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH and two of the remaining R groups are F on one carbon the remainder are H. Where two of R1( R2l R3, R4, R5 or R6 are CI the remainder are H. Where two of R1, R2l R3, R4, R5 or R6 are CI (not originating from the same carbon) and a third R group is OH, the remainder are H. Where one of R1, R2l R3, R4, R5 or R6 is alkyl and the remainder are H; the alkyl group shall have a linear length of no greater than 3 carbons. Where two of R1( R2, R3, R4, R5 or R6 are SH the remainder are H. Where one of R1, R2) R3, R4, R5 or R6is HNR7 the remainder are H. In more preferred embodiments: Where two of R^ R2, R3l R4, R5 or R6 are F the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH the remainder are H. Where two of R1r R2, R3, R4, R5 or R6 are OH and a third R group is F, the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH and a third R group is Ci the remainder are H. Where two of R1, R2, R3, R4, R5 or RBare F, and a third R groups is OH the remainder are H. Where one of R1( R2, R3, R^ R5 or R6 is Br the remainder are H, Where one R1( R2, R3, R4, R5 or Re is Br and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, Ra, Rs, R4, R5 or Re is SH the remainder are H. Where one of R-,, R2, R3, R4, R5 or R6 is SH and a second R groups is OH (not originating from the same carbon) the remainder are H. In more preferred embodiments: Where one of R^ R2, R3, R4, R5 or R6 is F the remainder are H. Where one of R1( R2l R3, R4, R5 or Re is CI the remainder are H. Where one of R1f R2, R3, R4, R5 or R6 is F and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3) R4, R5 or R6 is CI and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is alkyl and the remainder are H; the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R1; R2, R3, R^ R6 or R6 is alkyl and a second R group is OH (not originating from the same carbon) the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. A further aspect of the invention comprises feeding starter units of the formula where R^ and R2, may be the same or different and may independently be F, CI, OH, SH, H, CN, OR7, C(O)R7, or NHR7 wherein R7 is a C1- C4 alkyl, R1 and R2 may also be taken together to form a ketone, a spirocyclopropyl group or with -OCH2-, -CH20-, -SCHr or -CH2S-; furthermore R3, and R4 may be the same or different and may independently be be F, CI, Br, OR7, H or CN; provided that both R groups from one carbon on the ring are not OH.. In preferred embodiments: Where one of R^ R2, R3 and R4 is F the remainder are H. Where one of R1, R2, R3 and R4 is CI the remainder are H. Where one of R1, R2, R3 and R4 is F and a second R groups is OH (not originating from the same carbon) the remainder are H. Where one of R1f R2, R3 and R« is CI and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2l R3 and R* is SH the remainder are H. Where one of R1, R2l R3 and R4 is alkyl the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R1F R2, R3 and R4 is alkyl and a second R groups is OH (not originating from the same carbon) the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where two of R1, R2, R3 and R4 are F the remainder are H. An additional aspect of the invention comprises feeding starter units of the formula where X = bond or CH2;and R1, R2, R3) R4 or R5 may be the same or different and may independently be be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7, C(O)R7 or HNR7 where R7 is a C1-C4 alkyl, R1 and Rs, R2 and R4, may be taken together as a ketone or linked as either a substituted or unsubstituted methylene link, an ether link, a thia link or an amino link where R1 and R2 or R3 and R4 are linked as a spiro-cyclopropyl group or with -OCHr or -CH20- or -SCH^ or -CH2S-, R5 may be F, CL, OR7, H or CN; provided that no more than two of R1, R2, R3, R4 or R5 are SH and that both R groups attached to one carbon are not OH. In preferred embodiments: where R1, R2, R^ R4 or R5 are a combination of F and OH no more than 3 of R1, R2, R3) R4 or R5 are substituted and the remainder are H. Where R1, R2, R3, R4 or R5 are a combination of CI and OH no more than 3 of R^ are substituted and the remainder are H. Where R1( R2, R3, R4 or R5 are a combination of two are OH (not on the same carbon) and two are F on one carbon the remainder are H. Where two of R1f R2, R3, R4 or R5 are CI the remainder are H. Where two of R1, R2, R3, R4 or R5 are CI (not originating from the same carbon) and a third R group is OH the remainder are H. Where one of Rf1, R2, R3, R4 or R5 is alkyl the remainder are H; and the alkyl group shall have a linear length of no greater than 3 carbons. Where two of R1( R2, R3, R4 or R5 are SH the remainder are H. Where one of R1( R2, R3, R4 or R5 is NHR7 the remainder are H. Where one of R1, R2) R3) R4 or R5 is SH the remainder are H. In more highly preferred embodiments: where one of R^ R2, R3, R4 or R5 is OH the remainder are H. Where one of R^ R2, R3, R4 or R5 is F the remainder are H. Where one of R1, R2, R3, R4 or R5 is CI the remainder are H. Where one of R1, R2, R3, R* or R5 is F and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3l R* or R5 is CI and a second R groups is OH (not originating from the same carbon) the remainder are H. Where one of R-,, R2, R3l RA or R6 is SH and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, Ra, R* or R5 is alkyl the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R-\, R2l R3, R4 or R6 is alkyl and a second R group is OH (not originating from the same carbon) the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where two of R1, R2, R3, R4 or R5 are F the remainder are H. Where two of R1, R2, R3, R4 or R5 are OH the remainder are H. Where two of R-,, R2) R3, R4 or R5 are OH and a third R group is F the remainder are H. Where two of R1( R2, R3, R4 or R5 are OH and a third R groups is CI the remainder are H. Where two of R1, R2l R3, R« or R5 are F and a third R group is OH the remainder are H. An additional aspect of the invention comprises feeding starter units of the formula where R1, R2l R3 and R4 may be the same or different and may independently be CI, F, OH, SH, H, alkyl. CN, Br, R7f OR7, C(O)R7 or HNR7 where R7 is a C1-C4 alkyl, R^ and R2 or R5 and R4 may be taken together to form a ketone, provided that two R groups attached to the same carbon are not both OH. In preferred embodiments: Where one of R1, Rz, R3 or R4 is F the remainder are H. Where one of R1, R2, R3 or R4 is CI the remainder are H. Where one of R1f R2, R3 or R4 is Br the remainder are H. Where one of R1f R2, R3 or Rj is OH the remainder are H. Where one of R1, R2, R3 or R4 is F and a second R group is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2l R3 or R4 is CI and a second R groups is OH (not originating from the same carbon) the remainder are H. Where one of R1( R2, R3 or R4 is SH the remainder are H. Where one of R1, R2, R3 or R4 is SH and a second R groups is OH (not originating from the same carbon) the remainder are H. Where one of R1, R2, R3 or R4 is alkyl the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where one of R1, R2, R3 or FM is alkyl and a second R groups is OH (not originating from the same carbon) the remainder are H; and the alkyl group shall contain no more than 4 carbons and have a linear length of no greater than 3 carbons. Where two of R1, R2, R3 or R4 are F the remainder are H. Where two of R-,, R2) R3 or R4 are OH the remainder are H. Where two of R1, R2l R3 or R4 are OH and a third R group is F the remainder are H. Where two of Rv, R2, R3 or R4 are OH and a third R group is CI the remainder are H. Where two of R1, R2l R3 or R4 are F and a third R group is OH the remainder are H. In a preferred embodiment the present invention provides a method for the efficient incorporation of. 2-norbomane carboxylic acid; 2-(cis/trans)- hydroxycyclohexane carboxylic acid; 3-(cis/frans)-hydroxycyclohexane carboxylic acid; 4-(o/s/frans)-hydroxycyclohexane carboxylic acid; 2-(cisrfrans)- methylcyclohexane carboxylic acid; 4-(cis/trans)-methylcyclohexane carboxylic acid; 3-(cis/!rans)-methoxycyclohexane carboxylic acid; 4-(c;s/frans)-methoxycyclohexane carboxylic acid; 4-oxocyclohexane carboxylic acid; ethyl 2-oxocyclohexane carboxylic acid; 4-trans-n-pentylcyclohexane carboxylic acid; 2-trans-aminocyclohexane carboxylic acid; 4-cis-aminocyclohexane carboxylic acid; 4-(cis/lrans)- aminomethylcyclohexane carboxylic acid; cyclopentane carboxylic acid; cyclobutane carboxylic acid; 1-methylcyclohexane carboxylic acid; 3-trans-hydroxy-4-cis- fluorocyclohexane carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis- hydroxy-3-trans-fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans- chlorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans-chlorocycIohexane carboxylic acid; 3-fral7S-hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4-trans- hydroxy-3-cis-chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide carboxylic acid; 3-cis-cyclohexeneoxide carboxylic acid; 3,4-cis- dihydroxycyclohexane carboxylic acid and 3,4-tral7s-dihydroxycyclohexane carboxylic acid; cyclohexaneacetic acid; cyclohexanepropionic acid or 4-cistoans-tert- butylcyciohexane carboxylic acid or simple esters or salts thereof into FKBP-ligand analogQes by a strain with rapK or a rapK homologue deleted or inactivated, in a more preferred embodiment the present invention provides a method for the efficient incorporation of: 3-(cis#ral?s)-hydroxycyclohexane carboxylic acid; 4-(cistfrans)- hydroxycyclohexane carboxylic acid; 3-(cis/?rai)s)-methoxycyclohexane carboxylic acid; 4-(cisrtrans)-methoxycyclohexane carboxylic acid; 4-oxo cyclohexane carboxylic acid; cyclobutane carboxylic acid; 3-trans-hydroxy-4-cis-ftuorocyclohexane carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane carboxylic acid; 3-cis- hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans- fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans-chlorocyclohexane carboxylic acid and 4-cis-hydroxy-3-frBns-chlorocycIohexane carboxylic acid; 3-trans- hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4- chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide carboxylic acid; 3-cis- cydohexeneoxide carboxylic acid; 3,4-cis-dihydroxycyclohexane carboxylic acid and 3,4-trans-dihydroxycyclohexane carboxylic acid; cyclohexanepropionic acid; 4- ds/frans-tert-butylcyclohexane carboxylic acid or simple esters or salts thereof into FKBP-ligand analogues by a strain with rapK or a rapK homologue deleted or inactivated. In a specific embodiment of the present invention the fed starter units are not cyclohexane carboxylic acid, 3-cis,4-trans-dihydroxycyclohexane carboxylic acid, 1- cyclohexene carboxylic acid, 3-cydohexene carboxylic acid, cycioheptane carboxylic acid, 3-(cis/trans)-methylcyclohexane carboxylic acid, 4-(cis/transy methylcyclohexane carboxylic acid, 1-cycloheptene carboxylic acid or 5-cis-hydroxyl- 3-cyclohexene carboxylic acid. The strains for use in the embodiments described above are selected from the group comprising: Streptomyces hygroscopicus subsp. hygroscopicus NRRL 5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC14891, Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces hygroscopicus subsp. ascomyceticus ATCC 14891, Streptomyces tsukubaensis No.9993 FERM BP- 927, Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429, Steptomyces sp. MA 6858 ATCC 55098, Steptomyces sp. MA 6848. In a preferred embodiment said strain is selected from the group consisting ef: Steptomyces hygroscopicus subsp. hygroscopicus NRRL 5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891, Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces hygroscopicus subsp. ascomyceticus ATCC 14891, Streptomyces tsukubaensis No.9993 FERM BP-927, Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429 or Streptomyces sp. MA 6858 ATCC 55098. In a more highly preferred embodiment the strain is the rapamycin producer S. hygroscopicussubsp. hygroscopicus. In the methods for.the efficient incorporation of fed carboxylic acids described above the compounds produced are analogues of the FKBP-ligards as described herein, for example but without limitation: rapamycin, FK506, FK520, FK523, FK525, antascomicin, meridamycin and tsukubamycin. In a preferred embodiment the compounds produced are analogues of rapamycin, FK506 or FK520. In a more highly preferred embodiment the compounds produced are analogues of rapamycin; these compounds correspond to Formula II or Formula III as described below. Additionally, the methods described above may be used to generate novel FK506 and FK520 analogues which correspond to Formula I below: R2 = H, alkyl, halo, hydroxyl, thiol R5 = H, alkyl, halo, hydroxyl, thiol R4 = H, alkyl, halo, hydroxyl, thiol R5 = OMe, Me or H R6 = OMe, Me or H R7 = CH2CH3 or CH2CH=CH2 Z = keto or CH2 X=X'=bond; X=bond and X'- CH2l S, O or X= OH2, S, O, fused cyclopropyl unit and X'=bond In a preferred embodiment, where R6 = OH and Ro= H, OH, halo, alkyl or thiol. In a further preferred embodiment where Rs= OH and R9 = halo. where Re = 4-trans-OH, R9 = 3-cis-OCH3, and R2 = R3 = R4 = H, X = CH2l X' = bond, Z = keto, R6 = Re = OCH3 and R7 = CH2CH3 where Re = 4-trans-OH, R6 = 3-cis-OCH3, and R2 = R3 = R4 = H, X = CH2) X" = bond, Z - keto, R5 = R6 = OCH3 and R7 = CH2CH=CH2 Thus, for example, the recombinant strain S. hygroscopicus MG2-10 can be cultured in the presence of cyclohexane carboxylic acid to produce 9-deoxo-16-O- desmethyl-27-desmethoxy-39-desmethoxy-rapamycin (Example 12). It can be seen by one skilled in the art that homologues to rapK in other biosynthetic clusters that encode FKBP-ligands, including, but not limited to, FK506, FK520, FK523, FK525, meridamycin, tsukubamycin, antascomicin and 'hyg' can also be deleted or inactivated allowing efficient feeding of starter unit carboxylic acids leading to the production of novel analogues. In another aspect, S. hygroscopicus strains of the invention (including rapL or rapL homologues or not including rapL or rapL homologues and/or including rapK or rapK homologues or not including rapK or rapK homologues) may be fed with analogues of L-pipecolic acid, as described above, in combination with analogues of the natural 4,5-dihydroxycyclohex-1-enecarboxylic acid starter unit, as described above, to produce rapamycin analogues in which both the starter unit and the pipecolyl residue have been replaced. This approach is exemplified in Examples 10, 11 and 12. The present invention provides a process for producing FKBP-ligand analogues varylng in the extent of post-PKS modification and/or in which the pipecolic acid residue has been replaced, and optionally the starter 4,5- dihydroxycyclohex-1-enecarboxylic acid residue has been replaced. This process comprises the step of deleting or inactivating one or more genes in the microorganism host cell involved in the production of the precursor compound, L- pipecolic acid and/or 4,5-dihydroxycyclohex-1-ene carboxylic acid, required for biosynthesis of the rapamycin polyketide/NRPS template and/or in its subsequent post-PKS modification, thereby to suppress the production of the natural product. The process further comprises transforming the microorganism host cells with nucleic acid encoding polyketide-modifylng genes to restore polyketide production, culturing the transformed host cells under conditions suitable for polyketide production and optionally isolating the rapamycin analogues produced. The present invention provides a process for the production of FKBP-ligand . analogues including, but not limited to FK506, FK520, FK523, FK525, tsukubamycin, antascomicin, meridamycin and 'hyg', varylng in the extent of post-PKS modification and/or in which the amino acid residue has been replaced, and optionally the starter unit has been replaced. This process comprises the step of deleting or inactivating one or more genes in the microorganism host cell involved in the production of the precursor amino acid residue and/or starter unit, required for the biosynthesis of the polyketide/NRPS template and/or in its subsequent post-PKS modification, thereby to suppress the production of the natural product The process further comprises transforming the microorganism host cells with nucleic acid encoding polyketide- modifylng genes to restore polyketide production, culturing the transformed host cells under conditions suitable for polyketide production and optionally isolating polyketide analogues produced. The present invention provides novel FKBP-Figand analogues. In a further aspect the present invention provides the following FK520 analogues: 31-desmethoxy-FK520, 31-desmethoxy-31-cis-hydroxy-32-fr^ns-hydroxy- FK520, 31 -desmethoxy-31 -cis-hydroxy-32-cis-hydroxy-FK520, 31 -desmethoxy-31 - frans-hydroxy-32-trans-hydroxy-FK520, 31 -O-desmethyf-32-dehydroxy-FK520, 31 -O- desmethyl-FK520,31-desmethoxy-31-methyl-FK520,31-O-desmethyl-32-dehydroxy- 32-methyl-FK520,31-O-desmethyl-32-dehydrQxy-32-fluoro-FK520l31-desmethoxy- 31 -fluoro-FK520,31 -O-desmethyl-32-dehydroxy-32-chloro-FK520, 31 -desmethoxy- 31-chloro-FK520, 31-O-desmethy»-32-dehydroxy-32-fe/to^ methoxy-4-hydroxy-cydohexyl)-29-(hydroxy-cycloheptyl)-FK520, 29-de(3-methoxy-4- hydroxy-cyclohexyl)-29-(hydroxy-norborny))-FK520, 9-deoxo-31-desmethoxy-FK520, 9-deoxo-31-desmethoxy-31-cfe-hydroxy-32-trans-hydroxy-FK520, 9-deoxo-31- desmethoxy-31 -cis-hydroxy-32-cis-hydroxy-FK520,9-deoxo-31 -desmethoxy-31 - frans-hydroxy-32-trans-hydroxy-FK520,9-deoxo-31 -O-desmethyl-32-dehydroxy- FK520, 9-deoxo-31-Odesmethyl-FK520I9-deoxo-31-desmethoxy-31-methyl-FK520, 9-deoxo-31 -O-desmethyl-32-dehydroxy-32-methyl-FK520, 9-deoxo-31 -O-desmethyl- 32-dehydroxy-32-fluoro-FK520, 9-deoxo-31-desmethoxy-31 -fluoro-FK520, 9-deoxo- 31 -O-desmethyl-32-dehydroxy-32-chloro-FK520, 9-deoxo-31 -desmethoxy-31 -chloro- FK520, 9-deoxo-31 -Odesmethyl-32-dehydroxy-32-ferf-butyl-FK520, 9-deoxo-29- de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK5201 9-deoxo-29- de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-FK520, 30-desmethoxy- prolyl-FK520l30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-FK520, 30- desmethoxy-30-cis-hydroxy-31-cis-hydroxy-prolyl-FK520, 30-desmethoxy-30-trans- hydroxy-31-trans-hydroxy-prolyl-FK520, 30-O-desmethyl-31-dehydroxy-prolyl-FK520, 30-O-desmethyl-prolyl-FK520, 30-desmethoxy-30-methyl-prolyl-FK520, 30-O- desmethyl-31-dehydroxy-31-methyl-proiyl-FK520, 30-Odesmethyl-31-dehydroxy-31- fluoro-prolyl-FK520, 30-desmethoxy-30-fluoro-prolyl-FK520, 30-O-desmethyl-31 - dehydroxy-31-di)oro-prolyl-FK520) 30-desmethoxy-30-chloro-prolyl-FK520, 30- desmethyl-31-dehydroxy-31-terf-butyl-prolyl-FK520,28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-cycloheptyl)-FK520, 28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbornyl)-FK520I 8-deoxo-30-desmethoxy-31-hydroxy- prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-fra^-hydroxy-prolyl- FK520,,:8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-prolyl-FK520, 8- deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK520, 8-deoxo-30- O-desmethyl-31 -dehydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-prolyl-FK520, 8- deoxo-30-desmethoxy-30-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 - dehydroxy-31-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31- fluoro-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-prolyl-FK520, 8-deoxo-30-O- desmethyl-31 -dehydroxy-31 -chloro-prolyl-FK520,8-deoxo-30-desmethoxy-30-chloro prolyl-FK520t8-deoxo-30-O-desmethyl-31-dehydroxy-31-tert-butyl-prolyl-FK520, 8- deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl- FK520,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)- prolyl-FK520, 30-desmethoxy-3-hydroxy-prolyl-FK520,30-desmethoxy-30-cis- hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy- 31-cis-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-trans-hydroxy-31-trans- hydroxy-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31rdehydroxy-3-hydroxy-prolyl- FK520, 30-O-desmethyl-3-hydroxy-prolyl-FK52Q, 30-desmethoxy-30-methyl-3- hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyJ- FK520, 30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-prolyl-FK520, 30- desmethoxy-30-fluoro-3-hydroxy-prolyl-FK5201 30~O-desmethyl-31 -dehydroxy-31 - chloro-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-chloro-34iydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -tert-butyl-3-hydroxy-prolyl-FK520, 28-de(3- methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prDlyl-FK520, 28- de(3-mettioxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-31-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-cis-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-trans-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- O-desmethyl-31-dehydroxy-3-hydroxy-prolyl-FK520l 8-deoxo-30-O-desmethyl-3- hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK520, 8- deoxo-30-O-desmethyl-31-dehydroxy-31-methyl-3-hydroxy-prolyl-FK520, 8-deoxo- 30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-pro)yl-FK520, 8-deoxo-30- desmethoxy-30-fluoro-3-hydroxy-prolyl-FK520, B-deoxo-30-O-desmethyl-31 - dehydroxy-31-chloro-3-hydroxy-pro!yl-FK520, 8-deoxo-30-desmethoxy-30-chloro-3- hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -tert- butyl-3-hydroxy-pro!yl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-cycloheptyl)-3-hydroxy-proIyl-FK520, 8-deoxo-28-de^-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK520, 30-desmethoxy-4- hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31 -trans-hydroxy-4-hydroxy- prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK520, 30-O- desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK520, 30-O-desmethyl-4-hydroxy-prolyl- FK520,30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK520,30-O-desmethyl-31 - dehydroxy-31-methyl-4-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 - fluoro-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-fiuoro-4-hydroxy-prolyl-FK520, 30- O-desmethyl-31 -dehydroxy-3" -chloro-4-hydroxy-prolyl-FK520, 30-desmethoxy-30- chloro-4-hydroxy-pro!yl-FK520,30-O-desmethyl-31-dehydroxy-31 -terf-butyl-4- hydroxy-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy- cycloheptyl)-4-hydroxy-prolyl-FK520, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-norbomyl)-4-hydroxy-prolyl-FK520, 8-deoxo-30-desrnethoxy-31-hydroxy-4- hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4- hydroxy-prolyl-FK520, 8-deoxo30-desmethoxy-30-cis-hydroxy-31-c;s-hydroxy-4- hydroxy-prolyl-FK520>8-deoxo-30-desmethoxy-30-&ans-hydroxy-31-trans-hydroxy-4- hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-4-hydroxy-prolyl- FK520, 8-deoxo-30-O>desmethyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy- 30-methyM-hydroxy-prolyl-FK520) 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 - methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -fluoro-4- hydroxy-prolyl-FK520,8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK520, 8- deoxo-30-O-desmethyl-31-deriydroxy-31-chlor4-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-chloro-3-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl- 31 -dehydroxy-31 -ferf-butyl-4-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4- hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK520, 8-deoxo-28- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-4-hydroxy-prolyl-FK520) 31-desmethoxy-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31-cis-hydroxy-32- frans-hydroxy-trans-3-bicyclo[3.1.0.]FK520,31-desmethoxy-31-cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.]FK520, 31 -desmethoxy-31 -trans-hydroxy-32-trans- hydroxy-trans-3-bicyclo[3.1.0.JFK520, 31 -O-desmethyl-32-dehydroxy-trans-3- bicyclo[3.1.0.JFK520, 31-O-desmethyl-trans-3-bicyclo[3.1.0.JFK520, 31-desmethoxy- 31 -methyl-trans-3-bicyclo[3.1.0.JFK520, 31 -O-desmethyl-32-dehydroxy-32-methyl- trans~3-b)cyc\o[3.1.O.JFK520, 31-O-desmethyl-32-dehydroxy-32-fluoro-frBns-3- bicyclo[3.1.0.JFK520, 31-desmethoxy-31-fIuoro-trans-3-bicyclo[3.1.0.]FK520, 31-O- desmethyl-32-dehydroxy-32-chloro-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31- chloro-trans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl-32-dehydroxy-32-fe/t-butyl- frans-3-bicyclo[3.1.0.JFK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy- cycloheptyl)-trans-3-bicyclo[3.1.0.JFK520,29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-norbomylH/Tans-3-bicyclo[3.1.0.]FK520l 9-deoxo-31-desmethoxy-fral7S- 3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy- frans-3-bicyclo[3.1.0.]FK520,9-deoxo-31 -desmethoxy-31 -cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-trans-hydroxy-32- frans-hydroxy-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O-desmethyl-32-dehydroxy- frans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 -O-desmethy Wrans-3-bicyclo[3.1.0.JFK520, 9-deoxo-31-desmethoxy-31-methyW/ans-3-bicyclot3.1.0.]FK520,9-deoxo-31-O- desme%l-32-dehydroxy-32-methyl-trans-3-bicyclo[3.1.0.]FK520l9-deoxo-31-O- desmethyl-32-dehydroxy-32-fluoro-tnans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31- desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O-desmethyl-32- dehydroxy-32-chloro-fcrans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31- chloro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-32-dehydroxy-32-tert- butyl-rans-3-bicyclo[3.1.0.JFK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyciohexyl)- 29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK520I9-deoxo-29-de(3-methoxy-4- hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-trans-3-bicyclo[3.1.0.JFK520,, In a preferred embodiment, the present invention provides the following FK520 analogues: 31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK520, 31- desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK520, 31-desmethoxy-31-trans- hydroxy-32-£rans-hydroxy-FK520, 31 -desmethoxy-31 -methyl-FK520, 31 -desmethoxy- 31-fluoro-FK520, 31-desmethoxy-31-chloro-FK520, 31-O-desmethyl-32-dehydroxy- 32-tert-butyl-FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy- cycloheptyl)-FK520,29-de(3-methoxy-4-hydroxy-cyclohexy0-29-(hydroxy-norbornyl)- FK520, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK520, 9-deoxo- 31 -desmethoxy-31 -cis-hydroxy-32-cis-hydroxy-FK520, 9-deoxo-31 -desmethoxy-31 - /rans-hydroxy-32-fraAJS-hydroxy-FK520, 9-deoxo-31-desmethoxy-31-methyl-FK520, 9-deoxo-31-desmethoxy-31-f!uoro-FK520, 9-deoxo-31-desmethoxy-31-chloro-FK520, 9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert-butyl-FK520, 9-deoxo-29-de(3- methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK520, 9-deoxo-29-de(3- methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-FK520,, 30-desmethoxy-30- cis-hydroxy-31-trans-hydroxy-prolyl-FK520) 30-desmethoxy-30-cis-hydroxy-31-cis- hydroxy-prolyl-FK520, 30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl- FK520, 30-desmethoxy-30-methyl-prolyl-FK520, 30-desmethoxy-30-fluoro-prolyl- FK520,%0-desmethoxy-30-chloro-prolyl-FK520,30-desmethyl-31-dehydroxy-31-tert- butyl-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexy0-28-(hydroxy- cycloheptyl)-FK520128-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)- FK520, 8-deoxo-30-desmethoxy-31 -hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy- 30-c/'s-hydroxy-31-trans-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis- hydroxy-31-cis-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fcrans-hydroxy-31- frans-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-prolyl-FK520, 8- deoxo-30-O-desmethyl-prolyl-FK520, 8-deoxo-30-desmethoxy-30-methyl-prolyl- FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-methyl-prolyl-FK520, 8-deoxo-30- O-desmethyl-31-dehydroxy-31-fluoro-proiyl-FK520,8-deoxo-30-desmethoxy-30- fluoro-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -chloro-prolyl-FK520, 8-deoxo-30-desmethoxy-30-chloro-prolyl-FK520, 8-deoxo-30-O-desmethyl-31- dehydroxy-31-tert-butyl-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4- hydroxy-cyclohexyl)-28-{hydroxy-norbomyl)-prolyl-FK520,.30-desmethoxy-3-hydroxy- prolyl-FK520, 30-desmethoxy-30-cfe-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl- FK520,30-desmethoxy-30-cis-hydroxy-31 -cis-hydroxy-3-hydroxy-prolyl-FK520, 30- desmethoxy-30-trans-hydrbxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK520, 30-O- desmethyl-31-dehydroxy-3-hydroxy-prolyl-FK520,30-O-desmethyl-3-hydroxy-prolyl- FK520,30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31- dehydroxy-31-methyl-3-hydroxy-prolyl-FK520>30-O-desmethyl-31-dehydroxy-31- fluoro-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-fluoro-3-hydrow-prolyl-FK520, 30- O-desmethyl-31-dehydroxy-31-chloro-3-hydroxy-prolyl-FK520, 30-desmethoxy-30- chloro-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-3- hydroxy-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexy])-28-(hydroxy- cycloheptyl)-3-hydroxy-prolyl-FK520, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-norbornyl)-3-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-31-hydroxy-3- hydroxy-prolyl-FK520,8-deoxo-30-desmethoxy-30-c;s-hydroxy-31-trans-hydroxy-3- hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31 -cis-hydroxy-3- hydroxy-prolyl-FK520,8-debxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-3- hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-3-hydroxy-prolyl- FK520, 8-deoxo-30-O-desmethyl-3-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy- 30-methyl-3-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 - methyl-3-hydroxy-prolyl-FK520) 8-deoxo-30-O-desmethyl-31-dehydroxy-31-fluoro-3- hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-3-hydroxy-proiyl-FK520, 8- deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-chloro-3-hydroxy-3-hydroxy-pro!yl-FK520, 8-deoxo-30-O-desmethyl- 31 -dehydroxy-31 -terf-butyl-3-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4- hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK520, 8-deoxo-28- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK520, 30-desmethoxy-4-hydroxy-prolyl-FK520,30-desmethoxy-30-cis-hydroxy-31-trans- hydroxy-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4- hydroxy-prolyl-FK520,30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy- prolyl-FK520, 30-O-desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK520, 30-O- desmetbyM-hydroxy-prolyl-FK520, 30-desmethoxy-30-methyl-4-hydroxy-prolyl- FK520, 30-O-desmethyl-31-dehydroxy-31-methyl-4-hydroxy-prolyl-FK520, 30-O- desmethyl-31 -dehydroxy-31 -fluoro-4-hydroxy-prolyl-FK520, 30-desmethoxy-30- tluoro-4-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -chloro-4-hydroxy- prolyl-FK520, 30-desmethoxy-30-chloro-4-hydroxy-prolyl-FK520, 30-O-desmethyl-31 - dehydroxy-31 -tert-butyl-4-hydroxy-prolyl-FK5201 28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK520,28-de(3-methoxy-4- hydroxy-cyclohexyl>-28-(hydroxy-norbomyl)-4-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-31-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis- hydroxy-31-irans-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis- hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-trans- hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31- dehydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-. FK520, 8-deoxo-30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O- desmethyl-31 -dehydroxy-31 -methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O- desmethyl-31-dehydroxy-31:tluoro-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy- 30-fluoro-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -chloro- 4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-chloro-3-hydroxy-4-hydroxy- prolyl-FK520, 8-deoxo-30-O-desmethy^1 -dehydroxy-31 -ferf-butyl-4-hydroxy-prolyl- FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyO-28-(hydroxy-cycIoheptyl)-4- hydroxy-prolyf-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy- norbornyl)-4-hydroxy-prolyl-FK520,31-desmethoxy-fral7s-3-bicycloI3.1.0.JFK520, 31- desmethoxy-31-cis-hydroxy-32-trans-hydroxy-trans-3-bicyclo[3.1.0.]FK520, 31- desmethoxy-31-cis-hydroxy-32-cis-hydroxy-trans-3-bicyclo[3.1.0.]FK520, 31 - desmethoxy-31-trans-hydroxy-32-trans-hydroxy- desmethyl-32-dehydroxy-£rans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl-trans-3- bicyclop.1.0.]FK520>31-desmethoxy-31-methyWrans-3-bicycto[3.1.0.]FK520, 31-O- desmethyl-32-dehydroxy-32-methykrans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl- 32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31-fluoro-trans- 3-bicyclo[3.1.0.]FK520, 31 -O-desmethyl-32-dehydroxy-32-chloro-trans-3- bicyclot3.1.0.]FK520,31-desmethoxy-31-chloro-trans-3-bicyclo[3.1.0.]FK520, 31-O- desmethyl-32-dehydroxy-32-tert-butyl-trans-3-bicyclo[3.1.0.]FK520, 29-de(3- methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-trans-3- bicyclo[3.1.0.]FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy- norbornyl)-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31 -desmethoxy-trans-3- bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-&ial7S-hydroxy- frans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-desmethoxy-31-cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.JFK520, 9-deoxo-31-desmethoxy-31 -trans-hydroxy-32- frans-hydroxy-trans-3-bicyclo[3.1.0.]FK520I9-deoxo-31-O-desm6thy]-32-dehydroxy- frans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-methyl-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O- desmethyl-32-dehydroxy-32-methyl-tans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 -O- desmethyl-32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 - desmethoxy-31 -fluoro-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 -O-desmethyl-32- dehydroxy-32-chloro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-desmethoxy-31- chloro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-32-dehydroxy-32-feff- butyl-trans-3-bicyclo[3.1.0.JFK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-cycloheptyl)-fral7s-3-bicyclo[3.1.0.JFK520, 9-deoxo-29-de(3-methoxy-4- hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-trans-3-bicyclo[3.1.0.]FK520, In a more highly preferred embodiment, the present invention provides the following novel FK520 analogues: 31 -desmethoxy-31 -methyl-FK520, 31- desmethoxy-31.-fluon>FK520, 31-desmethoxy-31-chlon>FK520, 31-O-desmethyl-32- dehydroxy-32-ferf-butyl-FK520,29-de(3-methoxy-4-hydroxy-cycIohexyl)-29-(hydroxy- cycloheptyl)-FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)- FK520, 9-deoxo-31 -desmethoxy-31 -methyl-FK520, 9-deoxo-31 -desmethoxy-31 - fluoro-FK520,9-deoxo-31-desmethoxy-31-chloro-FK520, 9-deoxo-31-O-desmethyt- 32-dehydroxy-32-fert-butyl-FK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-cycloheptyl)-FK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-norbornyl)-FK520, 30-desmethoxy-30-methyl-prolyl-FK520, 30- desmethoxy-30-fluoro-prolyl-FK520, 30-desmethoxy-30-chloro-prolyl-FK520, 30- desmethyl-31-dehydroxy-31-ferf-butyl-prolyl-FK520, 28-de(3-rnethoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-cycloheptyl)-FK520, 28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbornyr)-FK520)8-deoxo-30-desmethoxii'-31-hydroxy- prolyl-FK520, 8-deoxo-3f>desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl- FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31 -cis-hydroxy-prolyl-FK520, 8- deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK520, 8-deoxo-30- O-desmethyl-31 -dehydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-prolyl-FK520, 8- deoxo-30-desmethoxy-30-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 - dehydroxy-31-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31- fluoro-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-prolyl-FK520, 8-deoxo-30-O- desmethyl-31 -dehydroxy-31 -chloro-proly)-FK520, 8-deoxo-30-desmethoxy-30-chloro- prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-terf-butyl-prolyl-FK520, 8- deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl- FK520,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)- prolyl-FK520,30-desmethoxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis- hydroxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy- 31 -cis-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30- hydroxy-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31-dehydroxy-3-hydroxy-prolyl- FK520, 30-O-desmethyl-3-hydroxy-prolyl-FK520,30-desmethoxy-30-methyl-3- hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl- FK520, 30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-pro!yl-FK520, 30- desmethoxy-30-fluoro-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 - chIoro-3-hydroxy-prolyl-FK520I30-desmethoxy-30-chloro-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -fe/t-butyl-3-hydroxy-prolyl-FK520,28-de(3- methoxy-4-hydroxy-cyclohexyl)-2S-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK520, 28- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK520, 8-deoxp-30rdesmethoxy-31-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-cis-hydroxy-31 -4rans-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-irans-hydroxy-31 -frar/s-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30- O-desmethyl-31 -dehydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-3- hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK5201 8- deoxo-30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl-FK520, 8-deoxo- 30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-fluoro-3-hydroxy-proly)-FK520, 8-deoxo-30-O-desmethyl-31 - dehydroxy-31-chloro-3-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-ch!oro-3- hydroxy^3-hydroxy-prolyl-FK520, 8-deoxo-3D-O-desmethyl-3lHJehydroxy-31-fe/t- butyl-3-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK520) 30-desmethoxy-4- hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy- prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK520, 30-O- desmethyl-31-dehydroxy-4-hydroxy-pro)yl-FK520, 3l>0-desmethyl-4-hydroxy-pro^ FK520, 30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK520,30-O-desmethyl-31 - dehydroxy-31-methyl-4-hydroxy-proIyl-FK520,30-O-desmethyl-31-dehydroxy-31- fluoro-4-hydroxy-prolyl-FK520,30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK520, 30- O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK520l 30-desmethoxy-30- chloro-4-hydroxy-prolyl-FK520,30-O-desmethyl-31-dehydroxy-31-fert-butyl-4- hydroxy-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy- cycloheptyl)-4-hydroxy-prolyl-FK520, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-norbornyl)-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-31 -hydroxy-4- hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4- hydroxy-prolyl-FK520) B-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4- hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-trans-hydroxy-31-frartS-hydroxy-4- hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-4-hydroxy-prolyl- . FK520, 8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy- 30-methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31- methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-fluoro-4- hydroxy-pro)yl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK520, 8- deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK520, 8-deoxo-30- desmethoxy-30-chloro-3-hydroxy-4-hydroxy-prolyl-FK520,8-deoxo-30-O-desmethyl- 31-dehydroxy-31~ferf-butyl-4-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4- hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK520, 8-deoxo-28- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-4-hydroxy-prDlyl-FK520r 31-desmethoxy-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31-cis-hydroxy-32- frans-hydroxy-£ral7S-3-bicyclo[3.1.0.]FK520,31 -desmethoxy-31 -cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.]FK520,31 -desmethoxy-31-trans-hydroxy-32-trans- hydroxy-trans-3-bicyclo[3.1.0.]FK520,31-O-desmethyl-32-dehydroxy-trans-3- bicyclo[3.1.0.]FK520, 31-O-desmethyMrans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy- 31-methyMrans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl-32-dehydroxy-32-methyl- Zrans-34)icyclo[3.1.0.)FK520, 31-O-desmethyl-32-dehydroxy-32-fluoro-foal7S-3- bicyclo[3.1.0.JFK520, 31-desmethoxy-31-fluorchfrans-3-bicyclo[3.1.0.JFK520, 31-O- desmethyl-32-dehydroxy-32-chloro-trans-3-b»cyclo[3.1.0.]FK520, 31-desmethoxy-31- chloro-trans-3-bicycio[3.1.0.]FK520, 31-O-desmethyl-32-dehydroxy-32-te/f-butyl- fral7S-3-bicyclo[3.1.0.]FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy- cycloheptyl)-£rans-3-bicyclo[3.1.0.JFK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-norbornyl)-trans-3-bicycio[3,1.0.JFK520, 9-deoxo-31 -desmethoxy-trans- 3-bicyclo[3.1.0.JFK52O, 9-deoxo-31 -desmethoxy-31 -c;s-hydroxy-32-trans-hydroxy- frans-3-bicyclo[3.1.0.]FK520, 9^deoxo-31-desmethoxy-31-cis-hydroxy-32-c/5- hydroxy-trans-3-bicyclo[3.1.0.]FK520I9-deoxo-31-desmethoxy-31-trans-hydroxy-32- frBns-hydroxy- trans-3-b)cyc\o[3.1.0.]FK520, 9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.JFK520, 9-deoxo-31-desmethoxy-31-methyWrans-3-bicyclo[3.1.0.JFK520,9-deoxo-31 -O- desmethyl-32-dehydroxy-32-methyl-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O- desmethyl-32-dehydroxy-32-fluoro-irans-3-bicyclo{3.1.0JFK520, 9-deoxo-31 - desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.JFK520, 9-deoxo-31-O-desmethyl-32- dehydroxy-32-chloro-irans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31- chioro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-32-dehydroxy-32-terf- butyMral?s-3-bicyclo[3.1.0.]FK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy- hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-trans-3-bicyclo[3.1.0.]FK520. In a further aspect the present invention provides the following FK506 analogues: 31-desmethoxy-FK506,31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy- FK506, 31-desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK506, 31-desmethoxy-31- frans-hydroxy-32-&-ans-hydroxy-FK506, 31-O-desmethyl-32-dehydroxy-FK506, 31-O- desmethyl-FK506, 31-desmethoxy-31-methyl-FK506,31-O-desmethyl-32-dehydroxy- 32-methyl-FK506,31-O-desmethyl-32-dehydroxy-32-fluoro-FK506>3l-desmethoxy- 31-fluoro-FK506, 31-O-desmethyl-32-dehydroxy-32-chloro-FK506, 31-desmethoxy- 31-chloro-FK506,31-O-desmethyl-32-dehydroxy-32-terf-butyl-FK506,29-de(3- methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK506, 29-de(3-methoxy-4- hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-FK506, 9-deoxo-31-desmethoxy-FK506, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK506, 9-deoxo-31- desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK506, 9-deoxo-31-desmethoxy-31- frans-hydroxy-32-trans-hydroxy-FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy- FK506,9-deoxo-31-O-desmethyl-FK566,9-deoxo-31-desmethoxy-31-methyl-FK506, 9-deoxo^31-O-desmethyl-32-dehydroxy-32-methyl-FK506, 9-deoxo-31-O-desmethyl- 32-dehydroxy-32-fluoro-FK506, 9-deoxo-31-desmethoxy-31-fluoro-FK506, 9-deoxo- 31-O-desmethyl-32-dehydroxy-32-chIoro-FK506,9-deoxo-31-desmethoxy-31-chloro- FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert-butyl-FK506, 9-deoxo-29- de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK506, 9-deoxo-29- de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbomyO-FK506,30-desmethoxy- prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-FK506, 30- desmethoxy-30-cis-hydroxy-31-cis-hydroxy-prolyl-FK506, 30-desmethoxy-30-trans- hydroxy-31-franJ^hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-prolyl-FK506, 30-O-desmethyl-prolyl-FK506, 30-desmethoxy-30-methyl-prolyl-FK506, 30-O- desmethyl-31-dehydroxy-31-methyl-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31- fluoro-prolyl-FK506, 30-desmethoxy-30-fluoro-prolyl-FK506, 30-O-desmethyl-31- dehydroxy-31 -chloro-prolyl-FK506, 30-desmethoxy-30-chloro-prolyl-FK506, 30-O- desmethyl-31 -dehydroxy-31 -te/f-butyl-prolyl-FK506,28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-cycloheptyl)-FK506, 28-de(3-methoxy-4-hydroxy- cycIohexyl)-28-(hydroxy-norbomyl)-FK506, 8-deoxo-30-desmethoxy-31-hydroxy- prolyl-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl- FK506, 8-deoxo-30ntesmethoxy-30-cis-hydroxy-31 -cis-hydroxy-prolyl-FK506, 8- deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK506, 8-deoxo-30- O-desmethyl-31 -dehydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-pro!yl-FK506, 8- deoxo-30-desmethoxy-30-methyl-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 - dehydroxy-31 -methyl-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 - fluoro-prolyl-FK506, 8-deoxo-30-desmethoxy-30-fluoro-prolyl-FK506, 8-deoxo-30-O- desmethyl-31-dehydroxy-31-chloro-prolyl-FK506, 8-deoxo-30-desmethoxy-30-chloro- prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-prolyl-FK506, 8- deoxo-28-de(3-methoxyr4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyO-prolyl- FK506, S-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)- prolyl-FK506, 30-desmethoxy-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis- hydroxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy- 31 -cis4iydroxy-3-hydroxy-prolyl-FK506, 3f>desmethoxy-30-£rans-hydroxy-31 -trans- hydroxy-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-3-hydroxy-prolyl- FK506, 30-O-desmethyl-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-methyl-3- hydroxy-prolyl-FK506,30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl- FK506, SO-O-desmethyl-SI-dehydroxy-SI-fluoro-S-hydroxy-prolyl-FKSOB, 30- desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506,30-O-desmethyl-3lKiehydroxy-31- chloro-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-chloro-3-hydroxy-proIyl-FK50B, 30-O-desmethyl-31-dehydroxyT31-terf-butyl-3-hydroxy-prolyl-FK506, 28-de(3- methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 2B- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-pro!yl-FK506, 8-deoxo-30-desmethoxy-31 -hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-cis-hydroxy-31-irans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-trans-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30- O-desmethyl-3l-dehydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-3- hydroxy-prolyl-FK506,8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 8- deoxo-SO-O-desmethyl-SI-dehydroxy-SI-methyl-S-hydroxy-prolyl-FKSOe.S-deoxo- 30-O-desmeth^31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30-Odesmethyl-31- dehydroxy-31-chloro-3-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-chloro-3- hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-terf- butyl-3-hydroxy-proly)-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK506, 30-desmethoxy-4- hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy- prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-cfe-hydroxy-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-trans-hydroxy-31 -trans-hydroxy-4-hydroxy-prolyl-FK506,30-O- desmethyl-31-dehydroxy-4-hydroxy-proIyl-FK506, 30-O-desmethyl-4-hydroxy-prolyl- FK506, 30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31- dehydroxy-31 -methyl-4-hydroxy-prolyl-FK506, 30-O-desmethjri-31 -dehydroxy-31 - fluoro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 30- 0-desmethyl-31 -dehydroxy-31 -chloro-4-hydroxy-prolyl-FK5D6, 30-desmethoxy-30- chloro-4-hydroxy-proIyl-FK506, 30-O-desmethyl-31 -dehydroxy-31 -terf-butyl-4- hydroxy-pro)yl-FK506l28-de(3-metboxy-4-hydroxy-cyclohexyl)-28-(hydroxy- cycloheptyl)-4-hydroxy-prolyl-FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-norbornyl)-4-hydroxy-proIyl-FK506, 8-deoxo-30-desmethoxy-31-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31 -lrans-hydroxy-4- hydroxy-prolyl-FK506,8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-4-hydroxy-prolyl- FK506, 8-deoxo-30-O-desmethyM-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy- 30-meth~yl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 - methyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-fluoro-4- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 8- deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-chloro-3-hydroxy-4-hydroxy-proiyl-FK506, 8-deoxo-3r>0-desmethyl- SI-dehydroxy-SI-tert-butyl-^hydroxy-prolyl-FKSOe, 8-deoxo-28-de(3-methoxy-4- hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK506, 8-deoxo-28- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-4-hydroxy-prolyl-FK506, 31-desmethoxy-fral7S-3-bicyclo[3.1.0.]FK506,31-desmethoxy-31-cis-hydroxy-32- frans-hydroxy-trans-3-bicyclo[3.1.0.]FK506,31-desmethoxy-31-cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy-31-trans-hydroxy-32-frBns- hydroxy-trans-3-bicyclo[3.1.0.JFK506, 31-O-desmethyl-32-dehydroxy-trans-3- bicyclo[3.1.0.JFK506, 31-O-desmethyWrans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy- 31 -methyl-trans-3-bicyclo[3.1.0.JFK506,31-O-desmethyl-32-dehydroxy-32-methyl- fral7s-3-bicyclo[3.1.0.JFK506, 31 -O-desmethyl-32-dehydroxy-32-fiuoro-fral7s-3- bicyclo[3.1.0.JFK506, 31-desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.JFK506, 31-O- desmethyl-32-dehydroxy-32-chloro-trans-3-bicyc)o[3.1.0.]FK506, 31 -desmethoxy-31 - chloro-trans-3-bicyclo[3.1.0.]FK506, 31-O-desmethyl-32-dehydroxy-32-terf-butyl- frans-3-bicyclo[3.1.0.]FK506, 29-de(3-methoxy-4-hydroxy-cycIohexyJ)-29-(hydroxy- cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506,29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-norbornyl)-f/ans-3-bicyclo[3.1.0.JFK506, 9-deoxo-31 -desmethoxy-trans- 3-bicyclo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31 -cis-hydroxy-32-trans-hydroxy- frans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31-cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31-irans-hydroxy-32- frans-hydroxy-fral?s-3-bicyclo[3.1.0JFK505, 9-deoxo-31 -O-desmethyl-32-dehydroxy- frans-3-bicyclo[3.1.0.JFK506,9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0JFK506, 9-deoxo-31-desmethoxy-31-methyWrans-3-bicyclo[3.1.0.3FK506,9-deoxo-31-O- desmethyl-32-dehydroxy-32-methyl-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-O- desmethyl-32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31- desmethoxy-31-fluoro-f/al7S-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32- dehydroxy-32-chIoro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31 -desmethoxy-31 - chloro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert- butyl-trans-3-bicyclo[3.1.0.JFK506, 9-deoxo-29-de(3-methaxy-4~hydroxy-cyclohexyl)- 29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4- hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-trans-3-bicyclo[3.3.0.]FK506, In a preferred embodiment, the present invention provides the following FK506 analogues: 31 -desmethoxy-31 -cis-hydroxy-3,2-trans-hydroxy-FK506, 31 -desmethoxy- 31-cis-hydroxy-32-cis-hydroxy-FK506,31-desmethoxy-31-trans-hydroxy-32-trans- hydroxy-FK506, 31-desmethoxy-31 -methyl-FK506, 31-O-desmethyl-32-dehydroxy- 32-terf-butyl-FK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy- cycloheptyl)-FK506, 29-de(3-methoxy-4-hydroxy-cycJohexyl)-29-(hydroxy-norbornyl)- FK506, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK506,9-deoxo- 31-desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK506, 9-deoxo-31-desmethoxy-31- frans-hydroxy-32-trans-hydroxy-FK506,9-deoxo-31-desmethoxy-31-methyl-FK506, 9-deoxo-31 -O-desmethyl-Sa-dehydroxy-Sa-te/f-butyl-FKSOe, 9-deoxo-29-de(3- methoxy-^-hydroxy-cyclohexyl^Q-^ydroxy-cycloheptylJ-FKSOB, 9-deoxo-29-de(3- methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-FK506,.30-desmethoxy-30- cis-hydroxy-31 -fral?s-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31 -cis- hydroxy-prolyl-FK506, 30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl- FK506,30-desmethoxy-30-methyl-prolyl-FK506,30-O-desmethyl-31-dehydroxy-31- fert-butyl-prolyl-FK506128-de(3-methoxy-4-hydroxy-c^clohexyl)-28^(hydroxy- cycloheptyl)-FK506,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)- FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-FK506, 8- deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-proIyl-FK506, 8-deoxo-30- desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-methyl-protyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-terf- butyl-prolyl-FK506,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy- cycloheptyl)-pro!yl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-norbornyl)-prolyl-FK506, 30-desmBthoxy-3-hydroxy-prolyl-FK506, 30- desmethoxy-30-cis-hydroxy-31-trans-hydroxy-3-hydroxy-pro)yl-FK506, 30- desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK506, 30-desmethoxy- 30-trans-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31- dehydroxy-S-hydroxy-prolyl-FKSOe.SO-O-desmethyl-S-hydroxy-proIyl-FKSOe, 30- desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31- methyl-3-hydroxy-prolyl-FK506,30-O-desmethyJ-31-dehydroxy-31-fluoro-3-hydroxy- prolyl-FK506, 30-desmethoxy-30-f!uoro-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31 - dehydroxy-31 -chloro-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-chloro-3-hydroxy- pro!yl-FK506, 30-O-desmethyl-31-dehydroxy-31-ferf-butyl-3-hydroxy-proiyl-FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl- FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-Qorbornyl)-3-hydroxy- prolyl-FK506, 8-deoxo-30-desmethoxy-31 -hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo- 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo- 30-desmethoxy-30-cfe-hydroxy-31-cis-hydroxy-3-hydroxy-proIyl-FK506, 8-deoxo-30- desmethoxy-SO-trans-hydroxy-SI-trans-hydroxy-S-hydroxy-prolyl-FKSOB, 8-deoxo-30- O-desmethyl-SI-dehydroxy-S-hydroxy-prolyl-FKSOe, 8-deoxo-30-O-desmethyl-3- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 8- deoxo-30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl-FK506, 8-deoxo- 30-O-desmethyl-31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 - dehydroxy-31-chloro-3-hydroxy-prolyl-FK506t 8-deoxo-30-desmethoxy-30-chloro-3- hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -tert- butyl-S-hydroxy-prolyl-FKSOe, 8-deoxo-28-de(3-methpxy-4-hydroxy-cyclohexyl)-28- (hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK506, 30-desmethoxy-4- hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy- prolyl-FK506, 30>desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-fral7S-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK506,30-O- desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK506, 30-O-desmethyl-4-hydroxy-prolyl- FK506, 30-desmethoxy-30-methyl-4-hydroxy-proiyl-FK506,30-O-desmethyl-31- dehydroxy-31-methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31- fluoro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 30- 0-desmethyl-31-dehydroxy-31-chIoro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30- chloro^-hydroxy-prolyl-FKSOe, 30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-4- hydroxy-prolyl-FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy- cycloheptyl)-4-hydroxy-prolyl-FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-norbornyl)-4^hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-31 -hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-3f>cis-hydroxy-31-trans-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-ffans-hydroxy-31-trans-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-4-hydroxy-prolyl- FK506,8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy- 30-methyf-4-hydroxy-prolyl-FK506,8-deoxo-30-O-desmethyl-31 -dehydroxy-31 - methyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -fluoro-4- hydroxy-proIyl-FK506, 8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 8- deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prQlyl-FK506, 8-deoxo-30- desmethoxy-30-chloro-3-hydroxy-4-hydroxy-prolyl-FK506,8-deoxo-30-O-desmethyl- 31-dehydroxy-31-fert-butyl-4-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4- hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK506, 8-deoxo-28- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-4-hydroxy-prolyl-FK5061 31 -desmethoxy-trans-3-bicyclo[3.1.0.JFK506, 31 -desmethoxy-31 -cis-hydroxy-32- frans-hydroxy-trans-3-bicycio[3.1.0.]FK506, 31-desmethoxy-31-cis-hydroxy-32-cis- hydroxy-trans-3-bicycio[3.1.0.]FK506, 31-desmethoxy-31-trans-hydroxy-32-trans- hydroxy-trans-3-bicyclo[3.1.0.JFK506,31 -O-desmethyl-32-dehydroxy-trans-3- bicyc)o[3.1.0.]FK506, 31-O-desmethyWrans-3-bicyclo[3.1.i).]FK50B, 31-desmethoxy- 31-me%kran^3-bicyclo[3.1.0JFK506,31-O-desmethyl-32-dehydroxy-32-methyl- frans-3-bicyclo[3.1.0.]FK506, 31-O-desmethyh32-dehydroxy-32-fluoro-trans-3- bicyclo[3.1.0.]FK506, 31-desmethoxy-31-fIuoro-trans-3-bicyclo[3.1.0.JFK506, 31TO- desmethyl-32-dehydroxy-32-chloro-trans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy-31- chloro-trans-3-bicycio[3.1.0.]FK506, 31-O-desmethyl-32-dehydroxy-32-terf-butyl- frans-3-bicyclo[3.1.0.JFK506, 29-de(3-methoxy-4-hydroxy-K;yclohexyl)-29-(hydroxy- cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506,29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-norbornyl)-frBns-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-frBns- 3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy- frans-3-bicydo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-cis- hydroxy-fral7S-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-trans-hydroxy-32- frans-hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-O-desmethyl-32-dehydroxy- frans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-methyl-trans-3-bicyclo[3.1.0JFK506,9-deoxo-31-O- desmethyl-32-dehydroxy-32-methyl-ffBns-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O- desmethyl-32-dehydroxy-32-fluoro-fral7S-3-bicyclo[3.1.0.JFK506, 9-deoxo-31 - desmethoxy-31-fluoro-trans-3-bicyclo[3.lO.]FK506, 9-dBoxo-31-O-desmethy^32- . dehydroxy-32-chloro-tral7S-3-bicyclot3.1.0.]FK506, 9-deoxo-31-desmethoxy-31- chloro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy-32-terf- butyl-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4- hydroxy-cyclohexyl)-29-(hydroxy-norbornyO-trans-3-bicyclo[3.1,0.]FK506. In a more highly preferred embodiment, the present invention provides the following FK506 analogues: 31-desmethoxy-31-methyl-FK506,31-O-desmethyl-32- dehydroxy-32-terf-butyl-FK506,29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy- cycloheptyl)-FK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)- FK506,!9-deoxo-31-desmethoxy-31-methyl-FK506,9-deoxo-3i-O-desmethyl-32- dehydroxy-32-tert-butyl-FK506,9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-29- (hydroxy-cycloheptyl)-FK506, 9-deoxo29-de(3-methoxy-4-hydroxy-cyclohexyl)-29- (hydroxy-norbornyl)-FK506,30-desmethoxy-30-methyl-prolyl-FK506, 30-O- desmethyl-31 -dehydroxy-31 -tert-butyl-prolyl-FK506, 28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-cycloheptyO-FK506, 28-de(3-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbomyl)-FK506, 8-deoxo-30-desmethoxy-30-methyl- prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-prolyl-FK506, 8- deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl- FK506,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)- prolyl-FK506, 30-desmethoxy-3-hydroxy-prolyl-FK506,30-desmethoxy-30-cis- hydroxy-31-franshydroxy-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy- 31-cfe-hydroxy-3-hydroxy-prolyl-FK506,30-desmethoxy-30-trans-hydroxy-31-trans- hydroxy-3-hydroxy-prolyl-FK506, 30-Odesmethyl-31-dehydroxy-3-hydroxy-prolyl- FK506,30-O-desmethyl-3-hydroxy-prolyl-FK506,30-desmethoxy-30-methyl-3- hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-methyl-3-hydroxy-prolyl- FK506, 3f>CVdesmethyl-31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 30- desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31- chloro-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-chloro-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31 -dehydroxy-31 -tert-birtyl-3-hydroxy-prolyl-FK506, 28-de(3- methoxy-4-hydroxy-cyclohexy()-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 28- de(3-methoxy-4-hydroxy-cydohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-31-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-cis-hydroxy-31-fcnans-hydroxy-3-hydroxy-prolyl-FK506,8-deoxo30- desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30- desrnethoxy-30-trans-hydroxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30- O-desmethyl-31-dehydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-3- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 8- deoxo-30-O-desmethyl-31-dehydroxy-31-methyl-3-hydroxy-prolyl-FK506, 8-deoxo- 30-O-desmethyl-31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-fluoro-3-hydroxy-protyl-FK506,8-deoxo-30-O-desmethyl-31 - dehydroxy-31-chloro-3-hydroxy-profyl-FK506, 8-deoxo-30-desmethoxy-30-chloro-3- hydroxy-3-hydroxy-prolyl-FK506, B-deoxo-30-O-desmethyl-31 -dehydroxy-31 -tert- butyl-3-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28- (hydroxy-cycloheptyO-S-hydroxy-prolyl-FKSOB, 8-deoxo-28-de^-methoxy-4-hydroxy- cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK506, 30-desmethoxy-4- hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy- prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK506, 30-O- desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK506, 30-O-desmethyl-4-hydroxy-prolyl- FK506,30-desm6thoxy-30-methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31 - dehydroxy-31 -methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31 -dehydroxy-31 - fluoro-4-hydroxy-prolyl-FK506,30-desmethoxy-30-fluoro-4-hydroxy-proiyl-FK506, 30- O-desmethyl-31 -dehydroxy-31 -chloro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30- chloro-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-terf-butyl-4- hydroxy-prolyl-FK506,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy- cycloheptylH^hydroxy-prolyl-FKSOB, 28-de(3-methoxy-4-:hydroxy-cyclohexyl)-28- (hydroxy-norbomyl)-4-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-31 -hydroxy-4- hydroxy-prolyl^K506,8-deoxo-3Cklesmethoxy-30-cis-hydroxy-31-frahs-hydroxy-4- hydroxy-proly(-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4- hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-4-hydroxy-prolyl- FK506, 8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy- 30-methyM-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31- methyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -fluoro-4- hydroxy-prolyl-FK506,8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506,8- deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK506, 8-deoxo-30- desmethoxy-30-chloro-3-hydroxyU-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl- 31-dehydroxy-31-terf-butyl-4-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4- hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK506,8-deoxo-28- de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-4-hydroxy-prolyl-FK506, 31 -desmethoxy-trans-3-bicyclo[3.1.0.JFK506,31 -desmethoxy-31 -cis-hydroxy-32- frans-hydroxy-fral7S-3-bicyc!o[3.1:0.]FK506, 31-desmethoxy-31-cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy-31-trans-hydroxy-32-f/ans- hydroxy-trans-3-bicyclo[3.1.0.JFK506,31 -O-desmethyl-32-dehydroxy-trans-3- bicyclo[3.1.0.IFK506,31-O-desmethyMrans-3-bicyclo[3.1.0.JFK5O6, 31-desmethoxy- 31-methyl-trans-3-bicyclo[3.1.0.]FK506,31-O-desmethyl-32-dehydroxy-32-methyl- frans-3-bicyclo[3.1.0.]FK506,31-C>-desmethyl-32-dehydroxy-32-f[uoro-fr3ns-3- bicyclo[3.1.0.]FK506, 31-desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.JFK506, 31-O- desmethyl-32-dehydroxy-32-chloro-iral)s-3-bicyclo[3.1.0.JFK506, 31 -desmethoxy-31 - chloro-&ans-3-bicyclo[3.1.0.]FK506)31-O-desmethyl-32-dehydroxy-32-tert-butyl- frans-3-bicyclo[3.1.0.]FK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy- cyc)oheptyl)^frans-3-bicyclo[3.1.0.JFK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-norbornyl)-^rans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-trans- 3-bicycIo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31-cis-hydroxy-32-fral7s-hydroxy- frans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31 -desmethoxy-31 -cis-hydroxy-32-cis- hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31 -desmethoxy-31 -trans-hydroxy-32- fral7S-hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31 -O-desmethyl-32-dehydroxy- frans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.JFK506, 9-deoxo-31 -desmethoxy-31 -methyMrans-3~bicyclo[3.1.0.JFK506, 9-deoxo-31 -O- desmethyl-32-dehydroxy-32-methyl-irans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O- desmethyl-32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0JFK506,9-deoxo-31- desmethoxy-31-fluoroHfrans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32- dehydroxy-32-ch!oro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31- chloro-&ans-3-bicyclot3.1.0.]FK506,9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert- butyl-trans-3-bicyclo[3.1.0.JFK506, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)- 29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4- hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-fralJs-3-bicyclo[3.1.0.JFK506. In further aspects the invention provides: A: Compounds of the formula: where: x = bond or CHR1,, or -CHFVx-CHrV is R15 = R1 = OH, OCH3 R2 = H, OH, OCH3 R3 = H, OH, CH3, F, CI, OCH3 R4 = H, OH, CH3, F, CI R5 = H, OH R6 = H, OH R7 = H R8=H, keto. R9 = H, keto R10 = H R11 = H R13 = H R14 = H R16 = OH, OCH3 R17 = H, OH, CI, F and y = bond, CH2 with the-proviso that the compounds do not include the following:: i) where R1 = OCH3 in combination with R2= H, R« = C, RIB = cis-3-OH, Rn7 = trans-4-OH, R5= H, R6= H, R7= H, R8= H, R9= H, Ri0= H, R„ = H, x = CHRn; ii) where R1 - OH in combination with R2= OCH3, R1E = C, R16 = cis-3-OH, R17= trans-A-OH, R5= H, R6= H, R7= H, RB,R9 = keto, R10= H Rin = H, x = CHRn,' iii) where Rt = OH in combination with R2 = OH, R16 = C, R16 = cis-3-OCH3, R17= trans-A-OH, R5= H, R6= H, R7= H, RB,RB =keto, R10= H, Rn = H, x = CHR11; iv) where Ri = OH in combination with R2 = H, RiS = C, R16 = cis-3-OCH3, R17 = trans-4-OH, R6= H, Re= H, R7= H, R8lR9 = keto, R10= H, Rn = H, x = CHR11; v) where R1 = OCH3 in combination with R2 = H, R15 = C, R16 = cis-3-OH, R17 = frans-4-OH, RB= H, Rs= H, R7= H, R8lR9 = keto, R10 = H, Rn = H, x = CHR11; vi) where R1 = OCH3 in combination with R2= H, R15 = C, Ri6 = cis-3-OCH3, Ri7= trans-4-OH, R6 = H, Re = H, R7 = H, R8 = H, R9 = H, R10 = H, R„ = H, x = CHRni vii) except where R1 = OCH3 in combination with R2 = OH, R15 = C, Ri6 = cis- 3-OCH3l R17= frans-4-OH, R5 = H, Re = H, R7 = H, R8 = H, R9 = H, R10 = H,R11 = H,x = CHRi1; vii0 where RA - OCH3 in combination with R2 = OCH3, R« = C, Ri6 - cisr3- OCH3, R17 = frans-4-OH, R5 = H, Re = H, R7 = H, R6 = H, R9 = H, R10 = H, R11 = H,x = CHR11; be) where R-, = OH in combination with R2 = OCH3, R16 = C, R16 = cis-3-OCH3, Ri7= trans-40H, R5 = H, R6 = H, R7 = H, R8\|R8 = keto, R10 = H, RM = H, x = CHR11; x) where R., = OCH3 in combination with R2 = OH, R15 = C, Ri6 = cis-3-OCH3, R17= trans-4-OH, R5 = H, R6 = H, R7 = H, RB,R9 = keto, R10 = H, R1n = H, x = CHR„; xi) where R1 = OCH3 in combination with R2 = H, R15 = C, R16 = cis-3-OCH3, R17= frans-4-OH, R5 = H, R6 = H, R7 = H, R8,R9 = keto, R10 = H, Ru = H, x = CHRni xii) where R-, = OCH3 in combination with R2 = OCH3, Rn5 = C, R16 = cis-3-OH, R17 = frans-4-OH, R5 = H, Re = H, R7 = H, R8,R9 = keto, R10 = H, R„ = H, x = CHRu; xiii) where R1 = OCH3 in combination with R2 = H, Ri5 = C, R16 = cis-3-OCH3, R17= trans-4-OH, R6 = H, R6 = H, R7 = H, Re = H, R9 = H, R10 = H, x = bond; xiv) where R1 = OCH3 in combination with R2 = OCH3, R15 = C, RiB = cis-3- OCH3, R17 = trans-4-OH, R5 = H, Re = H, R7 = H, R8 = H. R9 = H, R10 = H, x = bond; xv) where R1 = OCH3 in combination with R2 = OH, R15 = C, R16 = cis-3-OCH3) R17 = trans-A-OH, R5 = H, R6 = H, R7 = H, RB,R9 = keto, R1D = H, x = bond; xvi) where Rt = OCH3 in combination with R2 = H, R« = C, R16 = cis-3-OCH3, Ri7a trans-4-OH, R5 = H, Re = H, R7 = H, RB.RO = keto, R10 = H, x = bond; xvii) where Rn = OCH3 in combination with R2 = OCH3, R15 = C, R1e = H, R17 = OH, R5 = H, Re = H, R7 = H, R8\|R8 = keto, R10 = H, Rn = H, x = CHRu; xviii) where -CHRe-x-CHRu- is and R^ = H, R13 = H, R14 = H, in combination with Ri = OCH3, R2 = OCH3) R16 = C, R16 = cis-3-OCH3, R17 = trans-A-OH, R7 = H, R8, R9 = keto, R10 = H; xix) where R16 = G, R16 = c;s-3-OCH3, Ri7 = trans-A-OH, y = bond, in combination with Ri = OCH3, R2 = H, R5 = H, Re = OH, R7 = H, Rin = H, x = bond, RB,R9 = keto, R10 = H xx) where R16 = G, R3 = H, R4 = frans-OH, y = bond, in combination with Ri = OCH3, R2 = OCH3, R5 = H, Re = H, R7 = H, R-n = H, x = CHRu, RBIRS = keto, R10 = H xxi) where R15 = G, R3 = H, R4 = OH, y = CH2 in combination with R1 = OCH3, R2 = OCH3; R5 = H, R6 = H, R7 = H, R-n = H, x = CHRu, RB.RS = keto, R10 = H xxii) where Ri5 = G, R3 = cis-OH, R4 = H, y = bond, in combination with Ri = OCH3, R2 = OCH3, R5 = H, Re= H, R7 = H, Rn = H, x = CHRu, Re,Re = keto, R10 = H xxiii) where R15 = G, R3 = CH3, R4 = OH, y = bond, in combination with Rn = OCH3, R2 = OCH3, R5= H, Re= H, R7 = H, R-n = H, x = CHR11, RB,R9 = keto, R10 = H xxiv) where R15 = G, R3 = H, R4 = OH, y = CH2, in combination with Ri = OH, R2 = OH, R5 = H, Re = H, R7 = H, R^ = H, x = CHRu, RB=RS = H, R10 = H xxvjr where R16 = G, R3 = H, R4 = OH, y = CH2, in combination with R-, = OCH3, R2 = OCH3, Rg = H, Re = H, R7 = H, R11 = H, X = CHRu, R8=R9 = H, R10 = H xxvi) where R16 = G, R3 = H, R1 = OH, y - CH2, in combination with R1 = OH, R2 = OCH3, R5 = H, Re = H, R7 = H, Rn = H, x = CHR1,, R8=R9 = H, R10 = H xxvii) where R15 = G, R3 = H, R4 = OH, y = CH2, in combination with Ri = OH, R2 = H, R5 = H, Re = H, R7 = H, R^ = H, x = CHRu, Re=Rs = H, R10 = Hj xxviii) where R15 = G, R3 = H, R4 = OH, y = CH2, in combination with Ri = OH, R2 = OCH3, R5 = H, R6 = H, R7 = H, R„ = H, x = CHRu, R8,R9 = keto, R10 = H xxix) where R15= G, R3 = H, R4 = OH, y = CH2, in combination with R1 = OCH3, R2 = H, R5 = H, Re = H, R7 = H, R;i = H, x = CHR„, RBjR9 = keto, R10 = H B. Compounds according to the formula below where R, = OH, OCH3 R2 = H, OH, OCH3 R3 = H, OH, CH3, OCH3 R4 = H,OH R5 = H Re = H, OH R7 = H RB = H, keto R9 = H, keto Rio = H x = bonct, CH2 or -CHRe-x-CHRs- is Rn = H R13 = H Ri4 = H y = bond, CH2 with the proviso that the compounds do not include the following: 0 where R3 = H, R4 = trans-OH, y = bond, in combination with Rt = OCH3) R2 = OCH3l R6 = H, Re = H, R7 = H, x = CH2, R8)R9 = keto, R10 = H ii) where R3 = H, R4 = OH, y = CH2 in combination with R1 = OCH3, R2 = OCH3, R6 = H, R6 = H, R7 = H, x = CH2, iii) where R3 = cis-OH, R4 = H, y = bond, in combination with R-, = OCH3, R2 = OCH3, R5 = H, R6 = H, R7 = H, x = CH2, RB,R8 = keto, R10 = H iv) where R3 = CHS, R4 = OH, y = bond, in combination with Rn = OCH3, R2 = OCH3, R6 = H, R6 = H, R7 = H, x = CH2, R8,RB = keto, R10 = H v) where R3 = H, R» = OH, y = CH2, in combination with R1 = OH, R2 = OH, R5 = H, Re = H, R7 = H, x= CH2l R8=R9 = H, R10 = H vi) where R3 = H, R4 = OH, y = CH2, in combination with R^ = OCH3, R2 = OCH3, R5 = H, Re = H, R7 = H, x = CH2, RB=R9 ~ H, R10 = H vii) where R3 = H, R4 = OH, y = CH2, in combination with R., = OH, R2 = OCH3, R5 = H, Re = H, R7 = H, x = CH2l R8=R9 — H, R10 = H viii) where R3 = H, R4 = OH, y = CH2, in combination with R^ = OH, R2 = H, R5= H, Re = H, R7 = H, x = CH2l R8=R9= H, R10 — H; ix) where R3 = H, R4 = OH, y = CH2, in combination with R1 = OH, R2 = OCH3, R5 = H, R6 = H, R7 = H, x = CH2, R8,R9 = keto, R10 = H x) where R3 = H, R4 = OH, y = CH2, in combination with R1 = OCH3, R2 = H, R5 = H, Re = H, R7 = H, x = CH2, RB,RB = keto, R10 = H xi) where R3 = OCH3, R4 = OH, y = bond, in combination with R1 = OCH3, R2 = H, R5 = H, R6 = OH, R7 = H, x = bond, RB,R9 = keto, R10 = H xii) where -CHRe-x-CHRs- is and Rn = H, R13 = H, Ru = H, in combination with Rn = OCH3, R2 = OCH3, R3 = OCH3, R4 = OH, R7 = H, RB,R9 = keto, R10 = H xiii) where Ri = OCH3 in combination with R2 = H, R3 = OCH3, R4= OH, R6 = H, Re = H, R7 = H, R8 = H, R6 = H, R10 = H, x = bond, y = bond xiv) where Ri = OCH3 in combination with R2 = OCH3, R3 = OCH3, R4= OH, R5 = H, R6 = H, R7 = H, R8 = H, R9 = H, R10 = H, x = bond, y = bond xv) where R1 = OCH3 in combination with R2 = OH, R3 = OCH3, R4 = OH, Rs = H, R6 = H, R7 = H, R8,R9 = keto, R10 = H, x = bond, y = bond xvi) where Ri = OCH3 in combination with R2 = H, R3 = OCH3, R4 = OH, Rs = H, R5 = H, R7 = H, R^Rg = keto, R10 = H, x = bond, y = bond xvii) where R1 = OCH3, R2 = H, R5 = OH, R4 = OH, R5 = H, R9 = H xviii) where R1 = OCH3, R2 = H, Rg = OCH3> R4 = OH, R8 = H, R9 = H xix) where Ri = OCH3) R2 = H, R3 = OH, R» = OH, RB,R9 = keto xx) where R1 = OH, R2 = OH, R5 = OCH3, R4 = OH, RB,R9 = keto xxi) where R^ = OCH3, R2 = OCH3, R3 = OH, R4 = OH, R8,R9 = keto xxii) where R1 = OCH3, R2 = OH, R5 = OCH3, R4 = OH, R„,R9 = keto xxiii) where R1 = OCH3, R2 = OCH3, R3 = OCH3, R4 = OH, R5 = H, R8 = H C. A compound selected from the group consisting of. 9-deoxo-16-O- desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre-rapamycin), 9-deoxo-16- 0-desmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin, 16-O-desmethyl-27- desmethoxy-39-O-desmethyl-rapamycin, 9-deoxo-16-O-desmethyl-39-O-desmethyl- rapamycin , 9-deoxo-16-O-desmethyl-27-desmethoxy-raparnycin , 16-O-desmethyl- 27-O-desmethyl-39-O-desmethyl-rapamycin, 9-deoxo-27-O-desmethyl-39-O- desmethyl-rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-rapamycin , 27-O- desmethyl-39-O-desmethyl-rapamycin, 9-deoxo-16-O-desmethyl-rapamycin , 9- deoxo-39-O-desmethyl-rapamycin , 8-deoxo-15-O-desmethyl-26-desmethoxy-38-O- desmethyl-prolylrapamycin (pre-prolylrapamycin), 8-deoxo-15-O-desmethyl-26-O- desmethyl-38-O-desmethyl-prolylrapamycin, 15-O-desmethyl-26-desmethoxy-38-O- desmethyl-prolylrapamycin, 8-deoxo-26-desmethoxy-38-O-desmethyl- prolylrapamycin , 8-deoxo-15-O-desmethyl-38-O-desmethyl-prolylrapamycin , 8- deoxo-15-O-desmethyl-26-desmethoxy-prolylrapamycin, 15-O-desmethyl-26-O- desmethyl-38-O-desmethyl-prolylrapamycin, 8-deoxo-26-O-desmethyl-38-O- desmethyl-prolylrapamycin, 8-deoxo-15-O-desmethyl-26-O-desmethyl- prolylrapamycin , 15-O-desmethyl-38-O-desmethyl-prolylrapamycin , 15-O- desmethyl-26-O-desmethyl-prolylrapamycin, 15-O-desmethyl-26-desmethoxy- prolylrapamycin, 26-desmethoxy-38-O-desmethyl-prolylrapamycin, 26-O-desmethyl- 38-O-desmethyl-prolylrapamycin , 8-deoxo-15-O-desmethyl-prolylrapamycin , 8- deoxo-26-O-desmethyl-prolylrapamycin, 8-deoxo-38-O-desmethyl-prolylrapamycin, 15-O-desmethyl-prolylrapamycin , 38-O-desmethyl-prolylrapamycin , 9-deoxo-16-O- desmethyl-27-desmetiioxy-39-desmethoxy-rapamycin, 9-deoxo-16-O-desmethyl-27- O-desmethyl-39-desmethoxy-rapamycin, 16-O-desmethyl-27-desmethoxy-39- desmethoxy-rapamycin, 9-deoxo-27-desrnethoxy-39-desmethoxy-rapamycin, 9- deoxo-16-O-desmethyl-39-desmethoxy-rapamycin, 16-O-desmethyl-27-O- desmethyl-39-clesmethoxy-rapamycin, 9-deoxo-27-O-desmethyl-39-desmethoxy- rapamycin , 16-O-desmethyl-39-desmethoxy-rapamycin , 27-desmethoxy-39- desmethoxy-rapamycin, 27-O-desmethyl-39-desmethoxy-rapamycin , 9-deoxo-39- desmethoxy-rapamycin, B-deoxo-15-O-desmethyl-26-desmethoxy-38-desmethoxy- prolylrapamycin, 8-deoxo-15-O-desmethyl-26-O-desmethyl-38-desmethoxy- prolylrapamycin, 15-O-desmethyl-26-desmethoxy-38-desmethoxy-prolylrapamycin, 8-deoxo-26-desmethoxy-38-desmethoxy-prolylrapamycin, 8-deoxo-15-O-desmethyl- 38-desmethoxy-proly)rapamycin, 15-O-desmethyl-26-O-desmethyl-38-desmethoxy- proiylrapamycin , 8-deoxo-26-O-desmethyl-38-desmethoxy-proIylrapamycin , 15-O- desmethyl-38-desmethoxy-prolylrapamycin, 26-desmethoxy-38-desmethoxy- prolylrapamycin , 26-O-desmethyl-38-desmethoxy-prolylrapamycin , 8-deoxo-38- desmethoxy-prolylrapamycin, 38-desmethoxy-prolylrapamycin, 9-deoxo-16-0 desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36- (hydroxycyclohexenyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3- cis-methoxy-4-trans-hydroxycyclohexyl)-36-(dihydroxy cyclohexyl) rapamycin, 9- deoxo-16-O-desmethyl-27-desm6thoxy-36-de(3-cis-methoxy-4-trans- hydroxycyclohexyl)-36-(hydroxynorbornyl) rapamycin, 9-deoxo-16-O-desmethyl-27- desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-methyl-4- hydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3- cis-methoxy-4-trans-hydroxycyclohexyl)-36-(4-methylhydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desme&iyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans- hydroxycyclohexyl)-36-{3-fluoro-4-hydroxycyclohexyl) rapamycin, 9-deoxo-16-O- desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3- hydroxy-4-fluorocyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36- de(3^is-methoxy-4-trans-hydroxycyclohexyl)-36-(3-chloro-4-hydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans- hydroxycyclohexyl)-36-(3-hydroxy-4-chlorocycloh6xyl) rapamycin, 9-deoxo-16-O- desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3- cis-4-cis-dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy- 36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-trans-4-trans- dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-39-O- desmethyl rapamycin, 9-deoxo-16-O-desmethyl-270-desmethyl-36-de(3-cis- methoxy-4-trans-hydroxycyclohexyl)-36-(hydroxycyclohexenyl) rapamycin, 9-deoxo- 16-O-desmethy)-27-O-desmethyl-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)- 36-(hydroxynorbomyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-36- de(3-cis-methoxy-4-trans-hydroxycyciohexyl)-36-(4-methylhydroxycyclohexyl) rapamycin. In a specific embodiment the present invention describes methods to produce and optionally isolate the following compounds (Figure 10, Figure 11, Figure 12, Figure 13, and Figures 14,15,16 and Figure 17): In a further aspect, the invention provides novel rapamycin analogues of where x = bond or CHRu, or -CHRs-x-CHRr is y = bond or CHR12 Ri= OH, OCH3 R2= H, OH, OCH3 Rr= H, OH, OCH3, alkyl-, halo-, amino-, thiol- residue R= H, OH, OCH3, alkyh halo-, amino-, thiol- residue R5= H, alkyl-, halo-, hydroxy- residue RB= H, alkyl-, halo-, hydroxy- residue R7= H, alkyl-, halo-, hydroxy- residue Rs,Rfi= =OorH,H Rio= H, alkyl-, halo-, hydroxy- residue Rn= H, alkyl-, halo-, hydroxy- residue R12= H, alkyl-, halo-, hydroxy-residue Ri3= H, alkyl-, halo-, hydroxy- residue R14= H, alkyl-, halo-, hydroxy- residue Additionally, the present invention also provides novel rapamycin analogues of where: x = bond or CHRu, or -CHRrx-CHRjr is R,= OH, OCH3 R2= H, OH, OCH3 R6= H, alkyl-, halo-, hydroxy- residue Re= H, alkyl-, halo-, hydroxy- residue R7= H, alkyl-, halo-, hydroxy- residue R8,R9= =OorH,H R10= H, alkyl-, halo-, hydroxy- residue Rn= H, alkyl-, halo-, hydroxy- residue R12= H, alkyl-, halo-, hydroxy-residue R13= H, alkyl-, halo-, hydroxy- residue R14= H, alkyl-, halo-, hydroxy- residue The novel rapamycin analogues are useful directly, and as templates for further semi-synthesis or bioconversion to produce compounds useful, as immunosuppressants, antifungal agents, anticancer agents, neuroregenerative agents or agents for the treatment of psoriasis, rheumatoid arthritis, fibrosis and other hyperproliferative diseases. Therefore in a further aspect, the present invention provides use of the FKBP- iigand analogues generated in the manufacture of a medicament for the treatment of cancer, the treatment of fungal infections, the treatment of autoimmune, inflammatory, proliferative and hyperproliferative diseases or the maintenance of immunosuppression. One skilled in the art would be able by routine experimentation to determine the ability of these compounds to inhibit fungal growth {e.g. Baker, H., et al., 1978; NCCLS Reference method for broth dilution antifungal susceptibility testing for yeasts: Approved standard M27-A, 17(9). 