Title of Invention	"TRANSFERRIN RECEPTOR ANTIBODIES"
Abstract	The invention provides further characterization of the disease and cancerassociated antigen, transferrin receptor.The invention also provide a novel family of antibodies that bind to the transferrin receptor, methods of diagnosing and treating various human cancers and diseases that express transferrin receptor.

Full Text

WO 2005/121179 PCT/US2005/020253 TRANSFERRIN RECEPTOR ANTIBODIES TECHNICAL FIELD [0001] This invention is in the fields of biology and immunotherapy More specifically, it concerns the disease and cancer-associated antigen transform receptor, and polyclonal and monoclonal antibodies and other polypeptides that bind to transferrin receptor The invention further provides the diagnosis and/or treament of a variety of human diseases and cancers associated with transferrin receptor using antagonists, inodulators and peptides that bind to transferrin receptor, including anti-transferrin receptor antibodies BACKGROUND OF THE INVENTION [0002] In addition to their known uses in diagnostics, antibodies have been shown to be useful as therapeutic agents For example, immunotherapy, or the use of antibodies for therapeutic purposes has been used in recent years to treat cancer Passive immunotherapy involves the use of monoclonal antibodies in cancer treaments. See for example, Cancer. Principles and Practice of Oncology, 6th Edition (2001) Chapt 20 pp 495-508 These antibodies can have inherent therapeutic biological activity both by direct inhibition of tumor cell growth or survival and by their ability to recruit the natural cell killing activity of the body's immune system These agents can be administered alone or in conjunction with radiation or chemotherapeutic agents Rituximab and Transtuzumab, approved for treament of non-Hodgkin's lymphoma and breast cancer, respectively, are two examples of such therapeutics Alternatively, antibodies can be used to make antibody conjugates where the antibody is linked to a toxic agent and directs that agent to the tumor by specifically binding to the tumor. Geintuzuinab ozogamicin is an example of an approved antibody conjugate used for the treament of leukemia. Monoclonal antibodies that bind to cancer cells and have potential uses for diagnosis and therapy have been disclosed in publications See, for example, the following patent applications which disclose, inter alia, some molecular weights of target proteins US Patent No 6,054,561 (200 kD c-erbB-2 (Her2), and other unknown antigens 40-200 KD in size) and U S. Patent No. 5,656,444 (50 kD and 55 kD oncofetal protein) Example of antibodies in clinical trials and/or approved for treament of solid tumors include Transtuzumab (antigen 180 kD, HER2/neu), Endrecolomab (antigen 40-50 kD, Ep-CAM), Anti-human milk fat globules (HMFG1) (antigen >200 kD, HMW 1 WO 2005/121179 PCT/US2005/0 20253 Mucin), Cetuximab (antigens 150 kD and 170 kD, EGF receptor), Alemtzumab (antigen 21-28 kD, CD52), and Rituximab (antigen 35 kD, CD20) [0003] The antigen targets of trastuzuinab (Her-2 receptor), which is used to treat breast cancer, and cetuximab (EGF receptor), which is in clinical trials for the treament of several cancers, are present at some detectable level on a large number of normal human adult tissues including skin, colon, lung, ovary, liver, and pancreas. The inargin of safety in using these therapeutics is possibly provided by the difference in the level of expression or in access of or activity of the antibody at these sites [0004] Another type of immunotherapy is active immunotherapy, or vaccination, with an antigen present on a specific cancer(s) or a DNA construct that directs the expression of the antigen, which then evokes the immune response in the individual, i e., to induce the individual to actively produce antibodies against their own cancer Active iininunization has not been used as often as passive immunotherapy or immunotoxins. [0005] Several models of disease (including cancer) progression have been suggested Theories range from causation by a single infective/transforming event to the evolution of an increasingly "disease-like" or 'cancer-like' tissue type leading ultimately to one with fully pathogenic or malignant capability some argue that with cancer, for example, a single mutational event is sufficient to cause maligancy, while others argue that subsequent alteration are also necessary some others have suggested that increasing mutational load and tumor grade are necessary for both initiation as well as progression of neoplasia via a continuuin of inutation-selection events at the cellular level some cancer targets are found only in tumor tissues, while others are present in normal tissues and are up regulated and/or over-expressed in tumor tissues In such situations, some researchers have suggested that the over-expression is linked to the acquisition of maligancy, while others suggest that the over-expression is merely amarker of a trend along a path to an increasing disease state [0006] An ideal diagnostic and/or therapeutic antibody would be specific for an antigen present on a large number of cancels, but absent or present only