1997), and for example but without limitation using the methods described in Example 19. Additionally, one skilled in the art would be able by routine experimentation to determine the ability of these compounds to inhibit tumour cell growth, for example but without limitation using the methods described in Example 19, (also see Dudkin, L, et al., 2001; Yu et at. 2001). In a further aspect the compounds of this invention are useful for inducing immunosuppression and therefore relate to methods of therapeutically or prophylactically inducing a suppression of a human's or an animal's immune system for the treatment or prevention of rejection of transplanted organs or tissue, the treatment of autoimmune, inflammatory, proliferative and hyperproliferative diseases (examples include but are not inclusively limited to autoimmune diseases, diabetes type I, acute or chronic rejection of an organ or tissue transplant, asthma, tumours or hyperprolific disorders, psoriasis, eczema, rheumatoid arthritis, fibrosis, allergies and food related allergies). Such assays are well known to those of skill in the art, for example but without limitation: Immunosuppressant activity - Warner, LM.,et al., 1992, Kahan et al. (1991) & Kahan & Camardo, 2001); Allografts - Fishbein, T.M., et al., 2002, Kirchner et al. 2000; Autoimmune / Inflammatory / Asthma - Carlson, R.P. et al., 1993, Powell, N. et al., 2001; Diabetes I - Rabinovitch, A. et al., 2002; Psoriasis - Reitamo, S. et al., 2001; Rheumatoid arthritis - Foey, A., et al., 2002; Fibrosis - Zhu, J. et al., 1999, Jain, S., et al., 2001, Gregory et al. 1993 The ability of the compounds of this invention to induce immunosuppression may be demonstrated in standard tests used for this purpose, for example but without limitation using the methods described in example 19.-In a further aspect the compounds of this invention are useful in relation to antifibrotic, neuroregenerative and anti-angiogenic mechanisms, one skilled in the art would be able by routine experimentation to determine the ability of these compounds to prevent angiogenesis (e.g. Guba, M.,et al., 2002,). One of skill in the art would be able by routine experimentation to determine the utility of these compounds in stents (e.g. Morice, M.C., et al., 2002). Additionally, one of skill in the art would be able by routine experimentation to determine the neuroregenerative ability of these compounds (e.g. Myckatyn, T.M., et al., 2002, Steiner et al. 1997) Brief description of the/Figures ' \J \N v Figure 1 Structure of rapamycin, the sections to the left of the line represent the binding domain and those to the right indicate the effector domain. Figure 2 Structure of rapamycin (A), FK-506 (B), FK-520 (C) and meridamycin (D) Figure 3 Plasmid map of pMG55, a double recombination vector with RpsL positive selection and oriT for conjugation. Figure 4 A flow chart demonstrating the cloning strategy for the isolation of pMAG144-16 to create MG2-10. Figure 5 Overview over the gene cassettes Figure 6 Structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl rapamycin Figure 7 Structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl prolylrapamycin Figure 8 Structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy rapamycin Figure 9 Structure of 16-O-desmethyl-27-desmethoxy rapamycin Figure 10 Structures of compounds 1,2,4, 5,6, 8, 9,15,16,17,18 and 19 Figure 11 Structures of compounds 3,7,10,11,12,13,14, 20, 21, 22 and 23 Figure 12 Structures of compounds 24,25, 27, 28,29, 31, 32, 38, 39,40,41 and 42 Figure 13 Structures of compounds 26,30, 33,34,35,36, 37,43, 44, 45, and 46 Figure 14 Structures of compounds 47,48, 50, 51, 53 and 57 Figure 15 Structures of compounds 49, 52, 54, 55, 56, and 58 Figure 16 Structure of compounds 61, 64,66, 67, 68, and 70 Figure 17 Structure of compounds 59, 60,62,63, 65, and 69 Figure 18 Pre-rapamycin heteronuclear multiple bond coherence HMBC Figure 19 Pre-rapamycin heteronuclear multiple quantum coherence HMQC Figure 20 Pre-rapamycin correlation spectroscopy (COSY) indicated by solid arrows, Pre-rapamycin total correlation spectroscopy (TOCSY) indicated by dotted arrows. Figure 21 Corrections in the DNA sequence of rapN, the corrected sequence is shown on top (SEQ ID NO: 1) and the published sequence (ace no: X86780, nt 91764-92978) is shown underneath (SEQ ID NO: 2). Figure 22 Corrections in the amino acid sequence of RapN, the corrected sequence is shown on top (SEQ ID NO: 3) and the published sequence (ace no: X86780) is shown underneath (SEQ ID NO: 4). Figure 23 Corrections in the DNA sequence of rapM, the corrected sequence is shown on top (SEQ ID NO: 5) and the published sequence (ace no: X86780, nt 92992-93945 complement) is shown underneath (SEQ ID NO: 6). Figure 24 Corrections in the amino acid sequence of RapM, the corrected sequence is shown on top (SEQ ID NO: 7) and the published sequence (ace no: X86780) is shown underneath (SEQ ID NO: 8). Figure 25 Corrections "m the DNA sequence of rapL, the corrected sequence is shown on top (SEQ ID NO: 9), the published sequence (ace no: X86780, nt 94047-95078 complement) is shown at the bottom (SEQ ID NO: 10). Figure 26 Corrections in the amino acid sequence of RapL, the corrected sequence is shown at the top (SEQ ID NO: 11) and the published sequence (ace no: X86780) is shown underneath (SEQ ID NO: 12) Figure 27 Corrections in the DNA sequence of rapK, the corrected sequence is shown at the top (SEQ ID NO: 13) and the published sequence (ace no: X86780, nt 95430-96434) is shown at the bottom (SEQ ID NO: 14). Figure 28 Corrections in the amino acid sequence of RapK, the corrected sequence is shown at the top (SEQ ID NO: 15) and the published sequence (ace no: X86780) is shown underneath (SEQ ID NO: 16). Figure 29 Corrections in the DNA sequence of rapJ, the corrected sequence is shown at the top (SEQ ID NO: 17) and the published sequence (ace no: X86780, nt 96465-97625) is shown at the bottom (SEQ ID NO: 18). Figure 30 Corrections in the amino acid sequence of RapJ, the corrected sequence is shown at the top (SEQ ID NO: 19) and the published sequence (ace no: X86780) is shown underneath (SEQ ID NO: 20). Figure 31 Corrections in the DNA sequence of rapl, the corrected sequence is shown at the top (SEQ ID NO: 21) and the published sequence (ace no: X86780, nt 97622-98404) is shown at the bottom (SEQ ID NO: 22). Figure 32 Corrections in the amino acid sequence of Rapl, the corrected sequence is shown at the top (SEQ ID NO: 23) and the published sequence (ace no: X86780) is shown underneath (SEQ ID NO: 24). Figure 33 Corrections in the DNA sequence of rapQ, the corrected sequence is shown at the top (SEQ ID NO: 25) and the published sequence (ace no: X86780, nt 90798-91433) is shown at the bottom (SEQ ID NO: 26). Figure 34 Corrections in the amino acid sequence of RapQ, the corrected sequence is shown at the top (SEQ ID NO: 27) and the published sequence (ace no: X86780) is shown underneath (SEQ ID NO: 28). Figure 35 A flow chart demonstrating the cloning strategy for the isolation of pMG278-1 to create MG3. Figure 36 A flow chart demonstrating the cloning strategy for the isolation of pMG267-1 to create MG4. Materials and Methods Materials All molecular biology enzymes and reagents were from commercial sources. D/L pipecolic acid was obtained from Sigma. Starter materials Table IV summarises the sources of the acids used in the feeding experiments described in the Examples section. For those compounds that were purchased det alls of the source are given. A brief synthetic method is given for those starter acids that were synthesised in house. A person of skill in the art will appreciate that variations on the methods described are routine and are within the scope of the present invention. WO 2004/007709 PCT/GB2003/003230 Acid Company Stock number synthesis 3-cis-cyclohexeneoxide carboxylic acid in house, Method A Mixture of 3,4-cis- dihydroxycyclohexane carboxylic acid and 3,4-trans- dihydroxycyclohexane carboxylic acid in house, Method D Cyclohexaneacetic acid Aldrich C10,450-7 Cyclohexanepropionic acid Aldrich 16,147 4-cis/trans-fe/f-butylcyclohexane carboxylic acid Aldrich 37,493-8 OH Synthesis of 3-cis,4-trans-dihydroxycyclohexane carboxylic acid Q _ J> o HQ KOH HO° THF/H20 Racemic 3-cis,4-trans-dihydroxycyclohexane carboxylic acid was readily attainable from commercially available racemic 3-cyclohexene carboxylic acid. This acid was epoxidised through treatment with /wete-chloroperbenzoic acid and converted to the lactone in situ by the addition of base (triethylamine), thus setting up the relative stereochemistries. This lactone was then hydrolysed by the action of aqueous potassium hydroxide, and the final product purified over ion exchange resin, (see PAS Lowden Thesis 1997, Corey, E. J. and Huang, H., 1989). Method A: 0H Et3N- IBCF HOCH2CH2SiMe3 A 9 Epoxides A and B were synthesised by standard steps. Cyclohex-3-ene carboxylic acid was protected with 2-trimethylsilylethanol following activation with isobutylchloroformate and triethylamine. The resultant ester was treated with meta- chloroperbenzoic acid and the resultant racemic mix of diastereomers separated on normal phase silica. The epoxides were either reacted on (see below) or deprotected directly by the treatment of trifluoroacetic acid, to liberate the respective free acids. 86 ! A protected epoxide was treated with anhydrous HF-pyridine to effect the ring opening to produce a pair of racemic regiomers, containing F and OH in a trans arrangement (as previously demonstrated for cyclohexene oxide). The esters were then deprotected with trifluoroacetic acid to liberate the free acids, (see Welch, J. T. and Seper, K., W., 1988) A protected epoxide was treated with concentrated hydrochloric acid suspended organic solvent to affect the ring opening to produce a pair of racemic regiomers, containing CI and OH in a trans arrangement (as previously demonstrated for cyclohexene oxide). The esters were then deprotected with trifluoroacetic acid to liberate the free acids, (see Chini, M., Crotti, P., et al., 1992) cis-dihydroxylcyclocarboxylic acids were generated by treating protected epoxides with a catalytic amount of osmium tetraoxide together with a co-oxidant. The esters were then deprotected with trifluoroacetic acid to liberate the free acids. Bacterial strains and growth conditions Escherichia coli DH10B (GibcoBRL) was grown in 2xTY medium as described by Sambrook et al. (1989) and E. coli ET12567(pUB307) as described in MacNeil et al. (1992) and E. coli ET12567(pUZ8002) as described in Paget et al. (1999) in 2xTY medium with kanamycin (25 ng/ml). The vectors pUC18 and Litmus28 were obtained from New England Biolabs. Vector pSET152 is described in Bierman et al., (1992a). E. coli transfbrmants were selected for with 100 jig/ml ampicillin or 50 ng/ml apramycin. The rapamycin producer S. hygroscopicus ATCC29253 and its derivatives were maintained on medium 1 agar plates (see below) at 26°C, and cultivated in TSBGM (Tryptic Soy Broth with 1.0 % glucose and 100 mM MES, pH 6.0) as described in (Khaw et al., 1998), supplemented with 100 pg/ml apramycin when required. Liquid cultures were grown at 25°C in side-baffled Erlenmeyer flasks with shaking at 300 rpm. The streptomycin resistant mutant S. hygroscopicus MG1C was selected using standard procedures and maintained on medium 1 with streptomycin (50\|ig/ml). Feeding methods: Spore stocks of all strains were prepared after growth on medium 1, preserved in 20% w/v glycerols 0% w/v lactose in distilled water and stored at -80 °C. Vegetative cultures were prepared by inoculating 100^ of frozen stock into 50ml medium 6 in 250ml flask. The culture was incubated for 36 to 48 hours at 28 °C, 250rpm. Feeding procedure: Vegetative cultures were inoculated at 0.5 ml into 7ml medium 7 in 50ml tubes. Cultivation was carried out for 7 days, 26°C, 250rpm. The feeding/addition of the selected carboxylic acids ("non-natural starters" or "natural starters") were carried out at 24 and 48 hours after inoculation and were fed at 1mM or 3mM. Description of Strains All strains shared the wild type morphology, with cream vegetative mycelia, white aerial hyphae, developing grey spores turning black and characteristically hygroscopic. Preferably spores for use in the generation of the recombinant strains as described herein were dark grey in colour, as defined in Fan 4, 202 C to B, more preferably they are as defined in Fan 4, 202 B (Royal Horticultural Society Colour Chart 2001, available from The Royal Horticultural Society, 80 Vincent Square, London, SW1P2PE). DAM manipulation and sequencing DNA manipulations, PCR and electroporation procedures were carried out as described in Sambrook et al. (1989). Southern hybridisations were carried out with probes labelled with digoxigenin using the DIG DNA labelling kit as described by the manufacturer (Boehringer Mannheim). DNA sequencing was performed as described previously (Gaisser et al., 2000). Fermentation of Streptomyces hygroscopicus strains. Streptomyces hygroscopicus strains were cultured from a frozen spore stock in cryopreservative (20% glycerol; 10% lactose w/v in distilled water) on Medium 1 (see Materials and Methods) and spores were harvested after 10-20 days growth at 29°C. Alternatively, spores from frozen working stocks were inoculated directly into pre-culture medium. A primary pre-culture was inoculated with the harvested spores and cultured in 250 ml Erlenmeyer flasks containing 50 ml Medium 6 (see Materials and Methods), shaken at 250 rpm with a two-inch throw, at 30°C, for two days. The primary pre-culture was used to inoculate secondary pre-cultures of Medium 6 (see Materials and Methods), at 10% v/v, which was shaken at 300 rpm with a one-inch throw, at 28°C, for a further 24h. Secondary pre-cultures were used to inoculate, at 10% v/v, production Medium 8 (see Materials and Methods) containing 0.01% v/v SAG 417 antifoam and allowed to ferment in a stirred bioreactor for five to seven days at 26°C. Airflow was set to 0.75 wm, over pressure at 0.5 bar and the impeller tip speed was controlled between 0.98 ms1 and 2.67 ms"1. Additional SAG 417 was added on demand. pH was controlled at 6 - 7 with ammonium (10% v/v) or sulphuric acid (1 M) and glucose solution (40% w/v) was drip fed on initiation of ammonium demand. Extraction and High Performance Liquid Chromatography (HPLC) analysis Method Centrifugation was carried out on 50 ml of the fermentation broth and the supernatant and the mycelium were extracted separately as follows. The mycelia were washed with H20 and extracted with 50 ml of methanol for 16 hours at 4°C. The cell debris was removed by centrifugation, the methanol evaporated to dryness then dissolved in 200 yl methanol. The supernatant of the fermentation broth was extracted twice with an equal volume of ethyl acetate. The organic layer was dried over Na2S04, evaporated to dryness and then dissolved in 200 µl methanol. HPLC analysis was performed on a Hewlett Packard HP1100 liquid chromatograph with variable wavelength detector or a Finnigan MAT LCQ (Finnigan, CA) instrument. High-resolution spectra were obtained on a Bruker BioApex IIA J T Fourier Transform-Ion Cyclotron Resonance (FT-ICR) mass spectrometer (Bruker, Bremen, FRG). For NMR analysis, the bacterial broth was centrifuged, the supernatant extracted with three equal volumes of ethylacetate and the myWia extracted with methanol as described above. The extracts were combined, dried (Na2S04) and evaporated under reduced pressure to yleld a white solid. Proton detected NMR spectra (1H, DQF-COSY, TOCSY, HMQC, HMBC, NOESY) were recorded on a Bruker Advance DRX500 spectrometer which operated at 500 MHz at 27 °C, with the exception of example 6, where the Bruker Advance DRX500 spectrometer was operated at 500 MHz at 10°C. Chemical shifts are described in parts per million (ppm) on the 8 scale and are referenced to CHCI3 at 5H 7.26 (1H) and CHCI3 at 8C 77.0 (13C). J values are given in Hertz (Hz). Extraction, isolation and analysis protocols (B). Extraction and purification protocol: The fermentation broth was clarified by centrifugation to provide supernatant and cells. The supernatant was applied to a column (16x15 cm) of Diaion* HP20 resin (Supelco), washed with water followed by 75% MeOH/H20 and then eluted with MeOH. The cells were mixed to homogeneity with an equal volume of acetone. After at least 30 minutes the acetone slurry was clarified by centrifugation and the supernatant decanted. The pelleted cells were similarly extracted twice more with acetone. The acetone extract was combined with the MeOH from the HP20 column and the solvent was removed in vacuo to give an aqueous concentrate. The aqueous (typically 1-2 L) was extracted with EtOAc (3x1-2 L) and the solvent removed in vacuo to give an oily crude extract (typically 20 g). The oily residue was dissolved in a minimal volume of EtOAc and dried onto silica. The coated silica was applied to a silica column (400g, 36 x 6 cm) that was eluted sequentially with acetone/hexane mixtures ranging from 25% acetone initially to 100% acetone. The fractions containing rapamycin analogues were identified by HPLC (280 nm) using conditions described within. The rapamycin analogue-containing fractions were combined and the solvent was removed in vacuo. The residue was further chromatographed over Sephadex LH20, eluting with 10:10:1 chloroform/heptane/ethanol. The semipurified rapamycin analogues were purified by reverse phase (C18) high performance liquid chromatography using a Gilson HPLC, eluting a Phenomenex 21.2 x 250 mm Luna 5 urn C18 BDS column at 21 mL/min, isocratic elution with 50% to 70% CH3CN/H20 mixtures depending on the polarity of the rapamycin analogue. Analysis of culture broths '. An aliquot of whole broth (1 mL) was shaken with CH3CN (1 mL) for 30 minutes. The mixture was clarified by centrifugation and the supernatant analysed by HPLC with diode array detection. The HPLC system comprised an Agilent HP1100 equipped with a BDS HYPERSIL C18 3 urn 4.6 x 150 mm column CThermoHypersil-Keystone) heated to 40°C. The gradient elution was from 55% mobile phase B to 95% mobile phase B over 10 minutes followed by an isocratic hold at 95% mobile phase B for 2 minutes with a flow rate of 1 mL/min. Mobile phase A was 10% acetonitrile:90% water, containing 10 mM ammonium acetate and 0.1% trifluoroacetic acid, mobile phase B was 90% acetonitrile:10% water, containing 10 mM ammonium acetate and 0.1% trifluoroacetic acid. Rapamycin analogues were identified by the presence of the characteristic rapamycin triene, centred on 278 nm. FK506 and FK520 analogues are identified by LC-MS analysis. Analysis by LCMS The HPLC system described above was coupled to a Bruker Daltonics Esquire3000 electrospray mass spectrometer. The same column and gradient elution scheme were used as described above. Mobile phase A was water, mobile phase B was acetonitrile. Positive negative switching was used over a scan range of 500 to 1000 Dalton. Example 1 Conjugation ofS. hygroscopicus The plasmid to be conjugated into S. hygroscopicus was transformed by electroporation into the dam' dcm' ET12567 £ coli strain containing either pUB307 as described in MacNeil et al. (1992) or pUZP002 as described in Paget et at. (1999). A preculture was used (over night culture, 30°C) to inoculate fresh 2xTY (with 50 fj.g/ml apramycin and 25 ug/ml kanamycin) at a dilution of 1/25 and grown with shaking at 37°C to an optical density at 595 nm of 0.25-0.6. The cells from this broth were washed twice with 2xTY, then resuspended with 0.5 ml of 2xTY per 25 ml original culture. The quality of the spore stock used is critical for the success of this method. In this context the age of the spores when harvested and the use of medium 1 are crucial for the isolation of high-quality spore suspension. To isolate high- quality spore suspensions of S. hygroscopicus, pre-dried plates of medium 1 agar (see Materials and Methods section) were spread with S. hygroscopicus spores or mycelia using standard microbiological techniques followed by incubation at 26°-28°C for 14- 21 days. Spores were harvested by addition of 1-2 ml of sterile 20 % w/v glycerol or water by standard, techniques. An aliquot of 200 pi of the S. hygroscopicus spore suspension was washed in 500 \|xl of 2xTY, resuspended in 500 µl of 2xTY, subjected to heat shock at 50°C for 10 minutes then cooled on ice. An aliquot of 0.5 ml of the £ coli suspension was mixed with the heat-shocked spores and this mixture plated on medium 1 agar plates. These plates were incubated at 26°-280C for 16 hours before overlaylng with 1 mg of nalidixic acid and 1 mg of apramycin per plate. Exconjugant colonies usually appeared after 3-7 days. Use in S.hygroscopicus MG2-10 of an alternative integrating vector, pRT801 Conjugation was also carried out using the 4>BT1-based integrating vector pRT801 into S.hygroscopicus MG2-10 as described above. Exconjugants were patched on to medium .1 containing 50ug/ml apramycin and 50ug/ml nalidixic acid, and shown to be apramycin resistant Example 2 Isolation of the S. hygroscopicus mutant MG2-10 carrylng the chromosomal deletion of rapQONMLKJI (Figure 4). An S. hygroscopicus mutant (MG2-10) in which the rapamycin modifylng genes rapQ, rapO/N, rapM, rapL, rapK, rapJ and rap! were deleted was constructed as described below. Isolation of the streptomycin resistant mutant MG1C: S.hygroscopicus NRRL5491 mycelia were spread onto plates of medium 1 containing 50mg/ml streptomycin. Three colonies were isolated and labelled MG1A, MG1B and MG1C. These were conjugated as in example 1 with the plasmid pMG49, a derivative of pSET152 containing the rpsL gene from S.lividans TK24. Exconjugants from each of these conjugations were patched onto a plate if medium 1 containing 50mg/ml apramycin and 50mg/ml nalidixic acid, to confirm the presence of the plasmid pMG49. They were then streaked, along with the original strains MG1A, MG1B and MG1C, onto a both a plate of medium 1 containing no antibiotic and a plate of.medium 1 containing 50mg/ml streptomycin. Growth was seen in all cases except fhe streaks of MG1A [pMG49], MG1B [pMG49] and MG1C [pMG49] on streptomycin, indicating that the w.t. rpsL gene from S.lividans TK24 conferred dominant streptomycin sensitivity on these strains. The production of pre-rapamycin was measured in MG1A, MG1B and MG1C and the best producer, MG1C, was kept for further work. Conjugation ofS. hygroscopicus MG1C Conjugations were carried out as described in example 1 using the streptomycin resistant S. hygroscopicus MG1C and vector pMG55 derived constructs. Construction of conjugative double recombination vector pMG55 (Figure 3) The primers MAG47 5'-GCAAGCTTGGTACCGACACGCTCGCCGAACAGG- 3' (SEQ ID NO: 29) and MAG48 5'-GCGCATGCCCTAGGGTGTACATTACTTCTCC- 3' (SEQ ID NO: 30) were used to amplify the S.lividans rpsL gene using the plasmid pRPSL21 (Shima et al., 1996) as a template. The PCR fragment was digested with Sp/jl and H/ndlll, isolated and ligated with the 3.2 kb fragment of pSET152 (Bierman et al., 1992b), which had been digested with Sph\ and H/ndlll. After transformation into £ coli DH1 OB, plasmid pMG55 was isolated. This plasmid was confirmed by sequencing. Plasmid pMG55 contains the rpsL gene to allow selection for double recombinants (Hosted and Baltz, 1997). Isolation of the S. hygroscopicus mutant MG2-10 carrylng the chromosomal deletion of rapQONMLKJI (Figure 4) The primers MAG23 5'-TATCTAGACTTCGCACGTGCCTGGGACA-3' (SEQ ID NO: 31) and MAG24 5^AGMGCTTACCCMTTCCAACATCACCT-3' (SEQ ID NO: 32) were used to amplify the left region of homology (from nt 89298 to nt 90798 in the rapamycin cluster as described in Schwecke et al.(Schwecke et al., 1995) using genomic DNA prepared from S. hygroscopicus NRRL5491 as a template. The 1.5 kb PCR product was digested with Xba\ and H/ndlll and ligated into pUC18 cut with Xbal and H/ndlll. After transformation into E. coli DM OB, the plasmid pMAG127- 8 was isolated. The primers MAG25 5'-GGAAGCTTTGACCACACGCCGCCCGTTC- 3* (SEQ ID NO: 33) and MAG26 5-ATGCATGCCCGCCGCAACCCGCTGGCCT-3' (SEQ ID NO: 34) were used to amplify the right region of homology (from nt 98404 to nt 99904 in the rapamycin cluster as described in Schwecke et al. (1995)) using genomic DNA prepared from S. hygroscopicus NRRL5491 as a template. The 1.5 kb product of PCR was digested with H/ndlll and Sph\ and ligated into pUC18 cut with H/ndlll and Sphl After transformation into £ co//DH10B, the plasmid pMAG128-2 was isolated (Figure 4). Both plasmids were checked by sequence analysis. The plasmid pMAG127-8 was digested with Sph\ and H/ndlll, the plasmid pMAG128-2 was digested with Xoal and H/ndlll and the 1.5 kb fragments were isolated from both plasmids. These fragments were ligated into pUC18 cut with Sph\ and Xbal and used to transform £ coli DH10B. The plasmid pMAG131-1 was isolated. This plasmid was digested with Sph\ and Xba\, the 3 kb fragment was isolated and ligated into pMG55 cut with Sph\ and Avr\\ and the DNA was used to transform £ coli DH10B. The plasmid pMAG144-16 was isolated and used to conjugate S. hygroscopicus MG1C. An apramycin resistant S. hygroscopicus colony was isolated, grown for 24 hours in TSBGM with shaking at 26°C, and spread onto medium 1 agar plates containing 50 ng/l streptomycin. Streptomycin resistant colonies were isolated and shown to be apramycin sensitive. The 7606 nt chromosomal deletion of the rapQONMLKJI region of the rapamycin cluster was verified in the mutant MG2-10 by using the 1.5 kb PCR product of MAG23 and MAG24 to probe EcoRI- and SamHI-digested chromosomal DNA. Analysis of the wild type S. hygroscopicus showed the expected 5.8 kb EcoRI and 5.9 kb BamHI band after hybridisation. When chromosomal DNA of MG2-10 was treated similarly, 9.6 kb EcoRI and 7.6 kb BamH\ bands were detected, indicating that rapQONMLKJI had been removed. Example 3 Expression of rapK in the S. hygroscopicus mutant MG2-10 carrylng the chromosomal deletion of rapQONMLKJI (Figure 4) Construction of expression vector pSGsetl The pSET152 (Bierman et al., 1992a) derived vector pCJR336 (kindly provided by Christine Martin and Corinne Squire) was created by cloning the primer dimerofCR347 5'- TAAACTAGTCCATCTGAGAGTTTCATATGGCCCTATTCTGCCCAGCCGCTCTAG AAAT-3' (SEQ ID NO: 35) and CR348 5'- ATTTCTAGAGCGGCTGGGCAGAATAGGGCCATATGAAACTCTCAGATGGACTAG TTTA -3' (SEQ ID NO: 36) into PvuW digested pSET152 using standard molecular biological techniques, thus introducing sites for the restriction enzymes Spel, aldel, and Xbal into pSET152. The orientation of the insert was confirmed by sequencing. Plasmid pCJR336 was digested using the restriction enzymes Wdel/Spel and vector pSG142 (Gaisser et ah, 2000) was digested identically. The resulting DNA bands of about 5.4 kb for pCJR336 and 1.2 kb for pSG142 were isolated followed by a ligation which was used to transform E. coli DH10B. The vector construct containing the acf//-ORF4 regulator region was isolated and digested using the restriction enzyme Xba\ followed by an alkaline phosphatase treatment according to standard protocols. The isolated DNA was ligated with a fragment of about 200 bp from plasmid pEXo/eG2cas (pSG142 derivative containing the ca. 1.2kb Ndel/BglW fragment of pSGcasOleG2 (WO01/79520) digested with the restriction enzymes Xba\ and Nhe\. Vector pSGsetl was isolated and the correct orientation of the insert was verified using restriction digests and sequence analysis. Plasmid pSGsetl contains the actll- ORF4 regulator, the Pacu promoter and the 6xHis-tag coding sequence as well as the lambda t0 transcriptional termination region (originating from plasmid pQE-16) and it can integrate site-specifically at the OC31 attachment site. Cloning of rapK The gene rapK was amplified by PCR using the primers BIOSG8 5'- GGGCATATGAGGCAATTGACTCCGCCGGTCACGGCACCGTACTGCC -3' (SEQ ID NO: 37) and BIOSG9 5'- GGGGTCTAGAGGTCACGCCACCACACCCTCGATCTCGACC -3' (SEQ ID NO: 38), which introduce a Afcfel site at the 5' end and a Xba\ site at the 3' end of rapK. Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated with Smal-cut pUC18 and used to transform E. co//DH10B. The DNA sequence of rapK in the isolated plasmid pUCrapK was verified by sequence analysis. The . differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Figure 27. The resulting changes in RapK are shown in Figure 28. Isolation ofpSGsetrapK Plasmid pUCrapK was digested with aldel and Xba\ and the insert fragments were isolated and ligated into identically digested pSGsetl. The ligation was used to transform £ coli DH10B using standard procedures and the transformants were analysed. Plasmid pSGsetrapK, was isolated and the construct was verified using restrictiSn digests and sequence analysis. Example 4 ... Identification of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmBthyl-rapamycin (pre-rapamycin, Figure 6) . 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre- rapamycin) was obtained by conjugating the S. hygroscopicus strain MG2-10 as described in Example 1 with pSGsetrapK and isolating the products produced on fermentation. This demonstrates that it is possible to complement the deletion of rapK in the MG2-10 strain and that if the strain is fed with pipecolic acid, pre- rapamycin is produced, an analogue which is lacking the post-PKS modifications. The plasmid pSGsetrapK was conjugated into S. hygrvscopicus MG2-10 and the strain grown in TSBGM fed with 2mg/l pipecolic acid at 25°C with shaking. The mycelia were extracted with methanol and the culture broth was extracted with ethyl acetate as described previously. Analysis of the culture broth of the pipecolic acid-fed S. hygrvscopicus mutant MG2-10[pSGsetrapK] by HPLC with UV detection at 280nm revealed the presence of two major new peaks with retention times of 4.0 and 5.1 minutes. Electrospray mass spectroscopy of these peaks revealed that both contained ions corresponding to a compound with a MW of 841.5. Neither of these peaks was seen in the culture extractions of the S. hygrvscopicus NRRL 5491 strain or the mutant strain MG2-10 without the rapK expression plasmid pSGsetrapK. MS/MS analysis of the ion with m/z of 864 (corresponding to the sodium adduct of pre-rapamycin) revealed that it fragmented into an ion with m/z of 735 corresponding to the loss of m/z 129 (pipecolic acid), or an ion with m/z of 556 corresponding to the loss of m/z 308 (C28- C42 of pre- rapamycin). This ion itself fragmented further to an ion with m/z 306, corresponding to the loss of m/z 250 (C14 to C27 of pre- rapamycin). This fragmentation pattern was identical to the pattern seen for rapamycin but with the second loss of m/z (-308) reduced by 14, corresponding to the absence of the C39 O-methyl group, the third loss of m/z (-250) reduced by 44, corresponding to the absence of the C27 methbxy and C16 O-methyl groups and the final ion (306) having a mass reduced by 14 corresponding to the absence of the C9 ketone group. This was evidence that the compound with MW 841.5 represents 9tdeoxo-16-O- desmetriyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre- rapamycin). Example 5. Preparation of gene cassettes for expression in S. hygrvscopicus MG2-10 Gene cassettes able to direct the expression of a variety of rapamycin modifylng genes and combinations of modifylng genes were constructed as described below. Cloning of rapN/O The contiguous genes rapN and rapO, hereafter designated rapN/O were amplified by PCR using the primers BIOSG2 5'- GGGCATATGTCGACGACCGATCAGGGTGAGACCGGAAAGGCCTG -3' (SEQ ID NO: 39) and.BIOSG3 5'- . GGGGTCTAGAGGTCAGTCCTGGGGTTCGAGAAGCTCGCCGGTCTCCTT-3' (SEQ ID NO: 40), which introduce a aldel site at the 5' end and a Xba\ site at the 3' end of rapN/O. Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated into Smal-cut pUC18 and used to transform £ coli DH10B. The DNA sequence of rapWO in the isolated plasmid pUCrapN/O was verified by sequence analysis. The differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Fig 21. The resulting changes in RapN are shown in Fig 22. Cloning ofrapM The gene rapMwas amplified by PCR using the primers BIOSG4 5'- GGGCATATGATCCAACCCGACGTCGTGACCGCCTTCACAGCGG -3' (SEQ ID NO:41)andBIOSG5 5'- GGGGTCTAGAGGTCACACGCGGACGGCGATCTGGTGCCGATAGG -3 (SEQ ID NO: 42), which introduce a aldel site at the 5" end and a Xba\ site at the 3' end of rapM. Plasmid pR19 (Schwecke et ai, 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated into Smal-cut pUC18 and used to transform £ coli DH10B. The DNA sequence of rapM in the isolated plasmid pUCrapM was verified by sequence analysis. The differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Fig 23. The resulting changes in RapM are shown in Fig 24. Cloning of rapL The gene rapL was amplified by PCR using the primers BIOSG6 5'- GGGCATATGCAGACCAAGGTTCTGTGCCAGCGTGACATCAAG -3' (SEQ ID NO: 43) and BIOSG7 5'- GGGGTCTAGAGGTCACTACAGCGAGTACGGATCGAGGACGTCCTCGGGCG-3' (SEQ ID NO: 44), which introduce a aldel site at the 5' end and a Xba\ site at the 3' end of rapL Plasmid pR19 (Schwecke et al„ 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated into Smal-cut pUC18 and used to transform E coli DH10B. The DNA sequence of rapL in the isolated plasmid pUCrapL was verified by sequence analysis. The differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Fig 25. The resulting changes in RapL are shown in Fig 26. Cloning of raphes The gene rapL was amplified by PCR using the primers BIOSG6 5'- GGGCATATGCAGACCAAGGTTCTGTGCCAGCGTGACATCAAG -3' (SEQ ID NO: 43) and BIOSG45 5'- GGAGATCTCAGCGAGTACGGATCGAGGACGTCCTCGGGCG -3' (SEQ ID NO: 45), which introduce a aldel site at the 5' end and a BgR\ site at the 3' end of rapL Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated into Smal-cut pUC19 and used to transform E coli DH10B. The DNA sequence of rapL in the isolated plasmid pUC19rapLhfe was verified by sequence analysis. Cloning of rapK The gene rapKwas amplified by PCR using the primers BIOSG8 5"- GGGCATATGAGGCAATTGACTCCGCCGGTCACGGCACCGTACTGCC -3" (SEQ ID NO: 37) and BIOSG9 5'- GGGGTCTAGAGGTCACGCCACCACACCCTCGATCTCGACC -3' (SEQ ID NO: 38), which introduce a Afdel site at the 5' end and a Xbal site at thet3' end of rapK. PlasmidPpR19 (Schwecke et al., 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated with Smal-cut pUC18 and used to transform £ coli DH10B. The DNA sequence of rapK in the isolated plasmid pUCrapK was verified by sequence analysis. The differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Fig 27. The resulting changes in RapK are shown Fig 28. Isolation of pSGsetrpaN/O, pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl, pSGsetrapK, and pSGsetrapL Plasmids pUCrapN/O, pUCrapJ, pUCrapM, pUCrapl, pUCrapL, pUCrapK and pAHL42 were digested w'rth Nde\ and Xbal and the insert fragments, ranging in size from about 1.3 kb to 0.7 kb, were isolated and ligated into identically digested pSGsetl The ligations were used to transform E coli DH10B using standard procedures and the transformants were analysed. Plasmids pSGsetrapN/O, i pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl, pSGsetrapK, and pSGsetrapL were isolated and the constructs were verified using restriction digests and sequence analysis. Cloning of rap J The gene rapJ was amplified by PCR using the primers BIOSG10 5'- GGGCATATGAGCACCGMGCTCAGCAAGAGAGCACGCCCACCGCACGCT-3' (SEQ ID NO: 46) and B10SG11 5'- GGGGTCTAGAGGTCACTCCGCTCCCCAGGTGACCCGGAGCTCGGC -3' (SEQ ID NO: 47), which introduce a Wdel site at the 5' end and a Xbal site at the 3' end of rapJ. Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated with Smal-cut pUC18 and used to transform E coli DH10B. The DNA sequence of rapJ in the isolated plasmid pUCrapJ was verified by sequence analysis. The differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Fig 29. The resulting changes in RapJ are shown in Fig 30. Cioning of rapl The gene rapl was amplified by PCR using the primers B10SG12 5'- GGGCATATGAGCGCGTCCGTGCAGACCATCAAGCTGCC -3' (SEQ ID NO: 48) and BIQSG13 5'-GGGGTCTAGAGGTCAGGCGTCCCCGCGGCGGGCGACGACCT. -3' (SEQ ID NO: 49), which introduce a aldel site at the 5' end and a Xbal site at the 3' end of rapl. Plasmid pAHL2 (kindly provided by Huai-Lo Lee) is derived from. pUC18 containing the rapl gene and was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated with Smal-cut pUC18 and used to transform E coli DH10B. The DNA sequence of rapl in the isolated plasmid pUCrapl was verified by sequence analysis. The differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Fig 31. The resulting changes in Rapl are shown in Fig 32. Cloning ofrapQ The gene rapQ was amplified by PCR using the primers AHL21 5'- CATATGTTGGAATTGGGTACCCGCCTG -3' (SEQ ID NO: 50) and AHL22 5'- TCTAGACGCTCACGCCTCCAGGGTG -3' (SEQ ID NO: 51), which introduce a aldel site at the 5' end and a Xbal site at the 3' end of rapQ. Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated with Smal-cut pUCl 8 and used to transform E. coli DH10B. The DNA sequence of rapQ in the isolated plasmid pAHL42 was verified by sequence analysis. The differences in the DNA sequence compared to the published sequence (ace. no. X86780) are shown in Fig 33. The resulting changes in RapQ are shown in Fig 34. Isolation ofpUCIBeryBVcas The gene eryBV was amplified by PCR using the primers casOleG21 (WO01/79520) and 7966 5'- GGGGAATTCAGATCTGGTCTAGAGGTCAGCCGGCGTGGCGGCGCGTG AGTTCCTCCAGTCGCGGGACGATCT -3' (SEQ ID NO: 52) and pSG142 (Gaisser et al., 2000) as template. The PCR fragment was cloned using standard procedures and plasmid pUC18eryBVcas was isolated with an aldel site overlapping the start codon of eryBV and an Xba\ and Bglll site following the stop codon. The construct was verified by sequence analysis. Isolation of vector pSGLitl The gene eryBV was amplified by PCR using the primers BIOSG1 5'- GGGTCTAGATCCGGACGAACGCATCGATTAATTAAGGAGGACACATA -3' (SEQ ID NO: 53) and 7966 5'- GGGGAATTCAGATCTGGTCTAGAGGTCAGCCGGCGTGGCGGCGCGTGAGTTC CTCCAGTCGCGGGACGATCT -3' (SEQ ID NO: 52), which introduce a Xba) site sensitive to Dam methylation at the 5' end and a Xbal site and a Bgl\\ site at 3' end of eryBV. Plasmid pUC18eryBVcas was used as a template. After treatment with T4 polynucleotide kinase using standard techniques the PCR product was ligated with Smal-cut pUC18 and used to transform E. coli DH10B. The construct was then digested using BamHI/Bgfll and an about 1.3 kb DNA band was isolated from an agarose gel followed by the ligation with BamHl/Bg/ll digested Litmus 28 vector DNA using standard procedures. The vector pSGLitl was isolated and the DNA sequence of the insert was verified by-sequence analysis. Isolation of pSGsetrpaN/O, pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl, pSGsetrapK, and pSGsetrapL Plasmids pUCrapN/O, pUCrapJ, pUCrapM, pUCrapl, pUCrapL, pUCrapK and pAHL42 were digested with Nde\ and Xba\ and the insert fragments ranging in size from about 1.3 kb to 0.7 kb were isolated and ligated into identically digested pSGsetl. The ligations were used to transform E coli DH10B using standard procedures and the transformants were analysed. Plasmids pSGsetrapN/O, pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl, pSGsetrapK, and pSGsetrapL were isolated and the constructs were verified using restriction digests and sequence analysis. Isolation of pSGLitrapN/O, pSGLitrapJ, pSGLitrapM, pSGLitrapQ, pSGLifrapt, pSGLitrapK, pSGLitrapL and pSGUtrapL^s Plasmids pSGsetrpaN/O, pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl, pSGsetrapK, pSGsetrapL, and pUCIQrapLhfe were digested using NdeMBgR] restriction enzymes and the bands ranging from about 0.7 to 1.3 kb were isolated followed by ligations with pSGLitl digested with Nde\/Bglll The ligations were used to transform E coli ET12567 and the transformants were analysed. Plasmids pSGLitrapN/O, pSGLitrapJ, pSGLitrapM, pSGLitrapQ, pSGLitrapl, pSGLitrapK, pSGLitrapL and pSGLitrapUis were isolated. Isolation of plasmids pSGsetapKI, pSGsetrapKM, pSGsetrapKN/O, pSGsetrapKL, pSGsetrapKQ and pSGrapKJ * The plasmids pSGLitrapN/O, pSGLitrapJ, pSGLitrapM, pSGLitrapQ, pSGLitrapl, and pSGLitrapL were digested using Xba\ and the fragments ranging from about 0.8 to 1.3 kb were isolated followed by ligations with pSGsetrapK . digested with Xba\ and treated with alkaline phosphatase using standard molecular biological techniques. The ligations were used to transform E. coli DH10B and the transformants were analysed. Plasmids pSGsetrapKI, pSGsetrapKM, pSGsetrapKN/O, pSGsetrapKL, pSGsetrapKQ and pSGrapKJ were isolated and the orientation of the insert was verified by restriction digest analysis. For the addition of rapLtfe these constructs were either digested with Bglll/Xbal followed by partial digest with Bglll as appropriate and the isolated vector fragments were ligated with the ~ 1kb Xbal/Bglll fragment of pSGLitrapLfe. Isolation ofplasmids pSGsetrapKIJ, pSGsetrapKIM and pSGsetrapKIQ The plasmids pSGLitrapJ, pSGLitrapWI, and pSGLitrapQ were digested using Xbal and the fragments ranging from about 0.8 to 1.3 were isolated followed by ligations with pSGsetrapKI digested with Xbal and treated with alkaline phosphatase using standard molecular biological techniques. The ligations were used to transform £ co// DM OB and the transformants were analysed. Plasmids pSGsetrapKIJ, pSGsetrapKIM, and pSGrapKIQ were isolated and the orientation of the insert was verified by restriction digest analysis. For the addition of rapUis these constructs were either digested with Bglll/Xbal followed by partial digest with Bglll as appropriate and the isolated vector fragments were ligated with the ~ 1kb Xbal/Bglll fragment of pSGLitrapUis. Isolation of plasmids pSGsetrapKN/OI, pSGsetrapKN/OQ, pSGsetrapKN/OM and pSGsetrapKN/OJ. ...... The plasmids pSGLitrapl, pSGLitrapM, pSGLitrapJ, and pSGLitrapQ were digested using Xbal and the fragments ranging from about 0.8 to 1.3 were isolated followed by ligations with pSGsetrapKN/O digested with Xbal and treated with alkaline phosphatase using standard molecular biological techniques. The ligations were used to transform £ co// DH10B and the transformants were analysed. Plasmids pSGsetrapKN/OI, pSGsetrapKN/OQ, pSGsetrapKN/OM and pSGrapKN/OJ were isolated and the orientation of the insert was verified by restriction digest analysis. For the addition of rapLhis these constructs were either digested with Bglll/Xbal followed by partial digest with Bglll as appropriate and the isolated vector fragments were ligated with the ~ 1kb Xbal/Bglll fragment of pSGL"rtrapLhl8. Isolation ofplasmids pSGsetrapKJM and pSGsetrapKJQ The plasmids pSGLitrapM and pSGLitrapQ were digested using Xbal and the fragments ranging from about 0.8 to 1.1 were isolated followed by a ligation with pSGsetrapKJ digested with Xbal and treated with alkaline phosphatase using standard molecular biological techniques. The ligations were used to transform £ coli DM OB and the transformants were analysed. Plasmids pSGsetrapKJM and pSGrapKJQ were isolated and the orientation of the insert was verified by restriction digest analysis. For the addition of rapUs these constructs were either digested with Bglll/Xbal followed by partial digest with Bglll as appropriate and the isolated vector fragments were ligated with the ~ 1kb Xbal/Bglll fragment of pSGUtrapUis- Using the same strategy outlined above, the following gene cassettes were isolated: pSGsetrapKIJM pSGsetrapKN/OJI pSGsetrapKIQN/OM pSGsetrapKIJQ pSGsetrapKJMN/O pSGsetrapKJMN/OQ pSGsetrapKIJN/O pSGsetrapKJQN/O pSGsetrapKIJN/OMQ pSGsetrapKIMN/O pSGsetrapKIJN/OM pSGsetrapN/OQ pSGsetrapKIQN/O pSGsetrapKIJN/OQ pSGsetrapKIJMN/OQ pSGsetrapKN/OMQ pSGsetrapKIMN/OQ An overview is given in Figure 5. For the addition of rapUt these cassette constructs were either digested with BgR\lXba\ or with Xba\ followed by partial digest with Bgl\\ as appropriate and the isolated vector fragments were ligated with the about 1 kb Xba\IBgl\\ fragment of pSGLJtrapUb- Example 6 Isolation of 9-deoxo-16-O-desmethyl-2 7-desmethoxy-39-O-desmethyl-rapamycin (pre-rapamycin, Figure 6) 9-Deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre- rapamycin) was obtained by conjugating the S. hygroscopicus strain MG2-10 with pSGsetrapKL and isolating the products generated as described below. This demonstrates that it is possible to complement the deletion of rapK and rapi. in the MG2-1Q strain and that pre-rapamycin is produced, an analogue which is lacking post-PKS modification. The feeding of pipecolic acid is not required when rapL is complemented confirming that rapL plays a role in the provision of pipecolic acid in the production of rapamycin. 4 S. hygroscopicus MG2-10[pSGsetrapKL] was cultured from a frozen working spore stock in cryopreservative (20% glycerol, 10% lactose w/v in distilled water) on Medium 1 (see Materials and Methods) and spores were harvested after 14 days growth at 29°C. A primary pre-culture was inoculated with the harvested spores and cultured in two 250 ml Erlenmeyer flasks containing 50 ml Medium 3 (see Materials and Methods), shaken at 250 rpm with a two-inch throw, at 30°C, for two days. The primary pre-culture was used to inoculate two secondary prs-cultures of Medium 2 (see Materials and Methods) and Medium 3, at 10% v/v, which was shaken at 300 rpm with a one-inch throw, at 25°C, for a further 24h. Four litres of Medium 4 (see Materials and Methods) and Medium 5 (see Materials and Methods) were prepared containing 0.01% v/v Pluronic L101 antifoam (BASF). Production Medium 4 was inoculated with the secondary pre-culture in Medium 2 and Production Medium 5 was inoculated with the secondary pre-culture in Medium 3 at 10% v/v and allowed to ferment in a 7 L stirred bioreactor for five to seven days at 25°C. Airflow was set to 0.75 wm and the impeller tip speed was controlled between 0.98 ms"1 and 2.67 ms"1. Additional Pluronic L101 was added on demand. To confirm the structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O- desmethyl-rapamycin (pre-rapamycin), broths from Medium 4 and Medium 5 were extracted with ethyl acetate and reduced to a crude extract by evaporation. The extracts were defatted on partition with hexane:methanot:water and flashed through a 70 g silica cartridge starting with hexane and finishing with acetone. Pre-rapamycin fractions from each fermentation were pooled and flashed through a C18 cartridge starting with water and finishing with methanol. Pre-rapamycin (8.5 mg) was isolated after chromatography on Sephadex LH20 using heptane:chloroform:ethanol as the mobile phase. This compound was analysed and the structure fully confirmed by NMR (Figure 18-20). The 1H and 13C NMR data are given in Table V below. Example 7 Isolation of 8-deoxo-15-O-desmethyl-26-desmethoxy-38-O-desmethyl- prolylrapamycin (pre-prolylrapamycin, Figure 7) Feeding of S. hygroscopicus MG2-10[pSEGrapK] with proline acid resulted in the production pre-prolylrapamycin as described below. This demonstrated that in the absence of rapL alternative pipecolic acid analogues are incorporated. S. hygroscopicus MG2-10[pSGsetrapK] was grown in TSBGM fed with 1 mg/l proline at 25°C with shaking. The mycelia were extracted with methanol and the culture broth was extracted with ethyl acetate as described previously. Analysis of the culture broth of the proline-fed S. hygroscopicus mutant MG2- 10[pSG,setrapKJ by HPLC with UV detection at 280nm revealed the presence of two major new peaks with retention times of 4.5 and 4.6 minutes. Electrospray mass spectroscopy of these peaks revealed that both contained ions corresponding to a compound with a MW of 827.5. Neither of these peaks were seen in the cultures of S. hygroscopicus NRRL 5491, S. hygroscopicus MG1C or S. hygroscopicus MG2-10 without the rapK expression plasmid pSGsetrapK. MS/MS analysis of the ion with m/z of 850 (corresponding to the sodium adduct of pre-prolylrapamycin) revealed that it fragmented into an ion with m/z of 735 corresponding to the loss of m/z 115 (proline), or an ion with m/z of 542 corresponding to the loss of m/z 308 (C27-C41 of pre-prolylrapamycin). This ion itself fragmented further to an ion with m/z 292, corresponding to the loss of m/z 250 (C13 to C26 of pre-prolylrapamycin). This fragmentation pattern was identical to the pattern seen for rapamycin but with the first loss of m/z (-115) reduced by 14 corresponding to the change from pipecolic acid to proline for the amino acid, the second loss of mfe (-308) reduced by 14, corresponding to the absence of the. C38 O-methyl group, the third loss of m/z (-250) reduced by 44, corresponding to the absence of the C26 methoxy.and C15 O-methyl groups and the final ion (306) having a mass reduced by 14 corresponding to the absence of the C8 ketone group and the change from pipecolic acid to proline. This was evidence that the compound with MW of 827.5 represents 8-deoxo-15-O- desmethyl-26-desmethoxy-38-O-desmethyl-prolylrapamycin (pre-prolylrapamycin). Example 8 Isolation of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy-rapamycin (39- dehydroxy pre- rapamycin, Figure 8) Feeding of S. hygroscopicus MG2-10[pSGsetrapK] with pipecolic acid and cyclohexane carboxylic acid resulted in the production of two major compounds, pre- rapamycin which corresponds to the incorporation of the natural starter unit and 39- dehydroxy pre-rapamycin, which corresponds to the incorporation of the fed starter unit S. hygroscopicus MG2-10[pSGsetrapK\| was grown in TSBGM fed with 2mg/l pipecolic acid and 1mM cyclohexane carboxylic acid at 25°C with shaking. The culture broth was extracted with ethyl acetate as described previously. Analysis of the culture broth of the cyclohexane carboxylic acid-fed S. hygroscopicus mutant MG2-10[pSGsetrapK] by HPLC with UV detection at 280nm revealed the presence of one major new peak with a retention time of 5.8 minutes. Electrospray mass spectroscopy of this peak revealed that it contained ions corresponding to a compound with a MW of 825.5. This peak was not seen in the cultures of S. hygroscopicus NRRL5491, S. hygroscopicus MG1C or S. hygroscopicus MG2-10 without the rapK expression plasmid pSGsetrapK. MS/MS . analysis of the ion with m/z of 848 (corresponding to the sodium adduct of 39- dehydroxy pre-rapamycin) revealed that it fragmented into an ion with m/z of 719 corresponding to the loss of m/z 129 (pipecolic acid), or an ion with m/z of 556 corresponding to the loss of m/z 292 (C28-C42 of 39-dehydroxy pre-rapamycin). This ion itself fragmented further to an ion with m/z 306, corresponding to the loss of m/z 250 (C14 to C27 of 39-dehydroxy pre-rapamycin). This fragmentation pattern was identical to the pattern seen for pre- rapamycin but with the second loss of m/z (-292) reduced by 16, corresponding to the absence of the C39 hydroxy group. This was evidence that the compound with MW 825.5 represents 9-deoxo-15-O-desmethyl-27- desmethoxy-39-desmethoxy-rapamycin(39-dehydroxy-pre-rapamycin). Example 9 Isolation of 16-O-desmethyl-27-desmethoxy-rapamycin (Figure 9) The S hygroscopicus strain MG2-10 was conjugated with pSGsetrapKIJ as described in Example 1. Feeding of this strain with pipecolic acid and isolation of the products produced on fermentation resulted in the production of 16-O-desmethyl-27- desmethoxy-rapamycin. The plasmid pSGsetrapKIJ (Figure 5) was conjugated into S. hygroscopicus MG2-10 and the strain grown inTSB GM fed with 2mg/l pipecolic acid at 25°C with shaking. The mycelia were extracted with methanol and the culture broth extracted with ethyl acetate as described previously. Analysis of the extracts of the S. hygroscopicus mutant MG2- 10[pSGsetrapKIJ] by electrospray mass spectroscopy revealed one major new peak of retention time 4.3 minutes which contained ions corresponding to a compound with a MW of 869. This peak was not seen in the cultures of S. hygroscopicus NRRL 5491, S. hygroscopicus MG1C S. hygroscopicus MG2-10 with or without the rapK expression plasmid pSGsetrapK. MS/MS analysis of the ion with m/z of 892 (corresponding to the sodium adduct of 16-O-desmethyl-27-desrnethoxy-rapamycin) reveale9 that it fragmented into an ion with m/z of 763 corresponding to the loss of m/z 129 (pipecolic acid), or an ion with m/z of 570 corresponding to the loss of m/z 322 (C28-C42 of 16-O-desmethyl-27-desmethoxy-rapamycin). This ion itself fragmented further to an ion with m/z 320, corresponding to the loss of m/z 250 (C14 to C27 of 16-O-desmethyl-27-desmethoxy-rapamycin). This fragmentation pattern was identical to the pattern seen for rapamycin but with the third loss of m/z (-250) reduced by 44, corresponding to the absence of the C16 methyl and C27 methoxy groups. This was evidence that the compound with MW 869 was 16-O-desmethyl-27- desmethoxy-rapamycin. Example 10 Army feeding S. hygroscopicus MG2-10[pSGsetrapKI] was used to cany out an array ; feeding. Primary vegetative cultures were prepared by innocculating medium with spore stock as described in the Materials and Methods. TSB GM medium was inoculated at 10% v/v using methods described in the materials and methods section. The following compounds were added as indicated in Table VI below The cultures were incubated, extracted and measured using techniques described in the Material and Method section. Table VII shows the results of the analysis showing the ion (m/z) observed for each combination of starter carboxylic acid and amino acid: These data demonstrate incorporation of the fed compounds. Example 11 Complementation of S.hygroscopicus MG2-10 with fkbQ To assess whether rapK homologous genes such as fkbO in S.hygroscopicus var. ascomyceticus and S.tsukubaensis, and orf5 in the partially sequenced 'hyg' cluster (Ruan et al., 1997) fulfil similar functions, complementation assays were carried out using fkbO as described below. Isolation ofpMG169-1 The gene fkbO from Strepomyces hygroscopicus var. ascomyceticus (ATCC 14891), an FK520 producer, was amplified by PCR using the primers fkbof 5'- GGGCATATGACCGATGCCGGACGCCA 3' (SEQ ID NO: 54) and fkbor 5' GGGGTCTAGATCACGCCACCATGCCTTCGA 3" (SEQ ID NO: 55), introducing a aldel site at the 5'end and a Xbal site at the 3'end of fkbO. Genomic DNA isolated from S.hygroscopicusvar. ascomyceticus (ATCC 14891) was used as a template. The amplified PCR product was subjected to digestion with aldel and Xbal and ligated with WdekXbal cut pSGsetl. The ligation was used to transform Ecoli DH10B and the transformants were analysed using methods described in the Materials and Methods section. Plasmid pMG169-1 was isolated and verified by restriction digestion and S.hygivscopicus MG2-10 was transformed using methods described in the Materials and Methods section. Heterologous complementation of rapK by fkbO S.hygroscopicus MG2-10[pMG169-1] was grown in TSBGM fed with 2mg/l pipecolic acid at 25°C with shaking. The culture broth and mycelia were extracted using methods described in the Materials and Methods section (Method A). Analysis of the extract with UV detection at 280nm revealed the presence of two major new peaks with retention times of 4.5 and 4.6 minutes. Electrospray mass spectroscopy of these peaks revealed that both contained ions with a MW of 827.5 corresponding to two isomers of pre-rapamycin (Example 7). Example 12 Efficient production of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy- rapamycin (39-dehyroxy pre-rapamycin, Figure 8) in the absence of competition by endogenous starter unit by feeding to a rapK knockout mutant The ability of S. hygroscopicus strains MG2-10 and MG2-10[pSGsetrapK] to incorporate a different starter unit, cyclohexane carboxylic acid, was compared as described below. When fed cyclohexane carboxylic acid and pipecolic acid MG2-10 produced only one compound (39-dehydroxy pre-rapamycin) corresponding to incorporation of the fed starter unit only, whereas MG2-10[pSGsetrapK] produced two compounds in a 1:1 ratio, 39-dehydroxy pre-rapamycin and pre-rapamycin. This demonstrated that rapK is required for the incorporation of the natural endogenous starter unit and a rapK knock-out strain had no competition of the endogenous starter unit with the fed starter unit S. hygroscopicus MG2-10 was grown on TSBGM fed with 2 mg/L pipecolic acid and 1 mM cyclohexane carboxylic acid at 25°C with shaking. The culture broth was extracted with ethyl acetate as described previously. Analysis of the extracts by HPLC with UV detection at 280 nm revealed the presence of one new major peak with a retention time of 5.8 min. However, S. hygroscopicus MG2-10[pSGsetrapK\| (Example 4), produced pre-rapamycin (Figure 6) in addition to 39-dehydroxy pre- rapamycin in a ratio of ~1:1 when fed with cyclohexane carboxylic acid (Example 8, Figure 8). Surprisingly, feeding of cyclohexane carboxylic acid to S. hygroscopicus MG2-10 resulted in a single product, 39-dehydroxy pre-rapamycin. The endogenous starter, 4,5-dihydroxycyclohex-1-ene carboxylic acid, was not incorporated in the absence of rapK. There was therefore no competition between the incorporation of the fed carboxylic acid and the endogenous starter. Example 13 Elucidation of the function ofRapM Cultures of Str&ptomyces IMdans TK24, S. lividans TK24[pSGsetrapM] and S. IMdans TK24[pSGsetrapQ] were grown in TSBGM with shaking at 30°C and fed with 20 ng/ml of pre-rapamycin. Controls remained unfed. After a further 5 days incubation, the cultures were extracted with ethylacetate and brought to dryness. Reconst'rtution and analysis by LC-MS identified no productiorf of rapamycin analogues in the unfed controls. Two major new peaks were identified in the extract of S. //V/dansTK24[pSGsetrapM] fed pre-rapamycin, one at 2.5 min and one at 7.9 min. Electrospray mass spectroscopy of these peaks revealed that both contained ions corresponding to a compound with a MW of 855.6, consistent with 9-deoxo-16- 0-methyl-27-desmethoxy-39-O-desmethyl-rapamycin(16-O-methyl-pre-rapamycin).. Two isomers were commonly observed when extracts were analysed by LC-MS in the absence of TFA. No new peaks were identified in the extracts of S. lividans TK24 or S. lividans TK24[pSGsetrapQ]. Unmodified pre-rapamycin was clearly evident. RapM was clearly responsible for methylation at the C16 hyclroxyl, RapQ was not specific for this site. Example 14 Elucidation of the function of RapJ Cultures of S. IMdans TK24, S. Uvidans TK24[pSGsetrapK], S. IMdans TK24[pSGsetrapJ] and S. Uvidans TK24[pSGsetrapKJ] were grown in TSBGM with shaking at 30°C and fed with 40 jig/ml of pre-rapamycin. Controls remained unfed. After a further 5 days incubation, the cultures were extracted with ethylacetate and brought to dryness. Reconstitution and analysis by LC-MS identified no production of rapamycin analogues in the unfed controls. One major new peak at 4.9 min was identified in the extracts of S. IMdans TK24[pSGsetrapKJ] and S. IMdans TK24[pSGsetrapJ] fed pre-rapamycin. Electrospray mass spectroscopy of this peak revealed that it contained ions corresponding to a compound with a MW of 855.5, consistent with 16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (C9 oxo- pre-rapamycin). In extracts of S. IMdans TK24 and S. IMdans TK24[pSGsetrapK] fed with pre-rapamycin, no new peaks were identified. Unmodified pre-rapamycin was clearly evident. Due to the homology of RapJ with FkbD of the FK506 and FK520 cluster, Rap J has been postulated to oxidise pre-rapamycin at C9 to 9-hydroxy-16-O- desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (C9 OH-pre-rapamycin). RapK has been postulated to be responsible for the further conversion to the ketone. Surprisingly, in the presence of RapJ, but in the absence of RapK, 16-O-desmethyl- 27-desmethoxy-39-O-desmethyl-rapamycin (C9 keto-pre-rapamycin) was formed. RapJ clearly has an oxidative function at C9, complete conversion to the ketone was observed. RapK does not have an oxidative function at C9. Example 15 Plasmids containing the following combinations of rapamycin modifylng genes were constructed as described below: pMG260 (rapl, rapJ, rapN, rapO, and rapL), pMG261 (rapl, rapJ, rapN, rapO, rapM and rapL), pMG262 (rapl, rapJ, rapN, rapO,. rapM, rapQ and rapL) pMG236 (rapN, rapO, rapQ and rapL) and pMG238 (rapJ and rapL). Isolation of plasmids pMG236 andpMG238 The plasmids pSGsetrapNOQ and pSGsetrapJ were digested using Bglll/Xbal and the isolated vector fragments were ligated with the 1kb Xbai/Bglll fragment of pSGLitrapUte. Plasmids pMG236 (expressing rapN, rapO, rapQ and rapL) and pMG238 (expressing rapJ and rapL) respectively, were isolated. Isolation of plasmids pMG260, pMG261 andpMG262 The plasmids pSGSetrapKIJNOL, pSGSetrapKIJMNOL, and pSGSetrapKUMNOQL were digested using Bglll and the isolated insert fragments (containing the rapamycin cluster genes from the Bglll site in rapl to the Bglll site after rapL) were ligated with the vector-containing fragment from pSGSetrapl digested with Bglll. Plasmids pMG260 (expressing rapl, rapJ, rapN, rapO, and rapL), pMG261 (expressing rapl, rapJ, rapN, rapO, rapM and rapL), and pMG262 (expressing rapl, rapJ, rapN, rapO, rapM, rapQ and rapL) were isolated. Example 16 An S.hygroscopicus mutant (MG3) carrylng the chromosomal deletion of rapK was constructed as described below. Heterologous complementation of rapK with fkbO can then be performed as described and will result in the restoration of rapamycin production demonstrating that fkbO"\s able to complement the function of rapK'm S. hygroscopicus. Isolation of the S.hygroscopicus mutant MG3 canylng the chromosomal deletion of rapK The primers RAPKF1 5'-CAAAGCTTCCTGGCGCGGTTCGGCCGGCA-3' (SEQ ID NO: 56) and RAPKF2 5,-TGGCATGCCCTTCCCCGCCGTTCCCTGGC-3, (SEQ ID.NO: 57) were used to amplify the left region of homology outside the gene rapK (from nt94403 to nt95429 in the rapamycin cluster as described in Schwecke et al., 1995) using genomic DNA prepared from S.hygroscopicus NRRL5491 as a template. The 1kb PCR product was phosphorylated using T4 polynucleotide kinase and ligated into dephosphorylated Smal cut pUC18. After transformation into Eco// DH10B, the plasmid pMG233-7 was isolated. The primers RAPKR1 5'- TGGCATGCCCCCGCCGAGCTGACCTGGAA-3' (SEQ ID NO: 58) and RAPKR2 5'- GTTCTAGAGCTTACGCGTGATGTCGAACG-3' (SEQ ID NO: 59) were used to amplify the right region of homology outside the gene rapK (from nt96435 to nt97428 in the rapamycin cluster as described in Schwecke et al., 1995) using genomic DNA prepared from S.hygroscopicus NRRL5491 as a template: The 1kb PCR product was phosphorylated using T4 polynucleotide kinase and ligated into dephosphorylated Smal cut pUC18. After transformation into Eco// DH10B, the plasmid pMG257-7 was isolated. Both plasmids were checked by sequence analysis. The plasmid pMG233-7 was digested with SphlZXbal and the 3.7kb fragment was isolated, pMG257-7 was digested with Sphl/Xbal and the 1kb fragment isolated. These fragments were ligated and used to transform Eco// DH10B. The plasmid pMG268-12 was isolated. This plasmid was digested with Hindlll/Xbal and the 2kb fragment isolated and ligated into pMG55 cut with Hindlll/Xbal and the DNA was used to transform E.coli DH10B. The plasmid pMG278-1 was isolated and used to conjugate S.hygroscopicus MG1C. An apramycin resistant colony is isolated, and is grown for 24 hours in TSBGM with shaking at 30°C and spread onto medium 1 agar plates containing 50ug/l streptomycin. Streptomycin resistant colonies are isolated and shown to be apramycin sensitive. The 1004nt chromosomal deletion of rapK can be verified in the mutant MG3 by Southern blotting. An overview is given in Figure 35. S.hygroscopicus MG3 is grown in TSBGM at 26°C with shaking. The culture broth and mycelia are extracted using methods as described in the Materials and Methods section. Analysis of the extract with UV detection reveals the presence of no peaks with the characteristic rapamycin triene. Expression offkbO in the S.hygroscopicus mutant MG3 carrylng the chromosomal deletion ofrapK Plasmid pMG 169-1 (described in example 11) is transformed into S.hygroscopicus mutant MG3 using methods as described in the Materials and Methods section. Heterologous complementation of rapK by fkbO S.hygroscopicus MG3pMG169-1 is grown in TSBGM at 26°C with shaking. The culture broth and mycelia arere extracted using methods as described in the Materials and Methods section. Analysis of the extract with UV detection at 280nm. reveals the presence of two major new peaks. Electrospray mass spectroscopy of these peaks reveals that these contain ions with a MW of 913 corresponding to rapamycin. Example 17 Isolation and heterologous complementation of the S.hygroscopicus var ascomyceticus mutant MG4 canylng the chromosomal deletion of fkbO Isolation of the S.hygroscopicus var ascomyceticus mutant MG4 carrylng the chromosomal deletion of fkbO The primers FKOF1 5'-GCTCTAGAGCCCGCGGCTCGCCGGACACG-3' (SEQ ID NO: 60) and FKOF2 5'-CCCCTGCAGGCGTCCGGCATCGGTCATCAG-3' (SEQ ID NO: 61) were used to amplify the left region of homology (from nt45750 to nt46751 in the ascomycin cluster as described in Wu et al., 2000) using genomic DNA prepared from S.hygroscopicus var ascomyceticus ATCC14891 as a template. The 1kb PCR product was phosphorylated using T4 polynucleotide kinase and ligated into dephosphorylated Smal cut pUC18. After transformation into E.coli. DH10B, the plasmid pMG258-4 was isolated. The primers FKOR1 5'- CGCCTGCAGGGATACGGTCCGCCGGGTCTGC-3' (SEQ ID NO: 62) and FKOR2 5XCMGCTTGTACGGTTCGCCACGGGCGTGC-3' (SEQ ID NO: 63) were used to amplify the right region of homology (from nt47785. to. nt48781 in the rapamycin cluster as described in Wu et al., 2000) using genomic DNA prepared from S.hygroscopicus var ascomyceticus ATCC14891 as a template. The 1kb PCR product was phosphorylated using T4 polynucleotide kinase and ligated into dephosphorylated Smal cut pUC18. After transformation into E.coli DH10B, the plasmid pMG259-5 was isolated. Both plasmids were checked by sequence analysis. The plasmid pMG258-4 was digested with Sbfl/Hindlll and the 3.7kb fragment was isolated, pMG259-5 was digested with Sbfl/Hindlll and the 1kb fragment isolated. These fragments were ligated and used to transform E.coli DH10B. The plasmid pMG265-1 was isolated. This plasmid was digested with HindHI/EcoRI and the 2kb fragment isolated and ligated into pMG55 cut with HindHI/EcoRI and the DNA was used to transform Ecoli DH10B, The plasmid pMG267-1 was isolated and used to conjugate S.hygroscopicus var ascomyceticus ATCC14891. An apramycin resistant colony is isolated and is grown for 24 hours in TSBGM with shaking at 30°C and spread onto medium 1 agar plates containing 50ug/l streptomycin. Streptomycin resistant colonies are isolated and shown to be apramycin sensitive. The 1034nt chromosomal deletion of fkbO can be verified in the mutant MG4 by Southern blotting. An overview is given in Figure 36. Expression ofRapKin the S.hygroscopicus var ascomyceticus mutant MG4 carrylng the chromosomal deletion of fkbO Plasmid pSGsetRapK is transformed into S.hygroscopicus mutant MG4 as described in the Materials and Methods section. Heterologous complementation of fkbO by rapK S.hygroscopicus var ascomyceticus MG4 pSGSetRapK is grown in TSBGM at 26°C with shaking. The culture broth and mycelia are extracted using methods as described in the Materials and Methods section. The extract is analysed by LC-MS to reveal the presence of a major new peak and to reveal that this contains ions that correspond to FK520 (ascomycin). Example 18 It is obvious to those skilled in the art that other biosynthetic clusters that encode FKBP-ligands for example, FK506, can be modified such that the rapK homologue is deleted or inactivated using the methods as described herein. In FK506, for example; this could be done by amplifylng PGR products against the regions either side of the fkbO gene (sequence accession number AF082099, AF082100), ligating these together in a vector such as pMG55, transforming the FK506-producing strain, selecting for the double crossover and confirming the removal of the fkbO gene by southern blotting. Example 19 Incorporation of non-natural starter units by the rapK deletion strain, S. hygroscopicus MG2-10, into rapamycin analogues in the absence of competition by endogenous natural starter unit. As demonstrated in examples 10 and 12, the rapamycin PKS has a high degree of flexibility for non-natural starter units and in the absence of rapK, the system is free of competition from the natural starter. In this example, the degree of flexibility is further demonstrated. S. hygroscopicus MG2-10 was grown, fed and extracted according to the feeding, extraction and analysis methods outlined in Materials and Methods (Method B). The range of carboxylic acids fed along with the compounds generated are listed below. Surprisingly, all of the carboxylic acids listed were incorporated as determined by observing the characteristic UV chromophore at 278 nm and electrospray mass spectrometry and resulted in the production of rapamycin analogues. The rapamycin analogues generated corresponded to the formula below as described in Table VIII: Example 20 Incorporation of non-natural starter units by the rapK deletion strain, S. hygroscopicus MG2-■/0[pSGsetrapN/OQLhiS], into rapamycin analogues in the absence of competition by endogenous natural starter unit. As demonstrated in examples 10,12 and 19, the rapamycin PKS has a high degree of flexibility for non-natural starter units and in the absence of rapK, the system is free of competition from the natural starter. In this example, the degree of flexibility is further demonstrated. S. hygroscopicus MG2-10[pSGsetrapN/OQLhis] was grown, fed and extracted according to the feeding, extraction and analysis methods outlined in Materials and Methods (Method B). The range of carboxylic acids fed along with the compounds generated are listed below. Surprisingly, all of the carboxylic acids listed were incorporated as determined by observing the characteristic UV chromophore at 278 nm and electrospray mass spectrometry and resulted in the production of rapamycin analogues. The rapamycin analogues generated corresponded to the formula below as described in Table IX: Carboxylic acid I M-H [M+K] I Compound generated starter unit fed. 1-cyclohexene 824.4 864.4 RIB = E, R« = 3-OH, y = bond, in carboxvlic acid combination with R1 = OH, R2 = H, R6 = H, carboxylic ac»o Rs = H, R7 = H, R6 = H, R6 = H, R10 = H, x = CHg 840.4 880.4 Ris = E, R16 = 3-OH, y = bond, in combination with R1 = OH, R2 = OH, R6 = H, Re = H, R7 = H, Re = H, R5 = H, Rn> — H, x = CH2 3-cycIohexene 840.4 880.4 R15 = C, R™ = OH, R17 = OH, in . ,. .. combination with R1 = OH, R2 = H, R5 - H, carboxylic acid R _H R _Up iu R-M P - H v - r%6 - n, K7 — n, (\B ~ n, K9 — n, rvio — n, x — CH5; 822.4 862.4 R15 = A, Ri6 = OH, R17~= H, in combination with R! = OH, R2 = H, R6 = H, Re = H, R7 = H, R6 = H, R9 = H, Rip = H, x = CH2 840.4 880.4 R15 = A, R16 = OH, R17 = H, in combination with R1 = OH, R2 = OH, R5 = H, R6 = H, R7 = H, R6 = H, Rg = H, R10 = H, x = CH2 cycloheptane 854.4 894.4 R15 = E, R1B = OH, y = CH2) in combination . .. .. with R-, = OH, R2 = OH, R5 = H, R6 = H, R7 carboxyhc acd = H> R? = ^ ^ = H ^ = H x J ^ methyl-2-norbornane 852.4 892.4 R15 = B, Ri6 s OH, R17 = H, in combination cartoxylic acid !* * Z™A% °* " ■ £.= »■ * — n, KB - n, Kg — n, K10 — n, x — on2 3-hydroxycyclohexane 824.4 864.4 R16 = E, R16 = 3-OH, y = bond, in carboxylic acid ^fl Jf1! 7, 0RH'_RH =RH' %\"l _CH^ 4-hydroxycyclohexane 840.4 880.4 R16 = E, R16 = 4-OH, y = bond, in carboxylic acid ^fl ** " °RH-_RH =H' " r\e ~ n, r\7 — n, r\s ~ n, t\g — n, rvio — n, A - Cji 2 824.4 864.4 R1S = E, R16 = 4-OH, y = bond, in combination with Ri = OH, R2 = OH, R5 = H, Rg = H, R7 = H, Rg = H, Rg = H, R10 = H, x = CH2 4-methylcyclohexane 838.4 878.4 R15 = D, R17 = OH, in combination with R1 = carboxylic acid ?H1Rz Z H- « = "• «= H, R7 = H, R8 = H, _; Kg — n, K10 = n, X — Un2 854.4 894.4 R15= D, R17 a OH, in combination with R1 — OH, R2 = OH, R5 = H, R6 = H, R7 = H, Re = ; H, Rg = H, Rip = H, x = CH2 Example 20 Incorporation of non-natural starter units by the rapK deletion strain, S. hygroscopicus MG3, into rapamycin analogues in the absence of competition by endogenous natural starter unit. As demonstrated in examples 10,12 and 19, the rapamycin PKS has a high degree of flexibility for non-natural starter units and in the absence of rapK, the system is free of competition from the natural starter. In this example, the degree of flexibility is further demonstrated. S. hygroscopicus MG3 is grown, fed and extracted according to the feeding, extraction and analysis methods outlined in Materials and Methods (Method B). The range of carboxylic acids fed that can be fed is listed below. Incorporation of the carboxylic acids listed and production of rapamycin analogues is determined by observing the characteristic UV chromophore at 278 nm and electrospray mass spectrometry. Carboxylic acid starter units that can be fed include, cyclohexane carboxylic acid, 3-cis,4-trans-dihydroxycyclohexane carboxylic acid, 1-cyclohexene carboxylic acid, 3-cyclohexene carboxylic acid, cycloheptane carboxylic acid, methyl 2- norbornane carboxylate, 3-hydroxycyclohexane carboxylic acid, 4- hydroxycyclohexane carboxylic acid, 3-methylcyclohexane carboxylic acid, 4- methylcyclohexane carboxylic acid, 3-(cis/trans)methoxycyclohexane carboxylic acid, 4-(cis/trans)methoxycyclohexane carboxylic acid, ethyl 4-cyclohexanone carboxylate, 3-fluoro-4-hydroxycarboxylic acid and 4-fluoro-3-hydroxycarboxylic acid, 3- cyclohexane oxide carboxylic acid, 3,4-cis-dihydroxycyclohexane carboxylic acid, 3- chloro-4-hydroxycarboxylic acid and 4-chloro-3-hydroxycarboxylic acid (and the pair of opposite diastereomers), cyclohexylpropionic acid and 4-tert-Butylcyclohexane carboxylic acid Example 21 Incorporation of non-natural starter units by the fkbO deletion strain, S. hygroscopicus var. ascomyceticus MG4, into FK520 analogues in the absence of competition by endogenous natural starter unit As demonstrated in examples 10,12,19 and 20, the rapamycin PKS has a high degree of flexibility for non-natural starter units. In the absence of fkbO, the FK520 system is free of competition from the natural starter. In this example, the degree of flexibility of the FK520 PKS is investigated, free of competition from the natural starter. S. hygrvscopicus van ascomyceticus MG4 is grown, fed and extracted according to the feeding, extraction and analysis methods outlined in Materials and Methods (Method 6). Examples of the range of carboxylic acids that can be fed are given in Table IV. Incorporation of the carboxylic acids listed and production of FK520 analogues is determined by electrospray mass spectrometry. Example 22 Incorporation of non-natural starter acids into FK506 analogues by an fkbO deletion mutant ofS. tsukubaensis in absence of competition from the natural starter. An fkbO deletion mutant of S. tsukubaensis is grown and fed according to the feeding methods outlined in Materials and Methods. A sub-set of the carboxylic acids listed in Table IV in Materials and Methods is fed. Analysis is performed as described in Method (B) of Materials and Methods. Example 23 Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetrapKILJ 9-deoxo-16-O-desmethyl-27-desmethoxy-rapamycin was obtained by conjugating the S. hygroscopicus strain MG2-10 with pSGsetrapKIU and isolating the fermentation products generated as described below. This demonstrates that it is possible to complement the deletion of rapK, rapl and rapL in the MG2-10 strain and that 9-deoxo-16-Odesmethyl-27-desmethoxy-rapamycin is produced, an analogue which is lacking the post-PKS modifications. The feeding of pipecolic acid is not required when rapL is complemented confirming that rapL plays a role in the provision of pipecolic acid in the production of rapamycin. S. hygroscopicus MG2-10 [pSGsetKILhfe] was fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20. 9-Deoxo-16-O-desmethyl-27-desmethoxy rapamycin (Compound 6) has the following characteristics: Isolated yleld: 22 mg Molecular weight 856 Molecular formula: C49H77NOH UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa* = 878, m/z for M-H = 854 Table X below summarises the 1H and 13C NMR data for 9-deoxo-16-O-desmethyl- 27-desmethoxy rapamycin in CDCI3. b: tentative assignment c: the assignment may be interchanged d: the assignment may be interchanged Compound 6 exists as a 1:1 mixture of conformers in CDCI3. The data above is for both conformers. Where a dotted line has been drawn across the table it was not possible to determine connectivity between spin systems, hence the assignment of data to a particular conformer is not possible. Example 24 Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetrapKIMLh] 9-Deoxo-27-desmethoxy-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKIMLhte as described in example 1 and isolating the products produced on fermentation. This demonstrated that it was possible to complement the deletion of rapK, rapl, rapM and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking some post-PKS modification. S. hygroscopicus MG2-10 [pSGsetKIMLhte] was fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC was 75% CH3CN/H20. 9-Deoxo-27-desmethoxy rapamycin (Compound 16) has the following characteristics: isolated yleld: 24 mg Molecular weight: 870 Molecular formula: C50H79NOH UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 •nm " Electrospray MS: m/z for MNa+ = 892, m/z for M-H = 868 Table XI below summarises the 1H and 13C NMR data for 9-deoxo-27-desmethoxy rapamycin in CDCI3. Example 25 Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetKIN/OLh] 9-Deoxo-16-O-desmethyl-27-O-desmethyl-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKIN/OLhis as described in Example 1 and isolating the products produced on fermentation. This demonstrated that it was possible to complement the deletion of rapK, rapl, eapN/O and rapL in the MG2-1© strain with the production of a rapamycin analogue lacking some post-PKS modification. S. hygroscopicus MG2-10 [pSGsetKIN/OUia] was fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20. 9-Deoxo-16-O-desmethyl-27-O-desmethylrapamycin (Compound 9) has the following characteristics: Isolated yleld: 77 mg Molecular weight 872 Molecular formula: C49H77NO12 UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa+ = 894, m/z for M-H = 870 Table XII below summarises the 1H and 13C NMR data for 9-deoxo-16-O-desmethyl- 27-O-desmethylrapamycin in CDCI3. Example 26 Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetKJLh] 16-O-Desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKJLWB as described in Example 1 and isolating the products produced on fermentation. This demonstrated that it was possible to complement the deletion of rapK, rapJ and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking some post-PKS modification. S. hygrvscopicus MG2-10 [pSGsetKJLhj6] was fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC was 55% CH3CN/H20. 16-O-Desmethyl-27-desmethoxy-39-O-desmethyl rapamycin (Compound 3) has the following characteristics: Isolated yleld: 176 mg (mixture of 2 interconverting isomers) Molecular weight 856 Molecular formula: C4BH73N012 UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa+ = 878, m/z for M-H = 854 MS fragmentation: The sodiated adduct (m/z 878) was fragmented to provide three fragments: C8-C42, m/z MNa+ 749; C1-C27, m/z MNa+ 570; C28-C42+C1- C14, m/z MNa+ 628. The fragment ions 628 and 570 were fragmented further to give the same fragment: C1-C14, m/z MNa* 320. The mass of this C1-C14 fragment is 14 mass units greater than the equivalent fragment from the fragmentation of the sodiated adduct of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-Odesmethyl rapamycin (Compound 1) consistent with oxidation at C9. Example 27 Isolation of product from fermentation of S. hygroscopicus MG2-lO[pSGsetKMNOLh] 9-Deoxo-27-O-desmethyl-39-O-desmethyl-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKMN/OLhs as described in example 1 and isolating the products produced on fermentation. This demonstrated that it was possible to complement the deletion of rapK, rapM, rapN/O and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking some post- PKS modification. S. hygroscopicus MG2-10 [pSGsetKMN/OLws] was fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20. 9-Deoxo-27-O-desmethyl-39-O-desmethyl rapamycin (Compound 8) has the following characteristics: Isolated yleld: 6 mg Molecular weight: 872 Molecular formula: C^HTTNO^ UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa* = 894, m/z for M-H = 870 MS fragmentation: The sodiated adduct (m/z 894) was fragmented to provide three fragments: C8-C42, m/z MNa+ 765; C1-C27, m/z MNa+ 586; C28-C42+C1- C14, m/z MNa+ 614. The fragment ions 614 and 586 were fragmented further to give the same fragment: C1-C14, m/z MNa* 306. The C1-C14 is identical to that obtained from fragmentation of the sodiated adduct of 9-deoxo-16-O-desmethyl-27- desmethoxy-39-O-desmethyl rapamycin; the compound is 9-deoxo. The C1-C27 fragment is 30 mass units greater than the equivalent fragment from 9-deoxo-16-O- desmethyl-27-desmethoxy-39-O-desmethyl rapamycin, consistent with one hydroxylation and one methylation; RapM methylates the hydroxy group at C-16 (see Example 22 for pSGsetKIUis together with Example 23 pSGsetKIMUis) and RapN in combination with RapO hydroxylates C27 so the data is consistent with the compound being 9-deoxo-27-O-desmethyl-39-O-desmethyl rapamycin (Compound 8). Example 28 Isolation of product from fermentation ofS. hygroscopicus MG2-lO[pSGsetKIJLh] 16-O-desmethyl-27-desmethoxy-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKIJLws as described] in Example 1 and isolating the products produced on fermentation. This demonstrated that it was possible to complement the deletion ofrapK, rapl, rapJ and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking some post-PKS modification. S. hygroscopicus MG2-10 [pSGsetKIJUiJ was fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20. 16-ODesmethyl-27-desmethoxy rapamycin (Compound 12) has the following characteristics: isolated yleld: 11 mg Molecular weight: 870 Molecular formula: C49H75N012 UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa* = 892, m/z for M-H = 868 Example 29 Isolation of product from fermentation of S. hygroscopicus MG2-10fpSGsetKL\^ 9-Deoxo-16-O-desmefriyl-27-desmethoxy-39-O-desmethyl-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKLws as described in example 1 and isolating the products produced on fermentation. This demonstrated that it was possible to complement the deletion of rapK and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking post-PKS modification (pre-rapamycin). S. hygroscopicus MG2-10 [pSGsetKUiJ was fermented, extracted and isolated using the methods outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20. 9-Deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl rapamycin (Compound 1) has the following characteristics: Isolated yleld: 24 mg Molecular weight 842 ..Molecular formula: C48H75NOH " UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa+ = 864, m/z for M-H = 840 MS fragmentation: The sodiated adduct (m/z 864.5) was fragmented to provide four fragments: C8-C42, m/z MNa* 735; C1-C27, m/z MNa* 556; C28- C42+C1-C14, m/z MNa* 614, C1-C14, m/z MNa+ 306. The expected m/z for these fragments were determined by comparison to the reported fragmentation of rapamycin (J. A. Reather, Ph.D. Dissertation, University of Cambridge, 2000). These fragments have the same m/z as the predicted m/z for the fragmentation of 9-deoxo- 16-O-desmethyl-27-desmethoxy-39-O-desmethyl rapamycin. Example 30 Isolation of product from fermentation of S. hygroscopicus MG2-10 fed with cyclohexane carboxylic acid 9-Deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy-rapamycin was obtained on feeding cyclohexane carboxylic acid to S. hygroscopicus MG2-10 and isolating the products produced on fermentation. The resulting mutasynthesis demonstrated that it was possible to chemically complement the deletion of rapK in the MG2-10 strain, in the absence of natural endogenous starter, with the resulting production of a rapamycin analogue lacking post-PKS modification. S. hygroscopicus MG2-10 was fermented (see Materials and Methods), fed (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The tsocratic solvent system used for preparative HPLC was 50% CH3CW/H20. 9-Deoxo-16-Odesmethyl-27-desmethoxy-39-desmethoxy rapamycin (Compound AT) has the following characteristics: Isolated yleld: 12 mg Molecular weight 826 Molecular formula: C48H75NO10 UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa+ = 848.5, m/z for M-H = 825 MS fragmentation: The sodiated adduct (m/z 848.5) was fragmented to provideCfour fragments: C8-C42, m/z MNa+ 719; C1-C27, m/z MNa+ 556; C28- C42+C1-C14, m/z MNa+ 598, C1-C14, m/z MNa+ 306. These data illustrate that the difference between Compound 47 and 9-deoxo-16-O-desmethyl-27-desmethoxy-39- O-desmethyl rapamycin (Compound 1) is located in the region of C28-C42. This fragment is 16 mass units less for Compound 47 than it is for Compound 1, consistent with Compound 47 being 9-deoxo-16-O-desmethyl-27-desmethoxy-39- desmethoxy rapamycin. Example 31 Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetKNOLh] 9-Deoxo-16-Odesmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin is obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKN/OUs as described in Example 1 and isolating the products produced on fermentation. This demonstrates that it is possible to complement the deletion of rapK, rapN/O and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking some post- PKS modification. S. hygroscopicus MG2-10 [pSGsetKN/OLhls] is fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC is 60% CH3CN/H20. 9-Deoxo-16-O-desmethyl-27-O-desmethyl-39-O-desmethyl rapamycin (Compound 2) has the following characteristics: Molecular weight 858 Molecular formula: C4BH75NO12 UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MK* = 896, m/z for M-H = 856 Example 32 identification of product from fennentation ofS. hygroscopicus MG2- 10[pSGsetKJNOLhJ 16-O-Desmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKJN/OLhte as described in example 1 and analysing the products produced on fermentation. This demonstrated that it was possible to complement the deletion of rapK, rapJ, rapN/O and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking some post-PKS modification. The fermentation broth (1 mL) was treated as described in the extraction, isolation and analysis Method (B) described in Materials and Methods. The HPLC chromatogram (280 nm) contained a peak that had the characteristic rapamycin triene (268 nm, 278 nm, 288 nm). This peak was not observed in the chromatogram of the control sample extracted from S. hygroscopicus MG2-10 in the absence of the cassette. LCMS (see Materials and Methods, Method B) of the novel rapamycin analogue peak gave ions m/z 895 (MNa) and 871 (M-H). These ions confirm that the molecular weight of the novel rapamycin analogue is 872, 30 mass units greater than 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl rapamycin (Compound 1), consistent with oxidation at C9 (rapJ) and hydroxylation at C27 (rapN/O). These data are consistent with the compound being 16-O-desmethyl-27-O-desmethyl-39-O desmethyl rapamycin (Compound 7). Example 33 Isolation of product from fermentation ofS. hygroscopicus MG2-10[pSGsetKJNOLh] 16-O-Desmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin is obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKJN/OLws as described in Example 1 and isolating the products produced on fermentation. This demonstrates that it is possible to complement the deletion of rapK, rapJ, rapN/O and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking some post-PKS modification. S. hygroscopicus MG2-10 [pSGsetKJN/OUis] is fermented (see Materials and Methods), extracted and isolated using the method (B) as outlined in Materials and Methods. The isocratic solvent system used for preparative HPLC is 60% CH3CN/H20, 16-O-Desmethyl-27-O-desmethyl-39-O-desmethyl rapamycin (Compound 7) has the following characteristics: Molecular weight 872 Molecular formula: C^H^NO-is UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288 nm Electrospray MS: m/z for MNa = 895, m/z for M-H = 871 Example 34 Identification of product from fermentation of S. hygroscopicus MG2-10 [pSGsetKIJNOQLh] 16-O-Desmethyl-rapamycin was obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKUN/OQLKs as described in example 1 and analysing the products produced on fermentation. This demonstrated that it was possible to complement the deletion of rapK, rapl, rap J, rapN/O, rapQ and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking methylation at C16-OH. In addition, it clearly identified RapQ as the SAM-dependent O-methyltransferase responsible for methylation of C27-OH. S. hygrvscopicus MG2-10 [pSGsetKIJN/OQUiJ was fermented (see Materials and Methods), extracted and analysed using the method (B) as outlined in Materials and Methods. The fermentation broth (1 mL) was treated as described in Materials and Methods. The HPLC chromatogram (280 nm) contained a peak that had the characteristic rapamycin triene (268 nm, 278 nm, 288 nm). This peak was not observed in the chromatogram of the control sample extracted from S. hygroscopicus MG2-10 in the absence of the cassette. LCMS (see Materials and Methods) of the novel rapamycin analogue peak gave ions m/z 923 (MNa*) and 899 (M-H). These ions confirm that the molecular weight of the novel rapamycin analogue is 900,14 mass units less than rapamycin. It has already been established that the only post- PKS gene not included in the cassette, rapM, acts to methylate the C16-OH, hence the novel rapamycin analogue is 16-O-desmethyl rapamycin (Compound 20) and rapQ is shown to be functional and acting to O-methylate at C27. Example 35 Bioassay of rapamycin analogues: (1) = 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre-rapamycin) (6) = 9-deoxc-16-O-desmethyl-27-desmethoxy-rapamycin (16)= 9-deoxo-27-desmethoxy-rapamycin, (3) = 16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (9) = 9-deoxo-16-Odesmethyl-27-O-desmethyl-rapamycin (8) = 9-deoxo-27-O-desmethyl-39-O-desmethyl-rapamycin. Cancer Cell Lines: -Growth inhibition of adherent human tumour cell lines of solid malignancies HT29 (colon) and MCF-7 (breast) was tested in vitro using an MTT (3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay using micro-titre plates (Sieuwerts, A.M., et al., 1995). All cell lines were obtained from either the ATCC (American Type Culture Collection) or ECACC (European Collection of Cell Cultures). All cell lines were grown from frozen stocks and passaged at least once prior to use in RPM11640. Cells were harvested from sub-confluent cultures using minimal trypsinization. Cells were diluted to the appropriate density for each cell line (dependent on cell doubling time) in RPM11640, and seeded in 60 wells of a 96 well plate in a volume of 100 µl per well (i.e. outside wells of the plate were not used). Plates were incubated at 37°C overnight Following this incubation, log scale dilutions of reference and test substances were added in 100 µl per well, 6 replicates were used to test all test compounds, reference compounds and medium controls. Plates were incubated for a further 72 h prior to analysis. MTT (5 mg/ml) was added to each well and plates were re-incubated for 3-4 h. Unreacted MTT was removed from the wells and formazan crystals formed from the MTT were dissolved in DMSO and characteristic absorbance read at 570 nm. The concentration (nM) of each test compound and reference compound, which resulted in 50% of maximum inhibition (ICso),, was calculated for each cell line and quoted along with the maximum percentage of inhibition observed (lm), see Table XIII. For reference, rapamycin has an ICsoOf 200nM and an lmof 40% in the HT-29 cell line and an IC50of 0.03nM and an !m of 56% in the MCF-7 cell line. Mixed Lymphocyte Reaction (MLR): Originally developed to assess tissue compatibility prior to allografts, MLR offers an established model for immune reaction in vitro (SOULILLOU, J.P., et al. (1975); T. Meo. "Immunological Methods", L Lefkovits and B.Pernis, Eds., Academic Press, N.Y. pp. 227-239 (1979). MLR was performed by mixing splenic lymphocytes isolated from C57BU6 mice (5x10s cells) with inhibited splenic lymphocytes from CBA mice (2.5x105 cells). The inhibited CBA lymphocytes induced a proliferative response in C57BL/6 lymphoctes and this was determined by [3H] thymidine incorporation into DNA as a measure of proliferation of splenic lymphocytes isolated from C57BL/6 mice. The anti-proliferative effect was assayed for in the presence of log scale dilutions of reference compounds, test compounds and media controls over a 72 h period at 37 °C. The concentration of each test compound and reference compound, which inhibited lymphocyte proliferation by 50% (IC50), compared to control proliferation, was calculated for each cell line and quoted as a ratio of the concentration of rapamycin required to inhibit lymphocyte proliferation by 50% (rlC50), see Table XIV. Anti-fungal Assay: The comparative anti-fungal activities of reference and test compounds were determined against pathogenic fungi Candida albicans DSM 5816, Candida albicans DSM 1386 and Candida glabrata DSM 11226. This was achieved using a microtitre plate adaption of the NCCLS Reference Method for Broth Dilution Antifungal Susceptibility Testing for Yeasts: Approved Standard (M27-A, vol. 17 No. 9. (1997)). Yeast strains were inoculated (104 cfu/ml) to RPM11640 media containing 0.165 mM MOPS, pH 7. Growth was determined in the presence of log scale dilutions of reference compounds, test compounds and media controls after incubation with shaking at 37 °C, 24 h. Minimum inhibitory concentration (MIC) and minimum fungicidal activity (MFC) were determined for test compounds and expressed as a ratio of the rapamycin minimum inhibitory concentration (rMIC respectively), see Table XV. References Alarcon, CM., Heitman, J., and Cardenas, M.E. (1999) Protein kinase activity and identification of a toxic effector domain of the target of rapamycin TOR proteins in yeast Molecular Biology of the Cell 10:2531-2546. Aparicio, J.F., Molnar, I., Schwecke, T., Konig, A., Haydock, S.F., Khaw, L.E., Staunton, J., and Leadlay, P.F. (1996) Organization of the biosynthetic gene cluster for rapamycin in Streptomyces hygroscopicus: analysis of the enzymatic domains in the modular polyketide synthase. Gene 169: 9-16. Baker, H., Sidorowicz, A., Sehgal, S.N., and Vezina, C. (1978) Rapamycin (AY- 22,989), a new antifungal antibiotic. III. In vitro and in vivo evaluation. Journal of Antibiotics 31: 539-545. Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R., and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia colito Streptomyces spp. Gene 116:43-49. Blanc, V., Lagneaux, D., Didier, P., Gil, P., Lacroix, P., and Crouzet, J. (1995) Cloning and analysis of structural genes from Streptomyces pristinaespiralis encoding enzymes involved in the conversion of pristinamycin llB to pristinamycin llA (PHA): PHA synthase and NADH:riboflavin 5'-phosphate oxidoreductase. Journal of Bacteriology ATI: 5206-5214. Blanc, V., Gil, P., Bamas-Jacques, N., Lorenzon, S., Zagorec, M., Schleuniger, J., Bisch, D., Blanche, F., Debussche, L, Crouzet, J., and Thibaut, D. (1997) Identification and analysis of genes from Streptomyces pristinaespiralis encoding enzymes involved in the biosynthesis of the 4-dimethylamino-L- phenylalanine precursor of pristinamycin I. Molecular Microbiology 23:191- 202. Box, S.J., Shelley, P.R., Tyler, J.W., Verrall, M.S., Warr, S:R.C, Badger, A.M., Levy, M.A., and Banks, R.M. (1995) 27-O-Demethylrapamycin, an immunosuppressant compound produced by a new strain of Streptomyces hygroscopicus. Journal of Antibiotics 48:1347-1349. - Brown, E.J., Albers, M.W., Shin, T.B., Ichikawa, K., Keith, C.T., Lane, W.S., and Schreiber, S.L (1994) A mammalian protein targeted by G1-arresting rapamycin-receptor complex. Nature 369:756-758. Brunn, G.J., Williams, J., Sabers, C, Wiederrecht G., Lawrence, J.C., and Abraham, R.T. (1996) Direct inhibition of the signaling functions of the mammalian target of rapamycin by the phosphoinosttide 3-kinase inhibitors, wortmannin and LY294002. EMBO Journal 15: 5256-5267. Cao, W., Mohacsi, P., Shorthouse, R., Pratt, R. and Morris, R.E. (1995). Effects of rapamycin on growth factor-stimulated vascular smooth muscle cell DNA synthesis. Inhibition of basic fibroblast growth factor and platelet-derived growth factor action and antagonism of rapamycin by FK506. Transplantation 59(3): 390-395. Carlson, R.P., Hartman, DA, Tomchek, LA, Walter, T.L, Lugay, J.R., Calhoun, W., Sehgal, Si.N., Chang, J.Y. (1993). Rapamycin, a potential disease-modifylng antiarthritic drug. J. Pharmacol. Exp. Ther. 266(2): 1125-38. Chambraud, B., Radanyl, C, Camonis, J.H., Shazand, K., Rajkowskt, K., and Baulieu, E.E. (1996) FAP48, a new protein that forms specific complexes both immunophilins FKBP59 and FKBP12. Prevention by the immunosuppressant drugs FK506 and rapamycin. Journal of Biological Chemistry 271: 32923- 32929. Chang, J.Y., Sehgal, S.N., and Bansbach, C.C. (1991) FK506 and rapamycin: novel pharmacological probes of the immune response. Trends in Pharmacological Sciences 12:218-223. Chen, J., Zheng, X.F., Brown, E.J., and Schreiber, S.L (1995) Identification of an 11- kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12- rapamycin-associated protein and characterization of a critical serine residue. Proceedings of the National Academy of Sciences of the United States of America 92:4947-4951. Chini, M., Crotti, P., Gardelli, C, and Macchia, F., (1992), Tetrahedron, 48, 3805- 3812 Choi, J.W., Chen, J., Schreiber, S.L, and Clardy, J. (1996) Structure of the FKBP12- rapamycin complex interacting with the binding domain of human FRAP. Science 273: 239-242. Chung, L, Liu, L, Patel, S., Carney, J.R., and Reeves, CD. (2001) Deletion of rapQNML from the rapamycin gene cluster of Streptomyces hygroscopicus gives production of the 16-O-desmethyl-27-desmethoxy analog. Journal of Antibiotics 54:250-256. Corey, E, J. and Huang, H., (1989) Tetrahedron Lett., 30, 5235-5238 DiLella, AG., and Craig, R.J. (1991) Exon organization of the human FKBP-12 gene: correlation with structural and functional protein domains. Biochemistry 30: 8512-8517. Du, L.C., Sanchez, C, Chen, M., Edwards, D.J., and Shen, B. (2000) The biosynthetic gene cluster for the antitumor drug bleomycin from Streptomyces verticiilus ATCC15003 supporting functional interactions between nonribosomal peptide synthetases and a polyketide synthase. Chemistry & Biology 7: 623-642. Dudkin, L, Dilling, M.B., Cheshire, P.J., Harwood, F.C., Hollingshead, M., Arbuck, S.G., Travis, R., Sausville, E.A., Houghton, P.J. (2001). Biochemical correlates of mTOR inhibition by the rapamycin ester CCI-779 and tumor growth inhibition. Clin. Cancer Res. 7(6):1758-64 Fehr, T., Sanglier, J-J., Schuler, W., Gschwind, L, Ponelle, M., Schilling, W., Wioland, C. (1996). Antascomicinc A, B, C, D and E: Novel FKBP12 binding compounds from a Micromonospora strain. J. Antibiot. 49(3): 230-233. Ferrari, S., Pearson, R.B., Siegmann, M., Kozma, S.C., and Thomas, G. (1993) The immunosuppressant rapamycin induces inactivation of P70s6k through dephosphorylation of a novel set of sites. Journal of Biological Chemistry 268: 16091-16094. Findiay J A, and Radios, L (1980) Canadian Journal of Chemistry 58:579. Fishbein, T.M., Florman, S., Gondolesi, G., Schiano, T., LeLeiko, N., Tschernia, A., Kaufman, S. (2002). Intestinal transplantation before and after the introduction of sirolimus. — Transplantation. 73(10): 1538-42. Foey, A., Green, P., Foxwell, B., Feldmann, M., Brennan, F. (2002). Cytokine- stimulated T cells induce macrophage IL-10 production dependent on phosphatidylinositol 3-kinase and p70S6K: implications for rheumatoid arthritis. Arthritis Res. 4(1):64-70. Epub 2001 Oct 10. Gaisser, S., Reather, J., Wirtz, G., Kellenberger, L., Staunton, J., and Leadlay, P.F. (2000) A defined system for hybrid macrolide biosynthesis in Saccharopolyspora erythraea. Molecular Microbiology 36: 391-401. Gaisser,.S., Lill, R., Staunton, J., Mendez, C, Salas, J., Leadlay, PF. (2002) Parallel pathways for oxidation of 14-membered polyketide macrolactones in Saccharopolyspora erythraea. Mol Microbiol 44:771-81. Galat, A. (2000) Sequence diversification of the FK506-binding proteins in several different genomes. European Journal of Biochemistry 267: 4945-4959. Gregory, C.R., Huie, P., Billingham, M.E. and Morris, R.E. (1993). Rapamycin inhibits arterial intimal thickening caused by both alloimmune and mechanical injury. Its effect on cellular, growth factor and cytokine response in injured vessels. Transplantation 55(6): 1409-1418. Gregory MA, Till R1 Smith, MCM. (in Press) integration site for Streptomyces phage c\|>BT1 and the development of site-specific integrating vectors. J Bacteriol. Guba, M., von Breitenbuch, P., Steinbauer, M., Koehl, G., Flegel, S., Hornung, M., Bruns, C.J., Zuelke, C, Farkas, S., Anthuber, M., Jauch, K.W., and Geissler, E.K. (2002) Rapamycin inhibits primary and metastatic tumor growth by antiangiogenesis: involvement of vascular endothelial growth factor. Nature Medicine 8:128-135. Hamilton, G.S., and Steiner, J. P. (1998) Immunophilins: Beyond immunosuppression. Journal of Medicinal Chemistry 41: 5119-5143. Hara, K., Yonezawa, K., Kozlowski, M.T., Sugimoto, T., Andrabi, K., Weng, Q.P., Kasuga, M., Nishimoto, I., and Avruch, J. (1997) Regulation of elF-4E BP1 phosphorylation by mTOR. Journal of Biological Chemistry 272: 26457- 26463. Hardwick, J.S., Kuruvilla, F.G., Tong, J.K., Shamji, A.F., and Schreiber, S.L. (1999) Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins. Proceedings of the National Academy of Sciences of the United States of America 96:14866- 14870. Hatanaka, H., Kino, T., Miyata, S., Inamura, N., Kuroda, A., Goto, T., Tanaka, H., Okuhara, M. (1988). FR-900520 and FR-900523, novel immunosuppressants isolated from a Streptomyces. II. Fermentation, isolation and physico- chemical and biological characteristics.i/. Antibiot. (Tokyo). 41(11): 1592-601. Hatanaka H, Kino T, Asano M, Goto T, Tanaka H, Okuhara M. (1989). FK-506 related compounds produced by Streptomyces tsukubaensis No. 9993. J. Antibiot (Tokyo). 42(4):620-2. Hendrickson, BA, Zhang, W., Craig, R.J., Jin, Y.J., Bierer, B.E., Burakoff, S., and DiLella, A.G. (1993) Structural organization of the genes encoding human and murine FK506-binding protein (FKBP)13 and comparison to FKBP1. Gene 134: 271-275. Hentges, K.E., Sirry, B., Gingeras, A.C., Sarbassov, D., Sonenberg, N., Sabatini, D., and Peterson, A.S. (2001) FRAP/mTOR is required for proliferation and patterning during embryonic development in the mouse. Proceedings of the National Academy of Sciences of the United States of America 98:13796- 13801. Hopwood, D.A. (1997) Genetic contributions to understanding polyketide synthases. Hosted, T.J., and Baltz, R.H. (1997) Use of rpsL for dominance selection and gene replacement in Streptomyces roseosporus. Journal of Bacteriology MS: 180- 186. Hung, D.T.,-and Schreiber, S.L (1992) cDNA cloning of a human 25 kDa FK506 and rapamycin binding protein. Biochemical and Biophysical Research Communications 184:733-738. Hung, D.T., Jamison, T.F., and Schreiber, S.L. (1996) Understanding and controlling the cell cycle with natural products. Chemistry & Biology 3: 623-639. Jain, S., Bickneli, G.R., Whiting, P.H., Nicholson, M.L (2001). Rapamycin reduces expression of fibrosis-associated genes in an experimental model of renal ischaemia reperfusion injury. Transplant Proc. 33(1-2):556-8. Jin, Y.J., Burakoff, S.J., and Bierer, B.E. (1992) Molecular cloning of a 25-kDa high affinity rapamycin binding protein, FKBP25. Journal of Biological Chemistry 287:10942-10945. Kahan, B.D., Chang, J.Y., and Sehgal, S.N. (1991) Preclinical evaluation of a new potent immunosuppressive agent, rapamycin. Transplantation 52:185-191. Kahan, B.D., and Camardo, J.S. (2001) Rapamycin: Clinical results and future opportunities. Transplantation 72:1181 -1193. Kallen, J. A., Sedrani, R., and Cottens S. (1996) X-ray crystal structure of 28-O- methylrapamycin complexed with FKBP12: Is the cyclohexyl moiety part of the effector domain of rapamycin? Journal of the American Chemical Society 118: 5857-5861. Kawasome, H., Papst, P., Webb, S., Keller, G.M., Johnson, G.L, Gelfand, E.W., and Terada, N. (1998) Targeted disruption of p70s8k defines its role in protein synthesis and rapamycin sensitivity. Proceedings of the National Academy of Sciences of the United States of America 95: 5033-5038. Khaw, C.E., Bohm, GA, Metcalfe, S., Staunton, J., and Leadlay, P.F. (1998) Mutational biosynthesis of novel rapamycins by a strain of Streptomyces hygroscopicus NRRL 5491 disrupted in rapL, encoding a putative lysine cyclodeaminase. Journal of Bacteriology 180: 809-814. Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwood, DA (2000) Practical Streptomyces Genetics, John Innes Foundation, Norwich. Kirby, B., and GrifRths,C.E.M. (2001) Psoriasis: the future. British Journal of Dermatology 144:37-43. Kirchner, G.I., Winkler, M., Mueller L, Vidal, C, Jacobsen, W., Franzke, A., Wagner, S., Blick, S., Manns MP., and Sewing K.-F.(2000) Pharmacokinetics of SDZ RAD and cyclosporin including their metabolites in seven kidney graft patients after the first dose of SDZ RAD. British Journal of Clinical Pharmacology 50:449-454.- Konig, A., Schwecke, T., Molnar, I., Bohm, G., Lowden, PAS., Staunton, J., and Leadlay, P.F. (1997) The pipecolate-incorporating enzyme for the biosynthesis of the immunosuppressant rapamycin. Nucleotide sequence analysis, disruption and heterologus expression of rapPfrom Streptomyces hygroscopicus. European Journal of Biochemistry 247: 526-534. Kunz, J., Loeschmann, A, Deuter-Reinhard, M., and Hall, M.N. (2000) FAP1, a homologue of human transcription factor NF-X1, competes with rapamycin for binding to FKBP12 in yeast. Molecular Microbiology 37:1480-1493. Kuo, C.J., Chung, J.K., Fiorentino, D.F., Flanagan, W.M., Blenis, J., and Crabtree, G.R. (1992) Rapamycin selectively inhibits interleukin-2 activation of p70 S6 kinase. Nature 358:70-73. Lee, M.H. Pascopella, L, Jacobs, W.R., Jr and Hatfull, G.F (1991). Site specific integration of mycobacteriophage L5: integration-proficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis and Bacille Calmette-Guerin: Prpc. Natl. Acad. Sci. USA, 88:3111-3115. Lee MH, Pascopella L, Jacobs WR Jr, Hatfull GF. (1991), Site-specific integration of mycobacteriophage L5: integration-proficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis, and bacille Calmette-Guerin. Proc Natl Acad Sci USA; 88:3111-5. Liang, J., Choi, J., and Clardy, J. (1999) Refined structure of the FKBP12-rapamycin- FRB ternary complex at 2.2 A resolution. Acta Crystallographica Section D- Biological Crystallography 55:736-744. - Lomovskaya, N., Fonstein, L., Ruan, X., Stassi, D., Katz, L, and Hutchinson, C.R. (1997) Gene disruption and replacement in the rapamycin-producing Streptomyces hygroscopicus strain ATCC 29253. Microbiology-Uk 143: 875- 883. Lowden, P.A.S., Bohm, G., Staunton, J., and Leadlay, P.F. (1996) The nature of the starter unit for the rapamycin polyketide sythase. Angewandte Chemie 35: 2249-2251. Lowden, P. A. S., (1997) Ph.D. Dissertation, University of Cambridge. "Studies on the biosynthesis of rapamycin". Lowden. PAS., Wilkinson, B., Bohm, GA, Handa, S., Floss, H.G., Leadlay, P.F., and Staunton, J. (2001) Origin and true nature of the starter unit for the rapamycin polyketide synthase. Angewandte Chemie-lnternational Edition 40: 777-779. Luengo J.!., Yamashita,.D.S., Dunnington, D., Beck, AK., Rozamus, L.W., Yen, H.K., Bossard, M.J., Levy, M.A, Hand, A, Newmantarr, T., Badger, A., Faucette, L, Johnson, R.K., Dalessio, K., Porter, T., Shu, A.Y.L, Heys, R., Choi, J.W., Kongsaeree, P., Clardy, J., and Holt, DA (1995) Structure- Activity Studies of Rapamycin Analogs - Evidence That the C-7 Methoxy Group Is Part of the Effector Domain and Positioned at the Fkbp12-Frap Interface. Chemistry & Biology 2:471-481. Lyons, W.E., George, E.B., Dawson, T.M., Steiner, J.P., and Snyder, S.H. (1994) Immunosuppressant FK506 promotes neurite outgrowth in cultures of RC12 cells and sensory ganglia. Proceedings of the National Academy of Sciences of the United States of America 91:3191-3195. MacNeil, D.J., Gewain, K.M., Ruby, C.L, Dezeny, G., Gibbons, P.H., and MacNeil, T. (1992) Analysis of Steptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111: 61-68. Marahiel, MA, Stachelhaus, T., and Mootz, H.D. (1997) Modular peptide . synthetases involved in nonribosomal peptide synthesis. Chemical Reviews 97: 2651-2673. Matsuura, M., Noguchi, T., Yamaguchi, D., Aida, T., Asayama, M., Takahashi, H. and Shirai, M. (1996). The sre gene (ORF469) encodes a site-specific recombinase responsible for integration of the R4 phage genome. J Bact. 178(11):3374-3376. McAlpine, J. B,.Swanson S. J., Jackson, M., Whittern, D.N. (1991). Revised NMR "assignments for rapamycin. Journal of Antibiotics 44: 688-690. Meo, T. in "Immunological Methods", L Lefkovits and B. Pernis, Eds., Academic Press, N.Y. pp. 227-239 (1979). Molnar, I., Aparicio, J.F., Haydock, S.F., Khaw, L.E., Schwecke, T., Konig, A, Staunton, J., and Leadlay, P.F. (1996) Organisation of the biosynthetic gene cluster for rapamycin in Streptomyces hygroscopicus: analysis of genes flanking the polyketide synthase. Gene 169:1-7. Morice, M.C., Serruys, P.W., Sousa, J.E., Fajadet, J., Ban Hayashi, E., Perin, M., Colombo, A, Schuler, G., Barragan, P., Guagliumi, G., Molnar, F., Falotico, R. (2002). RAVEL Study Group. Randomized Study with the Siroiimus- Coated Bx Velocity Balloon-Expandable Stent in the Treatment of Patients with de Novo Native Coronary Artery Lesions. A randomized comparison of a sirolimus-eluting stent with a standard stent for coronary revascularization. N. EngJJ. Med. 346(23): 1773-80. Motamedi, H., Shafiee, A., Cai, S.J., Streicher, S.L., Arison, B.H., and Miller, R.R. (1996) Characterization of methyltransferase and hydroxylase genes involved in the biosynthesis of the immunosuppressants FK506 and FK520. Journal of Bacteriology 178: 5243-5248. Motamedi, H., Cai, S.J., Shafiee, A., and Elliston, K.O. (1997) Structural organization of a multifunctional polyketide synthase involved in the biosynthesis of the macrolide immunosuppressant FK506. European Journal of Biochemistry 244: 74-80. Motamedi, H., and Shafiee, A (1998) The biosynthetic gene cluster for the macrolactone ring of the immunosuppressant FK506. European Journal of Biochemistry 256: 528-534. Myckatyn, T.M., Ellis, RA, Grand, A.G., Sen, S.K., Lowe, J.B. 3rd, Hunter, DA, Mackinnon, S.E. (2002). The effects of rapamycin in murine peripheral nerve isografts and allografts. Plast. Reconstr. Surg. 109(7):2405-17. Nave, B.T., Ouwens, D.M., Withers, D.J., Alessi, D.R., and Sheperd, P.R. (1999) Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino- acid deficiency on protein translation. Biochemical Journal 344:427-431. Navia, MA (1996) Protein-drug complexes important for immunoregulation and organ transplantation. Current Opinion in Structural Biology 6: 838-847. NCCLSTReference Method for Broth Dilution Antifungal Susceptibility Testing for Yeasts: Approved Standard M27-A, vol. 17 No. 9. (1997). Nishida, H., Sakakibara, T., Aoki, F., Sa'rto, T., Ichikawa, K., Inagaki, T., Kojima, Y., Yamauchi, Y., Huang, L.H., Guadliana, MA, Kaneko, T., and Kojima, N. (1995) Generation of novel rapamycin structures by microbial manipulations. Journal of Antibiotics 48: 657-666. Nielsen, J.B., Hsu, M.J., Byrne, K.M., and Kaplan, L (1991) Biosynthesis of the immunosuppressant immunomycin: the enzymology of pipecolate incorporation. Biochemistry 30: 5789-5796. Paget, M.S.B., Chamberlin, L, Atrih, A., Foster, S.J., and Buttner, M.J. (1999) Evidence that the extracytoplasmic function sigma factor c^ is required for normal cell wall structure in Streptomyces coelicolor A3(2). Journal of Bacteriology 181:204-211) Paiva, N.L, Demain, A.L, and Roberts, M.F. (1991) Incorporation of acetate, propionate, and methionine into rapamycin By Streptomyces hygroscopicus. Journal of Natural Products 54:167-177. Paiva, N.L., Demain, A.L, and Roberts, M.F. (1993) The immediate precursor of the nitrogen-containing ring of rapamycin is free pipecolic acid. Enzyme and Microbial Technology 15:581-585. Patterson, C.E., Schaub, T., Coleman, E.J., and Davies E.C. (2000) Developmental regulation of FKBP65. An ER-localized extracellular matrix binding-protein. Molecular Biology of the Cell 11:3925-3935. Pfeifer, BA, Admiraal, S.J., Gramajo, H., Cane, D.E., and Khosla, C. (2001) Biosynthesis of complex polyketides in a metabolically engineered strain of £. co//. Science 291:1790-1792. Powell, N., Till, S., Bungre, J., Corrigan, C. (2001). The immunomodulatory drugs cyclosporin A, mycophenolate mofetil, and sirolimus (rapamycin) inhibit allergen-induced proliferation and IL-5 production by PBMCs from atopic asthmatic patients. J. Allergy Clin. Immunol. 108(6):915-7 Rabinovitch, A., Suarez-Pinzon, W.L., Shapiro, A.M., Rajotte, R.V., Power, R. (2002). Combination therapy with sirolimus and interleukin-2 prevents spontaneous and recurrent autoimmune diabetes in NOD mice.Diabetes. 51(3):638-45. Raught, B., Gingras, A.C., and Sonenberg, N. (2001) The target of rapamycin (TOR) proteins. Proceedings of the National Academy of Sciences of the United States of America 98:7037-7044. Rawlings, B.J. (2001) Type I polyketide. biosynthesis in bacteria (Part A). Natural Product Reports 18:190-227. Reather, J. A., (2000), Ph.D. Dissertation, University of Cambridge. "Late steps in the biosynthesis of macrocyclic lactones". Re'rtamo, S., Spuls, P., Sassolas, B., Lahfa, M., Claudy, A., Griffiths, C.E.; Sirolimus European Psoriasis Study Group. (2001). Efficacy of sirolimus (rapamycin) administered concomitantly with a subtherapeutic dose of cyclosporin in the treatment of severe psoriasis: a randomized controlled trial. Br. J. Dermatol. 145(3):438-45. Rosen, M.K., and Schreiber, S.L (1992) Natural products as probes of cellular function: studies of immunophilins. Angewandte Chemie-lnternational Edition in English 31: 384-400. Roymans, D., and Siegers, H. (2001) Phosphaditidylinositol 3-kinases in tumor progression. European Journal of Biochemistry 268:487-498. Ruan, XA, Stass, D., Lax, SA, and Katz, L (1997) A second type-l PKS gene cluster isolated from Streptomyces hygroscopicus ATCC 29253, a rapamycin- producing strain. Gene 203:1-9. Salituro, G.M., Zink, D.L, Dahl, A., Nielsen, J., Wu, E., Huang, L, Kastner C, Dumont, F. (1995) Meridamycin: a novel nonimmunosuppressive FKBP12 ligandfrom Streptomyces hygroscopicus. Tetrahydron letters 36: 997-1000. Schwarzer, D., and Marahiel, MA. (2001) Multimodular biocatalysts for natural product assembly. Naturwissenschaften 88: 93-101. Sambrook, J., Fritsch. E.F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, N.Y. Schreiber, S.L, and Crabtree, G.R. (1992) The mechanism of action of cyclosporine A and FK506. Immunology Today 13:136-142. Schwecke, T., Aparicio, J.F., Molnar, l., K6nig, A., Khaw, L.E., Haydock, S.F., Oliynyk, M., Caffrey, P., Cortes, J., Lester, J.B., Bohm, G.A., Staunton, J., • and Leadlay, P.F. (1995) The biosynthetic gene cluster for the polyketide immunosuppressant rapamycin. Proceedings of the National Academy of Sciences of the United States of America 92: 7839-7843. Sedrani, R., Cottens, S., Kallen, J., and Schuler, W. (1998) Chemical modifications of rapamycin: the discovery of SDZ RAD. Transplantation Proceedings 30: 2192-2194. ' £ • ■ Sehgal,"S.N., Baker, H., and Vezina, C. (1975) Rapamycin (AY-22,989), a new antifungal antibiotic II. Fermentation, isolation and characterization. The Journal of Antibiotics 28:727-733. Shepherd, P.R, Withers, D.J., and Siddle K. (1998) Phosphoinositide 3-kinase: the key switch mechanism in insulin signalling. Biochemical Journal 333:471- 490. Shima, J., Hesketh, A., Okamoto, S., Kawamoto, S., and Ochi, K. (1996) Induction of actinorhodin production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin resistance in Streptomyces lividans and Streptomyces coelicolor A3(2). Journal of Bacteriology 178: 7276-7284. Sigal, N.H., and Dumont, F.J. (1992) Cyclosporin A, FK-506, and rapamycin: pharmacological probes of lymphocyte signal transduction. Annual Review of Immunology 10:519-560. Sieuwerts, A.M., Klijn, J.G., Peters, H.A., Foekens, J.A. (1995). The MTT tetrazolium salt assay scrutinized: how to use this assay reliably to measure metabolic activity of cell cultures in vitro for the assessment of growth characteristics, IC50-values and cell survival. Eur. J Clin. Chem. Clin. Biochem. 33(11):813- 23. Smovkina, T., Mazodier, P., Boccard, F., Thompson, CJ. and Guerineau, M. (1990) Construction of a series of pSAM2-based integrative vectors for use in actinomycetes. Gene 94:53-59. SOULILLOU, J.P., CARPENTER, C.B., LUNDIN, A.P. and STROM, T.B. (1975) Augmentation of proliferation and in vitro production of cytotoxic cells by 2-ME in the rat J Immunol. 115(6): 1566-71. Staunton, J., and Weissman, K.J. (2001) Polyketide biosynthesis: a millennium review. Natural Product Reports 18:380-416. Steiner, J.P., Hamilton, G.S., Ross, D. T., Valentine, H.L, Guo, H., Connolly, M.A., Liang, S., Ramsey, C, Li, J.-H.J., Huang, W., Howorth, P., Soni, R., Fuller, M., Sauer, H., Nowotnik, A.C., and Suzdak, P.D. (1997) Neutrophic immunophiiin ligands stimulate structural and functional recovery in neurodegenerative animal models. Proceedings of the National Academy of Sciences of the United States of America 94:2019-2024. Tang, S.J., Reis, G., Kang, H., Gingras, A-C., Sonenberg, N., and Schuman, E.M. (2002) A rapamycin-sensitive signaling pathway contributes to long-term synaptic plasticity in the hippocampus. Proceedings ofthe National Academy of Sciences of the United States of America 1:467-472. Van Duyne, G.D., Standaert, R.F., Karplus, PA, Schreiber, S.L,.and Clardy, J. (1993) Atomic structures of the human immunophiiin FKBP-12 complexes with FK506 and rapamycin. Journal of Molecular Biology 229:105-124. Van Mellaert L, Mei, L, Lammertyn, E., Schacht, S., and Anne, J. (1998) Site- specific integration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector. Microbiology 144:3351-3358. Vezina, C, Kudelski, A., and Sehgal, S.N. (1975) Rapamycin (AY-22,989), a new antifungal antibiotic. I. Taxonomy of the producing streptomycete and isolation of the active principle. 777e Journal of Antibiotics 28: 721-726. Vilella-Bach, M., Nuzzi, P., Fang, Y.M., and Chen, J. (1999) The FKBP12-rapamycin- binding domain is required for FKBP12-rapamycin-associated protein kinase activity.and Gi progression. Journal of Biological Chemistry 274:4266-4272. Waller, J.R., and Nicholson, M.L (2001) Molecular mechanisms of renal allograft fibrosis. British Journal of Surgery 88:1429-1441. Warner, L.M., Adams, L.M., Chang, J.Y., Sehgal, S.N. (1992). A modification of the in vivo mixed lymphocyte reaction and rapamycin's effect in this model.Clin. Immunol. Immunopathol. 64(3):242-7. Weber, T., and Marahiel, M.A. (2001) Exploring the domain structure of modular nonribosomal peptide synthetases. Structure 9: R3-R9 Welch, J. T. and Seper, K., W., (1988), J. Org. Chem., 53,2991-2999 Wilkinson, B., Foster, G., Rudd, BAM., Taylor, N.L., Blackaby, A.P., Sidebottom, P.J., Cooper, D.J., Dawson, M.J., Buss, A.D., Gaisser, S., Bohm, I.U., Rowe, C.J., Cortes, J., Leadlay, P.F. and Staunton, J. (2000). Novel octaketide macrofides related to 6-deoxoerythronolide B provide evidence for iterative operation of the erythromycin polyketide synthase. Chemistry & Biology 7: 111-117. Wong, G.K., Griffith, S., Kojima, I., and Demain, A.L. (1998) Antifungal activities of rapamycin and its derivatives, prolylrapamycin, 32-desmethylrapamycin, and 32-desmethoxyrapamycin. Journal of Antibiotics 51:487-491. Wu, K., Chung, L., Revill, W.P., Katz, L, and Reeves, CD. (2000) The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene 251: 81-90. Yem, A!W., Tomasselli, A.G., Heinrikson, R.L., Zurcher-Neely, H., Ruff, VA., Johnson, RA, and Deibel, M.R. (1992) The Hsp56 component of steroid receptor complexes binds to immobilized FK506 and shows homology to FKBP-12 and FKBP-13. Journal of Biological Chemistry 267: 2868-2871. Yu, K., Toral-Barza, L, Discafani, C, Zhang, W.G., Skotnicki, J., Frost, P., Gibbons, J.J. (2001) mTOR, a novel target in breast cancer the effect of CCI-779, an mTOR inhibitor, in preclinical models of breast cancer. Endocrine-Related Cancer 8:249-258. Zhu, J., Wu J., Frizell, E., Liu, S.L, Bashey, R., Rubin, R., Norton, P., Zern, MA (1999). Rapamycin inhibits hepatic stellate cell proliferation in vitro and limits fibrogenesis in an in vivo model of liver fibrosis. Gastroenterology. 117(5):1198-204. WE CLAIM : 1. A method of generating analogues of FKBP-ligands which incorporate a non-natural starter unit, said method comprising: (a) generating a recombinant strain in which at least the rapK homologue which has at least 40% sequence identity to the sequence of rapK as shown in SEQ ID NO: 13 has been deleted or inactivated; and (b) feeding a non-natural starter unit to said strain. 2. The method as claimed in claim 1, which additionally comprises deleting one or more further auxiliary genes. 3. The method as claimed in any one of claims 1 or 2, which additionally comprises restoring by complementation one or more of the deleted genes. 4. The method as claimed in any one of claims 1 to 3, which additionally comprises the step of isolating and purifylng the FKBP-ligand analogues generated. 5. The method as claimed in any one of claims 1 to 4, wherein said non-natural starter unit is selected from the group consisting of: 2-norbornane carboxylic acid; 2- (cis/trans)-hydroxycyclohexane carboxylic acid; 3-(cis/trans)-hydroxycyclohexane carboxylic acid; 4-(cis/trans)-hydroxycyclohexane carboxylic acid; 2-(cis/trans)- methylcyclohexane carboxylic acid; 4-(cis/trans)-methylcyclohexane carboxylic acid; 3-(cis/trans)-methoxycyclohexane carboxylic acid; 4-(cis/trans)-methoxycyclohexane carboxylic acid; 4-oxo cyclohexane carboxylic acid; 2-oxo cyclohexane carboxylic acid; 4-trans-n-pentylcyclohexane carboxylic acid; 2-trans-aminocyclohexane carboxylic acid; 4-cis-aminocyclohexane carboxylic acid; 4-(cis/trans)- aminomethylcyclohexane carboxylic acid; cyclopentane carboxylic acid; cyclobutane carboxylic acid; 1-methylcyclohexane carboxylic acid; 3-trans-hydroxy-4-cis- fluorocyclohexane carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis- hydroxy-3-trans-fluorocyclohexane carboxylic acid; 3-c/'s-hydroxy-4-trans- chlorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans-chlorocyclohexane carboxylic acid; 3-trans-hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4-trans- hydroxy-3-cis-chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide carboxylic acid; 3-cis-cyclohexeneoxide carboxylic acid; 3,4-cis- dihydroxycyclohexane carboxylic acid and 3,4-trans-dihydroxycyclohexane carboxylic acid; cyclohexaneacetic acid; cyclohexanepropionic acid and 4-cis/trans-tert- butylcyclohexane carboxylic acid or simple esters or salts thereof. 6. The method as claimed in claim 5, wherein said non-natural starter unit is selected from the group consisting of: 3-(cis/trans)-hydroxycyclohexane carboxylic acid; 4- (cis/trans)-hydroxycyclohexane carboxylic acid; 3-(cis/trans)-methoxycyclohexane carboxylic acid; 4-(cis/trans)-methoxycyclohexane carboxylic acid; 4-oxo cyclohexane carboxylic acid; cyclobutane carboxylic acid; 3-trans-hydroxy-4-cis- fluorocyclohexane carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis- hydroxy-3-trans-fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans- chlorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans-chlorocyclohexane carboxylic acid; 3-trans-hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4-trans- hydroxy-3-cis-chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide carboxylic acid; 3-cis-cyclohexeneoxide carboxylic acid; 3,4-cis- dihydroxycyclohexane carboxylic acid and 3,4-trans-dihydroxycyclohexane carboxylic acid; cyclohexanepropionic acid; 4-cis/trans-tert-butylcyclohexane carboxylic acid or simple esters or salts thereof. 7. The method as claimed in claim 5 provided that the non-natural starter fed to said recombinant strain is not: cyclohexane carboxylic acid, 3-cis,A-trans- dihydroxycyclohexane carboxylic acid, 1-cyclohexene carboxylic acid, 3-cyclohexene carboxylic acid, cycloheptane carboxylic acid, 3-(cis/trans)-methylcyclohexane carboxylic acid, 4-(cis/frans)-methylcyclohexane carboxylic acid, 1-cycloheptene carboxylic acid or 5-cis-hydroxyl-3-cyclohexene carboxylic acid. 8. The method as claimed in any one of claims 1 to 7, wherein the recombinant strain of part (a) is made according to a method comprising: (a) constructing a conjugative deletion plasmid in an E. coli strain that is dam", dcm" or dam" and dcm. (b) generation of spores from said host strain suitable for conjugation wherein said strain is grown at a humidity of between 10% and 40% and the spores are harvested at between 5 and 30 days; (c) conjugating the E. coli strain of step (a) with the spores from step (b) on a medium that comprises per litre: i) 0.5g to 5g corn steep powder, ii) 0.1g to 5g Yeast extract, iii) 0.1g to 10g calcium carbonate; and iv) 0.01g to 0.5 g iron sulphate; said medium additionally containing BACTO-agar and starch and having been dried to result in 1-20% weight loss; and (d) optionally culturing the recombinant strain under conditions suitable for polyketide production. 9. The method as claimed in any one of claims 1 to 8, wherein the strain is selected from the group consisting of Streptomyces hygroscopicus subsp. hygroscopicus NRRL 5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891, Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces tsukubaensis No.9993 FERM BP-927, Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429 and Streptomyces sp. MA 6858 ATCC 55098. 10. The method as claimed in claim 9, wherein the strains are selected from the group consisting of: S. hygroscopicus subsp. hygroscopicus NRRL 5491 and S. hygroscopicus var. ascomyceticus ATCC 14891. 11. The method as claimed in claim 10, wherein the strain is the rapamycin producer S. hygroscopicus subsp. hygroscopicus NRRL 5491. 12. The method as claimed in claim 3, wherein the process of restoring the deleted genes comprises: (a) constructing a gene cassette which contains one or more of the deleted genes and (b) transforming said recombinant strain that contains biosynthetic clusters that encode FKBP-ligands with said gene cassette. 13. The method as claimed in claim 12, wherein said gene cassette is assembled directly in an expression vector. 14. The method as claimed in claim 12 or 13, wherein the complementation is homologous. 15. The method as claimed in claim 12 or 13, wherein the complementation is heterologous. 16. The method as claimed in any one of claims 2 to 15, wherein said one or more deleted or inactivated auxiliary genes are selected from the group consisting of starter unit supply genes, amino acid precursor supply genes, cytochrome P-450 monooxygenases, ferredoxins and SAM-dependent O-methyltransferases. 17. The method as claimed in claim 16, wherein the deleted or inactivated genes are selected from the group consisting of rapL, rapN, rapO, rapM, rapQ, rapl and rapJ. 18. A recombinant strain that contains biosynthetic clusters that encode FKBP-ligands, wherein at least the rapK homologue has been deleted or inactivated. 19. The recombinant strain as claimed in claim 18, wherein the strain is selected from the group consisting of Streptomyces hygroscopicus subsp. hygroscopicus NRRL 5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891, Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces tsukubaensis No.9993 FERM BP-927, Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429 and Streptomyces sp. MA 6858 ATCC 55098. 20. The recombinant strain as claimed in claim 19, wherein the strains are selected from the group consisting of S. hygroscopicus subsp. hygroscopicus NRRL 5491 and S. hygroscopicus var. ascomyceticus ATCC 14891. 21. The recombinant strain as claimed in claim 20, wherein the strain is the rapamycin producer S. hygroscopicus subsp. hygroscopicus NRRL 5491. 22. The recombinant strain as claimed in any one of claims 18 to 21, wherein the additionally deleted or inactivated auxiliary genes are selected from the group consisting of: rapL, rapN/O, rapQ, rapM, rapl and rapJ have been deleted, wherein said deletion is not rapQrapN/OrapMrapL A METHOD OF GENERATING ANALOGUES OF FKBP-LIGANDS WHICH INCORPORATE A NON-NATURAL STARTER UNIT ABSTRACT The present invention relates to production of polyketides and other natural products and to libraries of compounds and individual novel compounds. One important area is the isolation and potential use of novel FKBP-ligand analogues and host cells that produce these compounds. The invention is particularly concerned with methods for the efficient transformation of strains that produce FKBP analogues and recombinant cells in which cloned genes or gene cassettes are expressed to generate novel compounds such as polyketide (especially rapamycin) FKBP-ligand analogues, and to processes foT their preparation, and to means employed therein (e.g. nucleic acids, vectors, gene cassettes and genetically modified strains).

Full Text

The instant application is divided out of Indian Patent Application No.
1971/KOLNP/2004.
Field of the Invention
The present invention relates to novel polyketide (rapamycin) fkbp-ligand
analogues and method for production thereof. One
important area is the isolation and potential use of novel FKBP-ligand analogues and
host cells that produce these compounds. The invention is particularly concerned
with methods for the efficient transformation of strains that produce FKBP analogues
and recombinant cells in which cloned genes or gene cassettes are expressed to
generate novel compounds such as polyketide (especially rapamycin) FKBP-ligand
analogues, and to processes for their preparation, and to means employed therein
(e.g. nucleic acids, vectors, gene cassettes and genetically modified strains).
Background of the invention
Rapamycin (sirolimus) (Figure 1) is a lipophilic macrolide produced by
Streptomyces hygroscopicus NRRL 5491 (Sehgal et al., 1975; Vezina et al., 1975;
U.S. Patent No. 3,929,992; U.S. Patent No. 3,993,749) with a 1,2,3-tricarbonyl
moiety linked to a pipecolic acid lactone (Paiva et al., 1991). Other related macrolides
(Figure 2) include FK506 (tacrolimus) (Schreiber and Crabtree, 1992), FK520
(ascomycin or immunomycin) (Wu et al., 2000), FK525 (Hatanaka H, et al., 1989,
FK523 (Hatanaka, H., et al, 1988), antascomicins (Fehr, T., et al., 1996) and
meridamycin (Salituro et al., 1995). For the purpose of this invention rapamycin is
described by the numbering convention of McAlpine et al. (1991) in preference to the
numbering conventions of Findlay et al. (1980) or Chemical Abstracts (11th-
Cumulative Index, 1982-1986 p60719CS).
The versatile mode of action of rapamycin demonstrates the pharmacological
value ofthe compound and emphasizes the necessity to isolate novel derivatives of
the drug. Rapamycin shows moderate antifungal activity, mainly against Candida
species but also against filamentous fungi (Baker ef al., 1978; Sehgal et al., 1975;
Vezina et a!., 1975; U.S. Patent No. 3,929,992; U.S. Patent No. 3,993,749).
Rapamycin inhibits cell proliferation by targeting signal transduction pathways in a
variety of cell types, e.g. by inhibiting signalling pathways that allow progression from
the G1 to the S-phase of the cell cycle (Kuo ef al., 1992). In T cells rapamycin inhibits
signalling from the IL-2 receptor and subsequent autoproliferation of the T cells
resulting in immunosuppression. The inhibitory effects of rapamycin are not limited to

T cells, since rapamycin inhibits the proliferation of many mammalian cell types
(Brunn ef al, 1996). Rapamycin is, therefore, a potent immunosuppressant with
established or predicted therapeutic applications in the prevention of organ allograft
rejection and in the treatment of autoimmune diseases (Kahan et al., 1991). It
appears to cause fewer side effects than the standard anti-rejection treatments
(Navia, 1996). 40-O-(2-hydroxy)ethyl-rapamycin (SDZ RAD, Certican, Everolimus) is
a semi-synthetic analogue of rapamycin that shows immunosuppressive
pharmacological effects (Sedrani, R. et al., 1996; U.S. 5,655,772).The clinical
efficacy of the drug is presently under investigation in Phase III clinical trials (Kirchner
et aL, 2000). The rapamycin ester CCI-779 (Wyeth-Ayerst) inhibits cell growth in vitro
and inhibits tumour growth in vivo (Yu et al., 2001). The drug is currently in Phase 111
clinical trials. The value of rapamycin in the treatment of chronic plaque psoriasis
(Kirby and Griffiths, 2001), the potential use of effects such as the stimulation of
neurite outgrowth in PC12 cells (Lyons et al., 1994), the block of the proliferative
responses to cytokines by vascular and smooth muscle cells after mechanical injury
(Gregory et a/., 1993) and its role in prevention of allograft fibrosis (Waller and
Nicholson, 2001) are areas of intense research (Kahan and Camardo, 2001). Recent
reports reveal that rapamycin is associated with lower incidence of cancer in organ
allograft patients on long-term immunosuppressive therapy than those on other
immunosuppressive regimes, and that this redueed cancer incidence is due to
inhibition of angiogenesis (Guba et al., 2002). It has been reported that the
neurotrophic activities of immunophifin ligands are independent of their
immunosuppressive activity (Steiner et al., 1997) and that nerve growth stimulation is
promoted by disruption of the mature steroid receptor complex as outlined in the
patent application WO01/03692. Side effects such as hyperiipidemia and
thrombocytopenia as well as potential teratogenic effects have been reported
(Hentges et a/., 2001; Kahan and Camardo, 2001).
. The polyketide backbone of rapamycin is synthesised by head-to-tail
condensation of a total of seven propionate and seven acetate units to a shikimate
derived cyclohexane carboxylic acid starter unit (Paiva et al., 1991). The L-lysine
derived imino acid, pipecolic acid, is condensed via an amide linkage onto the last
acetate of the polyketide backbone (Paiva et el, 1993) and is followed by
lactonisation to form the macrocycle. A107 kb genomic region containing the
biosynthetic gene cluster has been sequenced (Schwecke ef at., 1995). Analysis of
the open reading frames revealed three large genes encoding the modular polyketide

synthase (PKS) (Aparicio et al., 1996; Schwecke et al., 1995). Embedded between
the PKS genes lies the rapP gene encoding a protein with sequence similarity to
activation domains of nonribosomal peptide synthetases and it is thought to act
analogously (Konig et al., 1997). The region encoding the PKS genes is flanked on
both sides by 24 additional open reading frames encoding enzymes believed to be
required for the biosynthesis of rapamycin (Molnar et al., 1996). These include the
following post-polyketide modification enzymes: two cytochrome P-450
monooxygenases, designated as RapJ and RapN, an associated ferredoxin RapO,
and three potential SAM-dependent O-methyltransferases Rapl, RapM and RapQ.
Other adjacent genes have putative roles in the regulation and the export of
rapamycin (Molnar et al., 1996). The cluster also contains the gene rapL whose
product RapL is proposed to catalyse the formation of the rapamycin precursor L-
pipecolic acid through the cyclodeamination of L-lysine (Khaw et al., 1998; Paiva et
al., 1993). The introduction of a frameshift mutation into rapL gave rise to a mutant
unable to produce significant amounts of rapamycin and feeding of L-pipecolic acid to
the growth medium restored wild-type levels of rapamycin production (Khaw et al.,
1998). The biosynthetic precursors to the cyclohexane ring of rapamycin originate
from the shikimic acid pathway (Lowden et al., 1996; Lowden et al., 2001). Other
closely-related macrolides such as FK506 (tacrolimus) (Schreiber and Crabtree,
1992), FK520 (ascomycin or immunomycin) (Wu et al., 2000), antascomicin (Fehr,
T., et al., 1996) and meridamycin (Salituro et al., 1995) share a common
pharmacophore that interacts with FK506-binding proteins (FKBPs) (Figure 2). Thus
rapamycin and related compounds for example, but without limitation, FK506, FK520,
'hyg', FK523, meridamycin, antascomicin, FK525 and tsukubamycin can be
considered "FKBP-ligands". The partial sequence of the FK506 gene cluster
(Motamedi et al., 1996; Motamedi et a/., 1997; Motamedi and Shafiee, 1998), the
'hyg' cluster (Ruan et al., 1997) and the complete sequence of the FK520 gene
cluster have been published (Wu et al., 2000; U.S. Patent No. 6,150,513). There is
significant homology between genes within these clusters and the rapamycin
biosynthetic gene cluster and similarity in enzyme function (Motamedi et al., 1996).
The pharmacologic actions of rapamycin characterised to date are believed to
be mediated by the interaction with cytosolic receptors termed FKBPs or
immunophilins. lmmunophilins (this term is used to denote immunosuppressant
binding proteins) catalyse the isomerisation of cis and trans peptidyl-proline bonds
and belong to a highly conserved family of enzymes found in a wide variety of

organisms (Rosen and Schreiber, 1992). Two large groups of enzymes belonging to
the family of immunophilins are represented by FKBPs and cyclophilins (Schreiber
and Crabtree, 1992). The major intracellular rapamycin receptor in eukaryotic T-cells
is FKBP12 (DiLella and Craig, 1991) and the resulting complex interacts specifically
with target proteins to inhibit the signal transduction cascade of the cell. FK506, an
immunosuppressive agent structurally related to rapamycin, also specifically binds to
FKBP12 but it effects immunosuppression through a different mechanism (Chang et
al., 1991; Sigal and Dumont, 1992). Rapamycin and FK506 compete for the same
binding site, thus FK506 can have an antagonistic effect with rapamycin when the
two drugs are used together (Cao et al., 1995). Analysis of the crystal structure of
the FKBP12-rapamycin complex has identified a rapamycin-binding pharmacophore
termed the 'binding domain' (Van Duyne et al., 1993) (see Figure 1). The 'binding
domain' is required for the interaction with the immunophilin and consists, for both
FK506 and rapamycin, of the C-1 to C-14 region including the ester linkage, the
pipecolinyl ring, the dicarbonyl and the hemiketal ring (see Figure 2). The interaction
is characterised by many hydrophobic contacts and some hydrogen bonds including
one to the hydroxyl group on the cyclohexane ring. The pipecolinyl ring (C2 to N7)
makes the deepest penetration into the protein where it is surrounded by highly
conserved aromatic amino acid, residues lining the hydrophobic binding cavity. Both
the C1 and the CB carbonyl groups are involved in hydrogen bonding and the C9
carbonyl group protrudes into a pocket formed by three completely conserved
aromatic amino acid residues (one tyrosine and two phenylalanine acid residues) in
FKBP12. The domain of the immunophilin-ligand complex interacting with the target
protein projects away from FKBP.
The target of the rapamycin-FKBP12 complex has been identified in yeast as
TOR (target of rapamycin) (Alarcon et a/., 1999) and the mammalian protein is known
as FRAP (FKBP-rapamycin associated protein) or mTOR (mammalian target of
rapamycin) (Brown et a/., 1994). These proteins show significant similarity to the
phosphotransferase domains of phosphatidylinositol 3- kinases and the observation
that a point mutation in the FKBP12-rapamycin binding domain (FRB) of mTOR
abolishes mTOR kinase activity provides evidence for the involvement of FRB in the
function of the kinase domain (Vilella-Bach et al., 1999). The crystal structure of
FKBP12-rapamycin with a truncated form of mTOR containing the FRB domain
(Chen ef at., 1995) has been obtained thus defining the 'effector' domain of
rapamycin (Choi et al., 1996; Liang et al., 1999). The analysis of the crystal structure

revealed that protein-protein contacts are relatively limited compared to the
interaction between rapamycin and each protein. No hydrogen bonds between
rapamycin and FRB were identified. Interaction is concentrated in a series of
hydrophobic contacts between the triene region of rapamycin and mainly aromatic
residues of FRB (Liang et al., 1999). The most deeply buried atom of rapamycin is
the methyl attached to C23 (see Figure 2). The C23 to C34 region and the
cyclohexyl ring of rapamycin make superficial hydrophobic contacts with FRB. A
small conformational change in rapamycin was evident between the binary and the
ternary complexes (Liang et al., 1999).
Divergences between the biological effects of C16 methcxy group rapamycin
analogues and their ability to bind FKBP12 were detected and the location of the C16
subsfrtuents at the interfacial space between FKBP12 and mTOR was postulated
(Luengo et al., 1995). The analysis of the crystal structure of FKBP12 with the non-
immunosuppressive 28-Omethyl rapamycin revealed a significant difference in the
orientation of the cyclohexyl ring which may result in disruption of mTOR binding
(Kallen et al., 1996).
Rapamycin impacts signalling cascades within the cell through the inhibition
of the p70S6k kinase, a serine/threonine kinase in higher eukaryotes which
phosphorylates the ribosomal protein S6 (Ferrari et al., 1993; Kuo et al., 1992). The
S6 protein is located in the ribosomal 40S subunit and it is believed to be an
important functional site involved in tRNA and mRNA binding. A regulatory function
for mRNA translation through S6 phosphorylation by p70S6k has been postulated
(Kawasome et al., 1998). Rapamycin inhibits protein synthesis through its effect on
other growth related events, including the activity of cyclin-dependent kinases,
phosphorylation of cAMP-responsive element modulator (CREM) and
phosphorylation of the elongation factor binding protein 4E-BB1 (PHAS1) (Hung et
al., 1996). The drug induces the accumulation of the dephosphorylated species of
4E-BP1 that binds to the translation initiation factor elF-4E, thus, suppressing
translation initiation of cap-dependent mRNAs (Hara et al., 1997; Raught et al.,
2001).
A link between mTOR signalling and localized protein synthesis in neurons;
the effect on the phosphorylation state of proteins involved in translational control;
the abundance of components of the translation machinery at the transcriptional and
translational levels; control of amino acid permease activity and the coordination of
the transcription of many enzymes involved in metabolic pathways have been

described (Raught et al., 2001). Rapamycin sensitive signalling pathways also
appear to play an important role in embryonic brain development, learning and
memory formation (Tang et al., 2002). Research on TOR proteins in yeast also
revealed their roles in modulating nutrient-sensitive signalling pathways (Hardwick et
al., 1999). Similarly, mTOR has been identified as a direct target for the action of
protein kinase B and of having a key role in insulin signalling (Shepherd et al., 1998;
Nave et al., 1999). Mammalian TOR has also been implicated in the polarization of
the actin cytoskeleton and the regulation of translational initiation (Alarcon et al.,
1999). Phophatidylinositol 3-kinases, such as mTOR, are functional in several
aspects of the pathogenesis of tumours such as cell-cycle progression, adhesion, cell
survival and angiogenesis (Roymans and Siegers, 2001).
Most immunophilins do not appear to be directly involved in
immunosuppressive activities and relatively little is known concerning their natural
ligands although candidates for natural ligands of the FKBPs termed FKBP-
associated proteins (FAP) such as FAP48 and FAP1 have been reported. The
specific interaction of FAPs with FKBPs during the formation of complexes was
prevented by rapamycin in a dose-dependent manner (Chambraud et al., 1996; Kunz
et al., 2000). Immunophilins appear to function in a wide range of cellular activities
such as protein folding; assembly and trafficking of proteins; co- regulation of
molecular complexes including heat shock proteins; steroid receptors; ion channels;
cell-to-cell interactions and transcription and translation of genes (Galat 2000;
Hamilton and Steiner 1998). All immunophilins possess the protein folding property
of peptidyl-prolyl cis-trans isomerisation and several immunophilins are found located
in the endoplasmic reticulum, a principal site of protein synthesis in the cell. In
addition to FKBP12 (U.S. 5,109,112) other immunophilins include FKBP12.6 (U.S.
5,457,182), FKBP13 (Hendrickson et al., 1993; U.S. 5,498,597), FKBP25 (Hung and
Schreiber, 1992; Jin et al., 1992), FKBP14.6 (U.S. 5,354,845), FKBP52 (U.S.
5,763,590), FKBP60 (Yem et al., 1992) and FKBP65 (Patterson et al., 2000).
The multitude of the FKBP's which are present in different cell types also
underline the utility of isolating novel FKBP-ligand analogues with potentially
changed binding and/or effector domains.
Pharmacokinetic studies of rapamycin and rapamycin analogues have
demonstrated the need for the development of novel rapamycin compounds that may
be more stable in solution, more resistant to metabolic attack and have improved bio-
availability. Modification using chemically available positions on the molecule has

been addressed, however, this approach has limited utility as the sites available for
chemical modification are limited and there is less ability to selectively modify a
particular position. Biological approaches to producing novel rapamycin analogues
have been less successful due to the difficulties encountered in working with the
organism (Lomovskaya et al., 1997; Kieser et al., 2000) despite the availability of the
sequence of the biosynthetic gene cluster of rapamycin from S. hygroscopicus
(Schwecke et al., 1995).
A range of synthesised rapamycin analogues using the chemically available
sites of the molecule has been reported. The description of the following compounds
Was adapted to the numbering system of the rapamycin molecule described in Figure
1. Chemically available sites on the molecule for derivatisation or replacement
include C40 and C28 hydroxyl groups (e.g. U.S. 5,665,772; U.S. 5,362,718), C39
and C16 methoxy groups (e.g. WO96/41807; U.S. 5,728,710), C32, C26 and C9 keto
groups (e.g. U.S. 5,378,836; U.S. 5,138,051; U.S. 5,665,772). Hydrogenation at
C17, C19 and/or C21, targeting the triene, resulted in retention of antifungal activity
but loss of immunosuppression (e.g. U.S. 5,391,730; U.S. 5,023,262). Significant
improvements in the stability of the molecule (e.g. formation of oximes at C32, C40
and/or C28, U.S. 5,563,145, U.S. 5,446,048), resistance to metabolic attack (e.g.
U.S. 5,912,253), bioavailability (e.g. U.S. 5,221,670; U.S. 5,955,457; WO98/04279)
and the production of prodrugs (e.g. U.S. 6,015,815; U.S. 5,432,183) have been
achieved through derivatisation. However, chemical modification requires significant
quantities of rapamycin template and, as a base and acid labile compound, it is
difficult to work with. Where chemical derivatisation can be group selective, it is often
difficult to be site selective. Consequently, chemical modification invariably requires
multiple protective and deprotecive steps and produces mixed products in variable
yields.
The isolation of rapamycin analogues using biological methods such as
biotransformation and phage-based genetic modification has also been described,
isolation of minor metabolites from both mutant strains and rapamycin producing
strains has provided small quantities of a number of rapamycin analogues. These
strains are often low yielding and produce mixtures of rapamycin analogues. The
isolation of 27-O-desmethylrapamycin and 27-desmethoxyrapamycin was reported
from the culture supernatant of S. hygroscopicus NCIMB 40319 (Box et al., 1995).
The antifungal activity of 27-O-desmethylrapamycin was lower than that of rapamycin
but the inhibition of FKBP12 PPIase activity seemed to be increased. The inhibition

of ConA-stimuiated proliferation of murine splenic T cells and the inhibition of UPS-
stimulated proliferation of murine splenic B cells was decreased when compared to
rapamycin (Box et al, 1995). Similarly, antifungal activities of the rapamycin
derivatives prolylrapamycin, 27-O-desmethylrapamycin and 27-
desmethoxyrapamycin were lower than that of rapamycin (Wong et al., 1998).
Rapamycin analogues (16-O-desmethylrapamycin, 27-O-desmethylrapamycin, 39-O-
desmethylrapamycin, 16,27-O-bisdesmethylrapamycin, prolylrapamycin, 26-O-
desmethylprolylrapamycin, 9-deoxorapamycin, 27-desmethoxyrapamycin, 27-
desmethoxy-39-O-desmethylrapamycin, 9-deoxo-27-desmethoxyrapamycin, 28-
dehydrorapamycin, 9-deoxo-27-desmethoxy-39-O-desmethylrapamycin) were also
isolated from Actinoplanes sp N902-109 after the addition of cytochrome P450
inhibitors and/or precursor feeding to the culture or after biotransformation of isolated
rapamycin (Nishida et al., 1995). The use of such inhibitors, however, only allows
the targeting of a particular enzyme function and is not site selective. Rational
production of a single selected analogue is not possible via this method. The
resulting production of mixtures of rapamycin analogues rather than a single desired
product also impacts yield. The mixed lymphocyte reaction (MLR) inhibitory activity
of the compounds was assessed and little effect on the activity was detected after the
loss of the methyl group at C27 or/and C16. In addition, 9-deoxorapamycin showed
a more significant decrease in activity and the loss of the methoxy group at C27, the
hydroxy group at C28 and the substitution of a pipecolinyl group for a prolyl group
resulted in a reduction in potency (Nishida et al., 1995). Similarly, biotransformation
of rapamycin and the isolation of 16,39-O-bisdesmethylrapamycin have been
reported (WO 94/09010). The retention of inhibitory activity in cell proliferation
assays with compounds modified in the cyclohexyl ring, e.g. 39-O-
desmethylrapamycin and C40 modifications such as SDZ RAD, identify this region of
the molecule as a target for the generation of novel rapamycin analogues. Novel
rapamycin analogues were reported after feeding cyclohexanecarboxylic acid,
cycloheptanecarboxylic acid, cyclohex-1-enecarboxylic acid, 3-
methylcyclohexanecarboxylic acid, cyclohex-3-enecarboxylic acid, 3-
hydroxycyclohex-4-enecarboxylic acid and cyclohept-1-enecarboxylic acid to cultures
of S. hygmscopicus thus demonstrating the flexibility in the loading module of the
rapamycin polyketide synthase (PAS. Lowden, PhD dissertation, University of
Cambridge, 1997). These novel rapamycin analogues were produced in competition

with the natural starter, 4, 5-dihydroxycyclohex-1-enecarboxylic acid, resulting in
reduced yields and mixed products.
The isolation of recombinant S. hygroscopicus strains producing various
rapamycin analogues, using biological methods mediated by phage technology
(Lomovskaya et al., 1997), has been reported. In the presence of added proline
derivatives, a S. hygroscopicus rapL deletion mutant synthesized the novel
rapamycin analogues prolylrapamycin, 4-hydroxyprolylrapamycin and 4-
hydroxyprolyl-26-desmethoxy-rapamycin (Khaw et al., 1998). Similarly, the novel
rapamycins 3-hydroxy-prolyl-rapamycin, 3-hydroxy-pro!yl-26-desmethoxy-rapamycin,
and trans-3-aza-bicyclof3,1,0]hexane-2-carboxylic acid rapamycin have been
identified as described in WO98/54308. The activity of prolylrapamycin and 4-
hydroxyprolyl-26-desmethoxy-rapamycin was assessed in proliferation assays and
the inhibitory activity of the latter compound was significantly less than that of
rapamycin (Khaw et al., 1998). The deletion of five contiguous genes, rapQONML
(responsible for post-polyketide modifications at C16, C27 and production of L-
pipecolic acid) and their replacement with a neomycin resistance marker in S.
hygroscopicus ATCC29253 using phage-based methology resulted in the production
of 16-O-desmethyl-27-desmethoxyrapamycin when fed with pipecolic acid (Chung et
al., 2001). No complementation of this deletion mutant has been demonstrated using
this technology. Furthermore, the site-specific functionality of rapM and rapQ
remains unclear, therefore, rational design of rapamycin analogues requiring
methylation at C16-OH or C27-OH has not been enabled. The phage-based
methodology suffers from a number of drawbacks as described in more det all below.
It offers a difficult and protracted process of obtaining engineered strains and has a
reduced versatility in comparison to the methodology disclosed within this current
patent.
Conventional approaches to manipulate rapamycin modifying genes using
biological methods comprise the mutation or deletion of individual genes in the
chromosome of a host strain or/and the insertion of individual genes as extra copies
of homologous or heterologous genes either individually or as gene cassettes
(WO01/79520, WO 03/048375). However, the isolation of novel rapamycin
analogues using such biological methods has been limited due to the difficulties in
transforming the rapamycin-producing organism S. hygroscopicus. It has been
reported that the commonly used methods of transformation with plasmid DNA or
conjugal transfer were Unsuccessful with the rapamycin producing strain (Lomovskya

et al., 1997, Schweke et al., 1995, Kieser et al., 2000). The current state of the art
uses the methodology of Lomovskya et al. (1997), a work intensive phage based
method that is severely limited by the size of the cloned DNA fragments transferred
into S. hygroscopicus (Kieser et al., 2000). This technology is limited to the transfer
of a maximum of 6.4 kb of cloned DNA. Thus, when complementing a deletion
mutant using this technology the artisan is limited to the inclusion of -2 functional
genes in addition to desired promoter, regions of homology and resistance marker.
The genetic information for the rapamycin biosynthetic gene cluster has been
available since 1995 (Schwecke et al., 1995), however, limited progress in this area
has been made (Khaw et al., 1998; Chung et al., 2001; WO01/34816).
Summary of the Invention
The present invention provides recombinant methods for the efficient
transformation of strains that contain a biosynthetic cluster encoding an FKBP tigand,
for example but without limitation Streptomyces hygroscopicus subsp. hygroscopicus
NRRL 5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554,
Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC14891,
Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087,
Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces
hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces tsukubaensis
No.9993 FERM BP-927, Streptomyces hygroscopicus subsp. yakushimaensis,
Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp.
A92-306401 DSM 8429, Steptomyces sp. MA 685B ATCC 55098, Steptomyces sp.
MA 6848, said methods comprising:
(a) constructing a conjugative deletion plasmid in an £ coli strain that is
dam , dcm or dam and dcm . -
(b) generation of spores from said strain suitable for conjugation wherein
said strain is grown at a humidity of between 10% and 40% and the spores
are harvested at between 5 and 30 days;
(c) . conjugating the E. co// strain of step (a) with the spores from step (b)
on a medium that comprises per litre:
i) 0.5g to 5g corn steep powder,
ii) 0.1 g to 5g Yeast extract,
iii) 0.1 g to 10g calcium carbonate; and
iv) 0.01 g to 0.5 g iron sulphate;
said media additionally containing BACTO-agar and starch and having been

dried to result in 1-20% weight loss; and
(d) optionally culturing the strain under conditions suitable for polyketide
production.
In a preferred embodiment the methods are used for the transformation of
Streptomyces hygroscopicus subsp. hygroscopicus (e.g. NRRL 5491), Actinoplanes
sp. N9Q2-109 (e.g. FERM BP-3832), Streptomyces sp. AA6554, Streptomyces
hygroscopicus var. ascomyceticus {e.g. MA 6475 ATCC 14891), Streptomyces
hygroscopicus var. ascomyceticus {e.g. MA 6678 ATCC 55087), Streptomyces
hygroscopicus var. ascomyceticus (e.g.MA 6674), Streptomyces hygroscopicus var.
ascomyceticus {e.g. ATCC 55276), Streptomyces tsukubaensis No.9993 (e.g. FERM
BP-927), Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp.
{e.g. DSM 4137), Streptomyces sp. (e.g. DSM 7348), Micromonospora n.sp. A92-
306401 (e.g. DSM 8429) or Streptomyces sp. (e.g. MA 6858 ATCC 55098). In a
more preferred embodiment the methods are used for the transformation of: S.
hygroscopicus subsp. hygroscopicus (e.g. NRRL 5491) or S. hygroscopicus var.
ascomyceticus (e.g. ATCC 14891). In a still more highly preferred embodiment the
methods are used for the transformation of the rapamycin producer S hygroscopicus
subsp. hygroscopicus (e.g. NRRL 5491).
Therefore the present invention also provides a recombinant strain that
contains biosynthetic clusters that encode FKBP-ligands where one or more auxiliary
genes have been deleted or inactivated using the methods as described herein.
In a further aspect, the present invention provides recombinant methods and
materials for expressing combinations of polyketide modification enzymes so as to
produce novel polyketide analogues. In a specific embodiment, the present invention
provides recombinant methods and materials for expressing the combinations of
enzymes responsible for post-PKS modification and/or precursor supply from
biosynthetic clusters that encode FKBP-ligands for example but without limitation
rapamycin, FK506, FK520, FK523, FK525, antascomicin, meridamycin,
tsukubamycin and analogues therof and methods for the production of analogues in
recombinant host cells. In a preferred embodiment the recombinant methods and
materials are used for expressing the combinations of enzymes responsible for post-
PKS modification and/or precursor supply in the biosynthesis of rapamycin, FK520,
FK506 and 'hyg' and methods for the production of rapamycin, FK520, FK506 and
'hyg' analogues in recombinant host cells. In a more highly preferred embodiment
the recombinant methods and materials are used for expressing the combinations of

enzymes responsible for post-PKS modification and/or precursor supply in the
biosynthesis of rapamycin and methods for the production of rapamycin analogues in
recombinant host cells.
Broadly, the present invention is concerned with the alteration of a gene
system which has a core portion responsible for the production of a basic product,
and a multiplicity of modifying genes responsible for effecting relatively small
modifications to the basic product- e.g. effecting glycosylation, oxidation, reduction,
alkylation, dealkylation, acylation or cyclisation of the basic product, and a multiplicity
of precursor supply genes which are involved in the production of particular precursor
compounds (e.g. pipecolate; 4,5 dihydroxycyclohex-1-ene carboxyiic acid). Thus the
basic product may be a modular polyketide and the modifying genes may be
concerned with glycosylation and/or other modifications of a polyketide chain, and
the precursor supply genes may be involved in the production and/or incorporation of
natural or non-natural precursors (e.g. pipecolate and/or 4,5 dihydroxycyclohex-1-
ene carboxyiic acid in the rapamycin system).
The core portion may not function properly or even at all in the absence of a
precursor supply gene (unless a natural or unnatural precursor compound is supplied
or is otherwise available).
In one aspect the invention provides methods for the alteration of a gene
system with a core portion that cannot function due to a deletion or inactivation of a
precursor supply gene. Suitable gene systems include, but are not limited to, the
rapamycin, antascomicin, FK520, FK506, 'hyg', FK523, meridamycin, FK525 and
tsukubamycin biosynthetic clusters. In this aspect of the invention, the precursor
supply gene lacking is preferably rapK or a homologue of rapK (e.g. fkbO in the
FK506 or FK520 gene clusters). The gene system is preferably the rapamycin
cluster. The precursor supply gene lacking is more preferably rapK. This aspect of
the invention provides methods for the efficient production of a multiplicity of basic
products through the incorporation of natural or non-natural precursors (e.g. 4,5-
dihydroxycyclohex-1-ene carboxyiic acid). Methods may also embody further
aspects as set out below.
Another type of system is a non-ribosomal peptide ("NRP") system where the
basic product is a peptide and the modifying genes are genes responsible for
modifications to a peptide (glycosylation, reduction etc), and the precursor supply
genes are genes involved in the production of unusual amino acid residues to be
incorporated in the peptide. Systems can also be of mixed type, e.g. having a

polyketide part and a part with a different biosynthetic origin, e.g. NRP. Indeed,
rapamycin can be regarded as an example of this since the pipecolate residue is an
amino acid residue added by an enzyme similar to ones found in NRP systems.
These modifying genes and precursor supply genes may be regarded as
"auxiliary genes" for polyketide synthesis and the term "auxiliary genes" as used
herein may refer to modifying genes, precursor supply genes or both.
The alteration of the gene system involves the creation of a functioning
altered system in which the set of auxiliary genes has been altered. Thus one or
more auxiliary genes (and preferably two or more, three or more, four or more, five or
more, six or more or seven or more) may have been deleted (or rendered non-
functional) and/or replaced by different genes.
This may involve a "deletion system" comprising nucleic acid encoding a
gene system lacking a multiplicity of functional auxiliary genes. This deletion system
can then be complemented with one or more functional auxiliary genes (which may
be the same as or different from the genes they replace). This can be carried out
combinatorially, a deletion system being complemented by a multiplicity of different
genes and sets of genes.
An altered system which differs from the natural system in lacking one or
more modifying functions could be produced (a) by producing a deletion system and
restoring by complementation less than all of the deleted genes; or (b) by selectively
deleting or inactivating genes of an existing system. In an altered system produced
according to (b) genes may be inactivated by site-directed mutagenesis of an active
site important in the protein function (active site point mutation), by truncation of the
gene through a frameshift mutation, by an in-frame deletion of a section of the gene
important to its function, such as an active site; partial deletion or inactivation by point
mutation. These could all be carried out by double recombination and selecting for
the mutant genotype, or by single recombination. In a preferred embodiment the
altered system is produced by method (a). Such methods could also be used in
producing a deletion system. The "complementation" approach (a) is preferably
homologous, in that the "restored" genes are from the same gene cluster, however,
heterologous complementation, wherein the "restored" genes are sslected from a
different biosynthetic cluster that encodes FKBP-ligands, is also contemplated by the
present invention. In a preferred embodiment the "restored" genes are essentially
the same as the deleted genes, or are variants thereof, which perform similar
functions.

In a further aspect of the invention, an altered system with a deleted (or non-
functional) precursor supply gene can be fed with alternative precursors so that it
produces variant products.
As applied to a polyketide synthase ("PKS") system, one preferred type of
embodiment is a method for producing polyketides comprising: (a) providing a strain
of an organism which contains one or more PKS genes expressible to produce a
functioning PKS which can generate a polyketide in the organism, for example PKS
genes that encode a FKBP-ligand, the organism lacking one or more (and preferably
a plurality) of functional auxiliary genes naturally associated with said PKS genes
which encode gene products capable of effecting respective modifications of the
polyketide; and (b) effecting complementation by causing said organism to express
one or more auxiliary genes, the expressed modifying genes constituting an
incomplete set of auxiliary genes naturally associated with said PKS genes and/or
comprising one or more variant auxiliary genes; and (c) culturing said strain and
optionally isolating the polyketide analogues produced.
The step of providing a strain of an organism containing one or more PKS
genes may include a step of providing nucleic acid encoding a gene cluster
comprising said one or more PKS genes and lacking said one or more auxiliary
genes; and introducing said nucleic acid into the organism.
The PKS genes are preferably rapamycin genes. The auxiliary genes which
are lacking are preferably one or more of rapK, rap], rapQ, rapM, the contiguous
genes rapN and O (herein designated as rapN/O), rapL and rapJ. In specific
embodiments contemplated by the present invention:
i) one auxiliary gene is lacking, for example rapK; rapl; rapQ; rapM; rapL,
rapN/O or rapJ is lacking; preferably where one auxiliary gene is lacking it
is selected from the group consisting of rapK; rapl; fapQ; rapM; rapN/O and rapJ;
ii) two auxiliary genes are lacking for example: rapKrapl; rapKrapQ;
rapKrapM; rapKrapN/O; rapKrapL; rapKrapJ; rapklrapQ; raplrapM;
rapIrapNAD; raplrapL; raplrapJ; rapQrapM; rapQrapN/O; rapQrapL;
rapQrapJ; rapMrapN/O; rapMrapL; rapMrapJ; rapN/OrapL; rapN/OrapJ or
rapLrapJ are lacking;
iii) three auxiliary genes are lacking for example: rapKraplrapQ;
rapKraplrapM; rapKrapl rapN/O; rapKraplrapl; rapKraplrapJ;
rapKrapQrapM; rapKrapQRapN/O; rapKrapQrapL; rapKrapQrapJ;

rapKrapMrapN/O; rapKrapMrapL; rapKrapMrapJ; rapKrapN/OrapL;
rapKrapN/OrapJ; rapKrapLrapJ; rap'mpQrapM; raplrspQrepN/O;
raplrapQrapL; raplrapQrapJ; rapIrapMrapN/O; raplrapMrapL; rapl
rapMrapJ; raplrapN/OrapL; raplrapN/OrapJ; raplrapLrapJ;
rapQrapMrapN/O; rapQrapMrapL; rapQrapMrapJ; rapQrapN/OrapL;
rapQrapN/OrapJ; rapQrapLrapJ; rapMrapN/OrapL; rapMrapN/OrapJ;
rapMrapLrap or rapN/OrapLrapJ are lacking
iv) four auxiliary genes are lacking, for example: rapKraplrapQrapM;
rapKraplrapQrapN/O; rapKraplrapQrapL; rapKraplrapQrapJ;
rapKrapIrapMmpN/O; rapKraplrapMrapL; rapKraplrapMrapJ;
rapKraplrapN/OrapL; rapKraplrapN/OrapJ; rapKraplrapLrapJ;
rapKrapQrapMrapN/O; rapKrapQrapMrapL; rapKrapQrapMrapJ;
rapKrapQrapN/OrapL; rapK, rapQ, rapN/O, rapJ; rapKrapQrapLrapJ;
rapKrapMrapN/OrapL; rapKrapMrapN/OrapJ; rapKrapMrapLrapJ;
rapKrapN/OrapLrapJ; raplrapQrapMrapN/O; raplrapQrapMrapL; rapl
rapQrapMrapJ; raplrapQrapN/OrapL; raplrapQrapN/OrapJ;
raplrapQrapLrapJ; raplrapMrapN/OrapL; raplrapMrapN/OrapJ;
raplrapMrapLrapJ; raplrapN/OrapLrapJ; rapQrapMrapN/OrapL;
rapQrapMrapN/OrapJ; rapQrapMrapLrapJ; rapQrapN/OrapLrapJ or
rapMrapN/OrapLrapJ are lacking;
v) five auxiliary genes are lacking, for example: rapKraplrapQrapMrapN/O;
rapKraptrapQrapMrapL; rapKraplrapQrapMrapJ;
. rapKraplrapQrapN/OrapL; rapKraplrapQrap N/OrapJ;
rapKraplrapQrapLrapJ;rapKraplrapMrapN/OrapL;
rapKraplrapMrapN/OrapJ;rapKraplrapMrapLrapJ;
rapKraplrapN/OrapLrapJ; rapKrapQrapMrapN/OrapL;
- rapKrapQrapMrapN/OrapJ; rapKrapQrapMrapLrapJ;
rapKrapQrapN/OrapLrapJ;rapKrapMrapN/OrapLrapJ;
raplrapQrapMrapN/OrapL;raplrapQrapMrapN/OrapJ;
raplrapQrapN/OrapLrapJ; raplrapMrapN/OrapLrapJ;
rapQrapMrapN/OrapLrapJ or raplrapQrapMrapLrapJ are lacking;
vi) six auxiliary genes are lacking for example: rapKraplrapQrapMrapN/OrapL;
rapKraplrapQrapMrapN/OrapJ; rapKrapirapQrapMrapLrapJ;
rapKraplrapQrapN/OrapLrapJ; rapKraplrapMrapN/OrapLrapJ;

rapKrapQrapMrapN/OrapLrapJ or raplrapQrapMrapN/OrapLrapJ are
lacking; or
vii) seven auxiliary genes are lacking, e.g. rapKraplrapQrapMrapN/OrapLrapJ
are lacking.
The expression "lacking one or more functional auxiliary genes" covers both
the lack of a gene and the presence of a gene but in a non-functioning state, e.g.
because it has been specifically disabled.
In one aspect, the invention provides a novel and expeditious route to the
efficient incorporation of natural or non-natural precursors into FKBP-ligands. These
include, but are not limited to, the rapamycin, antascomicin, FK520, FK506, hyg',
FK523, meridamycin, FK525 and tsukubamycin polyketide synthase/non-ribosomal
peptide synthase systems, the invention thus provides novel analogues of their
respective natural products. In specific aspect, the invention provides a novel and
expeditious route to the efficient incorporation of natural or non-natural precursors
providing novel rapamycin analogues.
Therefore in one-aspect the present invention provides a method of
generating analogues of. FKBP-ligands which incorporate a non-natural starter unit, .
said method comprising:
(a) generating a recombinant strain in which at least the rapK homologue has
been deleted or inactivated; and
(b) feeding a non-natural starter unit to said strain
In a preferred embodiment the recombinant strain is generated using the
methods of the present invention.
In further aspects the invention provides libraries of compounds and individual
compounds available using such systems. Thus a typical compound is a variant of a
compound naturally produced by a gene system which has a eore portion
responsible for the production of a basic product, and a multiplicity of auxiliary genes
responsible for effecting relatively small modifications to the basic product, the
variant being producible by a system altered so that one or more of the auxiliary
genes are absent, non-functional, or replaced by functional variants. A preferred
class of compounds is rapamycin analogues corresponding to products of a
rapamycin system wherein one or more of the genes selected from the group
consisting of rapK, rapl, rapQ, rapM, rapN, rapO, rapL and rapJ genes are absent,
non-functional or variant.

In a further aspect, the present invention provides novel FKBP-analogues, in
a preferred embodiment the present invention provides novel rapamycin analogues.
Such compounds may have one or more useful properties, for example but without
[imitation, utility as immunosuppressants, antifungal agents, anticancer agents,
neuroregenerative agents, or agents for the treatment of psoriasis, rheumatoid
arthritis, fibrosis and other hyperproliferative diseases.
Definitions:
As used herein the term "modifying gene(s)" includes the genes required for
post-polyketide synthase modifications of the polyketide, for example but without
limitation cytochrome P-450 monooxygenases, ferredoxins and SAM-dependent O-
methyltransferases. In the rapamycin system these modifying genes include rapN/O,
rapM, rapl, rapQ, and rapJ but a person of skill in the art will appreciate that PKS
systems related to rapamycin (for example but without limitation: FK506, FK520,
antascomicin, 'hyg', FK523, meridamycin, FK525 and tsukubamycin) will have
homoiogues of at least a subset of these genes, some of which are discussed further
below.
As used herein the term "precursor supply gene(s)" includes the genes
required for the supply of the natural or non-natural precursors, the genes required
for the synthesis of any naturally or non-naturally incorporated precursors and the
genes required for the incorporation of any naturally or non-naturally incorporated
precursors. For example but without limitation in the rapamycin system these genes
include rapL, rapK and rapP but a person of skill in the art will appreciate that PKS
systems related to rapamycin (for example but without limitation: FK506, FK520,
antascomicin, 'hyg', FK523, meridamycin, FK525 and tsukubamycin) will have
homoiogues of these genes, some of which are discussed further below.
As used herein, the term "auxiliary gene(s)" includes references to modifying
genes, precursor supply genes or both modifying genes and precursor supply genes.
As used herein, the term "precursor" includes the natural starter units (i.e.
4,5-dihydroxycyclohex-1-ene carboxylic acid), non-natural starter units, and naturally
incorporated amino acids (i.e. pipecolic acid) and non-naturally incorporated amino
acids
As used herein the term "non-natural starter unif refers to any compounds
which can be incorporated as a starter unit in polyketide synthesis that are not the
starter unit usually chosen by that PKS.

As used herein, the term "FKBP-ligands" refers to compounds that bind to
the immunophilin FKBP, such compounds preferentially contains an a, B-diketo
amide where the B-keto is masked as an hemi-acet al. Such compounds include,
without limitation, rapamycin, FK520, FK506, antascomicin, hyg', FK523,
meridamycin, FK525 and tsukubamycin,
As used herein, the term "biosynthetic clusters that encode FKBP-
ligands" includes but is not limited to the gene clusters which direct the synthesis of
rapamycin, FK506, FK520, 'hyg', FK523, antascomicin, meridamycin, FK525 and
tsukubamycin.
As used herein the term "strains that contain biosynthetic clusters that
encode FKBP-ligands" includes but is not limited to: Streptomyces hygrvscopicus
subsp. hygrvscopicus (e.g. NRRL 5491), Actinoplanes sp. N902-109 (e.g. FERM BP-
3832), Streptomyces sp. AA6554, Streptomyces hygroscophus var. ascomyceticus
MA 6475 (e.g. ATCC 14891), Streptomyces hygrvscopicus var. ascomyceticus MA
6678 (e.g. ATCC 55087), Streptomyces hygroscopicus var. ascomyceticus MA 6674,
Streptomyces hygroscopicus var. ascomyceticus (e.g. ATCC 55276), Streptomyces
tsukubaensis No.9993 (e.g. FERM BP-927), Streptomyces hygrvscopicus subsp.
yakushimaensis, Streptomyces sp. (e.g. DSM4137), Streptomyces sp. (e.g. DSM
7348), Micromonospora n.sp. A92-306401 (e.g. DSM 8429) or Streptomyces sp. MA
6858 (e.g. ATCC 55098).
As used herein, the term urapK homologue" refers to homologues of the
rapamycin gene rapKfrom other biosynthetic clusters that encode FKBP-ligands, for
example but without limitation: the fkbO gene from the FK520 cluster, the fkbO gene
from the FK506 cluster and the Orf5 in the 'hyg' cluster. Such rapK homologues perform the same function as rapK in the synthesis of these related FKBP-ligands,
namely they are essential for the supply of the natural starter unit. Preferably, such
rapK homologues have at least 40% sequence identity, preferably at least 60%, at
least 70%, at least 80%, at least 90% or at least 95% sequence identity to the
sequence of rapK as shown in Figure 27 (SEQ ID NO: 13).
Det alled Description of the Invention
In one aspect, the present invention provides a novel and expeditious method
for the transformation of S. hygroscopicus. The use of phage technology for the
isolation of genetically modified strains of S. hygroscopicus has previously been
described (Khaw et al., 1998; Lomovskaya et al., 1997). However, no method other

than transection has ever been reported for the introduction of DNA into the
rapamycin producing strain S. hygroscopicus. Indeed, it has been stated previously
that the commonly used methods of transformation with plasmid DNA or conjugal
transfer were unsuccessful with the rapamycin-producing strain (Lomovskaya et al.,
1997, Kieser et al., 2000; Schweke et al., 1995).
In the present invention, surprisingly a conjugation protocol to successfully
transform S. hygroscopicus was established as described in Example 1. The
methodology was exemplified by the isolation of the deletion mutant in S.
hygroscopicus MG2-10 (Example 2) and by the expression of genes and gene
combinations as described in Examples 3, 5 and 15.
Therefore, in one aspect the present invention provides a method for
producing a recombinant strain that contains biosynthetic clusters that encode FKBP-
ligands where one or more auxiliary genes have been deleted or inactivated said
method comprising:
(a) construction of a conjugative plasmid in an E coli strain that is dam
dcm or dam and dcm ;
(b) generation of spores from said strain suitable for conjugation wherein
said strain is grown at a humidity of between 10% and 40% and the spores
are harvested at between 5 and 30 days;
(c) conjugating the E. coli strain of step (a) with the spores from step (b)
in a medium that comprises per litre:
i) 0.5g to 5g corn steep powder,
ii) 0.1g to 5g Yeast extract,
iii) 0.1g to 10g calcium carbonate; and
iv) 0.01 g to 0.5 g iron sulphate;
said media additionally containing BACTO-agar and starch and having been
dried to result in 1-20% weight loss; and
(d) optionally culturing the strain under conditions suitable for polyketide
production.
Preferably the E coli strain of step (a) is dam' and dcm".
Preferably, in step (b) the spores are harvested at between 10 and 25 days or
at between 14 and 21 days. In another embodiment, in step (b) the strain is grown
at a humidity of between 10 and 20%.
In a specific embodiment the starch in the media in step (c) used is wheat
starch.

In preferred embodiments the media used in step (c) comprises 1g to 4g corn
steep powder, 1g to 4g Yeast extract, 1g to 5g calcium carbonate; and 0.2g to 0.4 g
iron sulphate per litre. In a more preferred embodiment the media comprises per
litre: 2.5g com steep powder, 3g Yeast extract, 3g calcium carbonate; and 0.3g iron
sulphate;
The complementation strategy disclosed in this invention provides an
expeditious method to assess and identify the function of each auxiliary gene i.e.
rapK, rapQ, rapN/O, rapM, rapL, rapJ and/or rapl in rapamycin biosynthesis. The
gene product RapK has previously been identified as an interesting candidate for a
pteridine-dependent dioxygenase that could also catalyse an oxidative step in the
biosynthesis of rapamycin (Molnar et al., 1996). The homologous gene fkbO was
identified in the biosynthetic gene cluster of FK506 and due to the structural similarity
of rapamycin and FK506 a role for rapKin the oxidation of the C9 OH group was
postulated (Motamedi et al., 1996). The findings in Examples 3,4 and 6, describing
the rapK-dependent production of pre-rapamycin by S. hygroscopicus MG2-
10[pSGsetrapK] suggests that RapK has at least an additional function in rapamycin
biosynthesis.
In another aspect, therefore, the methods of the present invention led to the
elucidation of the function of RapK, namely that the expression of the rapK gene is
essential for the accumulation of any cyclised macrolide product. In a further aspect,
the present invention describes the complementation of S. hygroscopicus MG2-10
with fkbO, the homologue of rapK from the FK520 cluster, with the surprising
observation of fkbO dependent production of pre-rapamycin by S. hygroscopicus
MG2-10[pMG169-1] (Example 11). It can be seen by one skilled in the art that fkbO
fulfils a similar function in the production of FK520 as rapK and fkbO in the
production of pre-rapamycin. Further, one skilled in the art will appreciate that other
homologues of rapK, including but not limited to, fkbO in the FK506 cluster, fkbO in
the FK520 cluster and Orf5 in the 'hyg' cluster also fulfil the same function. In a
further aspect of the invention, homologues of rapK in biosynthetic clusters that
encode FKBP-ligands, including, but not limited to, FK506, FK520, FK525,
antascomicin, FK523, tsukubamycin, and 'hyg' can be deleted or inactivated,
providing strains unable to make their respective known natural products. Similarly,
the complementation strategy outlined above provides an expeditious method to
investigate the function, specificity and order for the expressed products of auxiliary
genes in the biosynthesis of other polyketides or non-ribosomal peptides.

In a preferred class of embodiment, the present invention provides a method
for the production of a recombinant host strain capable of producing rapamycin
analogues, further involving the construction of genomic delations, including but not
limited to rapQONMLKJl introduced into S. hygroscopicus and complementation or
partial complementation by expressing single genes or combinations of genes,
including but not limited to rapK, rap/, rapQ, rapM, the contiguous genes rapN and O
(herein designated as rapN/O), rapL and rapJ, in gene cassettes. Further, the
invention provides a method of producing said rapamycin analogues by culturing said
recombinant host strain, and optionally isolating the rapamycin analogues produced.
Thus, the recombinant strain MG2-10lpSGsetrapK], produced by complementation of
the genomic deletion strain S. hygroscopicus MG2-10, with rapK, was cultured to
produce 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre-
rapamycin).
In a further aspect of this class of the invention, the strategy involves the
integration of a vector comprising a sub-set of genes including, but rot limited to,
rapK, rapl, rapQ, rapM, rapN, rapO, rapL and rapJ into the S. hygroscopicus deletion
mutant above. Such.integration may be performed using a variety of available
integration functions including but not limited to: OC31 -based vectors, vectors based
on pSAM2 integrase (e.g. in pPM927 (Smovkina et al., 1990)), R4 integrase (e.g. in
pAT98 (Matsuura et al., 1996)), $VWB integrase (e.g. in pKT02 (Van Mellaert et al.,
1998)), 4>BT1 integrase ((e.g. pRT801) Gregory et al., in press) and L5 integrase
(e.g. Lee et at., 1991). In some cases this may need alteration of the host strain by
addition of the specific attB site for the integrase to enable high efficiency integration.
Replicating vectors could also be used, either as replacements to, or in addition to
0C31-based vectors. These include, but are not limited to, vectors based on plJ101
(e.g. plJ487, Kieser et al., 2000), pSG5 (e.g. pKC1139, Bierman et al., 1992) and
SCP2*te.g. plJ698, Kieser et al., 2000). This methodology has been exemplified
herein by the use of the ΦBT1 and ΦC31 site-specific integration functions.
Although the introduction of gene cassettes into S. hygroscopicus has been
exemplified in the present invention using the ΦBT1 and the ΦC31 site-specific
integration functions, those skilled in the art will appreciate that there are a number of
different strategies described in the literature, including those mentioned above that
could also be used to introduce such gene cassettes into prokaryotic, or more
preferably actinomycete, host strains. These include the use of alternative site-
specific integration vectors as described above and in the following articles (Kieser et

al., 2000; Van Mellaert et al., 1998; Lee ef at., 1991; Smovkina et al., 1990; Matsuura
et al., 1996). Alternatively, plasmids containing the gene cassettes may be
integrated into a neutral site on the chromosome using homologous recombination
sites. Further, for a number of actinomycete host strains, including S. hygroscopicus,
the gene cassettes may be introduced on self-replicating plasmids (Kieser et al.,
2000;WO98/01571).
In a further aspect of this class, the invention provides gene cassettes for the
complementation of the recombinant S. hygroscopicus deletion strains. Methods of
constructing gene cassettes and their heterologous use to produce hybrid
glycosylated macrolides have been previously described (Gaisser et al., 2002;
WO01/79520, WO 03/048375). The cloning method used to isolate the gene
cassettes of the present invention differs significantly from the approach previously
described in that the gene cassette is assembled directly in an expression vector
rather than pre-assembling the genes in pUC18/19- plasmids, thus providing a more
rapid cloning procedure. The approach is exemplified as described in Example 3,4,
5, 9 and 15. As described herein, a suitable vector (for example but without limitation
pSGLitl) can be constructed for use in the construction of said gene cassettes,
where a suitable restriction site (for example but without limitation Xba\), sensitive to
dam methylation is inserted 5' to the gene(s) of interest and a second restriction site
(for example Xba\) can be inserted 3' to the genes of interest The skilled artisan will
appreciate that other restriction sites may be used as an alternative to Xba\ and that
the methylation sensitive site may be 5' or 3' of the gene(s) of interest.
The use of gene cassettes enables the rapid and parallel generation of
multiple recombinant strains deleted in any combination of modifying genes from a
single S. hygroscopicus deletion strain. The cloning strategy facilitates the assembly
of a library of gene cassettes in either a directed or random manner, and is therefore
a powerful tool for the combinatorial production of novel rapamycin analogues
including but not exclusively limited to 9-deoxo-16-O-desrnethyl-27-desrnethoxy-39-
O-desmethyl-rapamycin (pre-rapamycin), 9-deoxo-16-O-desmethyl-27-O-desmethyl-
39-O-desmethyl-rapamycin, 16-O-desmethyl-27-desmethoxy-39-O-desmethyl-
rapamycin, 9-deoxo-16-O-desmethyl-39-O-desmethyl-rapamycin, 9-deoxo-16-O-
desmethyl-27-desmethoxy-rapamycin, 16-O-desmethyl-27-O-desmethyl-39-O-
desmethyl-rapamycin , 9-deoxoi27-O-desmethyl-39-O-desmethyl-rapamycin , 9-
deoxo-16-O-desmethyl-27-O-desmethyl-rapamycin , 27-O-desmethyl-39-O-
desmethyl-rapamycin , 9-deoxo-16-O-desmethyl-rapamycin , 9-deoxo-39-O-

desmethyl-rapamycin , 8-deoxo-15-O-desmethyl-26-desmethoxy-38-O-desmethyl-
prolylrapamycin (pre-prolylrapamycin), 8-deoxo-1 &-O-desmethyl-26-O-desmethyl-38-
O-desmethyl-prolylrapamycin, 15-O-desmethyl-26-desmethoxy-38-O-desmethyl-
prolylrapamycin, 8-deoxo-26-desmethoxy-38-O-desmethyi-prolylrapamycin, 8-
deoxo-15-O-desmethyl-38-O-desmethyl-prolylrapamycin , 8-deoxo-15-O-desmethyl-
26-desmethoxy-proIylrapamycin, 15-O-desmethyl-26-O-desmethyl-3B-O-desmethyi-
prolylrapamycin , 8-deoxo-26-O-desmethyI-38-O-desmethyl-prolylrapamycin , 8-
deoxo-15-O-desmethyl-26-O-desmethyl-prolylrapamycin , 15-O-desmethyl-38-O-
desmethyl-prolylrapamycin , 15-O-desmethyl-26-O-desmethyl-prolylrapamycin , 15-
O-desmethyi-26-desmethoxy-prolylrapamycir., 26-desmethoxy-38-O-desmethyl-
prolylrapamycin , 26-O-desmethyl-38-O-desmethyl-prolylrapamycin , 8-deoxo-15-O-
desmethyl-prolylrapamycin , 8-deoxo-26-O-desmethyl-prolylrapamycin , 8-deoxo-38-
O-desmethyl-prolylrapamycin , 15-O-desmethyl-prolylrapamycin , 38-O-desmethyl-
prolylrapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy-
rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyI-39-desmethoxy-rapamycin,
16-O-desmethyl-27-desmethoxy-39-desmethoxy-rapamycin, 9-deoxo-27-
desmethoxy-39-desmethoxy-rapamycin, 9-deoxo-16-O-desmethyl-39-desmethoxy-
rapamycin , 16-O-desmethyl-27-O-desmethyl-39-desmethoxy-rapamycin , 9-deoxo-
27-O-desmethyl-39-desmethoxy-rapamycin, 16-O-desmethy!-39-desmethoxy-
rapamycin , 27-desmethoxy-39-desmethoxy-rapamycin , 27-O-desmethyl-39-
desmethoxy-rapamycin, 9-deoxo-39-desmethoxy-rapamycin , 8-deoxo-15-O-
desmethyl-26-desmethoxy-38-desmethoxy-pro!ylrapamycin, 8-deoxo-15-O-
desmethyi-26-O-desmethyl-38-desmethoxy-proIylrapamycin, 15-O-desmethyl-26-
desmethoxy-38-desmethoxy-prolylrapamycin, 8-deoxo-26-desmethoxy-38-
desmethoxy-prolylrapamycin, 8-deoxo-15-O-desmethyl-38-desmethoxy-
prolylrapamycin, 15-O-desmethyl-26-O-desmethyl-38-desmeftioxy-prolylrapamycin ,
8-deox6-26-O-desmethyl-38-desmethoxy-pro)ylrapamycin, 15-O-desmethyI-38-
desmethoxy-prolylrapamycin , 26-desmethoxyr38-desmethoxy-prolylrapamycin , 26-
O-desmethyl-38-desmethoxy-prolylrapamycin, 8-deoxo-38-desmethoxy-
prolylrapamyctn, 38-desmethoxy-prolylrapamycin, 9-deoxo-16-O-desmethyl-27-
desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-
(hydroxycyclohexenyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-
cis-methoxy-4-trans-hydroxycyclohexyl)-36-(dihydroxy cyciohexyl) rapamycin, 9-
deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-
hydroxycyclohexyI)-36-(hydroxynorbomyl) rapamycin, 9-deoxo-16-O-desmethyl-27-

desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-methyl-4-
hydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-
cis-methoxy-4-trans-hydroxycyclohexyl)-36-(4-methylhydroxycyclohexyl) rapamycin,
9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-
hydroxycyclohexyl)-36-(3-fluoro-4-hydroxycyclohexyl) rapamycin, 9-deoxo-16-O-
desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-
hydroxy-4-fluorocyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-
de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-chloro-4-hydroxycyciohexyl)
rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-
hydroxycyclohexyl)-36-(3-hydroxy-4-chlorocyclohexylJ rapamycin, 9-deoxc~16-O-
desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-
cis-4-cis-dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-
36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-trans-4-trans-
dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-39-O-
desmethyl rapamycin, 9-deoxo-16-O-desmethyl-270-desmethyl-36-de(3-cis-
methoxy-4-trans-hydroxycyc]ohexyl)-36-(hydroxycyclohexenyl) rapamycin, 9-deoxo-
16-O-desmethyl-27-O-desmethyl-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-
36-(hydroxynorbomyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-36-
de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(4-methyl hydroxycyclohexyl)
rapamycin.
in a further aspect of this class, the present invention provides a system for
the combinatorial production of recombinant host strains capable of producing rapamycin analogues, involving construction of a genomic deletion rapQONMLKJI
introduced into S. hygroscopicus and its partial complementation by a combinatorial
library of gene cassettes comprising one or a plurality of the deleted auxiliary genes
rapQ, rapN/O, rapM, rapL, rapK, rapJ, and rap/. -
The approach outlined comprises as a part the cloning strategy to combine
genes including but not exclusively limited to rapK, rapl, rapQ, rapM, rapN/O, rapL
and rapJ, and / or genes with similar gene functions, in any possible gene
combination and gene order.
Another aspect of the invention allows the enhancement of gene expression
by changing the order of genes in a gene cassette. As applied to the preferred class,
the genes may comprise one or more of rapK, rapl, rapQ, rapM, rapN/O, rapL and
rapJ and / or genes with similar functions, allowing the arrangement of the genes in a
multitude of permutations as outlined in Example 5.

The cloning strategy outlined in this invention also allows the introduction of a
histidine tag in combination with a terminator sequence 3' of the gene cassette to
enhance gene expression. Those skilled in the art will appreciate other terminator
sequences could be used.
Another aspect of the invention describes the multiple uses of promotor
sequences in the assembled gene cassette to optimise gene expression.
It will now be obvious to one skilled in the art that S. hygroscopicus deletion
strains, the deletion comprising, but not limited to, a gene or a sub-set of the genes
rapQ, rapN/O, rapM, rapL, rapK, rapJ and rapl could be constructed. In this case,
gene cassettes for complementation or partial complementation would generally
comprise single genes or a plurality of genes selected from the sub-set of the genes
deleted.
It is well known to those skilled in the art that there are homologues to several
of the rapamycin modifylng and precursor supply genes in the gene clusters of
closely related systems including FK506 (Motamedi et al, 1996; Motamedi et al,
1997; Motamedi & Shafiee, 1998) and FK520 (Wu et al, 2000). These include the
following as described in Table I below:

Although the gene clusters of other closely related systems, including but not
limited to those for the biosynthesis of FK523, meridamycin, FK525, antascomicin
and tsukubamycin have not yet been sequenced, it can be anticipated that these will
be shown to bear a close resemblance to those whose sequences have been
determined, and, in particular, that these gene clusters will contain close homologues
of several of the rapamycin modifylng and precursor supply genes. Therefore, in a

further aspect of the invention, genes from heterologous gene clusters from such
closely related systems, including but not limited to FK506, FK520, FK523,
antascomicin, meridamycin, FK525, 'hyg' and tsukubamycin can be included in gene
cassettes in place of or in addition to their rapamycin homologues for
complementation and/or partial complementation of a rapamycin producer strain
containing a gene deletion or deletions including but not limited to the genes rapK,
rapl, rapQ, rapM, rapN/O, rapL and rapJ.
It is well known to those skilled in the art that polyketide gene clusters may be
expressed in heterologous hosts (Pfeifer and Khosla, 2001). Accordingly, the present
invention includes the transfer of the rapamycin biosynthetic gene cluster with or
without resistance and regulatory genes, either complete or containing deletions, for
complementation in heterologous hosts. Methods and vectors for the transfer as
defined above of such large pieces of DNA are well known in the art (Rawlings, 2001;
Staunton and Weissman, 2001) or are provided herein in the methods disclosed. In
this context a preferred host cell strain is a prokaryote, more preferably an
actinomycete or Escherichia coli, still more preferably include, but are not limited to
S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var. ascomyceticus,
Streptomyces tsukubaensis, Streptomyces coeficolor, Streptomyces Jividans,
Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis,
Streptomyces cinnamonensis, Streptomyces rimosus, Streptomyces albus,
Streptomyces griseofuscus,. Streptomyces longisporoflavus, Streptomyces
venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei or
Actinoplanes sp. N902-109.
In another aspect, the rapamycin analogues of the invention may be obtained by
a process comprising the steps of:
a) constructing a deletion strain, by the methods of the invention; the deletion
including, but not limited to, the genes rapK, rapQ, rapN/O, rapM, rapL, rapJ
and rapl, or a sub-set thereof,
b) culturing the strain under conditions suitable for polyketide production;
c) optionally, isolating the rapamycin analogue intermediate produced;
d) constructing a biotransformation strain containing a gene cassette comprising
all or a sub-set of the genes deleted;
e) feeding the rapamycin analogue intermediate in culture supernatant or
isolated as in step c) to a culture of the biotransformation strain under suitable
biotransformation conditions

f) optionally isolating the rapamycin analogue produced.
Suitable host strains for the construction of the biotransformation strain
include the native host strain in which the rapamycin biosynthetic gene cluster has
been deleted, or substantially deleted or inactivated, so as to abolish polyketide
synthesis, or a heterologous host strain. Methods for the expressing of gene
cassettes comprising one or a plurality of modifylng or precursor supply genes in
heterologous hosts are described in WO 01/79520. In this context heterologous
hosts suitable for biotransformation of the said FKBP-ligand analogue intermediates
include, but are not limited to, S. hygroscopicus, S. hygroscopicus sp., S.
hygroscopicus van ascomyceticus, Streptomyces tsukubaensis, Streptomyces
coelicolor, Streptomyces IMdans, Saccharopolyspora erythraea, Strsptomyces
fradiae, Streptomyces avermitilis, Streptomyces cinnamonensis, Streptomyces
rimosus, Streptomyces albus, Streptomyces griseofuscus, Streptomyces
iortgisporoHavus, Streptomyces venezuelae, Micromonospora griseorubida,
Amycolatopsis mediterranei, Escherichia coli and Actinoplanes sp. N902-109.
The close structural relationship between rapamycin and FK506, FK520,
FK523, 'hyg', meridamycin, antascomicin, FK525 and tsukubamycin, among others,
and tine established homologies between genes involved in the biosynthesis of
rapamycin and FK506 and FK520 (vide supra), renders obvious the application of the
methods of the present invention to these closely related systems. In a further
aspect, therefore, the invention includes the construction of deletion strains of the
producer strains of closely related compounds, including but not limited to FK506,
FK520, FK523, 'hyg', antascomicin, meridamycin, FK525 and tsukubamycin
containing a gene deletion or deletions of modifylng and/or precursor supply genes,
and more particularly including but not limited to genes with similar functions as rapK,
rapl, rapQ, rapM, rapN/O, rapL and rapJ, and their complementation or partial
complementation with a gene or gene cassettes comprising all or a sub-set of the
deleted homologous genes, or their functional homologues from heterologous gene
clusters, including but not limited to rapK, rapl, rapQ, rapM, rapN/O, rapL and rapJ to
produce recombinant strains capable of producing polyketide analogues varylng from
the parent polyketide in the incorporation of alternative precursors and/or the extent
of post-PKS modification. Further, the invention provides a method of producing said
polyketide analogues by culturing said recombinant host strains, and optionally
isolating the polyketide analogues produced.

In a further aspect, the invention provides a method for the production of
recombinant host strains capable of producing polyketide FKBP-ligand analogues
(other than rapamycin) varylng from the parent polyketide in the incorporation of
alternative precursors and/or the extent of post-PKS modification, comprising the
construction of a genomic deletion strain from which all or a portion of the auxiliary
genes have been removed, and its partial complementation by a gene cassette
comprising one or a plurality of the deleted genes and/or their homologues, and
further a method of producing said polyketide analogues by culturing said
recombinant host strain, and optionally isolating the polyketide analogues produced.
It is well known in the art that in most cases that auxiliary genes are co-located with
polyketide synthase genes in a gene cluster (Hopwood, 1997; Motamedi and
Shafiee, 1998; Wu et al., 2000) thus facilitating creation of the deletion strain. The
auxiliary genes to be deleted may or may not naturally form a contiguous sequence,
however, once the deletion strain has been created the partial complementation by
gene cassettes provides an expeditious approach to the production of recombinant
strains in which one or a plurality of the said genes have been deleted. Therefore, in
a further aspect, the invention provides a method for the combinatorial production of
recombinant host strains capable of producing polyketide FKBP-ligand analogues
(other than rapamycin) varylng from the parent polyketide in the incorporation of
alternative precursors and/or the extent of post-PKS modification, comprising the
partial complementation of the said genomic deletion strain by a combinatorial library
of gene cassettes comprising one or a plurality of the deleted genes, and further a
method of producing said polyketide analogues by culturing said recombinant host
strains under conditions suitable for polyketide production, and optionally isolating
the polyketide analogues produced. In this context a preferred recombinant host cell
strain is a prokaryote, more preferably an actinomycete, still more preferably a strain
selected from S. hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var.
ascomyceticus, Stneptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces
lividans, Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces
avermitilis, Streptomyces cinnamonensis, Steptomyces rimosus, Streptomyces
afbus, Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces
venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei or
Actinoplanes sp. N902-109.
Those skilled in the art will appreciate that the methods of the present
invention could be applied to recombinant host strains in which the polyketide

synthase (PKS) has been altered by genetic engineering to express a modified
rapamycin or other polyketide analogue. The prior art describes several methods for
the production of novel polyketides by the deletion or inactivation of individual
domains (W093/13663, W097/92358), construction of hybrid polyketide synthases
(WO98/01546, WO00/00618, WO00/01827) or alteration of domain specificity by
site-directed mutagenesis (WO02/14482).
It is well known in the art that non-ribosomal peptides are biosynthesised by
Non-Ribosomal Peptide Synthases (NRPSs) via the stepwise condensation of
successive amino acid building blocks, in a process analogous to that of polyketide
biosynthesis (for review see Marahiel et al., 1997; Schwarzer and Marahiel, 2001). It
is well known that several non-ribosomal peptides include unusual amino-acid
residues (modified, proteinogenic amino acids and / or non-proteinogenic amino
acids) and carboxy acids, the biosynthetic genes for which are co-located with the
non-ribosomal peptide synthase genes in the non-ribosomal peptide gene cluster
(Marahiel et al., 1997; Konz and Marahiel, 1999; Blanc et al., 1997). In several
cases, the non-ribosomal peptide product initially released from the NRPS is further
modified by a set of enzymes, including but not limited to glycosyl transferases,
reductases, acylation or heterocyclic ring formation (Konz and Marahiel, 1999; Blanc
et ah, 1995). These include the antibiotics chloroeremomycin, pristinamycin,
vancomycin and bleomycin (Konz and Marahiel, 1999; Du et al., 2000). The genes
for these post-NRPS enzymes are also typically co-located in the biosynthetic gene
cluster (Marahiel et al., 1997; Schwarzer and Marahiel, 2001). Therefore, in a further
aspect, the invention includes a method for the production of non-ribosomal peptide
analogues, varylng from the parent non-ribosomal peptide in the incorporation of
alternative precursor amino-acids and/or the extent of post-NRPS modification,
comprising the construction of a genomic deletion strain from Which all or a portion of
the genes encoding the native amino-acid precursor synthesis and/or post-NRPS
enzymes have been removed, and its partial complementation by a gene cassette
comprising one or a plurality of the deleted genes and/or their homologues, and
further a method of producing said non-ribosomal peptide analogues by culturing
said recombinant host strain, and optionally isolating the non-ribosomal peptide
analogues produced. The post-NRPS and precursor biosynthesis genes to be
deleted may or may not naturally form a contiguous sequence, however, once the
deletion strain has been created the partial complementation by gene cassettes
provides an expeditious approach to the production of recombinant strains in which

one or a plurality of the said genes have been deleted. Therefore, in a further
aspect, the invention provides a method for the combinatorial production of
recombinant host strains capable of producing non-ribosomal peptide analogues
varylng from the parent non-ribosomal peptide in the incorporation of alternative
precursors and/or the extent of post-NRPS modification, comprising the partial
complementation of the said genomic deletion strain by a combinatorial library of
gene cassettes comprising one or a plurality of the deleted genes, and further a
method of producing said non-ribosomal peptide analogues by culturing said
recombinant host strains under conditions suitable for non-ribosomal peptide
production, arid optionally isolating the non-ribosomal peptide analogues produced.
In this context a preferred recombinant host cell strain is a prokaryote, more
preferably an actinomycete, still more preferably a strain selected from S.
hygroscopicus, S. hygroscopicus sp., S. hygroscopicus var. ascomyceticus,
Streptomyces tsukubaensis, Streptomyces coelicolor, Streptomyces fividans,
Saccharopolyspora erythraea, Streptomyces fradiae, Streptomyces avermitilis,
Streptomyces cinnamonensis, Streptomyces rimosus, Streptomyces albus,
Streptomyces griseofuscus, Streptomyces longisporoflavus, Streptomyces
venezuelae, Micromonospora griseorubida, Amycolatopsis mediterranei or
Actinoplanes sp. N902-109.
It is well known that many actinomycetes contain multiple biosynthetic gene
clusters for different secondary metabolites, including polyketides and non-
ribosomally synthesised peptides. Specifically, it has been demonstrated that strains
of S. hygroscopicus produce a variety of polyketides and non-ribosomally
synthesised peptides in addition to rapamycin, FK506, FK520, FK523, meridamycin,
FK525, antascomicin and tsukubamycin. These include, but are not limited to,
elaiophylin, bialaphos, hygromycin, augustmycin, endomycin (ft, B), glebomycin,
hygroscopin, ossamycin and nigericin. These additional biosynthetic gene clusters
represent a competing requirement for.biosynthetic precursors and an additional
metabolic demand on the host strain. In order to enhance production of the desired
rapamycin, or other polyketide, analogues, it may therefore be advantageous to
delete or inactivate any other biosynthetic gene clusters present in the host strain.
Methods for the deletion or inactivation of biosynthetic gene clusters are well known
in the art.
In a further aspect of this class, the invention provides a mutasynthesis
methodology for the complementation of recombinant deletion strains

In a further aspect, S. hygroscopicus strains of the present invention
containing a deletion of rapL may be fed with analogues of the naturally incorporated
amino acid, L-pipecolic acid, to produce new analogues of rapamycin in which the
pipecolyl residue is replaced. Prior art describes that a rapL mutant can be
complemented by the addition of L-pipecolic acid to the culture (Khaw et al., 1998).
Similarly, it was demonstrated that rapamycin analogues were isolated after the
feeding and incorporation of L-pipecolic acid analogues, L-proline, L-trans-4-
hydroxyproline, L-cis-4-hydroxyproline, L-cis-3-hydroxyproline, trans-3-aza-bicyclo[3,
1, 0]hexane-2-carboxylic acid (WO98/54308). Using S. hygroscopicus MG2-10 as
strain background to express genes or gene cassettes encoding for post-PKS
modifylng steps not including rapL or rapL homologues, a library of S. hygroscopicus
strains is generated, capable of producing a plurality of modified products on feeding
with L-pipecolic acid analogues. Suitable L-pipecolic acid analogues include alkyl-,
halo-, hydroxy-, and amino-substituted pipecolic acids and prolines, and more
particularly L-proline, L-trans-4-hydroxyproline, L-cis-4-hydroxyproline, L-cis-3-
hydroxyproline, frans-3-aza-bicyclo[3,1, 0]hexane-2-carboxylic acid and L-pipecolic
acid analogues demonstrated to catalyse PP-ATP exchange measured by a
modification of Lipmann's method (Nielsen et al., 1991) including L-4-hydroxyproline,
1- hydroxyproline, 2-hydroxyproline, 3- hydroxyproline, frans-3-methyl-L-proline, cis-
3-methylproline, cis-3-methyl-DL-proline, c/s,fral7S-4-methylproline, cis-4-methyl-DL-
proline, l/al7s-4-methy)-DL-proline, fral7s-4-aminoproline, cis-4-chloro-L-proIine, 5-
iminoproline hydrochloride, cis-5-methyl-DL-proline, (+)-piperazic acid, 5-
chloropipecolic acid, 5-hydroxypipecolic acid, cis-4-hydroxy-L-pipecolic acid, trans-4-
hydroxy-D-pipecolic acid, 4-hydroxyallopipecolic acid, thiazolidine-4-carboxylic acid
(Nielsen et al., 1991). This approach is exemplified in Example 7.
The production of a limited number of novel rapamycin-analogues after
feeding-close structural analogues of the natural 4,5-dihydroxycyclohex-1-
enecarboxylic acid.starter.unit to cultures of S. hygroscopicus has previously been
described, thus demonstrating that the loading module of the rapamycin polyketide
synthase has some flexibility with respect to the starter acid (PAS. Lowden, PhD
dissertation, University of Cambridge, 1997). However, these methods led to the
production of a mixture of products. In a further aspect, the present invention allows
for the production of rapamycin and related FKBP-ligand analogues by feeding
strains of the present invention with analogues of the naturally incorporated 4,5-
dihydroxycyclohex-1-enecarboxylic acid starter unit to produce rapamycin analogues

incorporating alternative starter units including, but not limited to, cyclohexane
carboxylic acid, 3-cis,4-trans-dihydroxycyclohexane carboxylic acid, 1-cyclohexene
carboxylic acid, 3-cyclohexene carboxylic acid, cycloheptane carboxylic acid, 2-
norbornane carboxylic acid, 3-hydroxycycIohexane carboxylic acid, 4-
hydroxycyclohexane carboxylic acid, 3-methylcyclohexane carboxylic acid, 4-
methylcyclohexane carboxylic acid, 3-(cis/trans)methoxycyclohexane carboxylic acid,
4-(cis/trans)methoxycyclohexane carboxylic acid, 4-oxo cyclohexane carboxylic acid,
3-fluoro-4-hydroxycarboxylic acid and 4-fluoro-3-hydroxycarboxylic acid, 3-
cyclohexane oxide carboxylic acid, 3,4-cis-dihydroxycyclohexane carboxylic acid, 3-
chloro-4-hydroxycarboxylic acid and 4-chloro-3-hydroxycarboxylic acid (and the pair
of opposite diastereomers), cyclohexylpropionic acid, 4-tert-Butylcyclohexane
carboxylic acid and simple esters and salts thereof. This approach is exemplified in
Examples 8,19 and 20.
Additionally, structural analogues of biosynthetic precursors of the 4,5-
dihydroxycyclohex-1-enecarboxylic acid starter unit may be fed (Lowden et al.,
2001), leading to production of novel rapamycin analogues incorporating alternative
starter units.
However, these methods can lead to the production of mixed groups of
products; therefore, the present invention additionally provides a method for
removing the competition between the endogenously produced starter unit and the
alternative starter acid analogues that are fed in order to improve the efficiency of
production of novel rapamycin analogues.
In order to remove the competition between the endogenously produced
natural starter unit and the alternative starter acid analogues fed, it is preferable to
disrupt the biosynthesis of the natural 4,5-dihydroxycyclohex-1-enecarboxylic acid
starter unit. This may be achieved by deletion or inactivation ef one or more of the
genes involved in the biosynthesis of the natural 4,5-dihydroxycyclohex-1-
enecarboxylic acid starter unit from shikimic acid (Lowden et al., 2001) or the
biosynthesis of shikimic acid itself. In the latter case, it may be necessary to
supplement cultures with aromatic amino acids (phenyl alanine, tyrosine, tryptophan).
Alternatively, endogenous production of the natural 4,5-dihydroxycyclohex-1-ene
carboxylic acid starter unit may be suppressed by the addition of a chemical inhibitor
of shikimic acid biosynthesis. Such inhibitors are well known in the literature.
In a further aspect the invention makes use of the surprising discovery that
rapK is involved in the supply of the biosynthetic precursors), e.g. 4,5-

dihydroxycyclohex-1-ene carboxylic acid starter unit of rapamycin and therefore that
deletion or inactivation of rapK or a rapK homologue provides a strain lacking in
competition between the natural starter unit and fed non-natural starter units. In
another aspect, the invention provides, a method for the efficient incorporation of fed
acids including, but not limited to those described below.
Therefore in one aspect of the invention the method comprises feeding starter
units of the formula where X = bond or CH2 and R1, R2, R3l R4, R5
and R6 may be the same or different and may independently be CI, F, OH, SH, H,
alkyl, CN, Br, R7l OR7, C(0)R7 or HNR7 where R7 is a C1-C4 alkyl; R-, and R3, R2 and
R4, R3 and R5, R4 and R6, R1 and R6, or R2 and R6 may be joined as either a
substituted or unsubstituted methylene link, an ether link, a thia link or an amino link,
R, and R2, R3 and R4 or R5 and R6 may be taken together as a ketone; provided that
no more than 4 of R1f R2, Rs, R4, R5 or R5 may be CI; no more than 2 of R1, R2, R3,
R4, R5 or R6 may be HNR7; no more than 2 of R1, R2, R3, R4, R5 or R6 may be SH and
both R groups from one carbon on the ring are not OH.
In a preferred embodiment the starter unit is not selected from the group
consisting of: cyclohexane carboxylic acid, 3-cis,4-trans-dihydroxycyciohexane
carboxylic acid, cycloheptane carboxylic acid and 3-(cis/frans)-methylcyclohexane
carboxylic acid
In preferred embodiments: where R1,R2, R3, R4, R5 or R6 are a combination of
F and OH substitution no more than 3 of R1-6 are substituted and the remainder are
H. Where R1, R2, R3, R4, R5 or R6 are a combination of CI and OH substitution no
more than 3 of R1-6 are substituted and the remainder are H. Where any two of R1,
R2, R3, R4, R5 or R6 are OH and any two remaining R groups are F on one carbon the
remainder are H. Where two of R1 ,R2, R3l R4, R6 or R6 are CI the remainder are H.
Where two of R1 ,R2, R3, R4, R5 or R6are CI, not originating from the same carbon,
and a further R is OH the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is
alkyl and the remainder are H; the alkyl group shall have a linear length of no greater
than 3 carbons. Where one of R1, R2, R3, R4, R5 or R6 is NHR7 the remainder are H.
In more highly preferred embodiments: where two of Ri, R2, R3, R4, R5 or R6
are OH and a third R group is F, the remainder are H. Where two of Rn, R2, R3, R4,
R5 or R6 are F the remainder are H. Where two of R1, R2, R3l R4, R5 or R6 are OH the
remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH and a third R group is

CI the remainder are H. Where two of R1, R2, R3, R4, Re or R6 are F, and a third R
group is OH the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is SH the
remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is SH and a second R group
is OH (not originating from the same carbon) the remainder are H.
In still more higly preferred embodiments: where one of R-,, R2, R3, R4, R5 or
R6 is F the remainder are H. Where of R1, R2, R3, R4, R5 or R6 are CI the remainder
are H. Where one of R1, R2, R3, R4, R5 or R6, are F and a second R group is OH (not
originating from the same carbon) the remainder are H. Where one of R1, R2, R3, R4,
R5 or R6 is CI and a second R group is OH (not originating from the same carbon) the
remainder are H. Where one of R1, R2, R3 ,R4, R5 or R6 is alkyl and the remainder
are H; the alkyl group shall contain no more than 4 carbons and have a linear length
of no greater than 3 carbons. Where one of R1, R2| R3, R4, R5 or R6 is alkyl and a
second R group is OH (not originating from the same carbon) and remainder are H;
the alkyl group shall contain no more than 4 carbons and have a linear length of no
greater than 3 carbons.
A further aspect of the invention comprises feeding starter units of the formula
, where X = bond or CH2 and R1 ,R2l R3, R4, R6 and R6 may be the
same or different and may independently be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7,
C(O)R7 or HNR7 where R7 is a C1-C4 alkyl; R1 and R3, R2 and R4, R3 and R5, R4 and
R6, R1 and R5, or R2 and R6 may be joined as either a substituted or unsubstituted
methylene link, an ether link, a thia link or an amino link, R1 and R2, R3 and R4 or R5
and R6 may be taken together as a ketone; provided that no more than 4 of R1, R2,
R3, R4, R5 or R6 may be CI; no more than 2 of R1 R2, R3, R4, R5 or R6 may be HNR7;
no morethan 2 of R1 R2, R3, R4, R5 or R6 may be SH and both R groups from one
carbon on the ring are not OH.
In a preferred embodiment the starter unit is not selected from the group
consisting of: 1-cyclohexene carboxylic acid and 1-cycloheptene carboxylic acid
In preferred embodiments, where R1 R2, R3, R4, R5 or R6 are a combination of
F and OH substitution no more than 3 of R^ are substituted and the remainder are
H. Where R1, R2, R3, R4, R5 or R6 are a combination of CI and OH substitution no
more than 3 of R1-6 are substituted and the remainder are H. Where any two of R1,
R2. R3. R4, R5 or R6 are OH and two of the remaining R groups are F on the same
carbon the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are CI the

remainder are H. Where two of R1, R2, R3 R4 R5 or R6 are CI, not originating from
the same carbon, and a further R group is OH the remainder are H. Where one of
-R2. R3, R4, R5 or Re is alkyl and the remainder are H; the alkyl group shall have a
linear length of no greater than 3 carbons. Where one of R1, R2, R3, R4, R5 or R6 is
NHR7 the remainder are H.
In more highly preferred embodiments: where two of R1, R2, R3, R4, R5 or R6
are OH and a third R group is F, the remainder are H. Where two of R1, R2, R3, R4,
R5 or R6 are F the remainder are H. Where two of R1( R2, R3, R4, R5 or R6 are OH the
remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH and a third R group is
CI the remainder are H. Where two of R1, R2, R3, R4, R6 or R6 are F, and a third R
group is OH the remainder are H. Where one of R1, R2, R3, R^ R5 or Re is SH the
remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is SH and a second R group
is OH (not originating from the same carbon) the remainder are H.
In still more higly preferred embodiments: where one of R1, R2, R3, R4, R5 or
R6 is F the remainder are H. Where of R^ R2, R3, R4, R5 or R6 are CI the remainder
are H. Where one of R1, R2, R3l R4, R5 or R6, are F and a second R group is OH (not
originating from the same carbon) the remainder are H. Where one of Rit R2, R3, R4, R5 or Re is CI, a second R group is OH (not originating from the same carbon) the
remainder are H. Where one of R1( R2, R3) R1, R5 or Re is alkyl and the remainder
are H; the alkyl group shall contain no more than 4 carbons and have a linear length
of no greater than 3 carbons. Where one of R1, R2, R3, R4, R5 or R6 is alkyl and a
second R group is OH (not originating from the same carbon) the remainder are H;
and the alkyl group shall contain no more than 4 carbons and have a linear length of
no greater than 3 carbons.
A further aspect of the invention comprises feeding starter units of the
formula':
where X = bond or CH2, R., and R2, may be the same or different

and may independently be F, CI, OH, SH, H, CN, OR7l C(O)R7, or NHR7 wherein R7
is a C1-C4 alkyl, R^ and R2 may also be taken together to form a ketone, a
spirocyclopropyl group or with -OCH2-, -CH20-, -SCH2- or-CH2S-; furthermore R3,
and R4 may be the same or different and may independently be be F, CI, Br, OR7, H
or CN; provided that both R groups from one carbon on the ring are not OH.

In a preferred embodiment the starter unit shall not be 5-cis-hydroxyl-3-
cyclohexene carboxylic acid.
In preferred embodiments:-Where two of R1, R2, Rs, or R4 are F the remainder
are H. Where-one of R1( R2, R3, or R4 is Ci the remainder are H. Where one of R3, or
R4 is F and one of R1 or R2 is OH the remainder are H. Where one of R3 or R4 is CI
and one of R1 or R2 is OH the remainder are H. Where one of R1 or R2 is SH the
remainder are H. Where one of R^ R2, R3, or R4 is alkyl and the remainder are H;
the alkyl group shall contain no more than 4 carbons and have a linear length of no
greater than 3 carbons. Where one of R3 or R* is alkyl and R1 or R2 is OH the
remainder are H; and the alkyl group shall contain no more than 4 carbons and have
a linear length of no greater than 3 carbons.
In more highly preferred embodiment where one of R1, R2, R3, or R4 is F the
remainder are H. Where one of R1( R2l R3, or R4 is CI the remainder are H
A further aspect of the invention comprises feeding starter units of the formula
where Rn, R2, R3, R*, R5 or R6 may be the same or different and

may independently be be be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7, C(O)R7 or
HNR7 where R7 is a C1-C4 alkyl; R1 and R3, R2 and R4, R3 and R5, R4 and R6, Rn and
R5, or R2 and R6 may be joined as either a substituted or unsubstituted methylene
link, an ether link, a thia link or an amino link, R3 and R» or R5 and R6 may be taken
together as a ketone;provided that both R groups from one carbon en the ring are not
OH.
In preferred embodiments: Where two of R1f R2, Rs, R4, R5 or R6 are F the
remainder are H. Where two of R-,, R2, R3, R1, R5 or R6 are OH, the remainder are H.
Where two of R^ R2, R3, R+, R5 or R6 are OH, and a third R group is F the remainder
are H. Where two of RL R2, R3, R4, R5 or R6 are OH, and a third R group is CI the
remainder are H. Where two of R^ R2, R3, R4, R5 or R6 are F and a third R group is
OH the remainder are H. Where one of R1, R2, R3, R+, R5 or R6 is Br the remainder
are H. Where one of Ru R2| R$, R*, R6 or R6 is Br and a second R group is OH the
remainder are H
In more preferred embodiments: Where one of R1, R2, R5, R4, R5 or R6 is F
the remainder are H. Where one of R1( R2, Rs, R1, R5 or R6 are CI the remainder are
H. Where one of R^ R2, R3, R4l R5 or Re is F and a second R group is OH (not

originating from the same carbon) the remainder are H. Where one of R1, R2, R3, R4,
R6 or Re is CI and a second R group is OH (not originating from the same carbon) the
remainder are H, Where one of R1f R2> R3, R4, R5 or Re is SH the remainder are H.
Where one R1, R2, R3, R4, Re or Re is SH and a second R group is OH (not originating
from the same carbon) the remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is
alkyl and the remainder are H; the alkyl group shall contain no more than 4 carbons
and have a linear length of no greater than 3 carbons. Where one of R^ R2, R3, R4, R5 or Re alkyl and a second R group is OH (not originating from the same carbon) the
remainder are H; and the alkyl group shall contain no more than 4 carbons and have
a linear length of no greater than 3 carbons
A further aspect of the invention comprises feeding starter units of the formula
where R1, R2, R3, R4, R5 or R6 may be the same or different and

may independently be be be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7, C(O)R7 or
HNR7 where R7 is a C1-C4 alkyl; R1 and R3, R2 and R4, R3 and R5, R4 and R6l R1 and
R5, or R2 and R6 may be joined as either a substituted or unsubstituted methylene
link, an ether link, a thia link or an amino link, R3 and R4 or R5 and R6 may be taken
together as a ketone;provided that both R groups from one carbon on the ring are not
OH.
In preferred embodiments: where R1F R2, R3, R4, R5 or R6 are a combination of
F and OH substitution no more than 3 of R^ are substituted and the remainder are
H. Where R1, R2, R3, R4, R5 or R6 are a combination of CI and OH substitution no
more than 3 of R^ are substituted and the remainder are H. Where two of R1, R2,
R3, R4, R5 or R6 are OH and two of the remaining R groups are F on one carbon the
remainder are H. Where two of R1( R2l R3, R4, R5 or R6 are CI the remainder are H.
Where two of R1, R2l R3, R4, R5 or R6 are CI (not originating from the same carbon)
and a third R group is OH, the remainder are H. Where one of R1, R2l R3, R4, R5 or
R6 is alkyl and the remainder are H; the alkyl group shall have a linear length of no
greater than 3 carbons. Where two of R1( R2, R3, R4, R5 or R6 are SH the remainder
are H. Where one of R1, R2) R3, R4, R5 or R6is HNR7 the remainder are H.
In more preferred embodiments: Where two of R^ R2, R3l R4, R5 or R6 are F
the remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH the remainder are

H. Where two of R1r R2, R3, R4, R5 or R6 are OH and a third R group is F, the
remainder are H. Where two of R1, R2, R3, R4, R5 or R6 are OH and a third R group is
Ci the remainder are H. Where two of R1, R2, R3, R4, R5 or RBare F, and a third R
groups is OH the remainder are H. Where one of R1( R2, R3, R^ R5 or R6 is Br the
remainder are H, Where one R1( R2, R3, R4, R5 or Re is Br and a second R group is
OH (not originating from the same carbon) the remainder are H. Where one of R1, Ra, Rs, R4, R5 or Re is SH the remainder are H. Where one of R-,, R2, R3, R4, R5 or R6
is SH and a second R groups is OH (not originating from the same carbon) the
remainder are H.
In more preferred embodiments: Where one of R^ R2, R3, R4, R5 or R6 is F
the remainder are H. Where one of R1( R2l R3, R4, R5 or Re is CI the remainder are
H. Where one of R1f R2, R3, R4, R5 or R6 is F and a second R group is OH (not
originating from the same carbon) the remainder are H. Where one of R1, R2, R3) R4,
R5 or R6 is CI and a second R group is OH (not originating from the same carbon) the
remainder are H. Where one of R1, R2, R3, R4, R5 or R6 is alkyl and the remainder
are H; the alkyl group shall contain no more than 4 carbons and have a linear length
of no greater than 3 carbons. Where one of R1; R2, R3, R^ R6 or R6 is alkyl and a
second R group is OH (not originating from the same carbon) the remainder are H;
and the alkyl group shall contain no more than 4 carbons and have a linear length of
no greater than 3 carbons.
A further aspect of the invention comprises feeding starter units of the formula
where R^ and R2, may be the same or different and may

independently be F, CI, OH, SH, H, CN, OR7, C(O)R7, or NHR7 wherein R7 is a C1-
C4 alkyl, R1 and R2 may also be taken together to form a ketone, a spirocyclopropyl
group or with -OCH2-, -CH20-, -SCHr or -CH2S-; furthermore R3, and R4 may be the
same or different and may independently be be F, CI, Br, OR7, H or CN; provided
that both R groups from one carbon on the ring are not OH..
In preferred embodiments: Where one of R^ R2, R3 and R4 is F the remainder
are H. Where one of R1, R2, R3 and R4 is CI the remainder are H. Where one of R1,
R2, R3 and R4 is F and a second R groups is OH (not originating from the same
carbon) the remainder are H. Where one of R1f R2, R3 and R« is CI and a second R
group is OH (not originating from the same carbon) the remainder are H. Where one

of R1, R2l R3 and R* is SH the remainder are H. Where one of R1, R2l R3 and R4 is
alkyl the remainder are H; and the alkyl group shall contain no more than 4 carbons
and have a linear length of no greater than 3 carbons. Where one of R1F R2, R3 and
R4 is alkyl and a second R groups is OH (not originating from the same carbon) the
remainder are H; and the alkyl group shall contain no more than 4 carbons and have
a linear length of no greater than 3 carbons. Where two of R1, R2, R3 and R4 are F
the remainder are H.
An additional aspect of the invention comprises feeding starter units of the
formula
where X = bond or CH2;and R1, R2, R3) R4 or R5 may be the same or

different and may independently be be CI, F, OH, SH, H, alkyl, CN, Br, R7, OR7,
C(O)R7 or HNR7 where R7 is a C1-C4 alkyl, R1 and Rs, R2 and R4, may be taken
together as a ketone or linked as either a substituted or unsubstituted methylene link,
an ether link, a thia link or an amino link where R1 and R2 or R3 and R4 are linked as
a spiro-cyclopropyl group or with -OCHr or -CH20- or -SCH^ or -CH2S-, R5 may be
F, CL, OR7, H or CN; provided that no more than two of R1, R2, R3, R4 or R5 are SH
and that both R groups attached to one carbon are not OH.
In preferred embodiments: where R1, R2, R^ R4 or R5 are a combination of F
and OH no more than 3 of R1, R2, R3) R4 or R5 are substituted and the remainder are
H. Where R1, R2, R3, R4 or R5 are a combination of CI and OH no more than 3 of R^
are substituted and the remainder are H. Where R1( R2, R3, R4 or R5 are a
combination of two are OH (not on the same carbon) and two are F on one carbon
the remainder are H. Where two of R1f R2, R3, R4 or R5 are CI the remainder are H.
Where two of R1, R2, R3, R4 or R5 are CI (not originating from the same carbon) and a
third R group is OH the remainder are H. Where one of Rf1, R2, R3, R4 or R5 is alkyl
the remainder are H; and the alkyl group shall have a linear length of no greater than
3 carbons. Where two of R1( R2, R3, R4 or R5 are SH the remainder are H. Where
one of R1( R2, R3, R4 or R5 is NHR7 the remainder are H. Where one of R1, R2) R3) R4
or R5 is SH the remainder are H.
In more highly preferred embodiments: where one of R^ R2, R3, R4 or R5 is
OH the remainder are H. Where one of R^ R2, R3, R4 or R5 is F the remainder are H.
Where one of R1, R2, R3, R4 or R5 is CI the remainder are H. Where one of R1, R2,
R3, R* or R5 is F and a second R group is OH (not originating from the same carbon)

the remainder are H. Where one of R1, R2, R3l R* or R5 is CI and a second R groups
is OH (not originating from the same carbon) the remainder are H. Where one of R-,,
R2, R3l RA or R6 is SH and a second R group is OH (not originating from the same
carbon) the remainder are H. Where one of R1, R2, Ra, R* or R5 is alkyl the
remainder are H; and the alkyl group shall contain no more than 4 carbons and have
a linear length of no greater than 3 carbons. Where one of R-\, R2l R3, R4 or R6 is
alkyl and a second R group is OH (not originating from the same carbon) the
remainder are H; and the alkyl group shall contain no more than 4 carbons and have
a linear length of no greater than 3 carbons. Where two of R1, R2, R3, R4 or R5 are F
the remainder are H. Where two of R1, R2, R3, R4 or R5 are OH the remainder are H.
Where two of R-,, R2) R3, R4 or R5 are OH and a third R group is F the remainder are
H. Where two of R1( R2, R3, R4 or R5 are OH and a third R groups is CI the remainder
are H. Where two of R1, R2l R3, R« or R5 are F and a third R group is OH the
remainder are H.
An additional aspect of the invention comprises feeding starter units of the
formula where R1, R2l R3 and R4 may be the same or different and
may independently be CI, F, OH, SH, H, alkyl. CN, Br, R7f OR7, C(O)R7 or HNR7
where R7 is a C1-C4 alkyl, R^ and R2 or R5 and R4 may be taken together to form a
ketone, provided that two R groups attached to the same carbon are not both OH.
In preferred embodiments: Where one of R1, Rz, R3 or R4 is F the remainder
are H. Where one of R1, R2, R3 or R4 is CI the remainder are H. Where one of R1f
R2, R3 or R4 is Br the remainder are H. Where one of R1f R2, R3 or Rj is OH the
remainder are H. Where one of R1, R2, R3 or R4 is F and a second R group is OH
(not originating from the same carbon) the remainder are H. Where one of R1, R2l R3
or R4 is CI and a second R groups is OH (not originating from the same carbon) the
remainder are H. Where one of R1( R2, R3 or R4 is SH the remainder are H. Where
one of R1, R2, R3 or R4 is SH and a second R groups is OH (not originating from the
same carbon) the remainder are H. Where one of R1, R2, R3 or R4 is alkyl the
remainder are H; and the alkyl group shall contain no more than 4 carbons and have
a linear length of no greater than 3 carbons. Where one of R1, R2, R3 or FM is alkyl
and a second R groups is OH (not originating from the same carbon) the remainder
are H; and the alkyl group shall contain no more than 4 carbons and have a linear
length of no greater than 3 carbons. Where two of R1, R2, R3 or R4 are F the

remainder are H. Where two of R-,, R2) R3 or R4 are OH the remainder are H. Where
two of R1, R2l R3 or R4 are OH and a third R group is F the remainder are H. Where
two of Rv, R2, R3 or R4 are OH and a third R group is CI the remainder are H. Where
two of R1, R2l R3 or R4 are F and a third R group is OH the remainder are H.
In a preferred embodiment the present invention provides a method for the
efficient incorporation of. 2-norbomane carboxylic acid; 2-(cis/trans)-
hydroxycyclohexane carboxylic acid; 3-(cis/frans)-hydroxycyclohexane carboxylic
acid; 4-(o/s/frans)-hydroxycyclohexane carboxylic acid; 2-(cisrfrans)-
methylcyclohexane carboxylic acid; 4-(cis/trans)-methylcyclohexane carboxylic acid;
3-(cis/!rans)-methoxycyclohexane carboxylic acid; 4-(c;s/frans)-methoxycyclohexane
carboxylic acid; 4-oxocyclohexane carboxylic acid; ethyl 2-oxocyclohexane carboxylic
acid; 4-trans-n-pentylcyclohexane carboxylic acid; 2-trans-aminocyclohexane
carboxylic acid; 4-cis-aminocyclohexane carboxylic acid; 4-(cis/lrans)-
aminomethylcyclohexane carboxylic acid; cyclopentane carboxylic acid; cyclobutane
carboxylic acid; 1-methylcyclohexane carboxylic acid; 3-trans-hydroxy-4-cis-
fluorocyclohexane carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane
carboxylic acid; 3-cis-hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis-
hydroxy-3-trans-fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans-
chlorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans-chlorocycIohexane
carboxylic acid; 3-fral7S-hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4-trans-
hydroxy-3-cis-chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide
carboxylic acid; 3-cis-cyclohexeneoxide carboxylic acid; 3,4-cis-
dihydroxycyclohexane carboxylic acid and 3,4-tral7s-dihydroxycyclohexane carboxylic
acid; cyclohexaneacetic acid; cyclohexanepropionic acid or 4-cistoans-tert-
butylcyciohexane carboxylic acid or simple esters or salts thereof into FKBP-ligand
analogQes by a strain with rapK or a rapK homologue deleted or inactivated, in a
more preferred embodiment the present invention provides a method for the efficient
incorporation of: 3-(cis#ral?s)-hydroxycyclohexane carboxylic acid; 4-(cistfrans)-
hydroxycyclohexane carboxylic acid; 3-(cis/?rai)s)-methoxycyclohexane carboxylic
acid; 4-(cisrtrans)-methoxycyclohexane carboxylic acid; 4-oxo cyclohexane
carboxylic acid; cyclobutane carboxylic acid; 3-trans-hydroxy-4-cis-ftuorocyclohexane
carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane carboxylic acid; 3-cis-
hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans-
fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans-chlorocyclohexane

carboxylic acid and 4-cis-hydroxy-3-frBns-chlorocycIohexane carboxylic acid; 3-trans-
hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4- chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide carboxylic acid; 3-cis-
cydohexeneoxide carboxylic acid; 3,4-cis-dihydroxycyclohexane carboxylic acid and
3,4-trans-dihydroxycyclohexane carboxylic acid; cyclohexanepropionic acid; 4-
ds/frans-tert-butylcyclohexane carboxylic acid or simple esters or salts thereof into
FKBP-ligand analogues by a strain with rapK or a rapK homologue deleted or
inactivated.
In a specific embodiment of the present invention the fed starter units are not
cyclohexane carboxylic acid, 3-cis,4-trans-dihydroxycyclohexane carboxylic acid, 1-
cyclohexene carboxylic acid, 3-cydohexene carboxylic acid, cycioheptane carboxylic
acid, 3-(cis/trans)-methylcyclohexane carboxylic acid, 4-(cis/transy
methylcyclohexane carboxylic acid, 1-cycloheptene carboxylic acid or 5-cis-hydroxyl-
3-cyclohexene carboxylic acid.
The strains for use in the embodiments described above are selected from
the group comprising: Streptomyces hygroscopicus subsp. hygroscopicus NRRL
5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554,
Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC14891,
Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087,
Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces
hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces hygroscopicus
subsp. ascomyceticus ATCC 14891, Streptomyces tsukubaensis No.9993 FERM BP-
927, Streptomyces hygroscopicus subsp. yakushimaensis, Streptomyces sp. DSM
4137, Streptomyces sp. DSM 7348, Micromonospora n.sp. A92-306401 DSM 8429,
Steptomyces sp. MA 6858 ATCC 55098, Steptomyces sp. MA 6848. In a preferred
embodiment said strain is selected from the group consisting ef: Steptomyces
hygroscopicus subsp. hygroscopicus NRRL 5491, Actinoplanes sp. N902-109 FERM
BP-3832, Streptomyces sp. AA6554, Streptomyces hygroscopicus var.
ascomyceticus MA 6475 ATCC 14891, Streptomyces hygroscopicus var.
ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var.
ascomyceticus MA 6674, Streptomyces hygroscopicus var. ascomyceticus ATCC
55276, Streptomyces hygroscopicus subsp. ascomyceticus ATCC 14891,
Streptomyces tsukubaensis No.9993 FERM BP-927, Streptomyces hygroscopicus
subsp. yakushimaensis, Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348,
Micromonospora n.sp. A92-306401 DSM 8429 or Streptomyces sp. MA 6858 ATCC

55098. In a more highly preferred embodiment the strain is the rapamycin producer
S. hygroscopicussubsp. hygroscopicus.
In the methods for.the efficient incorporation of fed carboxylic acids described
above the compounds produced are analogues of the FKBP-ligards as described
herein, for example but without limitation: rapamycin, FK506, FK520, FK523, FK525,
antascomicin, meridamycin and tsukubamycin. In a preferred embodiment the
compounds produced are analogues of rapamycin, FK506 or FK520. In a more
highly preferred embodiment the compounds produced are analogues of rapamycin;
these compounds correspond to Formula II or Formula III as described below.
Additionally, the methods described above may be used to generate novel
FK506 and FK520 analogues which correspond to Formula I below:

R2 = H, alkyl, halo, hydroxyl, thiol R5 = H, alkyl, halo, hydroxyl, thiol
R4 = H, alkyl, halo, hydroxyl, thiol
R5 = OMe, Me or H
R6 = OMe, Me or H

R7 = CH2CH3 or CH2CH=CH2
Z = keto or CH2
X=X'=bond; X=bond and X'- CH2l S, O or X= OH2, S, O, fused cyclopropyl unit and
X'=bond
In a preferred embodiment, where R6 = OH
and Ro= H, OH, halo, alkyl or thiol.
In a further preferred embodiment
where Rs= OH and R9 = halo.
where Re = 4-trans-OH, R9 = 3-cis-OCH3, and R2 = R3 = R4 = H,
X = CH2l X' = bond, Z = keto, R6 = Re = OCH3 and R7 = CH2CH3
where Re = 4-trans-OH, R6 = 3-cis-OCH3, and R2 = R3 = R4 = H,
X = CH2) X" = bond, Z - keto, R5 = R6 = OCH3 and R7 = CH2CH=CH2
Thus, for example, the recombinant strain S. hygroscopicus MG2-10 can be
cultured in the presence of cyclohexane carboxylic acid to produce 9-deoxo-16-O-
desmethyl-27-desmethoxy-39-desmethoxy-rapamycin (Example 12). It can be seen
by one skilled in the art that homologues to rapK in other biosynthetic clusters that
encode FKBP-ligands, including, but not limited to, FK506, FK520, FK523, FK525,
meridamycin, tsukubamycin, antascomicin and 'hyg' can also be deleted or
inactivated allowing efficient feeding of starter unit carboxylic acids leading to the
production of novel analogues.
In another aspect, S. hygroscopicus strains of the invention (including rapL or
rapL homologues or not including rapL or rapL homologues and/or including rapK or
rapK homologues or not including rapK or rapK homologues) may be fed with
analogues of L-pipecolic acid, as described above, in combination with analogues of
the natural 4,5-dihydroxycyclohex-1-enecarboxylic acid starter unit, as described

above, to produce rapamycin analogues in which both the starter unit and the
pipecolyl residue have been replaced. This approach is exemplified in Examples 10,
11 and 12.
The present invention provides a process for producing FKBP-ligand
analogues varylng in the extent of post-PKS modification and/or in which the
pipecolic acid residue has been replaced, and optionally the starter 4,5-
dihydroxycyclohex-1-enecarboxylic acid residue has been replaced. This process
comprises the step of deleting or inactivating one or more genes in the
microorganism host cell involved in the production of the precursor compound, L-
pipecolic acid and/or 4,5-dihydroxycyclohex-1-ene carboxylic acid, required for
biosynthesis of the rapamycin polyketide/NRPS template and/or in its subsequent
post-PKS modification, thereby to suppress the production of the natural product.
The process further comprises transforming the microorganism host cells with nucleic
acid encoding polyketide-modifylng genes to restore polyketide production, culturing
the transformed host cells under conditions suitable for polyketide production and
optionally isolating the rapamycin analogues produced.
The present invention provides a process for the production of FKBP-ligand .
analogues including, but not limited to FK506, FK520, FK523, FK525, tsukubamycin,
antascomicin, meridamycin and 'hyg', varylng in the extent of post-PKS modification
and/or in which the amino acid residue has been replaced, and optionally the starter
unit has been replaced. This process comprises the step of deleting or inactivating
one or more genes in the microorganism host cell involved in the production of the
precursor amino acid residue and/or starter unit, required for the biosynthesis of the
polyketide/NRPS template and/or in its subsequent post-PKS modification, thereby to
suppress the production of the natural product The process further comprises
transforming the microorganism host cells with nucleic acid encoding polyketide-
modifylng genes to restore polyketide production, culturing the transformed host cells
under conditions suitable for polyketide production and optionally isolating polyketide
analogues produced.
The present invention provides novel FKBP-Figand analogues.
In a further aspect the present invention provides the following FK520
analogues: 31-desmethoxy-FK520, 31-desmethoxy-31-cis-hydroxy-32-fr^ns-hydroxy-
FK520, 31 -desmethoxy-31 -cis-hydroxy-32-cis-hydroxy-FK520, 31 -desmethoxy-31 -
frans-hydroxy-32-trans-hydroxy-FK520, 31 -O-desmethyf-32-dehydroxy-FK520, 31 -O-
desmethyl-FK520,31-desmethoxy-31-methyl-FK520,31-O-desmethyl-32-dehydroxy-

32-methyl-FK520,31-O-desmethyl-32-dehydrQxy-32-fluoro-FK520l31-desmethoxy-
31 -fluoro-FK520,31 -O-desmethyl-32-dehydroxy-32-chloro-FK520, 31 -desmethoxy-
31-chloro-FK520, 31-O-desmethy»-32-dehydroxy-32-fe/to^
methoxy-4-hydroxy-cydohexyl)-29-(hydroxy-cycloheptyl)-FK520, 29-de(3-methoxy-4-
hydroxy-cyclohexyl)-29-(hydroxy-norborny))-FK520, 9-deoxo-31-desmethoxy-FK520,
9-deoxo-31-desmethoxy-31-cfe-hydroxy-32-trans-hydroxy-FK520, 9-deoxo-31-
desmethoxy-31 -cis-hydroxy-32-cis-hydroxy-FK520,9-deoxo-31 -desmethoxy-31 -
frans-hydroxy-32-trans-hydroxy-FK520,9-deoxo-31 -O-desmethyl-32-dehydroxy-
FK520, 9-deoxo-31-Odesmethyl-FK520I9-deoxo-31-desmethoxy-31-methyl-FK520,
9-deoxo-31 -O-desmethyl-32-dehydroxy-32-methyl-FK520, 9-deoxo-31 -O-desmethyl-
32-dehydroxy-32-fluoro-FK520, 9-deoxo-31-desmethoxy-31 -fluoro-FK520, 9-deoxo-
31 -O-desmethyl-32-dehydroxy-32-chloro-FK520, 9-deoxo-31 -desmethoxy-31 -chloro-
FK520, 9-deoxo-31 -Odesmethyl-32-dehydroxy-32-ferf-butyl-FK520, 9-deoxo-29-
de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK5201 9-deoxo-29-
de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-FK520, 30-desmethoxy-
prolyl-FK520l30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-FK520, 30-
desmethoxy-30-cis-hydroxy-31-cis-hydroxy-prolyl-FK520, 30-desmethoxy-30-trans-
hydroxy-31-trans-hydroxy-prolyl-FK520, 30-O-desmethyl-31-dehydroxy-prolyl-FK520,
30-O-desmethyl-prolyl-FK520, 30-desmethoxy-30-methyl-prolyl-FK520, 30-O-
desmethyl-31-dehydroxy-31-methyl-proiyl-FK520, 30-Odesmethyl-31-dehydroxy-31-
fluoro-prolyl-FK520, 30-desmethoxy-30-fluoro-prolyl-FK520, 30-O-desmethyl-31 -
dehydroxy-31-di)oro-prolyl-FK520) 30-desmethoxy-30-chloro-prolyl-FK520, 30-
desmethyl-31-dehydroxy-31-terf-butyl-prolyl-FK520,28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-cycloheptyl)-FK520, 28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbornyl)-FK520I 8-deoxo-30-desmethoxy-31-hydroxy-
prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-fra^-hydroxy-prolyl-
FK520,,:8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-prolyl-FK520, 8-
deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK520, 8-deoxo-30-
O-desmethyl-31 -dehydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-prolyl-FK520, 8-
deoxo-30-desmethoxy-30-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -
dehydroxy-31-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-
fluoro-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-prolyl-FK520, 8-deoxo-30-O-
desmethyl-31 -dehydroxy-31 -chloro-prolyl-FK520,8-deoxo-30-desmethoxy-30-chloro
prolyl-FK520t8-deoxo-30-O-desmethyl-31-dehydroxy-31-tert-butyl-prolyl-FK520, 8-
deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl-

FK520,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-
prolyl-FK520, 30-desmethoxy-3-hydroxy-prolyl-FK520,30-desmethoxy-30-cis-
hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-
31-cis-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-trans-hydroxy-31-trans-
hydroxy-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31rdehydroxy-3-hydroxy-prolyl-
FK520, 30-O-desmethyl-3-hydroxy-prolyl-FK52Q, 30-desmethoxy-30-methyl-3-
hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyJ-
FK520, 30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-prolyl-FK520, 30-
desmethoxy-30-fluoro-3-hydroxy-prolyl-FK5201 30~O-desmethyl-31 -dehydroxy-31 -
chloro-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-chloro-34iydroxy-prolyl-FK520,
30-O-desmethyl-31 -dehydroxy-31 -tert-butyl-3-hydroxy-prolyl-FK520, 28-de(3-
methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prDlyl-FK520, 28-
de(3-mettioxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK520,
8-deoxo-30-desmethoxy-31-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-cis-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-trans-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
O-desmethyl-31-dehydroxy-3-hydroxy-prolyl-FK520l 8-deoxo-30-O-desmethyl-3-
hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK520, 8-
deoxo-30-O-desmethyl-31-dehydroxy-31-methyl-3-hydroxy-prolyl-FK520, 8-deoxo-
30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-pro)yl-FK520, 8-deoxo-30-
desmethoxy-30-fluoro-3-hydroxy-prolyl-FK520, B-deoxo-30-O-desmethyl-31 -
dehydroxy-31-chloro-3-hydroxy-pro!yl-FK520, 8-deoxo-30-desmethoxy-30-chloro-3-
hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -tert-
butyl-3-hydroxy-pro!yl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-cycloheptyl)-3-hydroxy-proIyl-FK520, 8-deoxo-28-de^-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK520, 30-desmethoxy-4-
hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31 -trans-hydroxy-4-hydroxy-
prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK520,
30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK520, 30-O-
desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK520, 30-O-desmethyl-4-hydroxy-prolyl-
FK520,30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK520,30-O-desmethyl-31 -
dehydroxy-31-methyl-4-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -
fluoro-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-fiuoro-4-hydroxy-prolyl-FK520, 30-
O-desmethyl-31 -dehydroxy-3" -chloro-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-

chloro-4-hydroxy-pro!yl-FK520,30-O-desmethyl-31-dehydroxy-31 -terf-butyl-4-
hydroxy-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-
cycloheptyl)-4-hydroxy-prolyl-FK520, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-norbomyl)-4-hydroxy-prolyl-FK520, 8-deoxo-30-desrnethoxy-31-hydroxy-4-
hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-
hydroxy-prolyl-FK520, 8-deoxo30-desmethoxy-30-cis-hydroxy-31-c;s-hydroxy-4-
hydroxy-prolyl-FK520>8-deoxo-30-desmethoxy-30-&ans-hydroxy-31-trans-hydroxy-4-
hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-4-hydroxy-prolyl-
FK520, 8-deoxo-30-O>desmethyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-
30-methyM-hydroxy-prolyl-FK520) 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -
methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -fluoro-4-
hydroxy-prolyl-FK520,8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK520, 8-
deoxo-30-O-desmethyl-31-deriydroxy-31-chlor4-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-chloro-3-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-
31 -dehydroxy-31 -ferf-butyl-4-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-
hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK520, 8-deoxo-28-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-4-hydroxy-prolyl-FK520)
31-desmethoxy-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31-cis-hydroxy-32-
frans-hydroxy-trans-3-bicyclo[3.1.0.]FK520,31-desmethoxy-31-cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.]FK520, 31 -desmethoxy-31 -trans-hydroxy-32-trans-
hydroxy-trans-3-bicyclo[3.1.0.JFK520, 31 -O-desmethyl-32-dehydroxy-trans-3-
bicyclo[3.1.0.JFK520, 31-O-desmethyl-trans-3-bicyclo[3.1.0.JFK520, 31-desmethoxy-
31 -methyl-trans-3-bicyclo[3.1.0.JFK520, 31 -O-desmethyl-32-dehydroxy-32-methyl-
trans~3-b)cyc\o[3.1.O.JFK520, 31-O-desmethyl-32-dehydroxy-32-fluoro-frBns-3-
bicyclo[3.1.0.JFK520, 31-desmethoxy-31-fIuoro-trans-3-bicyclo[3.1.0.]FK520, 31-O-
desmethyl-32-dehydroxy-32-chloro-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31-
chloro-trans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl-32-dehydroxy-32-fe/t-butyl-
frans-3-bicyclo[3.1.0.JFK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-
cycloheptyl)-trans-3-bicyclo[3.1.0.JFK520,29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-norbomylH/Tans-3-bicyclo[3.1.0.]FK520l 9-deoxo-31-desmethoxy-fral7S-
3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-
frans-3-bicyclo[3.1.0.]FK520,9-deoxo-31 -desmethoxy-31 -cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-trans-hydroxy-32-
frans-hydroxy-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O-desmethyl-32-dehydroxy-
frans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 -O-desmethy Wrans-3-bicyclo[3.1.0.JFK520,

9-deoxo-31-desmethoxy-31-methyW/ans-3-bicyclot3.1.0.]FK520,9-deoxo-31-O-
desme%l-32-dehydroxy-32-methyl-trans-3-bicyclo[3.1.0.]FK520l9-deoxo-31-O-
desmethyl-32-dehydroxy-32-fluoro-tnans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-
desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O-desmethyl-32-
dehydroxy-32-chloro-fcrans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-
chloro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-32-dehydroxy-32-tert-
butyl-*rans-3-bicyclo[3.1.0.JFK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyciohexyl)-
29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK520I9-deoxo-29-de(3-methoxy-4-
hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-trans-3-bicyclo[3.1.0.JFK520,,
In a preferred embodiment, the present invention provides the following
FK520 analogues: 31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK520, 31-
desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK520, 31-desmethoxy-31-trans-
hydroxy-32-£rans-hydroxy-FK520, 31 -desmethoxy-31 -methyl-FK520, 31 -desmethoxy-
31-fluoro-FK520, 31-desmethoxy-31-chloro-FK520, 31-O-desmethyl-32-dehydroxy-
32-tert-butyl-FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-
cycloheptyl)-FK520,29-de(3-methoxy-4-hydroxy-cyclohexy0-29-(hydroxy-norbornyl)-
FK520, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK520, 9-deoxo-
31 -desmethoxy-31 -cis-hydroxy-32-cis-hydroxy-FK520, 9-deoxo-31 -desmethoxy-31 -
/rans-hydroxy-32-fraAJS-hydroxy-FK520, 9-deoxo-31-desmethoxy-31-methyl-FK520,
9-deoxo-31-desmethoxy-31-f!uoro-FK520, 9-deoxo-31-desmethoxy-31-chloro-FK520,
9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert-butyl-FK520, 9-deoxo-29-de(3-
methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK520, 9-deoxo-29-de(3-
methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-FK520,, 30-desmethoxy-30-
cis-hydroxy-31-trans-hydroxy-prolyl-FK520) 30-desmethoxy-30-cis-hydroxy-31-cis-
hydroxy-prolyl-FK520, 30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-
FK520, 30-desmethoxy-30-methyl-prolyl-FK520, 30-desmethoxy-30-fluoro-prolyl-
FK520,%0-desmethoxy-30-chloro-prolyl-FK520,30-desmethyl-31-dehydroxy-31-tert-
butyl-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexy0-28-(hydroxy-
cycloheptyl)-FK520128-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-
FK520, 8-deoxo-30-desmethoxy-31 -hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-
30-c/'s-hydroxy-31-trans-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-
hydroxy-31-cis-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fcrans-hydroxy-31-
frans-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-prolyl-FK520, 8-
deoxo-30-O-desmethyl-prolyl-FK520, 8-deoxo-30-desmethoxy-30-methyl-prolyl-
FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-methyl-prolyl-FK520, 8-deoxo-30-

O-desmethyl-31-dehydroxy-31-fluoro-proiyl-FK520,8-deoxo-30-desmethoxy-30-
fluoro-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -chloro-prolyl-FK520,
8-deoxo-30-desmethoxy-30-chloro-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-
dehydroxy-31-tert-butyl-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-
hydroxy-cyclohexyl)-28-{hydroxy-norbomyl)-prolyl-FK520,.30-desmethoxy-3-hydroxy-
prolyl-FK520, 30-desmethoxy-30-cfe-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-
FK520,30-desmethoxy-30-cis-hydroxy-31 -cis-hydroxy-3-hydroxy-prolyl-FK520, 30-
desmethoxy-30-trans-hydrbxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK520, 30-O-
desmethyl-31-dehydroxy-3-hydroxy-prolyl-FK520,30-O-desmethyl-3-hydroxy-prolyl-
FK520,30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31-
dehydroxy-31-methyl-3-hydroxy-prolyl-FK520>30-O-desmethyl-31-dehydroxy-31-
fluoro-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-fluoro-3-hydrow-prolyl-FK520, 30-
O-desmethyl-31-dehydroxy-31-chloro-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-
chloro-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-3-
hydroxy-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexy])-28-(hydroxy-
cycloheptyl)-3-hydroxy-prolyl-FK520, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-norbornyl)-3-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-31-hydroxy-3-
hydroxy-prolyl-FK520,8-deoxo-30-desmethoxy-30-c;s-hydroxy-31-trans-hydroxy-3-
hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31 -cis-hydroxy-3-
hydroxy-prolyl-FK520,8-debxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-3-
hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-3-hydroxy-prolyl-
FK520, 8-deoxo-30-O-desmethyl-3-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-
30-methyl-3-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -
methyl-3-hydroxy-prolyl-FK520) 8-deoxo-30-O-desmethyl-31-dehydroxy-31-fluoro-3-
hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-3-hydroxy-proiyl-FK520, 8-
deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-chloro-3-hydroxy-3-hydroxy-pro!yl-FK520, 8-deoxo-30-O-desmethyl-
31 -dehydroxy-31 -terf-butyl-3-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-
hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK520, 8-deoxo-28-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK520,
30-desmethoxy-4-hydroxy-prolyl-FK520,30-desmethoxy-30-cis-hydroxy-31-trans-
hydroxy-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-
hydroxy-prolyl-FK520,30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy-
prolyl-FK520, 30-O-desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK520, 30-O-

desmetbyM-hydroxy-prolyl-FK520, 30-desmethoxy-30-methyl-4-hydroxy-prolyl-
FK520, 30-O-desmethyl-31-dehydroxy-31-methyl-4-hydroxy-prolyl-FK520, 30-O-
desmethyl-31 -dehydroxy-31 -fluoro-4-hydroxy-prolyl-FK520, 30-desmethoxy-30-
tluoro-4-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -chloro-4-hydroxy-
prolyl-FK520, 30-desmethoxy-30-chloro-4-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -
dehydroxy-31 -tert-butyl-4-hydroxy-prolyl-FK5201 28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK520,28-de(3-methoxy-4-
hydroxy-cyclohexyl>-28-(hydroxy-norbomyl)-4-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-31-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-
hydroxy-31-irans-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-
hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-trans-
hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-
dehydroxy-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-.
FK520, 8-deoxo-30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-
desmethyl-31 -dehydroxy-31 -methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-
desmethyl-31-dehydroxy-31:tluoro-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-
30-fluoro-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -chloro-
4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-chloro-3-hydroxy-4-hydroxy-
prolyl-FK520, 8-deoxo-30-O-desmethy^1 -dehydroxy-31 -ferf-butyl-4-hydroxy-prolyl-
FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyO-28-(hydroxy-cycIoheptyl)-4-
hydroxy-prolyf-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-
norbornyl)-4-hydroxy-prolyl-FK520,31-desmethoxy-fral7s-3-bicycloI3.1.0.JFK520, 31-
desmethoxy-31-cis-hydroxy-32-trans-hydroxy-trans-3-bicyclo[3.1.0.]FK520, 31-
desmethoxy-31-cis-hydroxy-32-cis-hydroxy-trans-3-bicyclo[3.1.0.]FK520, 31 -
desmethoxy-31-trans-hydroxy-32-trans-hydroxy- desmethyl-32-dehydroxy-£rans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl-trans-3-
bicyclop.1.0.]FK520>31-desmethoxy-31-methyWrans-3-bicycto[3.1.0.]FK520, 31-O-
desmethyl-32-dehydroxy-32-methykrans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl-
32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31-fluoro-trans-
3-bicyclo[3.1.0.]FK520, 31 -O-desmethyl-32-dehydroxy-32-chloro-trans-3-
bicyclot3.1.0.]FK520,31-desmethoxy-31-chloro-trans-3-bicyclo[3.1.0.]FK520, 31-O-
desmethyl-32-dehydroxy-32-tert-butyl-trans-3-bicyclo[3.1.0.]FK520, 29-de(3-
methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-trans-3-
bicyclo[3.1.0.]FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-
norbornyl)-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31 -desmethoxy-trans-3-

bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-&ial7S-hydroxy-
frans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-desmethoxy-31-cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.JFK520, 9-deoxo-31-desmethoxy-31 -trans-hydroxy-32-
frans-hydroxy-trans-3-bicyclo[3.1.0.]FK520I9-deoxo-31-O-desm6thy]-32-dehydroxy-
frans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.]FK520,
9-deoxo-31-desmethoxy-31-methyl-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O-
desmethyl-32-dehydroxy-32-methyl-tans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 -O-
desmethyl-32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 -
desmethoxy-31 -fluoro-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31 -O-desmethyl-32-
dehydroxy-32-chloro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-desmethoxy-31-
chloro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-32-dehydroxy-32-feff-
butyl-trans-3-bicyclo[3.1.0.JFK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-cycloheptyl)-fral7s-3-bicyclo[3.1.0.JFK520, 9-deoxo-29-de(3-methoxy-4-
hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-trans-3-bicyclo[3.1.0.]FK520,
In a more highly preferred embodiment, the present invention provides the
following novel FK520 analogues: 31 -desmethoxy-31 -methyl-FK520, 31-
desmethoxy-31.-fluon>FK520, 31-desmethoxy-31-chlon>FK520, 31-O-desmethyl-32-
dehydroxy-32-ferf-butyl-FK520,29-de(3-methoxy-4-hydroxy-cycIohexyl)-29-(hydroxy-
cycloheptyl)-FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-
FK520, 9-deoxo-31 -desmethoxy-31 -methyl-FK520, 9-deoxo-31 -desmethoxy-31 -
fluoro-FK520,9-deoxo-31-desmethoxy-31-chloro-FK520, 9-deoxo-31-O-desmethyt-
32-dehydroxy-32-fert-butyl-FK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-cycloheptyl)-FK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-norbornyl)-FK520, 30-desmethoxy-30-methyl-prolyl-FK520, 30-
desmethoxy-30-fluoro-prolyl-FK520, 30-desmethoxy-30-chloro-prolyl-FK520, 30-
desmethyl-31-dehydroxy-31-ferf-butyl-prolyl-FK520, 28-de(3-rnethoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-cycloheptyl)-FK520, 28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbornyr)-FK520)8-deoxo-30-desmethoxii'-31-hydroxy-
prolyl-FK520, 8-deoxo-3f>desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-
FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31 -cis-hydroxy-prolyl-FK520, 8-
deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK520, 8-deoxo-30-
O-desmethyl-31 -dehydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-prolyl-FK520, 8-
deoxo-30-desmethoxy-30-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -
dehydroxy-31-methyl-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-
fluoro-prolyl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-prolyl-FK520, 8-deoxo-30-O-

desmethyl-31 -dehydroxy-31 -chloro-proly)-FK520, 8-deoxo-30-desmethoxy-30-chloro-
prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-terf-butyl-prolyl-FK520, 8-
deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl-
FK520,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-
prolyl-FK520,30-desmethoxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-
hydroxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-
31 -cis-hydroxy-3-hydroxy-prolyl-FK520, 30-desmethoxy-30- hydroxy-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31-dehydroxy-3-hydroxy-prolyl-
FK520, 30-O-desmethyl-3-hydroxy-prolyl-FK520,30-desmethoxy-30-methyl-3-
hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl-
FK520, 30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-pro!yl-FK520, 30-
desmethoxy-30-fluoro-3-hydroxy-prolyl-FK520, 30-O-desmethyl-31 -dehydroxy-31 -
chIoro-3-hydroxy-prolyl-FK520I30-desmethoxy-30-chloro-3-hydroxy-prolyl-FK520,
30-O-desmethyl-31 -dehydroxy-31 -fe/t-butyl-3-hydroxy-prolyl-FK520,28-de(3-
methoxy-4-hydroxy-cyclohexyl)-2S-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK520, 28-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK520,
8-deoxp-30rdesmethoxy-31-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-cis-hydroxy-31 -4rans-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-irans-hydroxy-31 -frar/s-hydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-
O-desmethyl-31 -dehydroxy-3-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-3-
hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK5201 8-
deoxo-30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl-FK520, 8-deoxo-
30-O-desmethyl-31 -dehydroxy-31 -fluoro-3-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-fluoro-3-hydroxy-proly)-FK520, 8-deoxo-30-O-desmethyl-31 -
dehydroxy-31-chloro-3-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-ch!oro-3-
hydroxy^3-hydroxy-prolyl-FK520, 8-deoxo-3D-O-desmethyl-3lHJehydroxy-31-fe/t-
butyl-3-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK520) 30-desmethoxy-4-
hydroxy-prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy-
prolyl-FK520, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK520,
30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK520, 30-O-
desmethyl-31-dehydroxy-4-hydroxy-pro)yl-FK520, 3l>0-desmethyl-4-hydroxy-pro^
FK520, 30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK520,30-O-desmethyl-31 -

dehydroxy-31-methyl-4-hydroxy-proIyl-FK520,30-O-desmethyl-31-dehydroxy-31-
fluoro-4-hydroxy-prolyl-FK520,30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK520, 30-
O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK520l 30-desmethoxy-30-
chloro-4-hydroxy-prolyl-FK520,30-O-desmethyl-31-dehydroxy-31-fert-butyl-4-
hydroxy-prolyl-FK520,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-
cycloheptyl)-4-hydroxy-prolyl-FK520, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-norbornyl)-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-31 -hydroxy-4-
hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-
hydroxy-prolyl-FK520) B-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-
hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-30-trans-hydroxy-31-frartS-hydroxy-4-
hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31 -dehydroxy-4-hydroxy-prolyl-
. FK520, 8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-desmethoxy-
30-methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-
methyl-4-hydroxy-prolyl-FK520, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-fluoro-4-
hydroxy-pro)yl-FK520, 8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK520, 8-
deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK520, 8-deoxo-30-
desmethoxy-30-chloro-3-hydroxy-4-hydroxy-prolyl-FK520,8-deoxo-30-O-desmethyl-
31-dehydroxy-31~ferf-butyl-4-hydroxy-prolyl-FK520, 8-deoxo-28-de(3-methoxy-4-
hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK520, 8-deoxo-28-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-4-hydroxy-prDlyl-FK520r
31-desmethoxy-trans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-31-cis-hydroxy-32-
frans-hydroxy-£ral7S-3-bicyclo[3.1.0.]FK520,31 -desmethoxy-31 -cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.]FK520,31 -desmethoxy-31-trans-hydroxy-32-trans-
hydroxy-trans-3-bicyclo[3.1.0.]FK520,31-O-desmethyl-32-dehydroxy-trans-3-
bicyclo[3.1.0.]FK520, 31-O-desmethyMrans-3-bicyclo[3.1.0.]FK520, 31-desmethoxy-
31-methyMrans-3-bicyclo[3.1.0.]FK520, 31-O-desmethyl-32-dehydroxy-32-methyl-
Zrans-34)icyclo[3.1.0.)FK520, 31-O-desmethyl-32-dehydroxy-32-fluoro-foal7S-3-
bicyclo[3.1.0.JFK520, 31-desmethoxy-31-fluorchfrans-3-bicyclo[3.1.0.JFK520, 31-O-
desmethyl-32-dehydroxy-32-chloro-trans-3-b»cyclo[3.1.0.]FK520, 31-desmethoxy-31-
chloro-trans-3-bicycio[3.1.0.]FK520, 31-O-desmethyl-32-dehydroxy-32-te/f-butyl-
fral7S-3-bicyclo[3.1.0.]FK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-
cycloheptyl)-£rans-3-bicyclo[3.1.0.JFK520, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-norbornyl)-trans-3-bicycio[3,1.0.JFK520, 9-deoxo-31 -desmethoxy-trans-
3-bicyclo[3.1.0.JFK52O, 9-deoxo-31 -desmethoxy-31 -c;s-hydroxy-32-trans-hydroxy-
frans-3-bicyclo[3.1.0.]FK520, 9^deoxo-31-desmethoxy-31-cis-hydroxy-32-c/5-

hydroxy-trans-3-bicyclo[3.1.0.]FK520I9-deoxo-31-desmethoxy-31-trans-hydroxy-32-
frBns-hydroxy- trans-3-b)cyc\o[3.1.0.]FK520, 9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.JFK520,
9-deoxo-31-desmethoxy-31-methyWrans-3-bicyclo[3.1.0.JFK520,9-deoxo-31 -O-
desmethyl-32-dehydroxy-32-methyl-trans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-O-
desmethyl-32-dehydroxy-32-fluoro-irans-3-bicyclo{3.1.0JFK520, 9-deoxo-31 -
desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.JFK520, 9-deoxo-31-O-desmethyl-32-
dehydroxy-32-chloro-irans-3-bicyclo[3.1.0.]FK520, 9-deoxo-31-desmethoxy-31-
chioro-trans-3-bicyclo[3.1.0.]FK520,9-deoxo-31-O-desmethyl-32-dehydroxy-32-terf-
butyMral?s-3-bicyclo[3.1.0.]FK520, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy- hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-trans-3-bicyclo[3.1.0.]FK520.
In a further aspect the present invention provides the following FK506
analogues: 31-desmethoxy-FK506,31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-
FK506, 31-desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK506, 31-desmethoxy-31-
frans-hydroxy-32-&-ans-hydroxy-FK506, 31-O-desmethyl-32-dehydroxy-FK506, 31-O-
desmethyl-FK506, 31-desmethoxy-31-methyl-FK506,31-O-desmethyl-32-dehydroxy-
32-methyl-FK506,31-O-desmethyl-32-dehydroxy-32-fluoro-FK506>3l-desmethoxy-
31-fluoro-FK506, 31-O-desmethyl-32-dehydroxy-32-chloro-FK506, 31-desmethoxy-
31-chloro-FK506,31-O-desmethyl-32-dehydroxy-32-terf-butyl-FK506,29-de(3-
methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK506, 29-de(3-methoxy-4-
hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-FK506, 9-deoxo-31-desmethoxy-FK506,
9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK506, 9-deoxo-31-
desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK506, 9-deoxo-31-desmethoxy-31-
frans-hydroxy-32-trans-hydroxy-FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy-
FK506,9-deoxo-31-O-desmethyl-FK566,9-deoxo-31-desmethoxy-31-methyl-FK506,
9-deoxo^31-O-desmethyl-32-dehydroxy-32-methyl-FK506, 9-deoxo-31-O-desmethyl-
32-dehydroxy-32-fluoro-FK506, 9-deoxo-31-desmethoxy-31-fluoro-FK506, 9-deoxo-
31-O-desmethyl-32-dehydroxy-32-chIoro-FK506,9-deoxo-31-desmethoxy-31-chloro-
FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert-butyl-FK506, 9-deoxo-29-
de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-cycloheptyl)-FK506, 9-deoxo-29-
de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbomyO-FK506,30-desmethoxy-
prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-FK506, 30-
desmethoxy-30-cis-hydroxy-31-cis-hydroxy-prolyl-FK506, 30-desmethoxy-30-trans-
hydroxy-31-franJ^hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-prolyl-FK506,

30-O-desmethyl-prolyl-FK506, 30-desmethoxy-30-methyl-prolyl-FK506, 30-O-
desmethyl-31-dehydroxy-31-methyl-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-
fluoro-prolyl-FK506, 30-desmethoxy-30-fluoro-prolyl-FK506, 30-O-desmethyl-31-
dehydroxy-31 -chloro-prolyl-FK506, 30-desmethoxy-30-chloro-prolyl-FK506, 30-O-
desmethyl-31 -dehydroxy-31 -te/f-butyl-prolyl-FK506,28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-cycloheptyl)-FK506, 28-de(3-methoxy-4-hydroxy-
cycIohexyl)-28-(hydroxy-norbomyl)-FK506, 8-deoxo-30-desmethoxy-31-hydroxy-
prolyl-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-
FK506, 8-deoxo-30ntesmethoxy-30-cis-hydroxy-31 -cis-hydroxy-prolyl-FK506, 8-
deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK506, 8-deoxo-30-
O-desmethyl-31 -dehydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-pro!yl-FK506, 8-
deoxo-30-desmethoxy-30-methyl-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -
dehydroxy-31 -methyl-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -
fluoro-prolyl-FK506, 8-deoxo-30-desmethoxy-30-fluoro-prolyl-FK506, 8-deoxo-30-O-
desmethyl-31-dehydroxy-31-chloro-prolyl-FK506, 8-deoxo-30-desmethoxy-30-chloro-
prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-prolyl-FK506, 8-
deoxo-28-de(3-methoxyr4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyO-prolyl-
FK506, S-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-
prolyl-FK506, 30-desmethoxy-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-
hydroxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-
31 -cis4iydroxy-3-hydroxy-prolyl-FK506, 3f>desmethoxy-30-£rans-hydroxy-31 -trans-
hydroxy-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-3-hydroxy-prolyl-
FK506, 30-O-desmethyl-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-methyl-3-
hydroxy-prolyl-FK506,30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl-
FK506, SO-O-desmethyl-SI-dehydroxy-SI-fluoro-S-hydroxy-prolyl-FKSOB, 30-
desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506,30-O-desmethyl-3lKiehydroxy-31-
chloro-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-chloro-3-hydroxy-proIyl-FK50B,
30-O-desmethyl-31-dehydroxyT31-terf-butyl-3-hydroxy-prolyl-FK506, 28-de(3-
methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 2B-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-pro!yl-FK506,
8-deoxo-30-desmethoxy-31 -hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-cis-hydroxy-31-irans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-trans-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-
O-desmethyl-3l-dehydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-3-

hydroxy-prolyl-FK506,8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 8-
deoxo-SO-O-desmethyl-SI-dehydroxy-SI-methyl-S-hydroxy-prolyl-FKSOe.S-deoxo-
30-O-desmeth^31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30-Odesmethyl-31-
dehydroxy-31-chloro-3-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-chloro-3-
hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-terf-
butyl-3-hydroxy-proly)-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK506, 30-desmethoxy-4-
hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy-
prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-cfe-hydroxy-4-hydroxy-prolyl-FK506,
30-desmethoxy-30-trans-hydroxy-31 -trans-hydroxy-4-hydroxy-prolyl-FK506,30-O-
desmethyl-31-dehydroxy-4-hydroxy-proIyl-FK506, 30-O-desmethyl-4-hydroxy-prolyl-
FK506, 30-desmethoxy-30-methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31-
dehydroxy-31 -methyl-4-hydroxy-prolyl-FK506, 30-O-desmethjri-31 -dehydroxy-31 -
fluoro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 30-
0-desmethyl-31 -dehydroxy-31 -chloro-4-hydroxy-prolyl-FK5D6, 30-desmethoxy-30-
chloro-4-hydroxy-proIyl-FK506, 30-O-desmethyl-31 -dehydroxy-31 -terf-butyl-4-
hydroxy-pro)yl-FK506l28-de(3-metboxy-4-hydroxy-cyclohexyl)-28-(hydroxy-
cycloheptyl)-4-hydroxy-prolyl-FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-norbornyl)-4-hydroxy-proIyl-FK506, 8-deoxo-30-desmethoxy-31-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31 -lrans-hydroxy-4-
hydroxy-prolyl-FK506,8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-4-hydroxy-prolyl-
FK506, 8-deoxo-30-O-desmethyM-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-
30-meth~yl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -
methyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-fluoro-4-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 8-
deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-chloro-3-hydroxy-4-hydroxy-proiyl-FK506, 8-deoxo-3r>0-desmethyl-
SI-dehydroxy-SI-tert-butyl-^hydroxy-prolyl-FKSOe, 8-deoxo-28-de(3-methoxy-4-
hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK506, 8-deoxo-28-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-4-hydroxy-prolyl-FK506,
31-desmethoxy-fral7S-3-bicyclo[3.1.0.]FK506,31-desmethoxy-31-cis-hydroxy-32-

frans-hydroxy-trans-3-bicyclo[3.1.0.]FK506,31-desmethoxy-31-cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy-31-trans-hydroxy-32-frBns-
hydroxy-trans-3-bicyclo[3.1.0.JFK506, 31-O-desmethyl-32-dehydroxy-trans-3-
bicyclo[3.1.0.JFK506, 31-O-desmethyWrans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy-
31 -methyl-trans-3-bicyclo[3.1.0.JFK506,31-O-desmethyl-32-dehydroxy-32-methyl-
fral7s-3-bicyclo[3.1.0.JFK506, 31 -O-desmethyl-32-dehydroxy-32-fiuoro-fral7s-3-
bicyclo[3.1.0.JFK506, 31-desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.JFK506, 31-O-
desmethyl-32-dehydroxy-32-chloro-trans-3-bicyc)o[3.1.0.]FK506, 31 -desmethoxy-31 -
chloro-trans-3-bicyclo[3.1.0.]FK506, 31-O-desmethyl-32-dehydroxy-32-terf-butyl-
frans-3-bicyclo[3.1.0.]FK506, 29-de(3-methoxy-4-hydroxy-cycIohexyJ)-29-(hydroxy-
cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506,29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-norbornyl)-f/ans-3-bicyclo[3.1.0.JFK506, 9-deoxo-31 -desmethoxy-trans-
3-bicyclo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31 -cis-hydroxy-32-trans-hydroxy-
frans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31-cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31-irans-hydroxy-32-
frans-hydroxy-fral?s-3-bicyclo[3.1.0JFK505, 9-deoxo-31 -O-desmethyl-32-dehydroxy-
frans-3-bicyclo[3.1.0.JFK506,9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0JFK506,
9-deoxo-31-desmethoxy-31-methyWrans-3-bicyclo[3.1.0.3FK506,9-deoxo-31-O-
desmethyl-32-dehydroxy-32-methyl-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-O-
desmethyl-32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-
desmethoxy-31-fluoro-f/al7S-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32-
dehydroxy-32-chIoro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31 -desmethoxy-31 -
chloro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert-
butyl-trans-3-bicyclo[3.1.0.JFK506, 9-deoxo-29-de(3-methaxy-4~hydroxy-cyclohexyl)-
29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4-
hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-trans-3-bicyclo[3.3.0.]FK506,
In a preferred embodiment, the present invention provides the following FK506
analogues: 31 -desmethoxy-31 -cis-hydroxy-3,2-trans-hydroxy-FK506, 31 -desmethoxy-
31-cis-hydroxy-32-cis-hydroxy-FK506,31-desmethoxy-31-trans-hydroxy-32-trans-
hydroxy-FK506, 31-desmethoxy-31 -methyl-FK506, 31-O-desmethyl-32-dehydroxy-
32-terf-butyl-FK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-
cycloheptyl)-FK506, 29-de(3-methoxy-4-hydroxy-cycJohexyl)-29-(hydroxy-norbornyl)-
FK506, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-FK506,9-deoxo-
31-desmethoxy-31-cis-hydroxy-32-cis-hydroxy-FK506, 9-deoxo-31-desmethoxy-31-
frans-hydroxy-32-trans-hydroxy-FK506,9-deoxo-31-desmethoxy-31-methyl-FK506,

9-deoxo-31 -O-desmethyl-Sa-dehydroxy-Sa-te/f-butyl-FKSOe, 9-deoxo-29-de(3-
methoxy-^-hydroxy-cyclohexyl^Q-^ydroxy-cycloheptylJ-FKSOB, 9-deoxo-29-de(3-
methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-FK506,.30-desmethoxy-30-
cis-hydroxy-31 -fral?s-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31 -cis-
hydroxy-prolyl-FK506, 30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-
FK506,30-desmethoxy-30-methyl-prolyl-FK506,30-O-desmethyl-31-dehydroxy-31-
fert-butyl-prolyl-FK506128-de(3-methoxy-4-hydroxy-c^clohexyl)-28^(hydroxy-
cycloheptyl)-FK506,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-
FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-prolyl-FK506, 8-
deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-proIyl-FK506, 8-deoxo-30-
desmethoxy-30-trans-hydroxy-31-trans-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-methyl-protyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-terf-
butyl-prolyl-FK506,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-
cycloheptyl)-pro!yl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-norbornyl)-prolyl-FK506, 30-desmBthoxy-3-hydroxy-prolyl-FK506, 30-
desmethoxy-30-cis-hydroxy-31-trans-hydroxy-3-hydroxy-pro)yl-FK506, 30-
desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK506, 30-desmethoxy-
30-trans-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31-
dehydroxy-S-hydroxy-prolyl-FKSOe.SO-O-desmethyl-S-hydroxy-proIyl-FKSOe, 30-
desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-
methyl-3-hydroxy-prolyl-FK506,30-O-desmethyJ-31-dehydroxy-31-fluoro-3-hydroxy-
prolyl-FK506, 30-desmethoxy-30-f!uoro-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31 -
dehydroxy-31 -chloro-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-chloro-3-hydroxy-
pro!yl-FK506, 30-O-desmethyl-31-dehydroxy-31-ferf-butyl-3-hydroxy-proiyl-FK506,
28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-
FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-Qorbornyl)-3-hydroxy-
prolyl-FK506, 8-deoxo-30-desmethoxy-31 -hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-
30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-
30-desmethoxy-30-cfe-hydroxy-31-cis-hydroxy-3-hydroxy-proIyl-FK506, 8-deoxo-30-
desmethoxy-SO-trans-hydroxy-SI-trans-hydroxy-S-hydroxy-prolyl-FKSOB, 8-deoxo-30-
O-desmethyl-SI-dehydroxy-S-hydroxy-prolyl-FKSOe, 8-deoxo-30-O-desmethyl-3-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 8-
deoxo-30-O-desmethyl-31 -dehydroxy-31 -methyl-3-hydroxy-prolyl-FK506, 8-deoxo-
30-O-desmethyl-31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -

dehydroxy-31-chloro-3-hydroxy-prolyl-FK506t 8-deoxo-30-desmethoxy-30-chloro-3-
hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -tert-
butyl-S-hydroxy-prolyl-FKSOe, 8-deoxo-28-de(3-methpxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK506, 30-desmethoxy-4-
hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy-
prolyl-FK506, 30>desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK506,
30-desmethoxy-30-fral7S-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK506,30-O-
desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK506, 30-O-desmethyl-4-hydroxy-prolyl-
FK506, 30-desmethoxy-30-methyl-4-hydroxy-proiyl-FK506,30-O-desmethyl-31-
dehydroxy-31-methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-
fluoro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 30-
0-desmethyl-31-dehydroxy-31-chIoro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-
chloro^-hydroxy-prolyl-FKSOe, 30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-4-
hydroxy-prolyl-FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-
cycloheptyl)-4-hydroxy-prolyl-FK506, 28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-norbornyl)-4^hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-31 -hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-3f>cis-hydroxy-31-trans-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-ffans-hydroxy-31-trans-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-4-hydroxy-prolyl-
FK506,8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-
30-methyf-4-hydroxy-prolyl-FK506,8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -
methyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -fluoro-4-
hydroxy-proIyl-FK506, 8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506, 8-
deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prQlyl-FK506, 8-deoxo-30-
desmethoxy-30-chloro-3-hydroxy-4-hydroxy-prolyl-FK506,8-deoxo-30-O-desmethyl-
31-dehydroxy-31-fert-butyl-4-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-
hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK506, 8-deoxo-28-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-4-hydroxy-prolyl-FK5061
31 -desmethoxy-trans-3-bicyclo[3.1.0.JFK506, 31 -desmethoxy-31 -cis-hydroxy-32-
frans-hydroxy-trans-3-bicycio[3.1.0.]FK506, 31-desmethoxy-31-cis-hydroxy-32-cis-
hydroxy-trans-3-bicycio[3.1.0.]FK506, 31-desmethoxy-31-trans-hydroxy-32-trans-
hydroxy-trans-3-bicyclo[3.1.0.JFK506,31 -O-desmethyl-32-dehydroxy-trans-3-
bicyc)o[3.1.0.]FK506, 31-O-desmethyWrans-3-bicyclo[3.1.i).]FK50B, 31-desmethoxy-

31-me%kran^3-bicyclo[3.1.0JFK506,31-O-desmethyl-32-dehydroxy-32-methyl-
frans-3-bicyclo[3.1.0.]FK506, 31-O-desmethyh32-dehydroxy-32-fluoro-trans-3-
bicyclo[3.1.0.]FK506, 31-desmethoxy-31-fIuoro-trans-3-bicyclo[3.1.0.JFK506, 31TO-
desmethyl-32-dehydroxy-32-chloro-trans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy-31-
chloro-trans-3-bicycio[3.1.0.]FK506, 31-O-desmethyl-32-dehydroxy-32-terf-butyl-
frans-3-bicyclo[3.1.0.JFK506, 29-de(3-methoxy-4-hydroxy-K;yclohexyl)-29-(hydroxy-
cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506,29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-norbornyl)-frBns-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-frBns-
3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-trans-hydroxy-
frans-3-bicydo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-cis-hydroxy-32-cis-
hydroxy-fral7S-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-trans-hydroxy-32-
frans-hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31-O-desmethyl-32-dehydroxy-
frans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.]FK506,
9-deoxo-31-desmethoxy-31-methyl-trans-3-bicyclo[3.1.0JFK506,9-deoxo-31-O-
desmethyl-32-dehydroxy-32-methyl-ffBns-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-
desmethyl-32-dehydroxy-32-fluoro-fral7S-3-bicyclo[3.1.0.JFK506, 9-deoxo-31 -
desmethoxy-31-fluoro-trans-3-bicyclo[3.lO.]FK506, 9-dBoxo-31-O-desmethy^32- .
dehydroxy-32-chloro-tral7S-3-bicyclot3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-
chloro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32-dehydroxy-32-terf-
butyl-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4-
hydroxy-cyclohexyl)-29-(hydroxy-norbornyO-trans-3-bicyclo[3.1,0.]FK506.
In a more highly preferred embodiment, the present invention provides the
following FK506 analogues: 31-desmethoxy-31-methyl-FK506,31-O-desmethyl-32-
dehydroxy-32-terf-butyl-FK506,29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-
cycloheptyl)-FK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-norbornyl)-
FK506,!9-deoxo-31-desmethoxy-31-methyl-FK506,9-deoxo-3i-O-desmethyl-32-
dehydroxy-32-tert-butyl-FK506,9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-
(hydroxy-cycloheptyl)-FK506, 9-deoxo*29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-
(hydroxy-norbornyl)-FK506,30-desmethoxy-30-methyl-prolyl-FK506, 30-O-
desmethyl-31 -dehydroxy-31 -tert-butyl-prolyl-FK506, 28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-cycloheptyO-FK506, 28-de(3-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbomyl)-FK506, 8-deoxo-30-desmethoxy-30-methyl-
prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -ferf-butyl-prolyl-FK506, 8-
deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-prolyl-

FK506,8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbomyl)-
prolyl-FK506, 30-desmethoxy-3-hydroxy-prolyl-FK506,30-desmethoxy-30-cis-
hydroxy-31-frans*hydroxy-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-
31-cfe-hydroxy-3-hydroxy-prolyl-FK506,30-desmethoxy-30-trans-hydroxy-31-trans-
hydroxy-3-hydroxy-prolyl-FK506, 30-Odesmethyl-31-dehydroxy-3-hydroxy-prolyl-
FK506,30-O-desmethyl-3-hydroxy-prolyl-FK506,30-desmethoxy-30-methyl-3-
hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-methyl-3-hydroxy-prolyl-
FK506, 3f>CVdesmethyl-31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 30-
desmethoxy-30-fluoro-3-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-
chloro-3-hydroxy-prolyl-FK506, 30-desmethoxy-30-chloro-3-hydroxy-prolyl-FK506,
30-O-desmethyl-31 -dehydroxy-31 -tert-birtyl-3-hydroxy-prolyl-FK506, 28-de(3-
methoxy-4-hydroxy-cyclohexy()-28-(hydroxy-cycloheptyl)-3-hydroxy-prolyl-FK506, 28-
de(3-methoxy-4-hydroxy-cydohexyl)-28-(hydroxy-norbomyl)-3-hydroxy-prolyl-FK506,
8-deoxo-30-desmethoxy-31-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-cis-hydroxy-31-fcnans-hydroxy-3-hydroxy-prolyl-FK506,8-deoxo30-
desmethoxy-30-cis-hydroxy-31-cis-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desrnethoxy-30-trans-hydroxy-31 -trans-hydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-
O-desmethyl-31-dehydroxy-3-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-3-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-methyl-3-hydroxy-prolyl-FK506, 8-
deoxo-30-O-desmethyl-31-dehydroxy-31-methyl-3-hydroxy-prolyl-FK506, 8-deoxo-
30-O-desmethyl-31-dehydroxy-31-fluoro-3-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-fluoro-3-hydroxy-protyl-FK506,8-deoxo-30-O-desmethyl-31 -
dehydroxy-31-chloro-3-hydroxy-profyl-FK506, 8-deoxo-30-desmethoxy-30-chloro-3-
hydroxy-3-hydroxy-prolyl-FK506, B-deoxo-30-O-desmethyl-31 -dehydroxy-31 -tert-
butyl-3-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-
(hydroxy-cycloheptyO-S-hydroxy-prolyl-FKSOB, 8-deoxo-28-de^-methoxy-4-hydroxy-
cyclohexyl)-28-(hydroxy-norbornyl)-3-hydroxy-prolyl-FK506, 30-desmethoxy-4-
hydroxy-prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-trans-hydroxy-4-hydroxy-
prolyl-FK506, 30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-hydroxy-prolyl-FK506,
30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-hydroxy-prolyl-FK506, 30-O-
desmethyl-31-dehydroxy-4-hydroxy-prolyl-FK506, 30-O-desmethyl-4-hydroxy-prolyl-
FK506,30-desm6thoxy-30-methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31 -
dehydroxy-31 -methyl-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31 -dehydroxy-31 -
fluoro-4-hydroxy-prolyl-FK506,30-desmethoxy-30-fluoro-4-hydroxy-proiyl-FK506, 30-
O-desmethyl-31 -dehydroxy-31 -chloro-4-hydroxy-prolyl-FK506, 30-desmethoxy-30-

chloro-4-hydroxy-prolyl-FK506, 30-O-desmethyl-31-dehydroxy-31-terf-butyl-4-
hydroxy-prolyl-FK506,28-de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-
cycloheptylH^hydroxy-prolyl-FKSOB, 28-de(3-methoxy-4-:hydroxy-cyclohexyl)-28-
(hydroxy-norbomyl)-4-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-31 -hydroxy-4-
hydroxy-prolyl^K506,8-deoxo-3Cklesmethoxy-30-cis-hydroxy-31-frahs-hydroxy-4-
hydroxy-proly(-FK506, 8-deoxo-30-desmethoxy-30-cis-hydroxy-31-cis-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-30-trans-hydroxy-31-trans-hydroxy-4-
hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-4-hydroxy-prolyl-
FK506, 8-deoxo-30-O-desmethyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-desmethoxy-
30-methyM-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31-dehydroxy-31-
methyl-4-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-31 -dehydroxy-31 -fluoro-4-
hydroxy-prolyl-FK506,8-deoxo-30-desmethoxy-30-fluoro-4-hydroxy-prolyl-FK506,8-
deoxo-30-O-desmethyl-31-dehydroxy-31-chloro-4-hydroxy-prolyl-FK506, 8-deoxo-30-
desmethoxy-30-chloro-3-hydroxyU-hydroxy-prolyl-FK506, 8-deoxo-30-O-desmethyl-
31-dehydroxy-31-terf-butyl-4-hydroxy-prolyl-FK506, 8-deoxo-28-de(3-methoxy-4-
hydroxy-cyclohexyl)-28-(hydroxy-cycloheptyl)-4-hydroxy-prolyl-FK506,8-deoxo-28-
de(3-methoxy-4-hydroxy-cyclohexyl)-28-(hydroxy-norbornyl)-4-hydroxy-prolyl-FK506,
31 -desmethoxy-trans-3-bicyclo[3.1.0.JFK506,31 -desmethoxy-31 -cis-hydroxy-32-
frans-hydroxy-fral7S-3-bicyc!o[3.1:0.]FK506, 31-desmethoxy-31-cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.]FK506, 31-desmethoxy-31-trans-hydroxy-32-f/ans-
hydroxy-trans-3-bicyclo[3.1.0.JFK506,31 -O-desmethyl-32-dehydroxy-trans-3-
bicyclo[3.1.0.IFK506,31-O-desmethyMrans-3-bicyclo[3.1.0.JFK5O6, 31-desmethoxy-
31-methyl-trans-3-bicyclo[3.1.0.]FK506,31-O-desmethyl-32-dehydroxy-32-methyl-
frans-3-bicyclo[3.1.0.]FK506,31-C>-desmethyl-32-dehydroxy-32-f[uoro-fr3ns-3-
bicyclo[3.1.0.]FK506, 31-desmethoxy-31-fluoro-trans-3-bicyclo[3.1.0.JFK506, 31-O-
desmethyl-32-dehydroxy-32-chloro-iral)s-3-bicyclo[3.1.0.JFK506, 31 -desmethoxy-31 -
chloro-&ans-3-bicyclo[3.1.0.]FK506)31-O-desmethyl-32-dehydroxy-32-tert-butyl-
frans-3-bicyclo[3.1.0.]FK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-29-(hydroxy-
cyc)oheptyl)^frans-3-bicyclo[3.1.0.JFK506, 29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-norbornyl)-^rans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-trans-
3-bicycIo[3.1.0.]FK506,9-deoxo-31-desmethoxy-31-cis-hydroxy-32-fral7s-hydroxy-
frans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31 -desmethoxy-31 -cis-hydroxy-32-cis-
hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31 -desmethoxy-31 -trans-hydroxy-32-
fral7S-hydroxy-trans-3-bicyclo[3.1.0.]FK506,9-deoxo-31 -O-desmethyl-32-dehydroxy-
frans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-trans-3-bicyclo[3.1.0.JFK506,

9-deoxo-31 -desmethoxy-31 -methyMrans-3~bicyclo[3.1.0.JFK506, 9-deoxo-31 -O-
desmethyl-32-dehydroxy-32-methyl-irans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-
desmethyl-32-dehydroxy-32-fluoro-trans-3-bicyclo[3.1.0JFK506,9-deoxo-31-
desmethoxy-31-fluoroHfrans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-O-desmethyl-32-
dehydroxy-32-ch!oro-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-31-desmethoxy-31-
chloro-&ans-3-bicyclot3.1.0.]FK506,9-deoxo-31-O-desmethyl-32-dehydroxy-32-fert-
butyl-trans-3-bicyclo[3.1.0.JFK506, 9-deoxo-29-de(3-methoxy-4-hydroxy-cyclohexyl)-
29-(hydroxy-cycloheptyl)-trans-3-bicyclo[3.1.0.]FK506, 9-deoxo-29-de(3-methoxy-4-
hydroxy-cyclohexyl)-29-(hydroxy-norbomyl)-fralJs-3-bicyclo[3.1.0.JFK506.
In further aspects the invention provides:
A: Compounds of the formula:

where:
x = bond or CHR1,, or -CHFVx-CHrV is

R15 =

R1 = OH, OCH3
R2 = H, OH, OCH3
R3 = H, OH, CH3, F, CI, OCH3
R4 = H, OH, CH3, F, CI
R5 = H, OH
R6 = H, OH
R7 = H
R8=H, keto.
R9 = H, keto
R10 = H
R11 = H
R13 = H
R14 = H
R16 = OH, OCH3
R17 = H, OH, CI, F and
y = bond, CH2
with the-proviso that the compounds do not include the following::
i) where R1 = OCH3 in combination with R2= H, R« = C, RIB = cis-3-OH, Rn7
= trans-4-OH, R5= H, R6= H, R7= H, R8= H, R9= H, Ri0= H, R„ = H, x =
CHRn;
ii) where R1 - OH in combination with R2= OCH3, R1E = C, R16 = cis-3-OH,
R17= trans-A-OH, R5= H, R6= H, R7= H, RB,R9 = keto, R10= H Rin = H, x =
CHRn,'
iii) where Rt = OH in combination with R2 = OH, R16 = C, R16 = cis-3-OCH3,
R17= trans-A-OH, R5= H, R6= H, R7= H, RB,RB =keto, R10= H, Rn = H, x =
CHR11;

iv) where Ri = OH in combination with R2 = H, RiS = C, R16 = cis-3-OCH3, R17
= trans-4-OH, R6= H, Re= H, R7= H, R8lR9 = keto, R10= H, Rn = H, x =
CHR11;
v) where R1 = OCH3 in combination with R2 = H, R15 = C, R16 = cis-3-OH, R17
= frans-4-OH, RB= H, Rs= H, R7= H, R8lR9 = keto, R10 = H, Rn = H, x =
CHR11;
vi) where R1 = OCH3 in combination with R2= H, R15 = C, Ri6 = cis-3-OCH3,
Ri7= trans-4-OH, R6 = H, Re = H, R7 = H, R8 = H, R9 = H, R10 = H, R„ =
H, x = CHRni
vii) except where R1 = OCH3 in combination with R2 = OH, R15 = C, Ri6 = cis-
3-OCH3l R17= frans-4-OH, R5 = H, Re = H, R7 = H, R8 = H, R9 = H, R10 =
H,R11 = H,x = CHRi1;
vii*0 where RA - OCH3 in combination with R2 = OCH3, R« = C, Ri6 - cisr3-
OCH3, R17 = frans-4-OH, R5 = H, Re = H, R7 = H, R6 = H, R9 = H, R10 = H,
R11 = H,x = CHR11;
be) where R-, = OH in combination with R2 = OCH3, R16 = C, R16 = cis-3-OCH3,
Ri7= trans-40H, R5 = H, R6 = H, R7 = H, R8|R8 = keto, R10 = H, RM = H, x
= CHR11;
x) where R., = OCH3 in combination with R2 = OH, R15 = C, Ri6 = cis-3-OCH3,
R17= trans-4-OH, R5 = H, R6 = H, R7 = H, RB,R9 = keto, R10 = H, R1n = H, x
= CHR„;
xi) where R1 = OCH3 in combination with R2 = H, R15 = C, R16 = cis-3-OCH3,
R17= frans-4-OH, R5 = H, R6 = H, R7 = H, R8,R9 = keto, R10 = H, Ru = H, x
= CHRni
xii) where R-, = OCH3 in combination with R2 = OCH3, Rn5 = C, R16 = cis-3-OH,
R17 = frans-4-OH, R5 = H, Re = H, R7 = H, R8,R9 = keto, R10 = H, R„ = H, x
= CHRu;
xiii) where R1 = OCH3 in combination with R2 = H, Ri5 = C, R16 = cis-3-OCH3,
R17= trans-4-OH, R6 = H, R6 = H, R7 = H, Re = H, R9 = H, R10 = H, x =
bond;
xiv) where R1 = OCH3 in combination with R2 = OCH3, R15 = C, RiB = cis-3-
OCH3, R17 = trans-4-OH, R5 = H, Re = H, R7 = H, R8 = H. R9 = H, R10 = H,
x = bond;
xv) where R1 = OCH3 in combination with R2 = OH, R15 = C, R16 = cis-3-OCH3)
R17 = trans-A-OH, R5 = H, R6 = H, R7 = H, RB,R9 = keto, R1D = H, x = bond;

xvi) where Rt = OCH3 in combination with R2 = H, R« = C, R16 = cis-3-OCH3,
Ri7a trans-4-OH, R5 = H, Re = H, R7 = H, RB.RO = keto, R10 = H, x = bond;
xvii) where Rn = OCH3 in combination with R2 = OCH3, R15 = C, R1e = H, R17 =
OH, R5 = H, Re = H, R7 = H, R8|R8 = keto, R10 = H, Rn = H, x = CHRu;
xviii) where -CHRe-x-CHRu- is and R^ = H, R13 = H, R14 = H, in
combination with Ri = OCH3, R2 = OCH3) R16 = C, R16 = cis-3-OCH3, R17 =
trans-A-OH, R7 = H, R8, R9 = keto, R10 = H;
xix) where R16 = G, R16 = c;s-3-OCH3, Ri7 = trans-A-OH, y = bond, in
combination with Ri = OCH3, R2 = H, R5 = H, Re = OH, R7 = H, Rin = H, x
= bond, RB,R9 = keto, R10 = H
xx) where R16 = G, R3 = H, R4 = frans-OH, y = bond, in combination with Ri =
OCH3, R2 = OCH3, R5 = H, Re = H, R7 = H, R-n = H, x = CHRu, RBIRS =
keto, R10 = H
xxi) where R15 = G, R3 = H, R4 = OH, y = CH2 in combination with R1 = OCH3,
R2 = OCH3; R5 = H, R6 = H, R7 = H, R-n = H, x = CHRu, RB.RS = keto, R10
= H
xxii) where Ri5 = G, R3 = cis-OH, R4 = H, y = bond, in combination with Ri =
OCH3, R2 = OCH3, R5 = H, Re= H, R7 = H, Rn = H, x = CHRu, Re,Re =
keto, R10 = H
xxiii) where R15 = G, R3 = CH3, R4 = OH, y = bond, in combination with Rn =
OCH3, R2 = OCH3, R5= H, Re= H, R7 = H, R-n = H, x = CHR11, RB,R9 =
keto, R10 = H
xxiv) where R15 = G, R3 = H, R4 = OH, y = CH2, in combination with Ri = OH, R2
= OH, R5 = H, Re = H, R7 = H, R^ = H, x = CHRu, RB=RS = H, R10 = H
xxvjr where R16 = G, R3 = H, R4 = OH, y = CH2, in combination with R-, = OCH3,
R2 = OCH3, Rg = H, Re = H, R7 = H, R11 = H, X = CHRu, R8=R9 = H, R10 =
H
xxvi) where R16 = G, R3 = H, R1 = OH, y - CH2, in combination with R1 = OH, R2
= OCH3, R5 = H, Re = H, R7 = H, Rn = H, x = CHR1,, R8=R9 = H, R10 = H
xxvii) where R15 = G, R3 = H, R4 = OH, y = CH2, in combination with Ri = OH, R2
= H, R5 = H, Re = H, R7 = H, R^ = H, x = CHRu, Re=Rs = H, R10 = Hj
xxviii) where R15 = G, R3 = H, R4 = OH, y = CH2, in combination with Ri = OH, R2
= OCH3, R5 = H, R6 = H, R7 = H, R„ = H, x = CHRu, R8,R9 = keto, R10 = H

xxix) where R15= G, R3 = H, R4 = OH, y = CH2, in combination with R1 = OCH3,
R2 = H, R5 = H, Re = H, R7 = H, R;i = H, x = CHR„, RBjR9 = keto, R10 = H
B. Compounds according to the formula below

where
R, = OH, OCH3
R2 = H, OH, OCH3
R3 = H, OH, CH3, OCH3
R4 = H,OH
R5 = H
Re = H, OH
R7 = H
RB = H, keto
R9 = H, keto
Rio = H
x = bonct, CH2 or -CHRe-x-CHRs- is

Rn = H
R13 = H
Ri4 = H
y = bond, CH2
with the proviso that the compounds do not include the following:

0 where R3 = H, R4 = trans-OH, y = bond, in combination with Rt =
OCH3) R2 = OCH3l R6 = H, Re = H, R7 = H, x = CH2, R8)R9 = keto, R10
= H
ii) where R3 = H, R4 = OH, y = CH2 in combination with R1 = OCH3, R2 =
OCH3, R6 = H, R6 = H, R7 = H, x = CH2, iii) where R3 = cis-OH, R4 = H, y = bond, in combination with R-, = OCH3,
R2 = OCH3, R5 = H, R6 = H, R7 = H, x = CH2, RB,R8 = keto, R10 = H
iv) where R3 = CHS, R4 = OH, y = bond, in combination with Rn = OCH3,
R2 = OCH3, R6 = H, R6 = H, R7 = H, x = CH2, R8,RB = keto, R10 = H
v) where R3 = H, R» = OH, y = CH2, in combination with R1 = OH, R2 =
OH, R5 = H, Re = H, R7 = H, x= CH2l R8=R9 = H, R10 = H
vi) where R3 = H, R4 = OH, y = CH2, in combination with R^ = OCH3, R2 =
OCH3, R5 = H, Re = H, R7 = H, x = CH2, RB=R9 ~ H, R10 = H
vii) where R3 = H, R4 = OH, y = CH2, in combination with R., = OH, R2 =
OCH3, R5 = H, Re = H, R7 = H, x = CH2l R8=R9 — H, R10 = H
viii) where R3 = H, R4 = OH, y = CH2, in combination with R^ = OH, R2 = H,
R5= H, Re = H, R7 = H, x = CH2l R8=R9= H, R10 — H;
ix) where R3 = H, R4 = OH, y = CH2, in combination with R1 = OH, R2 =
OCH3, R5 = H, R6 = H, R7 = H, x = CH2, R8,R9 = keto, R10 = H
x) where R3 = H, R4 = OH, y = CH2, in combination with R1 = OCH3, R2 =
H, R5 = H, Re = H, R7 = H, x = CH2, RB,RB = keto, R10 = H
xi) where R3 = OCH3, R4 = OH, y = bond, in combination with R1 = OCH3,
R2 = H, R5 = H, R6 = OH, R7 = H, x = bond, RB,R9 = keto, R10 = H
xii) where -CHRe-x-CHRs- is and Rn = H, R13 = H, Ru = H, in
combination with Rn = OCH3, R2 = OCH3, R3 = OCH3, R4 = OH, R7 =
H, RB,R9 = keto, R10 = H
xiii) where Ri = OCH3 in combination with R2 = H, R3 = OCH3, R4= OH, R6
= H, Re = H, R7 = H, R8 = H, R6 = H, R10 = H, x = bond, y = bond
xiv) where Ri = OCH3 in combination with R2 = OCH3, R3 = OCH3, R4=
OH, R5 = H, R6 = H, R7 = H, R8 = H, R9 = H, R10 = H, x = bond, y =
bond
xv) where R1 = OCH3 in combination with R2 = OH, R3 = OCH3, R4 = OH,
Rs = H, R6 = H, R7 = H, R8,R9 = keto, R10 = H, x = bond, y = bond

xvi) where Ri = OCH3 in combination with R2 = H, R3 = OCH3, R4 = OH, Rs
= H, R5 = H, R7 = H, R^Rg = keto, R10 = H, x = bond, y = bond
xvii) where R1 = OCH3, R2 = H, R5 = OH, R4 = OH, R5 = H, R9 = H
xviii) where R1 = OCH3, R2 = H, Rg = OCH3> R4 = OH, R8 = H, R9 = H
xix) where Ri = OCH3) R2 = H, R3 = OH, R» = OH, RB,R9 = keto
xx) where R1 = OH, R2 = OH, R5 = OCH3, R4 = OH, RB,R9 = keto
xxi) where R^ = OCH3, R2 = OCH3, R3 = OH, R4 = OH, R8,R9 = keto
xxii) where R1 = OCH3, R2 = OH, R5 = OCH3, R4 = OH, R„,R9 = keto
xxiii) where R1 = OCH3, R2 = OCH3, R3 = OCH3, R4 = OH, R5 = H, R8 = H
C. A compound selected from the group consisting of. 9-deoxo-16-O-
desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre-rapamycin), 9-deoxo-16-
0-desmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin, 16-O-desmethyl-27-
desmethoxy-39-O-desmethyl-rapamycin, 9-deoxo-16-O-desmethyl-39-O-desmethyl-
rapamycin , 9-deoxo-16-O-desmethyl-27-desmethoxy-raparnycin , 16-O-desmethyl-
27-O-desmethyl-39-O-desmethyl-rapamycin, 9-deoxo-27-O-desmethyl-39-O-
desmethyl-rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-rapamycin , 27-O-
desmethyl-39-O-desmethyl-rapamycin, 9-deoxo-16-O-desmethyl-rapamycin , 9-
deoxo-39-O-desmethyl-rapamycin , 8-deoxo-15-O-desmethyl-26-desmethoxy-38-O-
desmethyl-prolylrapamycin (pre-prolylrapamycin), 8-deoxo-15-O-desmethyl-26-O-
desmethyl-38-O-desmethyl-prolylrapamycin, 15-O-desmethyl-26-desmethoxy-38-O-
desmethyl-prolylrapamycin, 8-deoxo-26-desmethoxy-38-O-desmethyl-
prolylrapamycin , 8-deoxo-15-O-desmethyl-38-O-desmethyl-prolylrapamycin , 8-
deoxo-15-O-desmethyl-26-desmethoxy-prolylrapamycin, 15-O-desmethyl-26-O-
desmethyl-38-O-desmethyl-prolylrapamycin, 8-deoxo-26-O-desmethyl-38-O-
desmethyl-prolylrapamycin, 8-deoxo-15-O-desmethyl-26-O-desmethyl-
prolylrapamycin , 15-O-desmethyl-38-O-desmethyl-prolylrapamycin , 15-O-
desmethyl-26-O-desmethyl-prolylrapamycin, 15-O-desmethyl-26-desmethoxy-
prolylrapamycin, 26-desmethoxy-38-O-desmethyl-prolylrapamycin, 26-O-desmethyl-
38-O-desmethyl-prolylrapamycin , 8-deoxo-15-O-desmethyl-prolylrapamycin , 8-
deoxo-26-O-desmethyl-prolylrapamycin, 8-deoxo-38-O-desmethyl-prolylrapamycin,
15-O-desmethyl-prolylrapamycin , 38-O-desmethyl-prolylrapamycin , 9-deoxo-16-O-
desmethyl-27-desmetiioxy-39-desmethoxy-rapamycin, 9-deoxo-16-O-desmethyl-27-
O-desmethyl-39-desmethoxy-rapamycin, 16-O-desmethyl-27-desmethoxy-39-
desmethoxy-rapamycin, 9-deoxo-27-desrnethoxy-39-desmethoxy-rapamycin, 9-

deoxo-16-O-desmethyl-39-desmethoxy-rapamycin, 16-O-desmethyl-27-O-
desmethyl-39-clesmethoxy-rapamycin, 9-deoxo-27-O-desmethyl-39-desmethoxy-
rapamycin , 16-O-desmethyl-39-desmethoxy-rapamycin , 27-desmethoxy-39-
desmethoxy-rapamycin, 27-O-desmethyl-39-desmethoxy-rapamycin , 9-deoxo-39-
desmethoxy-rapamycin, B-deoxo-15-O-desmethyl-26-desmethoxy-38-desmethoxy-
prolylrapamycin, 8-deoxo-15-O-desmethyl-26-O-desmethyl-38-desmethoxy-
prolylrapamycin, 15-O-desmethyl-26-desmethoxy-38-desmethoxy-prolylrapamycin,
8-deoxo-26-desmethoxy-38-desmethoxy-prolylrapamycin, 8-deoxo-15-O-desmethyl-
38-desmethoxy-proly)rapamycin, 15-O-desmethyl-26-O-desmethyl-38-desmethoxy-
proiylrapamycin , 8-deoxo-26-O-desmethyl-38-desmethoxy-proIylrapamycin , 15-O-
desmethyl-38-desmethoxy-prolylrapamycin, 26-desmethoxy-38-desmethoxy-
prolylrapamycin , 26-O-desmethyl-38-desmethoxy-prolylrapamycin , 8-deoxo-38-
desmethoxy-prolylrapamycin, 38-desmethoxy-prolylrapamycin, 9-deoxo-16-0
desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-
(hydroxycyclohexenyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-
cis-methoxy-4-trans-hydroxycyclohexyl)-36-(dihydroxy cyclohexyl) rapamycin, 9-
deoxo-16-O-desmethyl-27-desm6thoxy-36-de(3-cis-methoxy-4-trans-
hydroxycyclohexyl)-36-(hydroxynorbornyl) rapamycin, 9-deoxo-16-O-desmethyl-27-
desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-methyl-4-
hydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-
cis-methoxy-4-trans-hydroxycyclohexyl)-36-(4-methylhydroxycyclohexyl) rapamycin,
9-deoxo-16-O-desme&iyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-
hydroxycyclohexyl)-36-{3-fluoro-4-hydroxycyclohexyl) rapamycin, 9-deoxo-16-O-
desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-
hydroxy-4-fluorocyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-
de(3^is-methoxy-4-trans-hydroxycyclohexyl)-36-(3-chloro-4-hydroxycyclohexyl)
rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-
hydroxycyclohexyl)-36-(3-hydroxy-4-chlorocycloh6xyl) rapamycin, 9-deoxo-16-O-
desmethyl-27-desmethoxy-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-
cis-4-cis-dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-desmethoxy-
36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-36-(3-trans-4-trans-
dihydroxycyclohexyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-39-O-
desmethyl rapamycin, 9-deoxo-16-O-desmethyl-270-desmethyl-36-de(3-cis-
methoxy-4-trans-hydroxycyclohexyl)-36-(hydroxycyclohexenyl) rapamycin, 9-deoxo-
16-O-desmethy)-27-O-desmethyl-36-de(3-cis-methoxy-4-trans-hydroxycyclohexyl)-

36-(hydroxynorbomyl) rapamycin, 9-deoxo-16-O-desmethyl-27-O-desmethyl-36-
de(3-cis-methoxy-4-trans-hydroxycyciohexyl)-36-(4-methylhydroxycyclohexyl)
rapamycin.
In a specific embodiment the present invention describes methods to produce
and optionally isolate the following compounds (Figure 10, Figure 11, Figure 12,
Figure 13, and Figures 14,15,16 and Figure 17):

In a further aspect, the invention provides novel rapamycin analogues of

where
x = bond or CHRu, or -CHRs-x-CHRr is

y = bond or CHR12
Ri= OH, OCH3
R2= H, OH, OCH3
Rr= H, OH, OCH3, alkyl-, halo-, amino-, thiol- residue
R*= H, OH, OCH3, alkyh halo-, amino-, thiol- residue
R5= H, alkyl-, halo-, hydroxy- residue
RB= H, alkyl-, halo-, hydroxy- residue
R7= H, alkyl-, halo-, hydroxy- residue
Rs,Rfi= =OorH,H
Rio= H, alkyl-, halo-, hydroxy- residue
Rn= H, alkyl-, halo-, hydroxy- residue
R12= H, alkyl-, halo-, hydroxy-residue
Ri3= H, alkyl-, halo-, hydroxy- residue
R14= H, alkyl-, halo-, hydroxy- residue
Additionally, the present invention also provides novel rapamycin analogues of

where:
x = bond or CHRu, or -CHRrx-CHRjr is

R,= OH, OCH3
R2= H, OH, OCH3
R6= H, alkyl-, halo-, hydroxy- residue
Re= H, alkyl-, halo-, hydroxy- residue
R7= H, alkyl-, halo-, hydroxy- residue
R8,R9= =OorH,H
R10= H, alkyl-, halo-, hydroxy- residue
Rn= H, alkyl-, halo-, hydroxy- residue
R12= H, alkyl-, halo-, hydroxy-residue
R13= H, alkyl-, halo-, hydroxy- residue
R14= H, alkyl-, halo-, hydroxy- residue

The novel rapamycin analogues are useful directly, and as templates for
further semi-synthesis or bioconversion to produce compounds useful, as
immunosuppressants, antifungal agents, anticancer agents, neuroregenerative
agents or agents for the treatment of psoriasis, rheumatoid arthritis, fibrosis and other
hyperproliferative diseases.
Therefore in a further aspect, the present invention provides use of the FKBP-
iigand analogues generated in the manufacture of a medicament for the treatment of
cancer, the treatment of fungal infections, the treatment of autoimmune,
inflammatory, proliferative and hyperproliferative diseases or the maintenance of
immunosuppression.

One skilled in the art would be able by routine experimentation to determine
the ability of these compounds to inhibit fungal growth {e.g. Baker, H., et al., 1978;
NCCLS Reference method for broth dilution antifungal susceptibility testing for
yeasts: Approved standard M27-A, 17(9). 1997), and for example but without
limitation using the methods described in Example 19. Additionally, one skilled in the
art would be able by routine experimentation to determine the ability of these
compounds to inhibit tumour cell growth, for example but without limitation using the
methods described in Example 19, (also see Dudkin, L, et al., 2001; Yu et at. 2001).
In a further aspect the compounds of this invention are useful for inducing
immunosuppression and therefore relate to methods of therapeutically or
prophylactically inducing a suppression of a human's or an animal's immune system
for the treatment or prevention of rejection of transplanted organs or tissue, the
treatment of autoimmune, inflammatory, proliferative and hyperproliferative diseases
(examples include but are not inclusively limited to autoimmune diseases, diabetes
type I, acute or chronic rejection of an organ or tissue transplant, asthma, tumours or
hyperprolific disorders, psoriasis, eczema, rheumatoid arthritis, fibrosis, allergies and
food related allergies). Such assays are well known to those of skill in the art, for
example but without limitation: Immunosuppressant activity - Warner, LM.,et al.,
1992, Kahan et al. (1991) & Kahan & Camardo, 2001); Allografts - Fishbein, T.M., et
al., 2002, Kirchner et al. 2000; Autoimmune / Inflammatory / Asthma - Carlson, R.P.
et al., 1993, Powell, N. et al., 2001; Diabetes I - Rabinovitch, A. et al., 2002; Psoriasis
- Reitamo, S. et al., 2001; Rheumatoid arthritis - Foey, A., et al., 2002; Fibrosis -
Zhu, J. et al., 1999, Jain, S., et al., 2001, Gregory et al. 1993
The ability of the compounds of this invention to induce immunosuppression
may be demonstrated in standard tests used for this purpose, for example but
without limitation using the methods described in example 19.-In a further aspect the
compounds of this invention are useful in relation to antifibrotic, neuroregenerative
and anti-angiogenic mechanisms, one skilled in the art would be able by routine
experimentation to determine the ability of these compounds to prevent angiogenesis
(e.g. Guba, M.,et al., 2002,). One of skill in the art would be able by routine
experimentation to determine the utility of these compounds in stents (e.g. Morice,
M.C., et al., 2002). Additionally, one of skill in the art would be able by routine
experimentation to determine the neuroregenerative ability of these compounds (e.g.
Myckatyn, T.M., et al., 2002, Steiner et al. 1997)

Brief description of the/Figures ' \J \N v
Figure 1 Structure of rapamycin, the sections to the left of the line represent the
binding domain and those to the right indicate the effector domain.
Figure 2 Structure of rapamycin (A), FK-506 (B), FK-520 (C) and meridamycin
(D)
Figure 3 Plasmid map of pMG55, a double recombination vector with RpsL
positive selection and oriT for conjugation.
Figure 4 A flow chart demonstrating the cloning strategy for the isolation of
pMAG144-16 to create MG2-10.
Figure 5 Overview over the gene cassettes
Figure 6 Structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl
rapamycin
Figure 7 Structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl
prolylrapamycin
Figure 8 Structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy
rapamycin
Figure 9 Structure of 16-O-desmethyl-27-desmethoxy rapamycin
Figure 10 Structures of compounds 1,2,4, 5,6, 8, 9,15,16,17,18 and 19
Figure 11 Structures of compounds 3,7,10,11,12,13,14, 20, 21, 22 and 23
Figure 12 Structures of compounds 24,25, 27, 28,29, 31, 32, 38, 39,40,41 and
42
Figure 13 Structures of compounds 26,30, 33,34,35,36, 37,43, 44, 45, and 46
Figure 14 Structures of compounds 47,48, 50, 51, 53 and 57
Figure 15 Structures of compounds 49, 52, 54, 55, 56, and 58
Figure 16 Structure of compounds 61, 64,66, 67, 68, and 70
Figure 17 Structure of compounds 59, 60,62,63, 65, and 69
Figure 18 Pre-rapamycin heteronuclear multiple bond coherence HMBC
Figure 19 Pre-rapamycin heteronuclear multiple quantum coherence HMQC
Figure 20 Pre-rapamycin correlation spectroscopy (COSY) indicated by solid
arrows, Pre-rapamycin total correlation spectroscopy (TOCSY)
indicated by dotted arrows.
Figure 21 Corrections in the DNA sequence of rapN, the corrected sequence is
shown on top (SEQ ID NO: 1) and the published sequence (ace no:
X86780, nt 91764-92978) is shown underneath (SEQ ID NO: 2).

Figure 22 Corrections in the amino acid sequence of RapN, the corrected
sequence is shown on top (SEQ ID NO: 3) and the published
sequence (ace no: X86780) is shown underneath (SEQ ID NO: 4).
Figure 23 Corrections in the DNA sequence of rapM, the corrected sequence is
shown on top (SEQ ID NO: 5) and the published sequence (ace no:
X86780, nt 92992-93945 complement) is shown underneath (SEQ ID
NO: 6).
Figure 24 Corrections in the amino acid sequence of RapM, the corrected
sequence is shown on top (SEQ ID NO: 7) and the published
sequence (ace no: X86780) is shown underneath (SEQ ID NO: 8).
Figure 25 Corrections "m the DNA sequence of rapL, the corrected sequence is
shown on top (SEQ ID NO: 9), the published sequence (ace no:
X86780, nt 94047-95078 complement) is shown at the bottom (SEQ
ID NO: 10).
Figure 26 Corrections in the amino acid sequence of RapL, the corrected
sequence is shown at the top (SEQ ID NO: 11) and the published
sequence (ace no: X86780) is shown underneath (SEQ ID NO: 12)
Figure 27 Corrections in the DNA sequence of rapK, the corrected sequence is
shown at the top (SEQ ID NO: 13) and the published sequence (ace
no: X86780, nt 95430-96434) is shown at the bottom (SEQ ID NO:
14).
Figure 28 Corrections in the amino acid sequence of RapK, the corrected
sequence is shown at the top (SEQ ID NO: 15) and the published
sequence (ace no: X86780) is shown underneath (SEQ ID NO: 16).
Figure 29 Corrections in the DNA sequence of rapJ, the corrected sequence is
shown at the top (SEQ ID NO: 17) and the published sequence (ace
no: X86780, nt 96465-97625) is shown at the bottom (SEQ ID NO:
18).
Figure 30 Corrections in the amino acid sequence of RapJ, the corrected
sequence is shown at the top (SEQ ID NO: 19) and the published
sequence (ace no: X86780) is shown underneath (SEQ ID NO: 20).
Figure 31 Corrections in the DNA sequence of rapl, the corrected sequence is
shown at the top (SEQ ID NO: 21) and the published sequence (ace
no: X86780, nt 97622-98404) is shown at the bottom (SEQ ID NO:
22).

Figure 32 Corrections in the amino acid sequence of Rapl, the corrected
sequence is shown at the top (SEQ ID NO: 23) and the published
sequence (ace no: X86780) is shown underneath (SEQ ID NO: 24).
Figure 33 Corrections in the DNA sequence of rapQ, the corrected sequence is
shown at the top (SEQ ID NO: 25) and the published sequence (ace
no: X86780, nt 90798-91433) is shown at the bottom (SEQ ID NO:
26).
Figure 34 Corrections in the amino acid sequence of RapQ, the corrected
sequence is shown at the top (SEQ ID NO: 27) and the published
sequence (ace no: X86780) is shown underneath (SEQ ID NO: 28).
Figure 35 A flow chart demonstrating the cloning strategy for the isolation of
pMG278-1 to create MG3.
Figure 36 A flow chart demonstrating the cloning strategy for the isolation of
pMG267-1 to create MG4.
Materials and Methods
Materials
All molecular biology enzymes and reagents were from commercial sources.
D/L pipecolic acid was obtained from Sigma.
Starter materials
Table IV summarises the sources of the acids used in the feeding
experiments described in the Examples section. For those compounds that were
purchased det alls of the source are given. A brief synthetic method is given for those
starter acids that were synthesised in house. A person of skill in the art will
appreciate that variations on the methods described are routine and are within the
scope of the present invention.

WO 2004/007709

PCT/GB2003/003230

Acid Company Stock
number synthesis
3-cis-cyclohexeneoxide carboxylic
acid in house, Method
A
Mixture of 3,4-cis-
dihydroxycyclohexane carboxylic
acid and 3,4-trans-
dihydroxycyclohexane carboxylic
acid in house, Method
D
Cyclohexaneacetic acid Aldrich C10,450-7
Cyclohexanepropionic acid Aldrich 16,147
4-cis/trans-fe/f-butylcyclohexane
carboxylic acid Aldrich 37,493-8

OH
Synthesis of 3-cis,4-trans-dihydroxycyclohexane carboxylic acid
Q _ J> o

HQ
KOH
HO°
THF/H20

Racemic 3-cis,4-trans-dihydroxycyclohexane carboxylic acid was readily attainable
from commercially available racemic 3-cyclohexene carboxylic acid. This acid was
epoxidised through treatment with /wete-chloroperbenzoic acid and converted to the
lactone in situ by the addition of base (triethylamine), thus setting up the relative
stereochemistries. This lactone was then hydrolysed by the action of aqueous
potassium hydroxide, and the final product purified over ion exchange resin, (see
PAS Lowden Thesis 1997, Corey, E. J. and Huang, H., 1989).

Method A:
0H Et3N- IBCF
HOCH2CH2SiMe3

A 9

Epoxides A and B were synthesised by standard steps. Cyclohex-3-ene carboxylic
acid was protected with 2-trimethylsilylethanol following activation with
isobutylchloroformate and triethylamine. The resultant ester was treated with meta-
chloroperbenzoic acid and the resultant racemic mix of diastereomers separated on
normal phase silica. The epoxides were either reacted on (see below) or
deprotected directly by the treatment of trifluoroacetic acid, to liberate the respective
free acids.
86

!
A protected epoxide was treated with anhydrous HF-pyridine to effect the ring
opening to produce a pair of racemic regiomers, containing F and OH in a trans
arrangement (as previously demonstrated for cyclohexene oxide). The esters were
then deprotected with trifluoroacetic acid to liberate the free acids, (see Welch, J. T.
and Seper, K., W., 1988)

A protected epoxide was treated with concentrated hydrochloric acid suspended
organic solvent to affect the ring opening to produce a pair of racemic regiomers,
containing CI and OH in a trans arrangement (as previously demonstrated for
cyclohexene oxide). The esters were then deprotected with trifluoroacetic acid to
liberate the free acids, (see Chini, M., Crotti, P., et al., 1992)

cis-dihydroxylcyclocarboxylic acids were generated by treating protected epoxides
with a catalytic amount of osmium tetraoxide together with a co-oxidant. The esters
were then deprotected with trifluoroacetic acid to liberate the free acids.

Bacterial strains and growth conditions
Escherichia coli DH10B (GibcoBRL) was grown in 2xTY medium as described
by Sambrook et al. (1989) and E. coli ET12567(pUB307) as described in MacNeil et al. (1992) and E. coli ET12567(pUZ8002) as described in Paget et al. (1999) in 2xTY
medium with kanamycin (25 ng/ml). The vectors pUC18 and Litmus28 were obtained
from New England Biolabs. Vector pSET152 is described in Bierman et al., (1992a).
E. coli transfbrmants were selected for with 100 jig/ml ampicillin or 50 ng/ml
apramycin.
The rapamycin producer S. hygroscopicus ATCC29253 and its derivatives
were maintained on medium 1 agar plates (see below) at 26°C, and cultivated in
TSBGM (Tryptic Soy Broth with 1.0 % glucose and 100 mM MES, pH 6.0) as
described in (Khaw et al., 1998), supplemented with 100 pg/ml apramycin when
required.
Liquid cultures were grown at 25°C in side-baffled Erlenmeyer flasks with
shaking at 300 rpm.
The streptomycin resistant mutant S. hygroscopicus MG1C was selected
using standard procedures and maintained on medium 1 with streptomycin
(50|ig/ml).
Feeding methods:
Spore stocks of all strains were prepared after growth on medium 1,
preserved in 20% w/v glycerols 0% w/v lactose in distilled water and stored at -80
°C. Vegetative cultures were prepared by inoculating 100^ of frozen stock into 50ml
medium 6 in 250ml flask. The culture was incubated for 36 to 48 hours at 28 °C,
250rpm.
Feeding procedure: Vegetative cultures were inoculated at 0.5 ml into 7ml medium 7
in 50ml tubes. Cultivation was carried out for 7 days, 26°C, 250rpm. The
feeding/addition of the selected carboxylic acids ("non-natural starters" or "natural
starters") were carried out at 24 and 48 hours after inoculation and were fed at 1mM
or 3mM.

Description of Strains
All strains shared the wild type morphology, with cream vegetative mycelia,
white aerial hyphae, developing grey spores turning black and characteristically
hygroscopic.
Preferably spores for use in the generation of the recombinant strains as
described herein were dark grey in colour, as defined in Fan 4, 202 C to B, more
preferably they are as defined in Fan 4, 202 B (Royal Horticultural Society Colour
Chart 2001, available from The Royal Horticultural Society, 80 Vincent Square,
London, SW1P2PE).
DAM manipulation and sequencing
DNA manipulations, PCR and electroporation procedures were carried out as
described in Sambrook et al. (1989). Southern hybridisations were carried out with
probes labelled with digoxigenin using the DIG DNA labelling kit as described by the
manufacturer (Boehringer Mannheim). DNA sequencing was performed as described
previously (Gaisser et al., 2000).
Fermentation of Streptomyces hygroscopicus strains.
Streptomyces hygroscopicus strains were cultured from a frozen spore stock
in cryopreservative (20% glycerol; 10% lactose w/v in distilled water) on Medium 1
(see Materials and Methods) and spores were harvested after 10-20 days growth at
29°C. Alternatively, spores from frozen working stocks were inoculated directly into
pre-culture medium. A primary pre-culture was inoculated with the harvested spores
and cultured in 250 ml Erlenmeyer flasks containing 50 ml Medium 6 (see Materials
and Methods), shaken at 250 rpm with a two-inch throw, at 30°C, for two days. The
primary pre-culture was used to inoculate secondary pre-cultures of Medium 6 (see

Materials and Methods), at 10% v/v, which was shaken at 300 rpm with a one-inch
throw, at 28°C, for a further 24h. Secondary pre-cultures were used to inoculate, at
10% v/v, production Medium 8 (see Materials and Methods) containing 0.01% v/v
SAG 417 antifoam and allowed to ferment in a stirred bioreactor for five to seven
days at 26°C. Airflow was set to 0.75 wm, over pressure at 0.5 bar and the impeller
tip speed was controlled between 0.98 ms*1 and 2.67 ms"1. Additional SAG 417 was
added on demand. pH was controlled at 6 - 7 with ammonium (10% v/v) or sulphuric
acid (1 M) and glucose solution (40% w/v) was drip fed on initiation of ammonium
demand.
Extraction and High Performance Liquid Chromatography (HPLC) analysis Method
Centrifugation was carried out on 50 ml of the fermentation broth and the
supernatant and the mycelium were extracted separately as follows. The mycelia
were washed with H20 and extracted with 50 ml of methanol for 16 hours at 4°C. The
cell debris was removed by centrifugation, the methanol evaporated to dryness then
dissolved in 200 yl methanol. The supernatant of the fermentation broth was
extracted twice with an equal volume of ethyl acetate. The organic layer was dried
over Na2S04, evaporated to dryness and then dissolved in 200 µl methanol. HPLC
analysis was performed on a Hewlett Packard HP1100 liquid chromatograph with
variable wavelength detector or a Finnigan MAT LCQ (Finnigan, CA) instrument.
High-resolution spectra were obtained on a Bruker BioApex IIA J T Fourier
Transform-Ion Cyclotron Resonance (FT-ICR) mass spectrometer (Bruker, Bremen,
FRG).
For NMR analysis, the bacterial broth was centrifuged, the supernatant
extracted with three equal volumes of ethylacetate and the myWia extracted with
methanol as described above. The extracts were combined, dried (Na2S04) and
evaporated under reduced pressure to yleld a white solid.
Proton detected NMR spectra (1H, DQF-COSY, TOCSY, HMQC, HMBC,
NOESY) were recorded on a Bruker Advance DRX500 spectrometer which operated
at 500 MHz at 27 °C, with the exception of example 6, where the Bruker Advance
DRX500 spectrometer was operated at 500 MHz at 10°C. Chemical shifts are
described in parts per million (ppm) on the 8 scale and are referenced to CHCI3 at 5H
7.26 (1H) and CHCI3 at 8C 77.0 (13C). J values are given in Hertz (Hz).

Extraction, isolation and analysis protocols (B).
Extraction and purification protocol:
The fermentation broth was clarified by centrifugation to provide supernatant and
cells. The supernatant was applied to a column (16x15 cm) of Diaion* HP20 resin
(Supelco), washed with water followed by 75% MeOH/H20 and then eluted with
MeOH. The cells were mixed to homogeneity with an equal volume of acetone. After
at least 30 minutes the acetone slurry was clarified by centrifugation and the
supernatant decanted. The pelleted cells were similarly extracted twice more with
acetone. The acetone extract was combined with the MeOH from the HP20 column
and the solvent was removed in vacuo to give an aqueous concentrate. The aqueous
(typically 1-2 L) was extracted with EtOAc (3x1-2 L) and the solvent removed in
vacuo to give an oily crude extract (typically 20 g). The oily residue was dissolved in
a minimal volume of EtOAc and dried onto silica. The coated silica was applied to a
silica column (400g, 36 x 6 cm) that was eluted sequentially with acetone/hexane
mixtures ranging from 25% acetone initially to 100% acetone. The fractions
containing rapamycin analogues were identified by HPLC (280 nm) using conditions
described within.
The rapamycin analogue-containing fractions were combined and the solvent was
removed in vacuo. The residue was further chromatographed over Sephadex LH20,
eluting with 10:10:1 chloroform/heptane/ethanol. The semipurified rapamycin
analogues were purified by reverse phase (C18) high performance liquid
chromatography using a Gilson HPLC, eluting a Phenomenex 21.2 x 250 mm Luna 5
urn C18 BDS column at 21 mL/min, isocratic elution with 50% to 70% CH3CN/H20
mixtures depending on the polarity of the rapamycin analogue.
Analysis of culture broths '.
An aliquot of whole broth (1 mL) was shaken with CH3CN (1 mL) for 30 minutes. The
mixture was clarified by centrifugation and the supernatant analysed by HPLC with
diode array detection. The HPLC system comprised an Agilent HP1100 equipped
with a BDS HYPERSIL C18 3 urn 4.6 x 150 mm column CThermoHypersil-Keystone)
heated to 40°C. The gradient elution was from 55% mobile phase B to 95% mobile
phase B over 10 minutes followed by an isocratic hold at 95% mobile phase B for 2
minutes with a flow rate of 1 mL/min. Mobile phase A was 10% acetonitrile:90%
water, containing 10 mM ammonium acetate and 0.1% trifluoroacetic acid, mobile
phase B was 90% acetonitrile:10% water, containing 10 mM ammonium acetate and

0.1% trifluoroacetic acid. Rapamycin analogues were identified by the presence of
the characteristic rapamycin triene, centred on 278 nm. FK506 and FK520
analogues are identified by LC-MS analysis.
Analysis by LCMS
The HPLC system described above was coupled to a Bruker Daltonics Esquire3000
electrospray mass spectrometer. The same column and gradient elution scheme
were used as described above. Mobile phase A was water, mobile phase B was
acetonitrile. Positive negative switching was used over a scan range of 500 to 1000
Dalton.
Example 1
Conjugation ofS. hygroscopicus
The plasmid to be conjugated into S. hygroscopicus was transformed by
electroporation into the dam' dcm' ET12567 £ coli strain containing either pUB307
as described in MacNeil et al. (1992) or pUZP002 as described in Paget et at. (1999).
A preculture was used (over night culture, 30°C) to inoculate fresh 2xTY (with 50
fj.g/ml apramycin and 25 ug/ml kanamycin) at a dilution of 1/25 and grown with
shaking at 37°C to an optical density at 595 nm of 0.25-0.6. The cells from this broth
were washed twice with 2xTY, then resuspended with 0.5 ml of 2xTY per 25 ml
original culture. The quality of the spore stock used is critical for the success of this
method. In this context the age of the spores when harvested and the use of medium
1 are crucial for the isolation of high-quality spore suspension. To isolate high- quality
spore suspensions of S. hygroscopicus, pre-dried plates of medium 1 agar (see
Materials and Methods section) were spread with S. hygroscopicus spores or mycelia
using standard microbiological techniques followed by incubation at 26°-28°C for 14-
21 days. Spores were harvested by addition of 1-2 ml of sterile 20 % w/v glycerol or
water by standard, techniques. An aliquot of 200 pi of the S. hygroscopicus spore
suspension was washed in 500 |xl of 2xTY, resuspended in 500 µl of 2xTY, subjected
to heat shock at 50°C for 10 minutes then cooled on ice. An aliquot of 0.5 ml of the £
coli suspension was mixed with the heat-shocked spores and this mixture plated on
medium 1 agar plates. These plates were incubated at 26°-280C for 16 hours before
overlaylng with 1 mg of nalidixic acid and 1 mg of apramycin per plate. Exconjugant
colonies usually appeared after 3-7 days.

Use in S.hygroscopicus MG2-10 of an alternative integrating vector, pRT801
Conjugation was also carried out using the 4>BT1-based integrating vector
pRT801 into S.hygroscopicus MG2-10 as described above. Exconjugants were
patched on to medium .1 containing 50ug/ml apramycin and 50ug/ml nalidixic acid,
and shown to be apramycin resistant
Example 2
Isolation of the S. hygroscopicus mutant MG2-10 carrylng the chromosomal deletion
of rapQONMLKJI (Figure 4).
An S. hygroscopicus mutant (MG2-10) in which the rapamycin modifylng
genes rapQ, rapO/N, rapM, rapL, rapK, rapJ and rap! were deleted was constructed
as described below.
Isolation of the streptomycin resistant mutant MG1C:
S.hygroscopicus NRRL5491 mycelia were spread onto plates of medium 1
containing 50mg/ml streptomycin. Three colonies were isolated and labelled MG1A,
MG1B and MG1C. These were conjugated as in example 1 with the plasmid pMG49,
a derivative of pSET152 containing the rpsL gene from S.lividans TK24.
Exconjugants from each of these conjugations were patched onto a plate if medium 1
containing 50mg/ml apramycin and 50mg/ml nalidixic acid, to confirm the presence of
the plasmid pMG49. They were then streaked, along with the original strains MG1A,
MG1B and MG1C, onto a both a plate of medium 1 containing no antibiotic and a
plate of.medium 1 containing 50mg/ml streptomycin. Growth was seen in all cases
except fhe streaks of MG1A [pMG49], MG1B [pMG49] and MG1C [pMG49] on
streptomycin, indicating that the w.t. rpsL gene from S.lividans TK24 conferred
dominant streptomycin sensitivity on these strains. The production of pre-rapamycin
was measured in MG1A, MG1B and MG1C and the best producer, MG1C, was kept
for further work.
Conjugation ofS. hygroscopicus MG1C
Conjugations were carried out as described in example 1 using the
streptomycin resistant S. hygroscopicus MG1C and vector pMG55 derived

constructs.
Construction of conjugative double recombination vector pMG55 (Figure 3)
The primers MAG47 5'-GCAAGCTTGGTACCGACACGCTCGCCGAACAGG-
3' (SEQ ID NO: 29) and MAG48 5'-GCGCATGCCCTAGGGTGTACATTACTTCTCC-
3' (SEQ ID NO: 30) were used to amplify the S.lividans rpsL gene using the plasmid
pRPSL21 (Shima et al., 1996) as a template. The PCR fragment was digested with
Sp/jl and H/ndlll, isolated and ligated with the 3.2 kb fragment of pSET152 (Bierman
et al., 1992b), which had been digested with Sph\ and H/ndlll. After transformation
into £ coli DH1 OB, plasmid pMG55 was isolated. This plasmid was confirmed by
sequencing. Plasmid pMG55 contains the rpsL gene to allow selection for double
recombinants (Hosted and Baltz, 1997).
Isolation of the S. hygroscopicus mutant MG2-10 carrylng the chromosomal deletion
of rapQONMLKJI (Figure 4)
The primers MAG23 5'-TATCTAGACTTCGCACGTGCCTGGGACA-3' (SEQ
ID NO: 31) and MAG24 5^AGMGCTTACCCMTTCCAACATCACCT-3' (SEQ ID
NO: 32) were used to amplify the left region of homology (from nt 89298 to nt 90798
in the rapamycin cluster as described in Schwecke et al.(Schwecke et al., 1995)
using genomic DNA prepared from S. hygroscopicus NRRL5491 as a template. The
1.5 kb PCR product was digested with Xba\ and H/ndlll and ligated into pUC18 cut
with Xbal and H/ndlll. After transformation into E. coli DM OB, the plasmid pMAG127-
8 was isolated. The primers MAG25 5'-GGAAGCTTTGACCACACGCCGCCCGTTC-
3* (SEQ ID NO: 33) and MAG26 5*-ATGCATGCCCGCCGCAACCCGCTGGCCT-3'
(SEQ ID NO: 34) were used to amplify the right region of homology (from nt 98404 to
nt 99904 in the rapamycin cluster as described in Schwecke et al. (1995)) using
genomic DNA prepared from S. hygroscopicus NRRL5491 as a template. The 1.5 kb
product of PCR was digested with H/ndlll and Sph\ and ligated into pUC18 cut with
H/ndlll and Sphl After transformation into £ co//DH10B, the plasmid pMAG128-2
was isolated (Figure 4). Both plasmids were checked by sequence analysis. The
plasmid pMAG127-8 was digested with Sph\ and H/ndlll, the plasmid pMAG128-2
was digested with Xoal and H/ndlll and the 1.5 kb fragments were isolated from both
plasmids. These fragments were ligated into pUC18 cut with Sph\ and Xbal and used
to transform £ coli DH10B. The plasmid pMAG131-1 was isolated. This plasmid was
digested with Sph\ and Xba\, the 3 kb fragment was isolated and ligated into pMG55

cut with Sph\ and Avr\\ and the DNA was used to transform £ coli DH10B. The
plasmid pMAG144-16 was isolated and used to conjugate S. hygroscopicus MG1C.
An apramycin resistant S. hygroscopicus colony was isolated, grown for 24 hours in
TSBGM with shaking at 26°C, and spread onto medium 1 agar plates containing 50
ng/l streptomycin. Streptomycin resistant colonies were isolated and shown to be
apramycin sensitive. The 7606 nt chromosomal deletion of the rapQONMLKJI region
of the rapamycin cluster was verified in the mutant MG2-10 by using the 1.5 kb PCR
product of MAG23 and MAG24 to probe EcoRI- and SamHI-digested chromosomal
DNA. Analysis of the wild type S. hygroscopicus showed the expected 5.8 kb EcoRI
and 5.9 kb BamHI band after hybridisation. When chromosomal DNA of MG2-10 was
treated similarly, 9.6 kb EcoRI and 7.6 kb BamH\ bands were detected, indicating
that rapQONMLKJI had been removed.
Example 3
Expression of rapK in the S. hygroscopicus mutant MG2-10 carrylng the
chromosomal deletion of rapQONMLKJI (Figure 4)
Construction of expression vector pSGsetl
The pSET152 (Bierman et al., 1992a) derived vector pCJR336 (kindly
provided by Christine Martin and Corinne Squire) was created by cloning the primer
dimerofCR347 5'-
TAAACTAGTCCATCTGAGAGTTTCATATGGCCCTATTCTGCCCAGCCGCTCTAG
AAAT-3' (SEQ ID NO: 35) and CR348 5'-
ATTTCTAGAGCGGCTGGGCAGAATAGGGCCATATGAAACTCTCAGATGGACTAG
TTTA -3' (SEQ ID NO: 36) into PvuW digested pSET152 using standard molecular
biological techniques, thus introducing sites for the restriction enzymes Spel, aldel,
and Xbal into pSET152. The orientation of the insert was confirmed by sequencing.
Plasmid pCJR336 was digested using the restriction enzymes Wdel/Spel and vector
pSG142 (Gaisser et ah, 2000) was digested identically. The resulting DNA bands of
about 5.4 kb for pCJR336 and 1.2 kb for pSG142 were isolated followed by a ligation
which was used to transform E. coli DH10B. The vector construct containing the
acf//-ORF4 regulator region was isolated and digested using the restriction enzyme
Xba\ followed by an alkaline phosphatase treatment according to standard protocols.
The isolated DNA was ligated with a fragment of about 200 bp from plasmid
pEXo/eG2cas (pSG142 derivative containing the ca. 1.2kb Ndel/BglW fragment of

pSGcasOleG2 (WO01/79520) digested with the restriction enzymes Xba\ and Nhe\.
Vector pSGsetl was isolated and the correct orientation of the insert was verified
using restriction digests and sequence analysis. Plasmid pSGsetl contains the actll-
ORF4 regulator, the Pacu promoter and the 6xHis-tag coding sequence as well as the
lambda t0 transcriptional termination region (originating from plasmid pQE-16) and it
can integrate site-specifically at the OC31 attachment site.
Cloning of rapK
The gene rapK was amplified by PCR using the primers BIOSG8 5'-
GGGCATATGAGGCAATTGACTCCGCCGGTCACGGCACCGTACTGCC -3' (SEQ
ID NO: 37) and BIOSG9 5'-
GGGGTCTAGAGGTCACGCCACCACACCCTCGATCTCGACC -3' (SEQ ID NO: 38),
which introduce a Afcfel site at the 5' end and a Xba\ site at the 3' end of rapK.
Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with
T4 polynucleotide kinase using standard techniques the PCR product was ligated
with Smal-cut pUC18 and used to transform E. co//DH10B. The DNA sequence of
rapK in the isolated plasmid pUCrapK was verified by sequence analysis. The .
differences in the DNA sequence compared to the published sequence (ace. no.
X86780) are shown in Figure 27. The resulting changes in RapK are shown in Figure
28.
Isolation ofpSGsetrapK
Plasmid pUCrapK was digested with aldel and Xba\ and the insert fragments
were isolated and ligated into identically digested pSGsetl. The ligation was used to
transform £ coli DH10B using standard procedures and the transformants were
analysed. Plasmid pSGsetrapK, was isolated and the construct was verified using
restrictiSn digests and sequence analysis.
Example 4 ...
Identification of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmBthyl-rapamycin
(pre-rapamycin, Figure 6) .
9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre-
rapamycin) was obtained by conjugating the S. hygroscopicus strain MG2-10 as
described in Example 1 with pSGsetrapK and isolating the products produced on

fermentation. This demonstrates that it is possible to complement the deletion of
rapK in the MG2-10 strain and that if the strain is fed with pipecolic acid, pre-
rapamycin is produced, an analogue which is lacking the post-PKS modifications.
The plasmid pSGsetrapK was conjugated into S. hygrvscopicus MG2-10 and
the strain grown in TSBGM fed with 2mg/l pipecolic acid at 25°C with shaking. The
mycelia were extracted with methanol and the culture broth was extracted with ethyl
acetate as described previously.
Analysis of the culture broth of the pipecolic acid-fed S. hygrvscopicus mutant
MG2-10[pSGsetrapK] by HPLC with UV detection at 280nm revealed the presence of
two major new peaks with retention times of 4.0 and 5.1 minutes. Electrospray mass
spectroscopy of these peaks revealed that both contained ions corresponding to a
compound with a MW of 841.5. Neither of these peaks was seen in the culture
extractions of the S. hygrvscopicus NRRL 5491 strain or the mutant strain MG2-10
without the rapK expression plasmid pSGsetrapK. MS/MS analysis of the ion with
m/z of 864 (corresponding to the sodium adduct of pre-rapamycin) revealed that it
fragmented into an ion with m/z of 735 corresponding to the loss of m/z 129
(pipecolic acid), or an ion with m/z of 556 corresponding to the loss of m/z 308 (C28-
C42 of pre- rapamycin). This ion itself fragmented further to an ion with m/z 306,
corresponding to the loss of m/z 250 (C14 to C27 of pre- rapamycin). This
fragmentation pattern was identical to the pattern seen for rapamycin but with the
second loss of m/z (-308) reduced by 14, corresponding to the absence of the C39
O-methyl group, the third loss of m/z (-250) reduced by 44, corresponding to the
absence of the C27 methbxy and C16 O-methyl groups and the final ion (306) having
a mass reduced by 14 corresponding to the absence of the C9 ketone group. This
was evidence that the compound with MW 841.5 represents 9tdeoxo-16-O-
desmetriyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre- rapamycin).
Example 5.
Preparation of gene cassettes for expression in S. hygrvscopicus MG2-10
Gene cassettes able to direct the expression of a variety of rapamycin
modifylng genes and combinations of modifylng genes were constructed as
described below.

Cloning of rapN/O
The contiguous genes rapN and rapO, hereafter designated rapN/O were
amplified by PCR using the primers BIOSG2 5'-
GGGCATATGTCGACGACCGATCAGGGTGAGACCGGAAAGGCCTG -3' (SEQ ID
NO: 39) and.BIOSG3 5'- .
GGGGTCTAGAGGTCAGTCCTGGGGTTCGAGAAGCTCGCCGGTCTCCTT-3'
(SEQ ID NO: 40), which introduce a aldel site at the 5' end and a Xba\ site at the 3'
end of rapN/O. Plasmid pR19 (Schwecke et al., 1995) was used as a template. After
treatment with T4 polynucleotide kinase using standard techniques the PCR product
was ligated into Smal-cut pUC18 and used to transform £ coli DH10B. The DNA
sequence of rapWO in the isolated plasmid pUCrapN/O was verified by sequence
analysis. The differences in the DNA sequence compared to the published sequence
(ace. no. X86780) are shown in Fig 21. The resulting changes in RapN are shown in
Fig 22.
Cloning ofrapM
The gene rapMwas amplified by PCR using the primers BIOSG4 5'-
GGGCATATGATCCAACCCGACGTCGTGACCGCCTTCACAGCGG -3' (SEQ ID
NO:41)andBIOSG5 5'-
GGGGTCTAGAGGTCACACGCGGACGGCGATCTGGTGCCGATAGG -3* (SEQ ID
NO: 42), which introduce a aldel site at the 5" end and a Xba\ site at the 3' end of
rapM. Plasmid pR19 (Schwecke et ai, 1995) was used as a template. After treatment
with T4 polynucleotide kinase using standard techniques the PCR product was
ligated into Smal-cut pUC18 and used to transform £ coli DH10B. The DNA
sequence of rapM in the isolated plasmid pUCrapM was verified by sequence
analysis. The differences in the DNA sequence compared to the published sequence
(ace. no. X86780) are shown in Fig 23. The resulting changes in RapM are shown in
Fig 24.
Cloning of rapL
The gene rapL was amplified by PCR using the primers BIOSG6 5'-
GGGCATATGCAGACCAAGGTTCTGTGCCAGCGTGACATCAAG -3' (SEQ ID NO:
43) and BIOSG7 5'-
GGGGTCTAGAGGTCACTACAGCGAGTACGGATCGAGGACGTCCTCGGGCG-3'

(SEQ ID NO: 44), which introduce a aldel site at the 5' end and a Xba\ site at the 3'
end of rapL Plasmid pR19 (Schwecke et al„ 1995) was used as a template. After
treatment with T4 polynucleotide kinase using standard techniques the PCR product
was ligated into Smal-cut pUC18 and used to transform E coli DH10B. The DNA
sequence of rapL in the isolated plasmid pUCrapL was verified by sequence
analysis. The differences in the DNA sequence compared to the published sequence
(ace. no. X86780) are shown in Fig 25. The resulting changes in RapL are shown in
Fig 26.
Cloning of raphes
The gene rapL was amplified by PCR using the primers BIOSG6 5'-
GGGCATATGCAGACCAAGGTTCTGTGCCAGCGTGACATCAAG -3' (SEQ ID NO:
43) and BIOSG45 5'-
GGAGATCTCAGCGAGTACGGATCGAGGACGTCCTCGGGCG -3' (SEQ ID NO:
45), which introduce a aldel site at the 5' end and a BgR\ site at the 3' end of rapL
Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with
T4 polynucleotide kinase using standard techniques the PCR product was ligated
into Smal-cut pUC19 and used to transform E coli DH10B. The DNA sequence of
rapL in the isolated plasmid pUC19rapLhfe was verified by sequence analysis.
Cloning of rapK
The gene rapKwas amplified by PCR using the primers BIOSG8 5"-
GGGCATATGAGGCAATTGACTCCGCCGGTCACGGCACCGTACTGCC -3" (SEQ
ID NO: 37) and BIOSG9 5'-
GGGGTCTAGAGGTCACGCCACCACACCCTCGATCTCGACC -3' (SEQ ID NO: 38),
which introduce a Afdel site at the 5' end and a Xbal site at thet3' end of rapK.
PlasmidPpR19 (Schwecke et al., 1995) was used as a template. After treatment with
T4 polynucleotide kinase using standard techniques the PCR product was ligated
with Smal-cut pUC18 and used to transform £ coli DH10B. The DNA sequence of
rapK in the isolated plasmid pUCrapK was verified by sequence analysis. The
differences in the DNA sequence compared to the published sequence (ace. no.
X86780) are shown in Fig 27. The resulting changes in RapK are shown Fig 28.
Isolation of pSGsetrpaN/O, pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl,
pSGsetrapK, and pSGsetrapL

Plasmids pUCrapN/O, pUCrapJ, pUCrapM, pUCrapl, pUCrapL, pUCrapK and
pAHL42 were digested w'rth Nde\ and Xbal and the insert fragments, ranging in size
from about 1.3 kb to 0.7 kb, were isolated and ligated into identically digested
pSGsetl The ligations were used to transform E coli DH10B using standard
procedures and the transformants were analysed. Plasmids pSGsetrapN/O,
i
pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl, pSGsetrapK, and pSGsetrapL
were isolated and the constructs were verified using restriction digests and sequence
analysis.
Cloning of rap J
The gene rapJ was amplified by PCR using the primers BIOSG10 5'-
GGGCATATGAGCACCGMGCTCAGCAAGAGAGCACGCCCACCGCACGCT-3'
(SEQ ID NO: 46) and B10SG11 5'-
GGGGTCTAGAGGTCACTCCGCTCCCCAGGTGACCCGGAGCTCGGC -3' (SEQ ID
NO: 47), which introduce a Wdel site at the 5' end and a Xbal site at the 3' end of
rapJ. Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment
with T4 polynucleotide kinase using standard techniques the PCR product was
ligated with Smal-cut pUC18 and used to transform E coli DH10B. The DNA
sequence of rapJ in the isolated plasmid pUCrapJ was verified by sequence analysis.
The differences in the DNA sequence compared to the published sequence (ace. no.
X86780) are shown in Fig 29. The resulting changes in RapJ are shown in Fig 30.
Cioning of rapl
The gene rapl was amplified by PCR using the primers B10SG12 5'-
GGGCATATGAGCGCGTCCGTGCAGACCATCAAGCTGCC -3' (SEQ ID NO: 48)
and BIQSG13 5'-GGGGTCTAGAGGTCAGGCGTCCCCGCGGCGGGCGACGACCT.
-3' (SEQ ID NO: 49), which introduce a aldel site at the 5' end and a Xbal site at the
3' end of rapl. Plasmid pAHL2 (kindly provided by Huai-Lo Lee) is derived from.
pUC18 containing the rapl gene and was used as a template. After treatment with T4
polynucleotide kinase using standard techniques the PCR product was ligated with
Smal-cut pUC18 and used to transform E coli DH10B. The DNA sequence of rapl in
the isolated plasmid pUCrapl was verified by sequence analysis. The differences in
the DNA sequence compared to the published sequence (ace. no. X86780) are
shown in Fig 31. The resulting changes in Rapl are shown in Fig 32.

Cloning ofrapQ
The gene rapQ was amplified by PCR using the primers AHL21 5'-
CATATGTTGGAATTGGGTACCCGCCTG -3' (SEQ ID NO: 50) and AHL22 5'-
TCTAGACGCTCACGCCTCCAGGGTG -3' (SEQ ID NO: 51), which introduce a aldel
site at the 5' end and a Xbal site at the 3' end of rapQ. Plasmid pR19 (Schwecke et al., 1995) was used as a template. After treatment with T4 polynucleotide kinase
using standard techniques the PCR product was ligated with Smal-cut pUCl 8 and
used to transform E. coli DH10B. The DNA sequence of rapQ in the isolated plasmid
pAHL42 was verified by sequence analysis. The differences in the DNA sequence
compared to the published sequence (ace. no. X86780) are shown in Fig 33. The
resulting changes in RapQ are shown in Fig 34.
Isolation ofpUCIBeryBVcas
The gene eryBV was amplified by PCR using the primers casOleG21
(WO01/79520) and 7966 5'-
GGGGAATTCAGATCTGGTCTAGAGGTCAGCCGGCGTGGCGGCGCGTG
AGTTCCTCCAGTCGCGGGACGATCT -3' (SEQ ID NO: 52) and pSG142 (Gaisser et al., 2000) as template. The PCR fragment was cloned using standard procedures
and plasmid pUC18eryBVcas was isolated with an aldel site overlapping the start
codon of eryBV and an Xba\ and Bglll site following the stop codon. The construct
was verified by sequence analysis.
Isolation of vector pSGLitl
The gene eryBV was amplified by PCR using the primers BIOSG1 5'-
GGGTCTAGATCCGGACGAACGCATCGATTAATTAAGGAGGACACATA -3' (SEQ
ID NO: 53) and 7966 5'-
GGGGAATTCAGATCTGGTCTAGAGGTCAGCCGGCGTGGCGGCGCGTGAGTTC
CTCCAGTCGCGGGACGATCT -3' (SEQ ID NO: 52), which introduce a Xba) site
sensitive to Dam methylation at the 5' end and a Xbal site and a Bgl\\ site at 3' end of
eryBV. Plasmid pUC18eryBVcas was used as a template. After treatment with T4
polynucleotide kinase using standard techniques the PCR product was ligated with
Smal-cut pUC18 and used to transform E. coli DH10B. The construct was then
digested using BamHI/Bgfll and an about 1.3 kb DNA band was isolated from an
agarose gel followed by the ligation with BamHl/Bg/ll digested Litmus 28 vector DNA

using standard procedures. The vector pSGLitl was isolated and the DNA sequence
of the insert was verified by-sequence analysis.
Isolation of pSGsetrpaN/O, pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl,
pSGsetrapK, and pSGsetrapL
Plasmids pUCrapN/O, pUCrapJ, pUCrapM, pUCrapl, pUCrapL, pUCrapK and
pAHL42 were digested with Nde\ and Xba\ and the insert fragments ranging in size
from about 1.3 kb to 0.7 kb were isolated and ligated into identically digested
pSGsetl. The ligations were used to transform E coli DH10B using standard
procedures and the transformants were analysed. Plasmids pSGsetrapN/O,
pSGsetrapJ, pSGsetrapM, pSGsetrapQ, pSGsetrapl, pSGsetrapK, and pSGsetrapL
were isolated and the constructs were verified using restriction digests and sequence
analysis.
Isolation of pSGLitrapN/O, pSGLitrapJ, pSGLitrapM, pSGLitrapQ, pSGLifrapt,
pSGLitrapK, pSGLitrapL and pSGUtrapL^s
Plasmids pSGsetrpaN/O, pSGsetrapJ, pSGsetrapM, pSGsetrapQ,
pSGsetrapl, pSGsetrapK, pSGsetrapL, and pUCIQrapLhfe were digested using
NdeMBgR] restriction enzymes and the bands ranging from about 0.7 to 1.3 kb were
isolated followed by ligations with pSGLitl digested with Nde\/Bglll The ligations
were used to transform E coli ET12567 and the transformants were analysed.
Plasmids pSGLitrapN/O, pSGLitrapJ, pSGLitrapM, pSGLitrapQ, pSGLitrapl,
pSGLitrapK, pSGLitrapL and pSGLitrapUis were isolated.
Isolation of plasmids pSGsetapKI, pSGsetrapKM, pSGsetrapKN/O, pSGsetrapKL,
pSGsetrapKQ and pSGrapKJ *
The plasmids pSGLitrapN/O, pSGLitrapJ, pSGLitrapM, pSGLitrapQ,
pSGLitrapl, and pSGLitrapL were digested using Xba\ and the fragments ranging
from about 0.8 to 1.3 kb were isolated followed by ligations with pSGsetrapK .
digested with Xba\ and treated with alkaline phosphatase using standard molecular
biological techniques. The ligations were used to transform E. coli DH10B and the
transformants were analysed. Plasmids pSGsetrapKI, pSGsetrapKM,
pSGsetrapKN/O, pSGsetrapKL, pSGsetrapKQ and pSGrapKJ were isolated and the
orientation of the insert was verified by restriction digest analysis. For the addition of
rapLtfe these constructs were either digested with Bglll/Xbal followed by partial digest

with Bglll as appropriate and the isolated vector fragments were ligated with the ~
1kb Xbal/Bglll fragment of pSGLitrapLfe.
Isolation ofplasmids pSGsetrapKIJ, pSGsetrapKIM and pSGsetrapKIQ
The plasmids pSGLitrapJ, pSGLitrapWI, and pSGLitrapQ were digested using
Xbal and the fragments ranging from about 0.8 to 1.3 were isolated followed by
ligations with pSGsetrapKI digested with Xbal and treated with alkaline phosphatase
using standard molecular biological techniques. The ligations were used to transform
£ co// DM OB and the transformants were analysed. Plasmids pSGsetrapKIJ,
pSGsetrapKIM, and pSGrapKIQ were isolated and the orientation of the insert was
verified by restriction digest analysis. For the addition of rapUis these constructs were
either digested with Bglll/Xbal followed by partial digest with Bglll as appropriate and
the isolated vector fragments were ligated with the ~ 1kb Xbal/Bglll fragment of
pSGLitrapUis.
Isolation of plasmids pSGsetrapKN/OI, pSGsetrapKN/OQ, pSGsetrapKN/OM and
pSGsetrapKN/OJ. ......
The plasmids pSGLitrapl, pSGLitrapM, pSGLitrapJ, and pSGLitrapQ were
digested using Xbal and the fragments ranging from about 0.8 to 1.3 were isolated
followed by ligations with pSGsetrapKN/O digested with Xbal and treated with
alkaline phosphatase using standard molecular biological techniques. The ligations
were used to transform £ co// DH10B and the transformants were analysed.
Plasmids pSGsetrapKN/OI, pSGsetrapKN/OQ, pSGsetrapKN/OM and pSGrapKN/OJ
were isolated and the orientation of the insert was verified by restriction digest
analysis. For the addition of rapLhis these constructs were either digested with
Bglll/Xbal followed by partial digest with Bglll as appropriate and the isolated vector
fragments were ligated with the ~ 1kb Xbal/Bglll fragment of pSGL"rtrapLhl8.
Isolation ofplasmids pSGsetrapKJM and pSGsetrapKJQ
The plasmids pSGLitrapM and pSGLitrapQ were digested using Xbal and the
fragments ranging from about 0.8 to 1.1 were isolated followed by a ligation with
pSGsetrapKJ digested with Xbal and treated with alkaline phosphatase using
standard molecular biological techniques. The ligations were used to transform £
coli DM OB and the transformants were analysed. Plasmids pSGsetrapKJM and
pSGrapKJQ were isolated and the orientation of the insert was verified by restriction

digest analysis. For the addition of rapUs these constructs were either digested with
Bglll/Xbal followed by partial digest with Bglll as appropriate and the isolated vector
fragments were ligated with the ~ 1kb Xbal/Bglll fragment of pSGUtrapUis-
Using the same strategy outlined above, the following gene cassettes were isolated:
pSGsetrapKIJM pSGsetrapKN/OJI pSGsetrapKIQN/OM
pSGsetrapKIJQ pSGsetrapKJMN/O pSGsetrapKJMN/OQ
pSGsetrapKIJN/O pSGsetrapKJQN/O pSGsetrapKIJN/OMQ
pSGsetrapKIMN/O pSGsetrapKIJN/OM pSGsetrapN/OQ
pSGsetrapKIQN/O pSGsetrapKIJN/OQ pSGsetrapKIJMN/OQ
pSGsetrapKN/OMQ pSGsetrapKIMN/OQ
An overview is given in Figure 5.
For the addition of rapUt these cassette constructs were either digested with
BgR\lXba\ or with Xba\ followed by partial digest with Bgl\\ as appropriate and the
isolated vector fragments were ligated with the about 1 kb Xba\IBgl\\ fragment of
pSGLJtrapUb-
Example 6
Isolation of 9-deoxo-16-O-desmethyl-2 7-desmethoxy-39-O-desmethyl-rapamycin
(pre-rapamycin, Figure 6)
9-Deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (pre-
rapamycin) was obtained by conjugating the S. hygroscopicus strain MG2-10 with
pSGsetrapKL and isolating the products generated as described below. This
demonstrates that it is possible to complement the deletion of rapK and rapi. in the
MG2-1Q strain and that pre-rapamycin is produced, an analogue which is lacking
post-PKS modification. The feeding of pipecolic acid is not required when rapL is
complemented confirming that rapL plays a role in the provision of pipecolic acid in
the production of rapamycin.
4
S. hygroscopicus MG2-10[pSGsetrapKL] was cultured from a frozen working
spore stock in cryopreservative (20% glycerol, 10% lactose w/v in distilled water) on
Medium 1 (see Materials and Methods) and spores were harvested after 14 days
growth at 29°C. A primary pre-culture was inoculated with the harvested spores and
cultured in two 250 ml Erlenmeyer flasks containing 50 ml Medium 3 (see Materials

and Methods), shaken at 250 rpm with a two-inch throw, at 30°C, for two days. The
primary pre-culture was used to inoculate two secondary prs-cultures of Medium 2
(see Materials and Methods) and Medium 3, at 10% v/v, which was shaken at 300
rpm with a one-inch throw, at 25°C, for a further 24h. Four litres of Medium 4 (see
Materials and Methods) and Medium 5 (see Materials and Methods) were prepared
containing 0.01% v/v Pluronic L101 antifoam (BASF). Production Medium 4 was
inoculated with the secondary pre-culture in Medium 2 and Production Medium 5 was
inoculated with the secondary pre-culture in Medium 3 at 10% v/v and allowed to
ferment in a 7 L stirred bioreactor for five to seven days at 25°C. Airflow was set to
0.75 wm and the impeller tip speed was controlled between 0.98 ms"1 and 2.67 ms"1.
Additional Pluronic L101 was added on demand.
To confirm the structure of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-
desmethyl-rapamycin (pre-rapamycin), broths from Medium 4 and Medium 5 were
extracted with ethyl acetate and reduced to a crude extract by evaporation. The
extracts were defatted on partition with hexane:methanot:water and flashed through a
70 g silica cartridge starting with hexane and finishing with acetone. Pre-rapamycin
fractions from each fermentation were pooled and flashed through a C18 cartridge
starting with water and finishing with methanol. Pre-rapamycin (8.5 mg) was isolated
after chromatography on Sephadex LH20 using heptane:chloroform:ethanol as the
mobile phase. This compound was analysed and the structure fully confirmed by
NMR (Figure 18-20). The 1H and 13C NMR data are given in Table V below.

Example 7
Isolation of 8-deoxo-15-O-desmethyl-26-desmethoxy-38-O-desmethyl-
prolylrapamycin (pre-prolylrapamycin, Figure 7)
Feeding of S. hygroscopicus MG2-10[pSEGrapK] with proline acid resulted in
the production pre-prolylrapamycin as described below. This demonstrated that in
the absence of rapL alternative pipecolic acid analogues are incorporated.
S. hygroscopicus MG2-10[pSGsetrapK] was grown in TSBGM fed with 1 mg/l
proline at 25°C with shaking. The mycelia were extracted with methanol and the
culture broth was extracted with ethyl acetate as described previously.
Analysis of the culture broth of the proline-fed S. hygroscopicus mutant MG2-
10[pSG,setrapKJ by HPLC with UV detection at 280nm revealed the presence of two
major new peaks with retention times of 4.5 and 4.6 minutes. Electrospray mass
spectroscopy of these peaks revealed that both contained ions corresponding to a
compound with a MW of 827.5. Neither of these peaks were seen in the cultures of
S. hygroscopicus NRRL 5491, S. hygroscopicus MG1C or S. hygroscopicus MG2-10
without the rapK expression plasmid pSGsetrapK. MS/MS analysis of the ion with
m/z of 850 (corresponding to the sodium adduct of pre-prolylrapamycin) revealed that
it fragmented into an ion with m/z of 735 corresponding to the loss of m/z 115
(proline), or an ion with m/z of 542 corresponding to the loss of m/z 308 (C27-C41 of
pre-prolylrapamycin). This ion itself fragmented further to an ion with m/z 292,

corresponding to the loss of m/z 250 (C13 to C26 of pre-prolylrapamycin). This
fragmentation pattern was identical to the pattern seen for rapamycin but with the first
loss of m/z (-115) reduced by 14 corresponding to the change from pipecolic acid to
proline for the amino acid, the second loss of mfe (-308) reduced by 14,
corresponding to the absence of the. C38 O-methyl group, the third loss of m/z (-250)
reduced by 44, corresponding to the absence of the C26 methoxy.and C15 O-methyl
groups and the final ion (306) having a mass reduced by 14 corresponding to the
absence of the C8 ketone group and the change from pipecolic acid to proline. This
was evidence that the compound with MW of 827.5 represents 8-deoxo-15-O-
desmethyl-26-desmethoxy-38-O-desmethyl-prolylrapamycin (pre-prolylrapamycin).
Example 8
Isolation of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy-rapamycin (39-
dehydroxy pre- rapamycin, Figure 8)
Feeding of S. hygroscopicus MG2-10[pSGsetrapK] with pipecolic acid and
cyclohexane carboxylic acid resulted in the production of two major compounds, pre-
rapamycin which corresponds to the incorporation of the natural starter unit and 39-
dehydroxy pre-rapamycin, which corresponds to the incorporation of the fed starter
unit
S. hygroscopicus MG2-10[pSGsetrapK| was grown in TSBGM fed with 2mg/l
pipecolic acid and 1mM cyclohexane carboxylic acid at 25°C with shaking. The
culture broth was extracted with ethyl acetate as described previously.
Analysis of the culture broth of the cyclohexane carboxylic acid-fed S.
hygroscopicus mutant MG2-10[pSGsetrapK] by HPLC with UV detection at 280nm
revealed the presence of one major new peak with a retention time of 5.8 minutes.
Electrospray mass spectroscopy of this peak revealed that it contained ions
corresponding to a compound with a MW of 825.5. This peak was not seen in the
cultures of S. hygroscopicus NRRL5491, S. hygroscopicus MG1C or S.
hygroscopicus MG2-10 without the rapK expression plasmid pSGsetrapK. MS/MS .
analysis of the ion with m/z of 848 (corresponding to the sodium adduct of 39-
dehydroxy pre-rapamycin) revealed that it fragmented into an ion with m/z of 719
corresponding to the loss of m/z 129 (pipecolic acid), or an ion with m/z of 556
corresponding to the loss of m/z 292 (C28-C42 of 39-dehydroxy pre-rapamycin). This

ion itself fragmented further to an ion with m/z 306, corresponding to the loss of m/z
250 (C14 to C27 of 39-dehydroxy pre-rapamycin). This fragmentation pattern was
identical to the pattern seen for pre- rapamycin but with the second loss of m/z (-292)
reduced by 16, corresponding to the absence of the C39 hydroxy group. This was
evidence that the compound with MW 825.5 represents 9-deoxo-15-O-desmethyl-27-
desmethoxy-39-desmethoxy-rapamycin(39-dehydroxy-pre-rapamycin).
Example 9
Isolation of 16-O-desmethyl-27-desmethoxy-rapamycin (Figure 9)
The S hygroscopicus strain MG2-10 was conjugated with pSGsetrapKIJ as
described in Example 1. Feeding of this strain with pipecolic acid and isolation of the
products produced on fermentation resulted in the production of 16-O-desmethyl-27-
desmethoxy-rapamycin.
The plasmid pSGsetrapKIJ (Figure 5) was conjugated into S. hygroscopicus
MG2-10 and the strain grown inTSB GM fed with 2mg/l pipecolic acid at 25°C with
shaking. The mycelia were extracted with methanol and the culture broth extracted
with ethyl acetate as described previously.
Analysis of the extracts of the S. hygroscopicus mutant MG2-
10[pSGsetrapKIJ] by electrospray mass spectroscopy revealed one major new peak
of retention time 4.3 minutes which contained ions corresponding to a compound with
a MW of 869. This peak was not seen in the cultures of S. hygroscopicus NRRL
5491, S. hygroscopicus MG1C S. hygroscopicus MG2-10 with or without the rapK
expression plasmid pSGsetrapK. MS/MS analysis of the ion with m/z of 892
(corresponding to the sodium adduct of 16-O-desmethyl-27-desrnethoxy-rapamycin)
reveale9 that it fragmented into an ion with m/z of 763 corresponding to the loss of
m/z 129 (pipecolic acid), or an ion with m/z of 570 corresponding to the loss of m/z
322 (C28-C42 of 16-O-desmethyl-27-desmethoxy-rapamycin). This ion itself
fragmented further to an ion with m/z 320, corresponding to the loss of m/z 250 (C14
to C27 of 16-O-desmethyl-27-desmethoxy-rapamycin). This fragmentation pattern
was identical to the pattern seen for rapamycin but with the third loss of m/z (-250)
reduced by 44, corresponding to the absence of the C16 methyl and C27 methoxy
groups. This was evidence that the compound with MW 869 was 16-O-desmethyl-27-
desmethoxy-rapamycin.

Example 10
Army feeding
S. hygroscopicus MG2-10[pSGsetrapKI] was used to cany out an array
; feeding. Primary vegetative cultures were prepared by innocculating medium with
spore stock as described in the Materials and Methods. TSB GM medium was
inoculated at 10% v/v using methods described in the materials and methods section.
The following compounds were added as indicated in Table VI below

The cultures were incubated, extracted and measured using techniques
described in the Material and Method section. Table VII shows the results of the
analysis showing the ion (m/z) observed for each combination of starter carboxylic
acid and amino acid:

These data demonstrate incorporation of the fed compounds.
Example 11
Complementation of S.hygroscopicus MG2-10 with fkbQ
To assess whether rapK homologous genes such as fkbO in S.hygroscopicus
var. ascomyceticus and S.tsukubaensis, and orf5 in the partially sequenced 'hyg'

cluster (Ruan et al., 1997) fulfil similar functions, complementation assays were
carried out using fkbO as described below.
Isolation ofpMG169-1
The gene fkbO from Strepomyces hygroscopicus var. ascomyceticus (ATCC
14891), an FK520 producer, was amplified by PCR using the primers fkbof 5'-
GGGCATATGACCGATGCCGGACGCCA 3' (SEQ ID NO: 54) and fkbor 5'
GGGGTCTAGATCACGCCACCATGCCTTCGA 3" (SEQ ID NO: 55), introducing a
aldel site at the 5'end and a Xbal site at the 3'end of fkbO. Genomic DNA isolated
from S.hygroscopicusvar. ascomyceticus (ATCC 14891) was used as a template.
The amplified PCR product was subjected to digestion with aldel and Xbal and
ligated with WdekXbal cut pSGsetl. The ligation was used to transform Ecoli DH10B
and the transformants were analysed using methods described in the Materials and
Methods section. Plasmid pMG169-1 was isolated and verified by restriction
digestion and S.hygivscopicus MG2-10 was transformed using methods described in
the Materials and Methods section.
Heterologous complementation of rapK by fkbO
S.hygroscopicus MG2-10[pMG169-1] was grown in TSBGM fed with 2mg/l
pipecolic acid at 25°C with shaking. The culture broth and mycelia were extracted
using methods described in the Materials and Methods section (Method A). Analysis
of the extract with UV detection at 280nm revealed the presence of two major new
peaks with retention times of 4.5 and 4.6 minutes. Electrospray mass spectroscopy
of these peaks revealed that both contained ions with a MW of 827.5 corresponding
to two isomers of pre-rapamycin (Example 7).
Example 12
Efficient production of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy-
rapamycin (39-dehyroxy pre-rapamycin, Figure 8) in the absence of competition by
endogenous starter unit by feeding to a rapK knockout mutant
The ability of S. hygroscopicus strains MG2-10 and MG2-10[pSGsetrapK] to
incorporate a different starter unit, cyclohexane carboxylic acid, was compared as
described below. When fed cyclohexane carboxylic acid and pipecolic acid MG2-10
produced only one compound (39-dehydroxy pre-rapamycin) corresponding to

incorporation of the fed starter unit only, whereas MG2-10[pSGsetrapK] produced
two compounds in a 1:1 ratio, 39-dehydroxy pre-rapamycin and pre-rapamycin. This
demonstrated that rapK is required for the incorporation of the natural endogenous
starter unit and a rapK knock-out strain had no competition of the endogenous starter
unit with the fed starter unit
S. hygroscopicus MG2-10 was grown on TSBGM fed with 2 mg/L pipecolic
acid and 1 mM cyclohexane carboxylic acid at 25°C with shaking. The culture broth
was extracted with ethyl acetate as described previously. Analysis of the extracts by
HPLC with UV detection at 280 nm revealed the presence of one new major peak
with a retention time of 5.8 min. However, S. hygroscopicus MG2-10[pSGsetrapK|
(Example 4), produced pre-rapamycin (Figure 6) in addition to 39-dehydroxy pre-
rapamycin in a ratio of ~1:1 when fed with cyclohexane carboxylic acid (Example 8,
Figure 8). Surprisingly, feeding of cyclohexane carboxylic acid to S. hygroscopicus
MG2-10 resulted in a single product, 39-dehydroxy pre-rapamycin. The endogenous
starter, 4,5-dihydroxycyclohex-1-ene carboxylic acid, was not incorporated in the
absence of rapK. There was therefore no competition between the incorporation of
the fed carboxylic acid and the endogenous starter.
Example 13
Elucidation of the function ofRapM
Cultures of Str&ptomyces IMdans TK24, S. lividans TK24[pSGsetrapM] and
S. IMdans TK24[pSGsetrapQ] were grown in TSBGM with shaking at 30°C and fed
with 20 ng/ml of pre-rapamycin. Controls remained unfed. After a further 5 days
incubation, the cultures were extracted with ethylacetate and brought to dryness.
Reconst'rtution and analysis by LC-MS identified no productiorf of rapamycin
analogues in the unfed controls. Two major new peaks were identified in the extract
of S. //V/dansTK24[pSGsetrapM] fed pre-rapamycin, one at 2.5 min and one at 7.9
min. Electrospray mass spectroscopy of these peaks revealed that both contained
ions corresponding to a compound with a MW of 855.6, consistent with 9-deoxo-16-
0-methyl-27-desmethoxy-39-O-desmethyl-rapamycin(16-O-methyl-pre-rapamycin)..
Two isomers were commonly observed when extracts were analysed by LC-MS in
the absence of TFA. No new peaks were identified in the extracts of S. lividans TK24
or S. lividans TK24[pSGsetrapQ]. Unmodified pre-rapamycin was clearly evident.

RapM was clearly responsible for methylation at the C16 hyclroxyl, RapQ was not
specific for this site.
Example 14
Elucidation of the function of RapJ
Cultures of S. IMdans TK24, S. Uvidans TK24[pSGsetrapK], S. IMdans
TK24[pSGsetrapJ] and S. Uvidans TK24[pSGsetrapKJ] were grown in TSBGM with
shaking at 30°C and fed with 40 jig/ml of pre-rapamycin. Controls remained unfed.
After a further 5 days incubation, the cultures were extracted with ethylacetate and
brought to dryness. Reconstitution and analysis by LC-MS identified no production of
rapamycin analogues in the unfed controls. One major new peak at 4.9 min was
identified in the extracts of S. IMdans TK24[pSGsetrapKJ] and S. IMdans
TK24[pSGsetrapJ] fed pre-rapamycin. Electrospray mass spectroscopy of this peak
revealed that it contained ions corresponding to a compound with a MW of 855.5,
consistent with 16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (C9 oxo-
pre-rapamycin). In extracts of S. IMdans TK24 and S. IMdans TK24[pSGsetrapK] fed
with pre-rapamycin, no new peaks were identified. Unmodified pre-rapamycin was
clearly evident.
Due to the homology of RapJ with FkbD of the FK506 and FK520 cluster,
Rap J has been postulated to oxidise pre-rapamycin at C9 to 9-hydroxy-16-O-
desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin (C9 OH-pre-rapamycin).
RapK has been postulated to be responsible for the further conversion to the ketone.
Surprisingly, in the presence of RapJ, but in the absence of RapK, 16-O-desmethyl-
27-desmethoxy-39-O-desmethyl-rapamycin (C9 keto-pre-rapamycin) was formed.
RapJ clearly has an oxidative function at C9, complete conversion to the ketone was
observed. RapK does not have an oxidative function at C9.
Example 15
Plasmids containing the following combinations of rapamycin modifylng genes
were constructed as described below: pMG260 (rapl, rapJ, rapN, rapO, and rapL),
pMG261 (rapl, rapJ, rapN, rapO, rapM and rapL), pMG262 (rapl, rapJ, rapN, rapO,.
rapM, rapQ and rapL) pMG236 (rapN, rapO, rapQ and rapL) and pMG238 (rapJ and
rapL).
Isolation of plasmids pMG236 andpMG238

The plasmids pSGsetrapNOQ and pSGsetrapJ were digested using Bglll/Xbal and
the isolated vector fragments were ligated with the 1kb Xbai/Bglll fragment of
pSGLitrapUte. Plasmids pMG236 (expressing rapN, rapO, rapQ and rapL) and
pMG238 (expressing rapJ and rapL) respectively, were isolated.
Isolation of plasmids pMG260, pMG261 andpMG262
The plasmids pSGSetrapKIJNOL, pSGSetrapKIJMNOL, and pSGSetrapKUMNOQL
were digested using Bglll and the isolated insert fragments (containing the rapamycin
cluster genes from the Bglll site in rapl to the Bglll site after rapL) were ligated with
the vector-containing fragment from pSGSetrapl digested with Bglll. Plasmids
pMG260 (expressing rapl, rapJ, rapN, rapO, and rapL), pMG261 (expressing rapl,
rapJ, rapN, rapO, rapM and rapL), and pMG262 (expressing rapl, rapJ, rapN, rapO,
rapM, rapQ and rapL) were isolated.
Example 16
An S.hygroscopicus mutant (MG3) carrylng the chromosomal deletion of rapK
was constructed as described below. Heterologous complementation of rapK with
fkbO can then be performed as described and will result in the restoration of
rapamycin production demonstrating that fkbO"\s able to complement the function of
rapK'm S. hygroscopicus.
Isolation of the S.hygroscopicus mutant MG3 canylng the chromosomal deletion of
rapK
The primers RAPKF1 5'-CAAAGCTTCCTGGCGCGGTTCGGCCGGCA-3'
(SEQ ID NO: 56) and RAPKF2 5,-TGGCATGCCCTTCCCCGCCGTTCCCTGGC-3,
(SEQ ID.NO: 57) were used to amplify the left region of homology outside the gene
rapK (from nt94403 to nt95429 in the rapamycin cluster as described in Schwecke et
al., 1995) using genomic DNA prepared from S.hygroscopicus NRRL5491 as a
template. The 1kb PCR product was phosphorylated using T4 polynucleotide kinase
and ligated into dephosphorylated Smal cut pUC18. After transformation into Eco//
DH10B, the plasmid pMG233-7 was isolated. The primers RAPKR1 5'-
TGGCATGCCCCCGCCGAGCTGACCTGGAA-3' (SEQ ID NO: 58) and RAPKR2 5'-
GTTCTAGAGCTTACGCGTGATGTCGAACG-3' (SEQ ID NO: 59) were used to
amplify the right region of homology outside the gene rapK (from nt96435 to nt97428
in the rapamycin cluster as described in Schwecke et al., 1995) using genomic DNA

prepared from S.hygroscopicus NRRL5491 as a template: The 1kb PCR product was
phosphorylated using T4 polynucleotide kinase and ligated into dephosphorylated
Smal cut pUC18. After transformation into Eco// DH10B, the plasmid pMG257-7 was
isolated. Both plasmids were checked by sequence analysis. The plasmid pMG233-7
was digested with SphlZXbal and the 3.7kb fragment was isolated, pMG257-7 was
digested with Sphl/Xbal and the 1kb fragment isolated. These fragments were ligated
and used to transform Eco// DH10B. The plasmid pMG268-12 was isolated. This
plasmid was digested with Hindlll/Xbal and the 2kb fragment isolated and ligated into
pMG55 cut with Hindlll/Xbal and the DNA was used to transform E.coli DH10B. The
plasmid pMG278-1 was isolated and used to conjugate S.hygroscopicus MG1C.
An apramycin resistant colony is isolated, and is grown for 24 hours in
TSBGM with shaking at 30°C and spread onto medium 1 agar plates containing
50ug/l streptomycin. Streptomycin resistant colonies are isolated and shown to be
apramycin sensitive. The 1004nt chromosomal deletion of rapK can be verified in the
mutant MG3 by Southern blotting. An overview is given in Figure 35.
S.hygroscopicus MG3 is grown in TSBGM at 26°C with shaking. The culture
broth and mycelia are extracted using methods as described in the Materials and
Methods section. Analysis of the extract with UV detection reveals the presence of no
peaks with the characteristic rapamycin triene.
Expression offkbO in the S.hygroscopicus mutant MG3 carrylng the chromosomal
deletion ofrapK
Plasmid pMG 169-1 (described in example 11) is transformed into
S.hygroscopicus mutant MG3 using methods as described in the Materials and
Methods section.
Heterologous complementation of rapK by fkbO
S.hygroscopicus MG3pMG169-1 is grown in TSBGM at 26°C with shaking.
The culture broth and mycelia arere extracted using methods as described in the
Materials and Methods section. Analysis of the extract with UV detection at 280nm.
reveals the presence of two major new peaks. Electrospray mass spectroscopy of
these peaks reveals that these contain ions with a MW of 913 corresponding to
rapamycin.

Example 17
Isolation and heterologous complementation of the S.hygroscopicus var
ascomyceticus mutant MG4 canylng the chromosomal deletion of fkbO
Isolation of the S.hygroscopicus var ascomyceticus mutant MG4 carrylng the
chromosomal deletion of fkbO
The primers FKOF1 5'-GCTCTAGAGCCCGCGGCTCGCCGGACACG-3'
(SEQ ID NO: 60) and FKOF2 5'-CCCCTGCAGGCGTCCGGCATCGGTCATCAG-3'
(SEQ ID NO: 61) were used to amplify the left region of homology (from nt45750 to
nt46751 in the ascomycin cluster as described in Wu et al., 2000) using genomic
DNA prepared from S.hygroscopicus var ascomyceticus ATCC14891 as a template.
The 1kb PCR product was phosphorylated using T4 polynucleotide kinase and
ligated into dephosphorylated Smal cut pUC18. After transformation into E.coli.
DH10B, the plasmid pMG258-4 was isolated. The primers FKOR1 5'-
CGCCTGCAGGGATACGGTCCGCCGGGTCTGC-3' (SEQ ID NO: 62) and FKOR2
5XCMGCTTGTACGGTTCGCCACGGGCGTGC-3' (SEQ ID NO: 63) were used to
amplify the right region of homology (from nt47785. to. nt48781 in the rapamycin
cluster as described in Wu et al., 2000) using genomic DNA prepared from
S.hygroscopicus var ascomyceticus ATCC14891 as a template. The 1kb PCR
product was phosphorylated using T4 polynucleotide kinase and ligated into
dephosphorylated Smal cut pUC18. After transformation into E.coli DH10B, the
plasmid pMG259-5 was isolated. Both plasmids were checked by sequence analysis.
The plasmid pMG258-4 was digested with Sbfl/Hindlll and the 3.7kb fragment was
isolated, pMG259-5 was digested with Sbfl/Hindlll and the 1kb fragment isolated.
These fragments were ligated and used to transform E.coli DH10B. The plasmid
pMG265-1 was isolated. This plasmid was digested with HindHI/EcoRI and the 2kb
fragment isolated and ligated into pMG55 cut with HindHI/EcoRI and the DNA was
used to transform Ecoli DH10B, The plasmid pMG267-1 was isolated and used to
conjugate S.hygroscopicus var ascomyceticus ATCC14891.
An apramycin resistant colony is isolated and is grown for 24 hours in
TSBGM with shaking at 30°C and spread onto medium 1 agar plates containing
50ug/l streptomycin. Streptomycin resistant colonies are isolated and shown to be
apramycin sensitive. The 1034nt chromosomal deletion of fkbO can be verified in the
mutant MG4 by Southern blotting. An overview is given in Figure 36.

Expression ofRapKin the S.hygroscopicus var ascomyceticus mutant MG4 carrylng
the chromosomal deletion of fkbO
Plasmid pSGsetRapK is transformed into S.hygroscopicus mutant MG4 as
described in the Materials and Methods section.
Heterologous complementation of fkbO by rapK
S.hygroscopicus var ascomyceticus MG4 pSGSetRapK is grown in TSBGM
at 26°C with shaking. The culture broth and mycelia are extracted using methods as
described in the Materials and Methods section. The extract is analysed by LC-MS to
reveal the presence of a major new peak and to reveal that this contains ions that
correspond to FK520 (ascomycin).
Example 18
It is obvious to those skilled in the art that other biosynthetic clusters that
encode FKBP-ligands for example, FK506, can be modified such that the rapK
homologue is deleted or inactivated using the methods as described herein. In
FK506, for example; this could be done by amplifylng PGR products against the
regions either side of the fkbO gene (sequence accession number AF082099,
AF082100), ligating these together in a vector such as pMG55, transforming the
FK506-producing strain, selecting for the double crossover and confirming the
removal of the fkbO gene by southern blotting.
Example 19
Incorporation of non-natural starter units by the rapK deletion strain, S.
hygroscopicus MG2-10, into rapamycin analogues in the absence of competition by
endogenous natural starter unit.
As demonstrated in examples 10 and 12, the rapamycin PKS has a high
degree of flexibility for non-natural starter units and in the absence of rapK, the
system is free of competition from the natural starter. In this example, the degree of
flexibility is further demonstrated.
S. hygroscopicus MG2-10 was grown, fed and extracted according to the
feeding, extraction and analysis methods outlined in Materials and Methods (Method
B). The range of carboxylic acids fed along with the compounds generated are listed
below. Surprisingly, all of the carboxylic acids listed were incorporated as
determined by observing the characteristic UV chromophore at 278 nm and

electrospray mass spectrometry and resulted in the production of rapamycin
analogues.
The rapamycin analogues generated corresponded to the formula below as
described in Table VIII:

Example 20
Incorporation of non-natural starter units by the rapK deletion strain, S.
hygroscopicus MG2-■/0[pSGsetrapN/OQLhiS], into rapamycin analogues in the
absence of competition by endogenous natural starter unit.
As demonstrated in examples 10,12 and 19, the rapamycin PKS has a high
degree of flexibility for non-natural starter units and in the absence of rapK, the
system is free of competition from the natural starter. In this example, the degree of
flexibility is further demonstrated.
S. hygroscopicus MG2-10[pSGsetrapN/OQLhis] was grown, fed and extracted
according to the feeding, extraction and analysis methods outlined in Materials and
Methods (Method B). The range of carboxylic acids fed along with the compounds
generated are listed below. Surprisingly, all of the carboxylic acids listed were
incorporated as determined by observing the characteristic UV chromophore at 278

nm and electrospray mass spectrometry and resulted in the production of rapamycin
analogues.
The rapamycin analogues generated corresponded to the formula below as
described in Table IX:

Carboxylic acid I M-H [M+K] I Compound generated
starter unit fed.
1-cyclohexene 824.4 864.4 RIB = E, R« = 3-OH, y = bond, in
carboxvlic acid combination with R1 = OH, R2 = H, R6 = H,
carboxylic ac»o Rs = H, R7 = H, R6 = H, R6 = H, R10 = H, x =
CHg
840.4 880.4 Ris = E, R16 = 3-OH, y = bond, in
combination with R1 = OH, R2 = OH, R6 =
H, Re = H, R7 = H, Re = H, R5 = H, Rn> — H,
x = CH2
3-cycIohexene 840.4 880.4 R15 = C, R™ = OH, R17 = OH, in
. ,. .. combination with R1 = OH, R2 = H, R5 - H,
carboxylic acid R _H R _Up iu R-M P - H v -
r%6 - n, K7 — n, (\B ~ n, K9 — n, rvio — n, x —
CH5;
822.4 862.4 R15 = A, Ri6 = OH, R17~= H, in combination
with R! = OH, R2 = H, R6 = H, Re = H, R7 =
H, R6 = H, R9 = H, Rip = H, x = CH2
840.4 880.4 R15 = A, R16 = OH, R17 = H, in combination
with R1 = OH, R2 = OH, R5 = H, R6 = H, R7
= H, R6 = H, Rg = H, R10 = H, x = CH2
cycloheptane 854.4 894.4 R15 = E, R1B = OH, y = CH2) in combination
. .. .. with R-, = OH, R2 = OH, R5 = H, R6 = H, R7
carboxyhc acd = H> R? = ^ ^ = H ^ = H x J ^
methyl-2-norbornane 852.4 892.4 R15 = B, Ri6 s OH, R17 = H, in combination
cartoxylic acid !* * Z™A% °* *" ■* £.= »■ *
— n, KB - n, Kg — n, K10 — n, x — on2
3-hydroxycyclohexane 824.4 864.4 R16 = E, R16 = 3-OH, y = bond, in
carboxylic acid ^fl Jf1*! 7, 0RH'_RH =RH' %\"l
_CH^
4-hydroxycyclohexane 840.4 880.4 R16 = E, R16 = 4-OH, y = bond, in
carboxylic acid ^fl *** " °RH-_RH =H' *" *
r\e ~ n, r\7 — n, r\s ~ n, t\g — n, rvio — n, A -
Cji 2
824.4 864.4 R1S = E, R16 = 4-OH, y = bond, in
combination with Ri = OH, R2 = OH, R5 =
H, Rg = H, R7 = H, Rg = H, Rg = H, R10 = H,
x = CH2
4-methylcyclohexane 838.4 878.4 R15 = D, R17 = OH, in combination with R1 =
carboxylic acid ?H1Rz Z H- *« = "• *«= H, R7 = H, R8 = H,
_; Kg — n, K10 = n, X — Un2
854.4 894.4 R15= D, R17 a OH, in combination with R1 —
OH, R2 = OH, R5 = H, R6 = H, R7 = H, Re =
; H, Rg = H, Rip = H, x = CH2

Example 20
Incorporation of non-natural starter units by the rapK deletion strain, S.
hygroscopicus MG3, into rapamycin analogues in the absence of competition by
endogenous natural starter unit.
As demonstrated in examples 10,12 and 19, the rapamycin PKS has a high
degree of flexibility for non-natural starter units and in the absence of rapK, the
system is free of competition from the natural starter. In this example, the degree of
flexibility is further demonstrated.
S. hygroscopicus MG3 is grown, fed and extracted according to the feeding,
extraction and analysis methods outlined in Materials and Methods (Method B). The
range of carboxylic acids fed that can be fed is listed below. Incorporation of the
carboxylic acids listed and production of rapamycin analogues is determined by
observing the characteristic UV chromophore at 278 nm and electrospray mass
spectrometry.
Carboxylic acid starter units that can be fed include, cyclohexane carboxylic
acid, 3-cis,4-trans-dihydroxycyclohexane carboxylic acid, 1-cyclohexene carboxylic
acid, 3-cyclohexene carboxylic acid, cycloheptane carboxylic acid, methyl 2-
norbornane carboxylate, 3-hydroxycyclohexane carboxylic acid, 4-
hydroxycyclohexane carboxylic acid, 3-methylcyclohexane carboxylic acid, 4-
methylcyclohexane carboxylic acid, 3-(cis/trans)methoxycyclohexane carboxylic acid,
4-(cis/trans)methoxycyclohexane carboxylic acid, ethyl 4-cyclohexanone carboxylate,
3-fluoro-4-hydroxycarboxylic acid and 4-fluoro-3-hydroxycarboxylic acid, 3-
cyclohexane oxide carboxylic acid, 3,4-cis-dihydroxycyclohexane carboxylic acid, 3-
chloro-4-hydroxycarboxylic acid and 4-chloro-3-hydroxycarboxylic acid (and the pair
of opposite diastereomers), cyclohexylpropionic acid and 4-tert-Butylcyclohexane
carboxylic acid
Example 21
Incorporation of non-natural starter units by the fkbO deletion strain, S.
hygroscopicus var. ascomyceticus MG4, into FK520 analogues in the absence of
competition by endogenous natural starter unit
As demonstrated in examples 10,12,19 and 20, the rapamycin PKS has a
high degree of flexibility for non-natural starter units. In the absence of fkbO, the
FK520 system is free of competition from the natural starter. In this example, the

degree of flexibility of the FK520 PKS is investigated, free of competition from the
natural starter.
S. hygrvscopicus van ascomyceticus MG4 is grown, fed and extracted
according to the feeding, extraction and analysis methods outlined in Materials and
Methods (Method 6). Examples of the range of carboxylic acids that can be fed are
given in Table IV. Incorporation of the carboxylic acids listed and production of
FK520 analogues is determined by electrospray mass spectrometry.
Example 22
Incorporation of non-natural starter acids into FK506 analogues by an fkbO deletion
mutant ofS. tsukubaensis in absence of competition from the natural starter.
An fkbO deletion mutant of S. tsukubaensis is grown and fed according to the
feeding methods outlined in Materials and Methods. A sub-set of the carboxylic
acids listed in Table IV in Materials and Methods is fed. Analysis is performed as
described in Method (B) of Materials and Methods.
Example 23
Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetrapKILJ
9-deoxo-16-O-desmethyl-27-desmethoxy-rapamycin was obtained by
conjugating the S. hygroscopicus strain MG2-10 with pSGsetrapKIU and isolating
the fermentation products generated as described below. This demonstrates that it is
possible to complement the deletion of rapK, rapl and rapL in the MG2-10 strain and
that 9-deoxo-16-Odesmethyl-27-desmethoxy-rapamycin is produced, an analogue
which is lacking the post-PKS modifications. The feeding of pipecolic acid is not
required when rapL is complemented confirming that rapL plays a role in the
provision of pipecolic acid in the production of rapamycin.
S. hygroscopicus MG2-10 [pSGsetKILhfe] was fermented (see Materials and
Methods), extracted and isolated using the method (B) as outlined in Materials and
Methods. The isocratic solvent system used for preparative HPLC was 60%
CH3CN/H20.
9-Deoxo-16-O-desmethyl-27-desmethoxy rapamycin (Compound 6) has the following
characteristics:
Isolated yleld: 22 mg
Molecular weight 856

Molecular formula: C49H77NOH
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa* = 878, m/z for M-H = 854
Table X below summarises the 1H and 13C NMR data for 9-deoxo-16-O-desmethyl-
27-desmethoxy rapamycin in CDCI3.

b: tentative assignment
c: the assignment may be interchanged
d: the assignment may be interchanged
Compound 6 exists as a 1:1 mixture of conformers in CDCI3. The data above
is for both conformers. Where a dotted line has been drawn across the table it was
not possible to determine connectivity between spin systems, hence the assignment
of data to a particular conformer is not possible.
Example 24
Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetrapKIMLh]
9-Deoxo-27-desmethoxy-rapamycin was obtained by conjugating S.
hygroscopicus MG2-10 strain with pSGsetKIMLhte as described in example 1 and
isolating the products produced on fermentation. This demonstrated that it was
possible to complement the deletion of rapK, rapl, rapM and rapL in the MG2-10
strain with the production of a rapamycin analogue lacking some post-PKS
modification.
S. hygroscopicus MG2-10 [pSGsetKIMLhte] was fermented (see Materials and
Methods), extracted and isolated using the method (B) as outlined in Materials and
Methods.
The isocratic solvent system used for preparative HPLC was 75% CH3CN/H20.
9-Deoxo-27-desmethoxy rapamycin (Compound 16) has the following characteristics:
isolated yleld: 24 mg
Molecular weight: 870
Molecular formula: C50H79NOH
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
•nm "
Electrospray MS: m/z for MNa+ = 892, m/z for M-H = 868
Table XI below summarises the 1H and 13C NMR data for 9-deoxo-27-desmethoxy
rapamycin in CDCI3.

Example 25
Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetKIN/OLh]
9-Deoxo-16-O-desmethyl-27-O-desmethyl-rapamycin was obtained by
conjugating S. hygroscopicus MG2-10 strain with pSGsetKIN/OLhis as described in
Example 1 and isolating the products produced on fermentation. This demonstrated
that it was possible to complement the deletion of rapK, rapl, eapN/O and rapL in the
MG2-1© strain with the production of a rapamycin analogue lacking some post-PKS
modification.
S. hygroscopicus MG2-10 [pSGsetKIN/OUia] was fermented (see Materials
and Methods), extracted and isolated using the method (B) as outlined in Materials
and Methods.
The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20.
9-Deoxo-16-O-desmethyl-27-O-desmethylrapamycin (Compound 9) has the following
characteristics:
Isolated yleld: 77 mg
Molecular weight 872

Molecular formula: C49H77NO12
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa+ = 894, m/z for M-H = 870
Table XII below summarises the 1H and 13C NMR data for 9-deoxo-16-O-desmethyl-
27-O-desmethylrapamycin in CDCI3.

Example 26
Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetKJLh]
16-O-Desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin was obtained by
conjugating S. hygroscopicus MG2-10 strain with pSGsetKJLWB as described in
Example 1 and isolating the products produced on fermentation. This demonstrated

that it was possible to complement the deletion of rapK, rapJ and rapL in the MG2-10
strain with the production of a rapamycin analogue lacking some post-PKS
modification.
S. hygrvscopicus MG2-10 [pSGsetKJLhj6] was fermented (see Materials and
Methods), extracted and isolated using the method (B) as outlined in Materials and
Methods.
The isocratic solvent system used for preparative HPLC was 55% CH3CN/H20.
16-O-Desmethyl-27-desmethoxy-39-O-desmethyl rapamycin (Compound 3) has the
following characteristics:
Isolated yleld: 176 mg (mixture of 2 interconverting isomers)
Molecular weight 856
Molecular formula: C4BH73N012
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa+ = 878, m/z for M-H = 854
MS fragmentation: The sodiated adduct (m/z 878) was fragmented to provide
three fragments: C8-C42, m/z MNa+ 749; C1-C27, m/z MNa+ 570; C28-C42+C1-
C14, m/z MNa+ 628. The fragment ions 628 and 570 were fragmented further to give
the same fragment: C1-C14, m/z MNa* 320. The mass of this C1-C14 fragment is
14 mass units greater than the equivalent fragment from the fragmentation of the
sodiated adduct of 9-deoxo-16-O-desmethyl-27-desmethoxy-39-Odesmethyl
rapamycin (Compound 1) consistent with oxidation at C9.
Example 27
Isolation of product from fermentation of S. hygroscopicus MG2-lO[pSGsetKMNOLh]
9-Deoxo-27-O-desmethyl-39-O-desmethyl-rapamycin was obtained by
conjugating S. hygroscopicus MG2-10 strain with pSGsetKMN/OLhs as described in
example 1 and isolating the products produced on fermentation. This demonstrated
that it was possible to complement the deletion of rapK, rapM, rapN/O and rapL in
the MG2-10 strain with the production of a rapamycin analogue lacking some post-
PKS modification.
S. hygroscopicus MG2-10 [pSGsetKMN/OLws] was fermented (see Materials
and Methods), extracted and isolated using the method (B) as outlined in Materials
and Methods.
The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20.

9-Deoxo-27-O-desmethyl-39-O-desmethyl rapamycin (Compound 8) has the
following characteristics:
Isolated yleld: 6 mg
Molecular weight: 872
Molecular formula: C^HTTNO^
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa* = 894, m/z for M-H = 870
MS fragmentation: The sodiated adduct (m/z 894) was fragmented to provide
three fragments: C8-C42, m/z MNa+ 765; C1-C27, m/z MNa+ 586; C28-C42+C1-
C14, m/z MNa+ 614. The fragment ions 614 and 586 were fragmented further to give
the same fragment: C1-C14, m/z MNa* 306. The C1-C14 is identical to that
obtained from fragmentation of the sodiated adduct of 9-deoxo-16-O-desmethyl-27-
desmethoxy-39-O-desmethyl rapamycin; the compound is 9-deoxo. The C1-C27
fragment is 30 mass units greater than the equivalent fragment from 9-deoxo-16-O-
desmethyl-27-desmethoxy-39-O-desmethyl rapamycin, consistent with one
hydroxylation and one methylation; RapM methylates the hydroxy group at C-16 (see
Example 22 for pSGsetKIUis together with Example 23 pSGsetKIMUis) and RapN in
combination with RapO hydroxylates C27 so the data is consistent with the
compound being 9-deoxo-27-O-desmethyl-39-O-desmethyl rapamycin (Compound
8).
Example 28
Isolation of product from fermentation ofS. hygroscopicus MG2-lO[pSGsetKIJLh]
16-O-desmethyl-27-desmethoxy-rapamycin was obtained by conjugating S.
hygroscopicus MG2-10 strain with pSGsetKIJLws as described] in Example 1 and
isolating the products produced on fermentation. This demonstrated that it was
possible to complement the deletion ofrapK, rapl, rapJ and rapL in the MG2-10
strain with the production of a rapamycin analogue lacking some post-PKS
modification.
S. hygroscopicus MG2-10 [pSGsetKIJUiJ was fermented (see Materials and
Methods), extracted and isolated using the method (B) as outlined in Materials and
Methods.
The isocratic solvent system used for preparative HPLC was 60% CH3CN/H20.

16-ODesmethyl-27-desmethoxy rapamycin (Compound 12) has the following
characteristics:
isolated yleld: 11 mg
Molecular weight: 870
Molecular formula: C49H75N012
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa* = 892, m/z for M-H = 868
Example 29
Isolation of product from fermentation of S. hygroscopicus MG2-10fpSGsetKL\^
9-Deoxo-16-O-desmefriyl-27-desmethoxy-39-O-desmethyl-rapamycin was
obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKLws as
described in example 1 and isolating the products produced on fermentation. This
demonstrated that it was possible to complement the deletion of rapK and rapL in the
MG2-10 strain with the production of a rapamycin analogue lacking post-PKS
modification (pre-rapamycin).
S. hygroscopicus MG2-10 [pSGsetKUiJ was fermented, extracted and
isolated using the methods outlined in Materials and Methods.
The isocratic solvent system used for preparative HPLC was 60%
CH3CN/H20.
9-Deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl rapamycin
(Compound 1) has the following characteristics:
Isolated yleld: 24 mg
Molecular weight 842
..Molecular formula: C48H75NOH
" UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa+ = 864, m/z for M-H = 840
MS fragmentation: The sodiated adduct (m/z 864.5) was fragmented to
provide four fragments: C8-C42, m/z MNa* 735; C1-C27, m/z MNa* 556; C28-
C42+C1-C14, m/z MNa* 614, C1-C14, m/z MNa+ 306. The expected m/z for these
fragments were determined by comparison to the reported fragmentation of
rapamycin (J. A. Reather, Ph.D. Dissertation, University of Cambridge, 2000). These

fragments have the same m/z as the predicted m/z for the fragmentation of 9-deoxo-
16-O-desmethyl-27-desmethoxy-39-O-desmethyl rapamycin.
Example 30
Isolation of product from fermentation of S. hygroscopicus MG2-10 fed with
cyclohexane carboxylic acid
9-Deoxo-16-O-desmethyl-27-desmethoxy-39-desmethoxy-rapamycin was
obtained on feeding cyclohexane carboxylic acid to S. hygroscopicus MG2-10 and
isolating the products produced on fermentation. The resulting mutasynthesis
demonstrated that it was possible to chemically complement the deletion of rapK in
the MG2-10 strain, in the absence of natural endogenous starter, with the resulting
production of a rapamycin analogue lacking post-PKS modification.
S. hygroscopicus MG2-10 was fermented (see Materials and Methods), fed
(see Materials and Methods), extracted and isolated using the method (B) as outlined
in Materials and Methods.
The tsocratic solvent system used for preparative HPLC was 50%
CH3CW/H20.
9-Deoxo-16-Odesmethyl-27-desmethoxy-39-desmethoxy rapamycin
(Compound AT) has the following characteristics:
Isolated yleld: 12 mg
Molecular weight 826
Molecular formula: C48H75NO10
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa+ = 848.5, m/z for M-H = 825
MS fragmentation: The sodiated adduct (m/z 848.5) was fragmented to
provideCfour fragments: C8-C42, m/z MNa+ 719; C1-C27, m/z MNa+ 556; C28-
C42+C1-C14, m/z MNa+ 598, C1-C14, m/z MNa+ 306. These data illustrate that the
difference between Compound 47 and 9-deoxo-16-O-desmethyl-27-desmethoxy-39-
O-desmethyl rapamycin (Compound 1) is located in the region of C28-C42. This
fragment is 16 mass units less for Compound 47 than it is for Compound 1,
consistent with Compound 47 being 9-deoxo-16-O-desmethyl-27-desmethoxy-39-
desmethoxy rapamycin.
Example 31
Isolation of product from fermentation of S. hygroscopicus MG2-10[pSGsetKNOLh]

9-Deoxo-16-Odesmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin is
obtained by conjugating S. hygroscopicus MG2-10 strain with pSGsetKN/OUs as
described in Example 1 and isolating the products produced on fermentation. This
demonstrates that it is possible to complement the deletion of rapK, rapN/O and rapL
in the MG2-10 strain with the production of a rapamycin analogue lacking some post-
PKS modification.
S. hygroscopicus MG2-10 [pSGsetKN/OLhls] is fermented (see Materials and
Methods), extracted and isolated using the method (B) as outlined in Materials and
Methods.
The isocratic solvent system used for preparative HPLC is 60% CH3CN/H20.
9-Deoxo-16-O-desmethyl-27-O-desmethyl-39-O-desmethyl rapamycin
(Compound 2) has the following characteristics:
Molecular weight 858
Molecular formula: C4BH75NO12
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MK* = 896, m/z for M-H = 856
Example 32
identification of product from fennentation ofS. hygroscopicus MG2-
10[pSGsetKJNOLhJ
16-O-Desmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin was obtained
by conjugating S. hygroscopicus MG2-10 strain with pSGsetKJN/OLhte as described
in example 1 and analysing the products produced on fermentation. This
demonstrated that it was possible to complement the deletion of rapK, rapJ, rapN/O
and rapL in the MG2-10 strain with the production of a rapamycin analogue lacking
some post-PKS modification.
The fermentation broth (1 mL) was treated as described in the extraction,
isolation and analysis Method (B) described in Materials and Methods. The HPLC
chromatogram (280 nm) contained a peak that had the characteristic rapamycin
triene (268 nm, 278 nm, 288 nm). This peak was not observed in the chromatogram
of the control sample extracted from S. hygroscopicus MG2-10 in the absence of the
cassette. LCMS (see Materials and Methods, Method B) of the novel rapamycin
analogue peak gave ions m/z 895 (MNa*) and 871 (M-H). These ions confirm that the
molecular weight of the novel rapamycin analogue is 872, 30 mass units greater than

9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl rapamycin (Compound 1),
consistent with oxidation at C9 (rapJ) and hydroxylation at C27 (rapN/O). These data
are consistent with the compound being 16-O-desmethyl-27-O-desmethyl-39-O
desmethyl rapamycin (Compound 7).
Example 33
Isolation of product from fermentation ofS. hygroscopicus MG2-10[pSGsetKJNOLh]
16-O-Desmethyl-27-O-desmethyl-39-O-desmethyl-rapamycin is obtained by
conjugating S. hygroscopicus MG2-10 strain with pSGsetKJN/OLws as described in
Example 1 and isolating the products produced on fermentation. This demonstrates
that it is possible to complement the deletion of rapK, rapJ, rapN/O and rapL in the
MG2-10 strain with the production of a rapamycin analogue lacking some post-PKS
modification.
S. hygroscopicus MG2-10 [pSGsetKJN/OUis] is fermented (see Materials and
Methods), extracted and isolated using the method (B) as outlined in Materials and
Methods.
The isocratic solvent system used for preparative HPLC is 60% CH3CN/H20,
16-O-Desmethyl-27-O-desmethyl-39-O-desmethyl rapamycin (Compound 7)
has the following characteristics:
Molecular weight 872
Molecular formula: C^H^NO-is
UV (by diode array detection during HPLC analysis): 268 nm, 278 nm, 288
nm
Electrospray MS: m/z for MNa* = 895, m/z for M-H = 871
Example 34
Identification of product from fermentation of S. hygroscopicus MG2-10
[pSGsetKIJNOQLh]
16-O-Desmethyl-rapamycin was obtained by conjugating S. hygroscopicus
MG2-10 strain with pSGsetKUN/OQLKs as described in example 1 and analysing the
products produced on fermentation. This demonstrated that it was possible to
complement the deletion of rapK, rapl, rap J, rapN/O, rapQ and rapL in the MG2-10
strain with the production of a rapamycin analogue lacking methylation at C16-OH.
In addition, it clearly identified RapQ as the SAM-dependent O-methyltransferase
responsible for methylation of C27-OH.

S. hygrvscopicus MG2-10 [pSGsetKIJN/OQUiJ was fermented (see Materials
and Methods), extracted and analysed using the method (B) as outlined in Materials
and Methods.
The fermentation broth (1 mL) was treated as described in Materials and
Methods. The HPLC chromatogram (280 nm) contained a peak that had the
characteristic rapamycin triene (268 nm, 278 nm, 288 nm). This peak was not
observed in the chromatogram of the control sample extracted from S. hygroscopicus
MG2-10 in the absence of the cassette. LCMS (see Materials and Methods) of the
novel rapamycin analogue peak gave ions m/z 923 (MNa*) and 899 (M-H). These
ions confirm that the molecular weight of the novel rapamycin analogue is 900,14
mass units less than rapamycin. It has already been established that the only post-
PKS gene not included in the cassette, rapM, acts to methylate the C16-OH, hence
the novel rapamycin analogue is 16-O-desmethyl rapamycin (Compound 20) and
rapQ is shown to be functional and acting to O-methylate at C27.
Example 35
Bioassay of rapamycin analogues:
(1) = 9-deoxo-16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin
(pre-rapamycin)
(6) = 9-deoxc-16-O-desmethyl-27-desmethoxy-rapamycin
(16)= 9-deoxo-27-desmethoxy-rapamycin,
(3) = 16-O-desmethyl-27-desmethoxy-39-O-desmethyl-rapamycin
(9) = 9-deoxo-16-Odesmethyl-27-O-desmethyl-rapamycin
(8) = 9-deoxo-27-O-desmethyl-39-O-desmethyl-rapamycin.
Cancer Cell Lines:
-Growth inhibition of adherent human tumour cell lines of solid malignancies
HT29 (colon) and MCF-7 (breast) was tested in vitro using an MTT (3-(4,5-
dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay using micro-titre plates
(Sieuwerts, A.M., et al., 1995). All cell lines were obtained from either the ATCC
(American Type Culture Collection) or ECACC (European Collection of Cell
Cultures). All cell lines were grown from frozen stocks and passaged at least once
prior to use in RPM11640. Cells were harvested from sub-confluent cultures using
minimal trypsinization. Cells were diluted to the appropriate density for each cell line
(dependent on cell doubling time) in RPM11640, and seeded in 60 wells of a 96 well
plate in a volume of 100 µl per well (i.e. outside wells of the plate were not used).

Plates were incubated at 37°C overnight Following this incubation, log scale
dilutions of reference and test substances were added in 100 µl per well, 6 replicates
were used to test all test compounds, reference compounds and medium controls.
Plates were incubated for a further 72 h prior to analysis. MTT (5 mg/ml) was added
to each well and plates were re-incubated for 3-4 h. Unreacted MTT was removed
from the wells and formazan crystals formed from the MTT were dissolved in DMSO
and characteristic absorbance read at 570 nm. The concentration (nM) of each test
compound and reference compound, which resulted in 50% of maximum inhibition
(ICso),, was calculated for each cell line and quoted along with the maximum
percentage of inhibition observed (lm), see Table XIII. For reference, rapamycin has
an ICsoOf 200nM and an lmof 40% in the HT-29 cell line and an IC50of 0.03nM and an
!m of 56% in the MCF-7 cell line.

Mixed Lymphocyte Reaction (MLR):
Originally developed to assess tissue compatibility prior to allografts, MLR
offers an established model for immune reaction in vitro (SOULILLOU, J.P., et al.
(1975); T. Meo. "Immunological Methods", L Lefkovits and B.Pernis, Eds., Academic
Press, N.Y. pp. 227-239 (1979). MLR was performed by mixing splenic lymphocytes
isolated from C57BU6 mice (5x10s cells) with inhibited splenic lymphocytes from
CBA mice (2.5x105 cells). The inhibited CBA lymphocytes induced a proliferative
response in C57BL/6 lymphoctes and this was determined by [3H] thymidine
incorporation into DNA as a measure of proliferation of splenic lymphocytes isolated
from C57BL/6 mice. The anti-proliferative effect was assayed for in the presence of
log scale dilutions of reference compounds, test compounds and media controls over
a 72 h period at 37 °C. The concentration of each test compound and reference
compound, which inhibited lymphocyte proliferation by 50% (IC50), compared to
control proliferation, was calculated for each cell line and quoted as a ratio of the

concentration of rapamycin required to inhibit lymphocyte proliferation by 50% (rlC50),
see Table XIV.

Anti-fungal Assay:
The comparative anti-fungal activities of reference and test compounds were
determined against pathogenic fungi Candida albicans DSM 5816, Candida albicans
DSM 1386 and Candida glabrata DSM 11226. This was achieved using a microtitre
plate adaption of the NCCLS Reference Method for Broth Dilution Antifungal
Susceptibility Testing for Yeasts: Approved Standard (M27-A, vol. 17 No. 9. (1997)).
Yeast strains were inoculated (104 cfu/ml) to RPM11640 media containing 0.165 mM
MOPS, pH 7. Growth was determined in the presence of log scale dilutions of
reference compounds, test compounds and media controls after incubation with
shaking at 37 °C, 24 h. Minimum inhibitory concentration (MIC) and minimum
fungicidal activity (MFC) were determined for test compounds and expressed as a
ratio of the rapamycin minimum inhibitory concentration (rMIC respectively), see
Table XV.

References
Alarcon, CM., Heitman, J., and Cardenas, M.E. (1999) Protein kinase activity and
identification of a toxic effector domain of the target of rapamycin TOR

proteins in yeast Molecular Biology of the Cell 10:2531-2546.
Aparicio, J.F., Molnar, I., Schwecke, T., Konig, A., Haydock, S.F., Khaw, L.E.,
Staunton, J., and Leadlay, P.F. (1996) Organization of the biosynthetic gene
cluster for rapamycin in Streptomyces hygroscopicus: analysis of the
enzymatic domains in the modular polyketide synthase. Gene 169: 9-16.
Baker, H., Sidorowicz, A., Sehgal, S.N., and Vezina, C. (1978) Rapamycin (AY-
22,989), a new antifungal antibiotic. III. In vitro and in vivo evaluation.
Journal of Antibiotics 31: 539-545.
Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R., and Schoner,
B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from
Escherichia colito Streptomyces spp. Gene 116:43-49.
Blanc, V., Lagneaux, D., Didier, P., Gil, P., Lacroix, P., and Crouzet, J. (1995)
Cloning and analysis of structural genes from Streptomyces pristinaespiralis
encoding enzymes involved in the conversion of pristinamycin llB to
pristinamycin llA (PHA): PHA synthase and NADH:riboflavin 5'-phosphate
oxidoreductase. Journal of Bacteriology ATI: 5206-5214.
Blanc, V., Gil, P., Bamas-Jacques, N., Lorenzon, S., Zagorec, M., Schleuniger, J.,
Bisch, D., Blanche, F., Debussche, L, Crouzet, J., and Thibaut, D. (1997)
Identification and analysis of genes from Streptomyces pristinaespiralis
encoding enzymes involved in the biosynthesis of the 4-dimethylamino-L-
phenylalanine precursor of pristinamycin I. Molecular Microbiology 23:191-
202.
Box, S.J., Shelley, P.R., Tyler, J.W., Verrall, M.S., Warr, S:R.C, Badger, A.M., Levy,
M.A., and Banks, R.M. (1995) 27-O-Demethylrapamycin, an
immunosuppressant compound produced by a new strain of Streptomyces
hygroscopicus. Journal of Antibiotics 48:1347-1349. -
Brown, E.J., Albers, M.W., Shin, T.B., Ichikawa, K., Keith, C.T., Lane, W.S., and
Schreiber, S.L (1994) A mammalian protein targeted by G1-arresting
rapamycin-receptor complex. Nature 369:756-758.
Brunn, G.J., Williams, J., Sabers, C, Wiederrecht G., Lawrence, J.C., and Abraham,
R.T. (1996) Direct inhibition of the signaling functions of the mammalian
target of rapamycin by the phosphoinosttide 3-kinase inhibitors, wortmannin
and LY294002. EMBO Journal 15: 5256-5267.
Cao, W., Mohacsi, P., Shorthouse, R., Pratt, R. and Morris, R.E. (1995). Effects of
rapamycin on growth factor-stimulated vascular smooth muscle cell DNA

synthesis. Inhibition of basic fibroblast growth factor and platelet-derived
growth factor action and antagonism of rapamycin by FK506. Transplantation
59(3): 390-395.
Carlson, R.P., Hartman, DA, Tomchek, LA, Walter, T.L, Lugay, J.R., Calhoun, W.,
Sehgal, Si.N., Chang, J.Y. (1993). Rapamycin, a potential disease-modifylng
antiarthritic drug. J. Pharmacol. Exp. Ther. 266(2): 1125-38.
Chambraud, B., Radanyl, C, Camonis, J.H., Shazand, K., Rajkowskt, K., and
Baulieu, E.E. (1996) FAP48, a new protein that forms specific complexes both
immunophilins FKBP59 and FKBP12. Prevention by the immunosuppressant
drugs FK506 and rapamycin. Journal of Biological Chemistry 271: 32923-
32929.
Chang, J.Y., Sehgal, S.N., and Bansbach, C.C. (1991) FK506 and rapamycin: novel
pharmacological probes of the immune response. Trends in Pharmacological
Sciences 12:218-223.
Chen, J., Zheng, X.F., Brown, E.J., and Schreiber, S.L (1995) Identification of an 11-
kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-
rapamycin-associated protein and characterization of a critical serine residue.
Proceedings of the National Academy of Sciences of the United States of
America 92:4947-4951.
Chini, M., Crotti, P., Gardelli, C, and Macchia, F., (1992), Tetrahedron, 48, 3805-
3812
Choi, J.W., Chen, J., Schreiber, S.L, and Clardy, J. (1996) Structure of the FKBP12-
rapamycin complex interacting with the binding domain of human FRAP.
Science 273: 239-242.
Chung, L, Liu, L, Patel, S., Carney, J.R., and Reeves, CD. (2001) Deletion of
rapQNML from the rapamycin gene cluster of Streptomyces hygroscopicus
gives production of the 16-O-desmethyl-27-desmethoxy analog. Journal of
Antibiotics 54:250-256.
Corey, E, J. and Huang, H., (1989) Tetrahedron Lett., 30, 5235-5238
DiLella, AG., and Craig, R.J. (1991) Exon organization of the human FKBP-12 gene:
correlation with structural and functional protein domains. Biochemistry 30:
8512-8517.
Du, L.C., Sanchez, C, Chen, M., Edwards, D.J., and Shen, B. (2000) The
biosynthetic gene cluster for the antitumor drug bleomycin from Streptomyces
verticiilus ATCC15003 supporting functional interactions between

nonribosomal peptide synthetases and a polyketide synthase. Chemistry &
Biology 7: 623-642.
Dudkin, L, Dilling, M.B., Cheshire, P.J., Harwood, F.C., Hollingshead, M., Arbuck,
S.G., Travis, R., Sausville, E.A., Houghton, P.J. (2001). Biochemical
correlates of mTOR inhibition by the rapamycin ester CCI-779 and tumor
growth inhibition. Clin. Cancer Res. 7(6):1758-64
Fehr, T., Sanglier, J-J., Schuler, W., Gschwind, L, Ponelle, M., Schilling, W.,
Wioland, C. (1996). Antascomicinc A, B, C, D and E: Novel FKBP12 binding
compounds from a Micromonospora strain. J. Antibiot. 49(3): 230-233.
Ferrari, S., Pearson, R.B., Siegmann, M., Kozma, S.C., and Thomas, G. (1993) The
immunosuppressant rapamycin induces inactivation of P70s6k through
dephosphorylation of a novel set of sites. Journal of Biological Chemistry 268:
16091-16094.
Findiay J A, and Radios, L (1980) Canadian Journal of Chemistry 58:579.
Fishbein, T.M., Florman, S., Gondolesi, G., Schiano, T., LeLeiko, N., Tschernia, A.,
Kaufman, S. (2002). Intestinal transplantation before and after the introduction
of sirolimus. —
Transplantation. 73(10): 1538-42.
Foey, A., Green, P., Foxwell, B., Feldmann, M., Brennan, F. (2002). Cytokine-
stimulated T cells induce macrophage IL-10 production dependent on
phosphatidylinositol 3-kinase and p70S6K: implications for rheumatoid
arthritis. Arthritis Res. 4(1):64-70. Epub 2001 Oct 10.
Gaisser, S., Reather, J., Wirtz, G., Kellenberger, L., Staunton, J., and Leadlay, P.F.
(2000) A defined system for hybrid macrolide biosynthesis in
Saccharopolyspora erythraea. Molecular Microbiology 36: 391-401.
Gaisser,.S., Lill, R., Staunton, J., Mendez, C, Salas, J., Leadlay, PF. (2002) Parallel
pathways for oxidation of 14-membered polyketide macrolactones in
Saccharopolyspora erythraea. Mol Microbiol 44:771-81.
Galat, A. (2000) Sequence diversification of the FK506-binding proteins in several
different genomes. European Journal of Biochemistry 267: 4945-4959.
Gregory, C.R., Huie, P., Billingham, M.E. and Morris, R.E. (1993). Rapamycin
inhibits arterial intimal thickening caused by both alloimmune and mechanical
injury. Its effect on cellular, growth factor and cytokine response in injured
vessels. Transplantation 55(6): 1409-1418.
Gregory MA, Till R1 Smith, MCM. (in Press) integration site for Streptomyces phage

c|>BT1 and the development of site-specific integrating vectors. J Bacteriol.
Guba, M., von Breitenbuch, P., Steinbauer, M., Koehl, G., Flegel, S., Hornung, M.,
Bruns, C.J., Zuelke, C, Farkas, S., Anthuber, M., Jauch, K.W., and Geissler,
E.K. (2002) Rapamycin inhibits primary and metastatic tumor growth by
antiangiogenesis: involvement of vascular endothelial growth factor. Nature
Medicine 8:128-135.
Hamilton, G.S., and Steiner, J. P. (1998) Immunophilins: Beyond
immunosuppression. Journal of Medicinal Chemistry 41: 5119-5143.
Hara, K., Yonezawa, K., Kozlowski, M.T., Sugimoto, T., Andrabi, K., Weng, Q.P.,
Kasuga, M., Nishimoto, I., and Avruch, J. (1997) Regulation of elF-4E BP1
phosphorylation by mTOR. Journal of Biological Chemistry 272: 26457-
26463.
Hardwick, J.S., Kuruvilla, F.G., Tong, J.K., Shamji, A.F., and Schreiber, S.L. (1999)
Rapamycin-modulated transcription defines the subset of nutrient-sensitive
signaling pathways directly controlled by the Tor proteins. Proceedings of the
National Academy of Sciences of the United States of America 96:14866-
14870.
Hatanaka, H., Kino, T., Miyata, S., Inamura, N., Kuroda, A., Goto, T., Tanaka, H.,
Okuhara, M. (1988). FR-900520 and FR-900523, novel immunosuppressants
isolated from a Streptomyces. II. Fermentation, isolation and physico-
chemical and biological characteristics.i/. Antibiot. (Tokyo). 41(11): 1592-601.
Hatanaka H, Kino T, Asano M, Goto T, Tanaka H, Okuhara M. (1989). FK-506
related compounds produced by Streptomyces tsukubaensis No. 9993. J.
Antibiot (Tokyo). 42(4):620-2.
Hendrickson, BA, Zhang, W., Craig, R.J., Jin, Y.J., Bierer, B.E., Burakoff, S., and
DiLella, A.G. (1993) Structural organization of the genes encoding human and
murine FK506-binding protein (FKBP)13 and comparison to FKBP1. Gene
134: 271-275.
Hentges, K.E., Sirry, B., Gingeras, A.C., Sarbassov, D., Sonenberg, N., Sabatini, D.,
and Peterson, A.S. (2001) FRAP/mTOR is required for proliferation and
patterning during embryonic development in the mouse. Proceedings of the
National Academy of Sciences of the United States of America 98:13796-
13801.
Hopwood, D.A. (1997) Genetic contributions to understanding polyketide synthases.

Hosted, T.J., and Baltz, R.H. (1997) Use of rpsL for dominance selection and gene
replacement in Streptomyces roseosporus. Journal of Bacteriology MS: 180-
186.
Hung, D.T.,-and Schreiber, S.L (1992) cDNA cloning of a human 25 kDa FK506 and
rapamycin binding protein. Biochemical and Biophysical Research
Communications 184:733-738.
Hung, D.T., Jamison, T.F., and Schreiber, S.L. (1996) Understanding and controlling
the cell cycle with natural products. Chemistry & Biology 3: 623-639.
Jain, S., Bickneli, G.R., Whiting, P.H., Nicholson, M.L (2001). Rapamycin reduces
expression of fibrosis-associated genes in an experimental model of renal
ischaemia reperfusion injury. Transplant Proc. 33(1-2):556-8.
Jin, Y.J., Burakoff, S.J., and Bierer, B.E. (1992) Molecular cloning of a 25-kDa high
affinity rapamycin binding protein, FKBP25. Journal of Biological Chemistry
287:10942-10945.
Kahan, B.D., Chang, J.Y., and Sehgal, S.N. (1991) Preclinical evaluation of a new
potent immunosuppressive agent, rapamycin. Transplantation 52:185-191.
Kahan, B.D., and Camardo, J.S. (2001) Rapamycin: Clinical results and future
opportunities. Transplantation 72:1181 -1193.
Kallen, J. A., Sedrani, R., and Cottens S. (1996) X-ray crystal structure of 28-O-
methylrapamycin complexed with FKBP12: Is the cyclohexyl moiety part of
the effector domain of rapamycin? Journal of the American Chemical Society
118: 5857-5861.
Kawasome, H., Papst, P., Webb, S., Keller, G.M., Johnson, G.L, Gelfand, E.W., and
Terada, N. (1998) Targeted disruption of p70s8k defines its role in protein
synthesis and rapamycin sensitivity. Proceedings of the National Academy of
Sciences of the United States of America 95: 5033-5038.
Khaw, C.E., Bohm, GA, Metcalfe, S., Staunton, J., and Leadlay, P.F. (1998)
Mutational biosynthesis of novel rapamycins by a strain of Streptomyces
hygroscopicus NRRL 5491 disrupted in rapL, encoding a putative lysine
cyclodeaminase. Journal of Bacteriology 180: 809-814.
Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., and Hopwood, DA (2000)
Practical Streptomyces Genetics, John Innes Foundation, Norwich.
Kirby, B., and GrifRths,C.E.M. (2001) Psoriasis: the future. British Journal of
Dermatology 144:37-43.
Kirchner, G.I., Winkler, M., Mueller L, Vidal, C, Jacobsen, W., Franzke, A., Wagner,

S., Blick, S., Manns MP., and Sewing K.-F.(2000) Pharmacokinetics of SDZ
RAD and cyclosporin including their metabolites in seven kidney graft patients
after the first dose of SDZ RAD. British Journal of Clinical Pharmacology
50:449-454.-
Konig, A., Schwecke, T., Molnar, I., Bohm, G., Lowden, PAS., Staunton, J., and
Leadlay, P.F. (1997) The pipecolate-incorporating enzyme for the
biosynthesis of the immunosuppressant rapamycin. Nucleotide sequence
analysis, disruption and heterologus expression of rapPfrom Streptomyces
hygroscopicus. European Journal of Biochemistry 247: 526-534.
Kunz, J., Loeschmann, A, Deuter-Reinhard, M., and Hall, M.N. (2000) FAP1, a
homologue of human transcription factor NF-X1, competes with rapamycin for
binding to FKBP12 in yeast. Molecular Microbiology 37:1480-1493.
Kuo, C.J., Chung, J.K., Fiorentino, D.F., Flanagan, W.M., Blenis, J., and Crabtree,
G.R. (1992) Rapamycin selectively inhibits interleukin-2 activation of p70 S6
kinase. Nature 358:70-73.
Lee, M.H. Pascopella, L, Jacobs, W.R., Jr and Hatfull, G.F (1991). Site specific
integration of mycobacteriophage L5: integration-proficient vectors for
Mycobacterium smegmatis, Mycobacterium tuberculosis and Bacille
Calmette-Guerin: Prpc. Natl. Acad. Sci. USA, 88:3111-3115.
Lee MH, Pascopella L, Jacobs WR Jr, Hatfull GF. (1991), Site-specific integration of
mycobacteriophage L5: integration-proficient vectors for Mycobacterium
smegmatis, Mycobacterium tuberculosis, and bacille Calmette-Guerin. Proc
Natl Acad Sci USA; 88:3111-5.
Liang, J., Choi, J., and Clardy, J. (1999) Refined structure of the FKBP12-rapamycin-
FRB ternary complex at 2.2 A resolution. Acta Crystallographica Section D-
Biological Crystallography 55:736-744. -
Lomovskaya, N., Fonstein, L., Ruan, X., Stassi, D., Katz, L, and Hutchinson, C.R.
(1997) Gene disruption and replacement in the rapamycin-producing
Streptomyces hygroscopicus strain ATCC 29253. Microbiology-Uk 143: 875-
883.
Lowden, P.A.S., Bohm, G., Staunton, J., and Leadlay, P.F. (1996) The nature of the
starter unit for the rapamycin polyketide sythase. Angewandte Chemie 35:
2249-2251.
Lowden, P. A. S., (1997) Ph.D. Dissertation, University of Cambridge. "Studies on the
biosynthesis of rapamycin".

Lowden. PAS., Wilkinson, B., Bohm, GA, Handa, S., Floss, H.G., Leadlay, P.F.,
and Staunton, J. (2001) Origin and true nature of the starter unit for the
rapamycin polyketide synthase. Angewandte Chemie-lnternational Edition 40:
777-779.
Luengo J.!., Yamashita,.D.S., Dunnington, D., Beck, AK., Rozamus, L.W., Yen,
H.K., Bossard, M.J., Levy, M.A, Hand, A, Newmantarr, T., Badger, A.,
Faucette, L, Johnson, R.K., Dalessio, K., Porter, T., Shu, A.Y.L, Heys, R.,
Choi, J.W., Kongsaeree, P., Clardy, J., and Holt, DA (1995) Structure-
Activity Studies of Rapamycin Analogs - Evidence That the C-7 Methoxy
Group Is Part of the Effector Domain and Positioned at the Fkbp12-Frap
Interface. Chemistry & Biology 2:471-481.
Lyons, W.E., George, E.B., Dawson, T.M., Steiner, J.P., and Snyder, S.H. (1994)
Immunosuppressant FK506 promotes neurite outgrowth in cultures of RC12
cells and sensory ganglia. Proceedings of the National Academy of Sciences
of the United States of America 91:3191-3195.
MacNeil, D.J., Gewain, K.M., Ruby, C.L, Dezeny, G., Gibbons, P.H., and MacNeil, T.
(1992) Analysis of Steptomyces avermitilis genes required for avermectin
biosynthesis utilizing a novel integration vector. Gene 111: 61-68.
Marahiel, MA, Stachelhaus, T., and Mootz, H.D. (1997) Modular peptide
. synthetases involved in nonribosomal peptide synthesis. Chemical Reviews
97: 2651-2673.
Matsuura, M., Noguchi, T., Yamaguchi, D., Aida, T., Asayama, M., Takahashi, H. and
Shirai, M. (1996). The sre gene (ORF469) encodes a site-specific
recombinase responsible for integration of the R4 phage genome. J Bact.
178(11):3374-3376.
McAlpine, J. B,.Swanson S. J., Jackson, M., Whittern, D.N. (1991). Revised NMR
"assignments for rapamycin. Journal of Antibiotics 44: 688-690.
Meo, T. in "Immunological Methods", L Lefkovits and B. Pernis, Eds., Academic
Press, N.Y. pp. 227-239 (1979).
Molnar, I., Aparicio, J.F., Haydock, S.F., Khaw, L.E., Schwecke, T., Konig, A,
Staunton, J., and Leadlay, P.F. (1996) Organisation of the biosynthetic gene
cluster for rapamycin in Streptomyces hygroscopicus: analysis of genes
flanking the polyketide synthase. Gene 169:1-7.
Morice, M.C., Serruys, P.W., Sousa, J.E., Fajadet, J., Ban Hayashi, E., Perin, M.,
Colombo, A, Schuler, G., Barragan, P., Guagliumi, G., Molnar, F., Falotico,

R. (2002). RAVEL Study Group. Randomized Study with the Siroiimus-
Coated Bx Velocity Balloon-Expandable Stent in the Treatment of Patients
with de Novo Native Coronary Artery Lesions. A randomized comparison of a
sirolimus-eluting stent with a standard stent for coronary revascularization. N.
EngJJ. Med. 346(23): 1773-80.
Motamedi, H., Shafiee, A., Cai, S.J., Streicher, S.L., Arison, B.H., and Miller, R.R.
(1996) Characterization of methyltransferase and hydroxylase genes involved
in the biosynthesis of the immunosuppressants FK506 and FK520. Journal of
Bacteriology 178: 5243-5248.
Motamedi, H., Cai, S.J., Shafiee, A., and Elliston, K.O. (1997) Structural organization
of a multifunctional polyketide synthase involved in the biosynthesis of the
macrolide immunosuppressant FK506. European Journal of Biochemistry
244: 74-80.
Motamedi, H., and Shafiee, A (1998) The biosynthetic gene cluster for the
macrolactone ring of the immunosuppressant FK506. European Journal of
Biochemistry 256: 528-534.
Myckatyn, T.M., Ellis, RA, Grand, A.G., Sen, S.K., Lowe, J.B. 3rd, Hunter, DA,
Mackinnon, S.E. (2002). The effects of rapamycin in murine peripheral nerve
isografts and allografts.
Plast. Reconstr. Surg. 109(7):2405-17.
Nave, B.T., Ouwens, D.M., Withers, D.J., Alessi, D.R., and Sheperd, P.R. (1999)
Mammalian target of rapamycin is a direct target for protein kinase B:
identification of a convergence point for opposing effects of insulin and amino-
acid deficiency on protein translation. Biochemical Journal 344:427-431.
Navia, MA (1996) Protein-drug complexes important for immunoregulation and
organ transplantation. Current Opinion in Structural Biology 6: 838-847.
NCCLSTReference Method for Broth Dilution Antifungal Susceptibility Testing for
Yeasts: Approved Standard M27-A, vol. 17 No. 9. (1997).
Nishida, H., Sakakibara, T., Aoki, F., Sa'rto, T., Ichikawa, K., Inagaki, T., Kojima, Y.,
Yamauchi, Y., Huang, L.H., Guadliana, MA, Kaneko, T., and Kojima, N.
(1995) Generation of novel rapamycin structures by microbial manipulations.
Journal of Antibiotics 48: 657-666.
Nielsen, J.B., Hsu, M.J., Byrne, K.M., and Kaplan, L (1991) Biosynthesis of the
immunosuppressant immunomycin: the enzymology of pipecolate
incorporation. Biochemistry 30: 5789-5796.

Paget, M.S.B., Chamberlin, L, Atrih, A., Foster, S.J., and Buttner, M.J. (1999)
Evidence that the extracytoplasmic function sigma factor c^ is required for
normal cell wall structure in Streptomyces coelicolor A3(2). Journal of
Bacteriology 181:204-211)
Paiva, N.L, Demain, A.L, and Roberts, M.F. (1991) Incorporation of acetate,
propionate, and methionine into rapamycin By Streptomyces hygroscopicus.
Journal of Natural Products 54:167-177.
Paiva, N.L., Demain, A.L, and Roberts, M.F. (1993) The immediate precursor of the
nitrogen-containing ring of rapamycin is free pipecolic acid. Enzyme and
Microbial Technology 15:581-585.
Patterson, C.E., Schaub, T., Coleman, E.J., and Davies E.C. (2000) Developmental
regulation of FKBP65. An ER-localized extracellular matrix binding-protein.
Molecular Biology of the Cell 11:3925-3935.
Pfeifer, BA, Admiraal, S.J., Gramajo, H., Cane, D.E., and Khosla, C. (2001)
Biosynthesis of complex polyketides in a metabolically engineered strain of £.
co//. Science 291:1790-1792.
Powell, N., Till, S., Bungre, J., Corrigan, C. (2001). The immunomodulatory drugs
cyclosporin A, mycophenolate mofetil, and sirolimus (rapamycin) inhibit
allergen-induced proliferation and IL-5 production by PBMCs from atopic
asthmatic patients.
J. Allergy Clin. Immunol. 108(6):915-7
Rabinovitch, A., Suarez-Pinzon, W.L., Shapiro, A.M., Rajotte, R.V., Power, R. (2002).
Combination therapy with sirolimus and interleukin-2 prevents spontaneous
and recurrent autoimmune diabetes in NOD mice.Diabetes. 51(3):638-45.
Raught, B., Gingras, A.C., and Sonenberg, N. (2001) The target of rapamycin (TOR)
proteins. Proceedings of the National Academy of Sciences of the United
States of America 98:7037-7044.
Rawlings, B.J. (2001) Type I polyketide. biosynthesis in bacteria (Part A). Natural
Product Reports 18:190-227.
Reather, J. A., (2000), Ph.D. Dissertation, University of Cambridge. "Late steps in
the biosynthesis of macrocyclic lactones".
Re'rtamo, S., Spuls, P., Sassolas, B., Lahfa, M., Claudy, A., Griffiths, C.E.; Sirolimus
European Psoriasis Study Group. (2001). Efficacy of sirolimus (rapamycin)
administered concomitantly with a subtherapeutic dose of cyclosporin in the
treatment of severe psoriasis: a randomized controlled trial. Br. J. Dermatol.

145(3):438-45.
Rosen, M.K., and Schreiber, S.L (1992) Natural products as probes of cellular
function: studies of immunophilins. Angewandte Chemie-lnternational Edition
in English 31: 384-400.
Roymans, D., and Siegers, H. (2001) Phosphaditidylinositol 3-kinases in tumor
progression. European Journal of Biochemistry 268:487-498.
Ruan, XA, Stass, D., Lax, SA, and Katz, L (1997) A second type-l PKS gene
cluster isolated from Streptomyces hygroscopicus ATCC 29253, a rapamycin-
producing strain. Gene 203:1-9.
Salituro, G.M., Zink, D.L, Dahl, A., Nielsen, J., Wu, E., Huang, L, Kastner C,
Dumont, F. (1995) Meridamycin: a novel nonimmunosuppressive FKBP12
ligandfrom Streptomyces hygroscopicus. Tetrahydron letters 36: 997-1000.
Schwarzer, D., and Marahiel, MA. (2001) Multimodular biocatalysts for natural
product assembly. Naturwissenschaften 88: 93-101.
Sambrook, J., Fritsch. E.F., and Maniatis, T. (1989) Molecular cloning: a laboratory
manual, 2nd ed. Cold Spring Harbor Laboratory Press, N.Y.
Schreiber, S.L, and Crabtree, G.R. (1992) The mechanism of action of cyclosporine
A and FK506. Immunology Today 13:136-142.
Schwecke, T., Aparicio, J.F., Molnar, l., K6nig, A., Khaw, L.E., Haydock, S.F.,
Oliynyk, M., Caffrey, P., Cortes, J., Lester, J.B., Bohm, G.A., Staunton, J.,
• and Leadlay, P.F. (1995) The biosynthetic gene cluster for the polyketide
immunosuppressant rapamycin. Proceedings of the National Academy of
Sciences of the United States of America 92: 7839-7843.
Sedrani, R., Cottens, S., Kallen, J., and Schuler, W. (1998) Chemical modifications of
rapamycin: the discovery of SDZ RAD. Transplantation Proceedings 30:
2192-2194. ' £ • ■
Sehgal,"S.N., Baker, H., and Vezina, C. (1975) Rapamycin (AY-22,989), a new
antifungal antibiotic II. Fermentation, isolation and characterization. The
Journal of Antibiotics 28:727-733.
Shepherd, P.R, Withers, D.J., and Siddle K. (1998) Phosphoinositide 3-kinase: the
key switch mechanism in insulin signalling. Biochemical Journal 333:471-
490.
Shima, J., Hesketh, A., Okamoto, S., Kawamoto, S., and Ochi, K. (1996) Induction of
actinorhodin production by rpsL (encoding ribosomal protein S12) mutations
that confer streptomycin resistance in Streptomyces lividans and

Streptomyces coelicolor A3(2). Journal of Bacteriology 178: 7276-7284.
Sigal, N.H., and Dumont, F.J. (1992) Cyclosporin A, FK-506, and rapamycin:
pharmacological probes of lymphocyte signal transduction. Annual Review of
Immunology 10:519-560.
Sieuwerts, A.M., Klijn, J.G., Peters, H.A., Foekens, J.A. (1995). The MTT tetrazolium
salt assay scrutinized: how to use this assay reliably to measure metabolic
activity of cell cultures in vitro for the assessment of growth characteristics,
IC50-values and cell survival. Eur. J Clin. Chem. Clin. Biochem. 33(11):813-
23.
Smovkina, T., Mazodier, P., Boccard, F., Thompson, CJ. and Guerineau, M. (1990)
Construction of a series of pSAM2-based integrative vectors for use in
actinomycetes. Gene 94:53-59.
SOULILLOU, J.P., CARPENTER, C.B., LUNDIN, A.P. and STROM, T.B. (1975)
Augmentation of proliferation and in vitro production of cytotoxic cells by 2-ME
in the rat J Immunol. 115(6): 1566-71.
Staunton, J., and Weissman, K.J. (2001) Polyketide biosynthesis: a millennium
review. Natural Product Reports 18:380-416.
Steiner, J.P., Hamilton, G.S., Ross, D. T., Valentine, H.L, Guo, H., Connolly, M.A.,
Liang, S., Ramsey, C, Li, J.-H.J., Huang, W., Howorth, P., Soni, R., Fuller,
M., Sauer, H., Nowotnik, A.C., and Suzdak, P.D. (1997) Neutrophic
immunophiiin ligands stimulate structural and functional recovery in
neurodegenerative animal models. Proceedings of the National Academy of
Sciences of the United States of America 94:2019-2024.
Tang, S.J., Reis, G., Kang, H., Gingras, A-C., Sonenberg, N., and Schuman, E.M.
(2002) A rapamycin-sensitive signaling pathway contributes to long-term
synaptic plasticity in the hippocampus. Proceedings ofthe National Academy
of Sciences of the United States of America 1:467-472.
Van Duyne, G.D., Standaert, R.F., Karplus, PA, Schreiber, S.L,.and Clardy, J.
(1993) Atomic structures of the human immunophiiin FKBP-12 complexes
with FK506 and rapamycin. Journal of Molecular Biology 229:105-124.
Van Mellaert L, Mei, L, Lammertyn, E., Schacht, S., and Anne, J. (1998) Site-
specific integration of bacteriophage VWB genome into Streptomyces
venezuelae and construction of a VWB-based integrative vector. Microbiology
144:3351-3358.
Vezina, C, Kudelski, A., and Sehgal, S.N. (1975) Rapamycin (AY-22,989), a new

antifungal antibiotic. I. Taxonomy of the producing streptomycete and
isolation of the active principle. 777e Journal of Antibiotics 28: 721-726.
Vilella-Bach, M., Nuzzi, P., Fang, Y.M., and Chen, J. (1999) The FKBP12-rapamycin-
binding domain is required for FKBP12-rapamycin-associated protein kinase
activity.and Gi progression. Journal of Biological Chemistry 274:4266-4272.
Waller, J.R., and Nicholson, M.L (2001) Molecular mechanisms of renal allograft
fibrosis. British Journal of Surgery 88:1429-1441.
Warner, L.M., Adams, L.M., Chang, J.Y., Sehgal, S.N. (1992). A modification of the
in vivo mixed lymphocyte reaction and rapamycin's effect in this model.Clin.
Immunol. Immunopathol. 64(3):242-7.
Weber, T., and Marahiel, M.A. (2001) Exploring the domain structure of modular
nonribosomal peptide synthetases. Structure 9: R3-R9
Welch, J. T. and Seper, K., W., (1988), J. Org. Chem., 53,2991-2999
Wilkinson, B., Foster, G., Rudd, BAM., Taylor, N.L., Blackaby, A.P., Sidebottom,
P.J., Cooper, D.J., Dawson, M.J., Buss, A.D., Gaisser, S., Bohm, I.U., Rowe,
C.J., Cortes, J., Leadlay, P.F. and Staunton, J. (2000). Novel octaketide
macrofides related to 6-deoxoerythronolide B provide evidence for iterative
operation of the erythromycin polyketide synthase. Chemistry & Biology 7:
111-117.
Wong, G.K., Griffith, S., Kojima, I., and Demain, A.L. (1998) Antifungal activities of
rapamycin and its derivatives, prolylrapamycin, 32-desmethylrapamycin, and
32-desmethoxyrapamycin. Journal of Antibiotics 51:487-491.
Wu, K., Chung, L., Revill, W.P., Katz, L, and Reeves, CD. (2000) The FK520 gene
cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891)
contains genes for biosynthesis of unusual polyketide extender units. Gene
251: 81-90.
Yem, A!W., Tomasselli, A.G., Heinrikson, R.L., Zurcher-Neely, H., Ruff, VA.,
Johnson, RA, and Deibel, M.R. (1992) The Hsp56 component of steroid
receptor complexes binds to immobilized FK506 and shows homology to
FKBP-12 and FKBP-13. Journal of Biological Chemistry 267: 2868-2871.
Yu, K., Toral-Barza, L, Discafani, C, Zhang, W.G., Skotnicki, J., Frost, P., Gibbons,
J.J. (2001) mTOR, a novel target in breast cancer the effect of CCI-779, an
mTOR inhibitor, in preclinical models of breast cancer. Endocrine-Related
Cancer 8:249-258.
Zhu, J., Wu J., Frizell, E., Liu, S.L, Bashey, R., Rubin, R., Norton, P., Zern, MA

(1999). Rapamycin inhibits hepatic stellate cell proliferation in vitro and limits
fibrogenesis in an in vivo model of liver fibrosis.
Gastroenterology. 117(5):1198-204.

WE CLAIM :
1. A method of generating analogues of FKBP-ligands which incorporate a non-natural
starter unit, said method comprising:
(a) generating a recombinant strain in which at least the rapK homologue which has
at least 40% sequence identity to the sequence of rapK as shown in SEQ ID NO: 13
has been deleted or inactivated; and
(b) feeding a non-natural starter unit to said strain.

2. The method as claimed in claim 1, which additionally comprises deleting one or more
further auxiliary genes.
3. The method as claimed in any one of claims 1 or 2, which additionally comprises
restoring by complementation one or more of the deleted genes.
4. The method as claimed in any one of claims 1 to 3, which additionally comprises the
step of isolating and purifylng the FKBP-ligand analogues generated.
5. The method as claimed in any one of claims 1 to 4, wherein said non-natural starter
unit is selected from the group consisting of: 2-norbornane carboxylic acid; 2-
(cis/trans)-hydroxycyclohexane carboxylic acid; 3-(cis/trans)-hydroxycyclohexane
carboxylic acid; 4-(cis/trans)-hydroxycyclohexane carboxylic acid; 2-(cis/trans)-
methylcyclohexane carboxylic acid; 4-(cis/trans)-methylcyclohexane carboxylic acid;
3-(cis/trans)-methoxycyclohexane carboxylic acid; 4-(cis/trans)-methoxycyclohexane
carboxylic acid; 4-oxo cyclohexane carboxylic acid; 2-oxo cyclohexane carboxylic
acid; 4-trans-n-pentylcyclohexane carboxylic acid; 2-trans-aminocyclohexane
carboxylic acid; 4-cis-aminocyclohexane carboxylic acid; 4-(cis/trans)-
aminomethylcyclohexane carboxylic acid; cyclopentane carboxylic acid; cyclobutane
carboxylic acid; 1-methylcyclohexane carboxylic acid; 3-trans-hydroxy-4-cis-
fluorocyclohexane carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane
carboxylic acid; 3-cis-hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis-
hydroxy-3-trans-fluorocyclohexane carboxylic acid; 3-c/'s-hydroxy-4-trans-
chlorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans-chlorocyclohexane
carboxylic acid; 3-trans-hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4-trans-
hydroxy-3-cis-chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide
carboxylic acid; 3-cis-cyclohexeneoxide carboxylic acid; 3,4-cis-
dihydroxycyclohexane carboxylic acid and 3,4-trans-dihydroxycyclohexane carboxylic

acid; cyclohexaneacetic acid; cyclohexanepropionic acid and 4-cis/trans-tert-
butylcyclohexane carboxylic acid or simple esters or salts thereof.
6. The method as claimed in claim 5, wherein said non-natural starter unit is selected
from the group consisting of: 3-(cis/trans)-hydroxycyclohexane carboxylic acid; 4-
(cis/trans)-hydroxycyclohexane carboxylic acid; 3-(cis/trans)-methoxycyclohexane
carboxylic acid; 4-(cis/trans)-methoxycyclohexane carboxylic acid; 4-oxo
cyclohexane carboxylic acid; cyclobutane carboxylic acid; 3-trans-hydroxy-4-cis-
fluorocyclohexane carboxylic acid and 4-trans-hydroxy-3-cis-fluorocyclohexane
carboxylic acid; 3-cis-hydroxy-4-trans-fluorocyclohexane carboxylic acid and 4-cis-
hydroxy-3-trans-fluorocyclohexane carboxylic acid; 3-cis-hydroxy-4-trans-
chlorocyclohexane carboxylic acid and 4-cis-hydroxy-3-trans-chlorocyclohexane
carboxylic acid; 3-trans-hydroxy-4-cis-chlorocyclohexane carboxylic acid and 4-trans-
hydroxy-3-cis-chlorocyclohexane carboxylic acid; 3-trans-cyclohexeneoxide
carboxylic acid; 3-cis-cyclohexeneoxide carboxylic acid; 3,4-cis-
dihydroxycyclohexane carboxylic acid and 3,4-trans-dihydroxycyclohexane carboxylic
acid; cyclohexanepropionic acid; 4-cis/trans-tert-butylcyclohexane carboxylic acid or
simple esters or salts thereof.
7. The method as claimed in claim 5 provided that the non-natural starter fed to said
recombinant strain is not: cyclohexane carboxylic acid, 3-cis,A-trans-
dihydroxycyclohexane carboxylic acid, 1-cyclohexene carboxylic acid, 3-cyclohexene
carboxylic acid, cycloheptane carboxylic acid, 3-(cis/trans)-methylcyclohexane
carboxylic acid, 4-(cis/frans)-methylcyclohexane carboxylic acid, 1-cycloheptene
carboxylic acid or 5-cis-hydroxyl-3-cyclohexene carboxylic acid.
8. The method as claimed in any one of claims 1 to 7, wherein the recombinant strain of
part (a) is made according to a method comprising:

(a) constructing a conjugative deletion plasmid in an E. coli strain that is dam",
dcm" or dam" and dcm.
(b) generation of spores from said host strain suitable for conjugation wherein
said strain is grown at a humidity of between 10% and 40% and the spores are
harvested at between 5 and 30 days;
(c) conjugating the E. coli strain of step (a) with the spores from step (b) on a
medium that comprises per litre:
i) 0.5g to 5g corn steep powder,
ii) 0.1g to 5g Yeast extract,

iii) 0.1g to 10g calcium carbonate; and
iv) 0.01g to 0.5 g iron sulphate;
said medium additionally containing BACTO-agar and starch and having been dried
to result in 1-20% weight loss; and
(d) optionally culturing the recombinant strain under conditions suitable for
polyketide production.
9. The method as claimed in any one of claims 1 to 8, wherein the strain is selected
from the group consisting of Streptomyces hygroscopicus subsp. hygroscopicus
NRRL 5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554,
Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891,
Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087,
Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces
hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces tsukubaensis
No.9993 FERM BP-927, Streptomyces hygroscopicus subsp. yakushimaensis,
Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp.
A92-306401 DSM 8429 and Streptomyces sp. MA 6858 ATCC 55098.
10. The method as claimed in claim 9, wherein the strains are selected from the group
consisting of: S. hygroscopicus subsp. hygroscopicus NRRL 5491 and S.
hygroscopicus var. ascomyceticus ATCC 14891.
11. The method as claimed in claim 10, wherein the strain is the rapamycin producer S.
hygroscopicus subsp. hygroscopicus NRRL 5491.
12. The method as claimed in claim 3, wherein the process of restoring the deleted
genes comprises:
(a) constructing a gene cassette which contains one or more of the deleted genes
and
(b) transforming said recombinant strain that contains biosynthetic clusters that
encode FKBP-ligands with said gene cassette.
13. The method as claimed in claim 12, wherein said gene cassette is assembled directly
in an expression vector.
14. The method as claimed in claim 12 or 13, wherein the complementation is

homologous.
15. The method as claimed in claim 12 or 13, wherein the complementation is
heterologous.
16. The method as claimed in any one of claims 2 to 15, wherein said one or more
deleted or inactivated auxiliary genes are selected from the group consisting of
starter unit supply genes, amino acid precursor supply genes, cytochrome P-450
monooxygenases, ferredoxins and SAM-dependent O-methyltransferases.
17. The method as claimed in claim 16, wherein the deleted or inactivated genes are
selected from the group consisting of rapL, rapN, rapO, rapM, rapQ, rapl and rapJ.
18. A recombinant strain that contains biosynthetic clusters that encode FKBP-ligands,
wherein at least the rapK homologue has been deleted or inactivated.
19. The recombinant strain as claimed in claim 18, wherein the strain is selected from
the group consisting of Streptomyces hygroscopicus subsp. hygroscopicus NRRL
5491, Actinoplanes sp. N902-109 FERM BP-3832, Streptomyces sp. AA6554,
Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891,
Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087,
Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces
hygroscopicus var. ascomyceticus ATCC 55276, Streptomyces tsukubaensis
No.9993 FERM BP-927, Streptomyces hygroscopicus subsp. yakushimaensis,
Streptomyces sp. DSM 4137, Streptomyces sp. DSM 7348, Micromonospora n.sp.
A92-306401 DSM 8429 and Streptomyces sp. MA 6858 ATCC 55098.
20. The recombinant strain as claimed in claim 19, wherein the strains are selected from
the group consisting of S. hygroscopicus subsp. hygroscopicus NRRL 5491 and S.
hygroscopicus var. ascomyceticus ATCC 14891.
21. The recombinant strain as claimed in claim 20, wherein the strain is the rapamycin
producer S. hygroscopicus subsp. hygroscopicus NRRL 5491.
22. The recombinant strain as claimed in any one of claims 18 to 21, wherein the
additionally deleted or inactivated auxiliary genes are selected from the group
consisting of: rapL, rapN/O, rapQ, rapM, rapl and rapJ have been deleted, wherein

said deletion is not rapQrapN/OrapMrapL

A METHOD OF GENERATING ANALOGUES OF FKBP-LIGANDS WHICH
INCORPORATE A NON-NATURAL STARTER UNIT

ABSTRACT

The present invention relates to production of polyketides and other natural products and to libraries of compounds
and individual novel compounds. One important area is the isolation and potential use of novel FKBP-ligand analogues and host cells
that produce these compounds. The invention is particularly concerned with methods for the efficient transformation of strains that
produce FKBP analogues and recombinant cells in which cloned genes or gene cassettes are expressed to generate novel compounds
such as polyketide (especially rapamycin) FKBP-ligand analogues, and to processes foT their preparation, and to means employed
therein (e.g. nucleic acids, vectors, gene cassettes and genetically modified strains).

Documents:

02674-kolnp-2007-abstract.pdf

02674-kolnp-2007-claims.pdf

02674-kolnp-2007-correspondence others.pdf

02674-kolnp-2007-description complete.pdf

02674-kolnp-2007-drawings.pdf

02674-kolnp-2007-form 1.pdf

02674-kolnp-2007-form 2.pdf

02674-kolnp-2007-form 3.pdf

02674-kolnp-2007-form 5.pdf

02674-kolnp-2007-gpa.pdf

02674-kolnp-2007-sequence listing.pdf

2674-KOLNP-2007-(03-10-2012)-ANNEXURE TO FORM 3.pdf

2674-KOLNP-2007-(03-10-2012)-CORRESPONDENCE.pdf

2674-KOLNP-2007-(09-04-2012)-CORRESPONDENCE.pdf

2674-KOLNP-2007-(09-04-2012)-FORM 3.pdf

2674-KOLNP-2007-(15-11-2011)-ABSTRACT.pdf

2674-KOLNP-2007-(15-11-2011)-AMANDED CLAIMS.pdf

2674-KOLNP-2007-(15-11-2011)-AMANDED PAGES OF SPECIFICATION.pdf

2674-KOLNP-2007-(15-11-2011)-EXAMINATION REPORT REPLY RECEIVED.pdf

2674-KOLNP-2007-(15-11-2011)-FORM-1.pdf

2674-KOLNP-2007-(15-11-2011)-FORM-13.pdf

2674-KOLNP-2007-(15-11-2011)-FORM-2.pdf

2674-KOLNP-2007-(15-11-2011)-OTHER PATENT DOCUMENT.pdf

2674-KOLNP-2007-(15-11-2011)-OTHERS.pdf

2674-KOLNP-2007-CANCELLED PAGES.pdf

2674-KOLNP-2007-CORRESPONDENCE 1.1.pdf

2674-KOLNP-2007-CORRESPONDENCE.pdf

2674-KOLNP-2007-EXAMINATION REPORT.pdf

2674-KOLNP-2007-FORM 13.pdf

2674-KOLNP-2007-FORM 18.pdf

2674-KOLNP-2007-GPA.pdf

2674-KOLNP-2007-GRANTED-ABSTRACT.pdf

2674-KOLNP-2007-GRANTED-CLAIMS.pdf

2674-KOLNP-2007-GRANTED-DESCRIPTION (COMPLETE).pdf

2674-KOLNP-2007-GRANTED-DRAWINGS.pdf

2674-KOLNP-2007-GRANTED-FORM 1.pdf

2674-KOLNP-2007-GRANTED-FORM 2.pdf

2674-KOLNP-2007-GRANTED-FORM 3.pdf

2674-KOLNP-2007-GRANTED-FORM 5.pdf

2674-KOLNP-2007-GRANTED-SPECIFICATION-COMPLETE-1.pdf

2674-KOLNP-2007-GRANTED-SPECIFICATION-COMPLETE.pdf

2674-KOLNP-2007-MARKED UP COPY-1.pdf

2674-KOLNP-2007-MARKED UP COPY.pdf

2674-KOLNP-2007-OTHERS.pdf

2674-KOLNP-2007-PETITION UNDER RULE 137.pdf

2674-KOLNP-2007-PRIORITY DOCUMENT.pdf

2674-KOLNP-2007-REPLY TO EXAMINATION REPORT-1.pdf

2674-KOLNP-2007-REPLY TO EXAMINATION REPORT.pdf

2674-KOLNP-2007-SEQUENCE LISTING.pdf

« Previous Patent

Next Patent »

Patent Number

256239

Indian Patent Application Number

2674/KOLNP/2007

PG Journal Number

21/2013

Publication Date

24-May-2013

Grant Date

21-May-2013

Date of Filing

18-Jul-2007

Name of Patentee

BIOTICA TECHNOLOGY LIMITED

Applicant Address

CHESTERFORD RESEARCH PARK, LITTLE CHESTERFORD NR SAFFRON WALDEN, ESSEX CB10 1XL

Inventors:

#	Inventor's Name	Inventor's Address
1	GAISSER SABINE	CHESTERFORD RESEARCH PARK, LITTLE CHESTERFORD NR SAFFRON WALDEN, ESSEX CB10 1XL
2	GREGORY MATTHEW ALAN	CHESTERFORD RESEARCH PARK, LITTLE CHESTERFORD NR SAFFRON WALDEN, ESSEX CB10 1XL
3	PETKOVIC HRVOJE	CHESTERFORD RESEARCH PARK, LITTLE CHESTERFORD NR SAFFRON WALDEN, ESSEX CB10 1XL
4	MOSS STEVEN	CHESTERFORD RESEARCH PARK, LITTLE CHESTERFORD NR SAFFRON WALDEN, ESSEX CB10 1XL

PCT International Classification Number

C07K 14/36

PCT International Application Number

PCT/GB2003/003230

PCT International Filing date

2003-07-16

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1	0216509.0	2002-07-16	U.K.
2	0224922.5	2002-10-25	U.K.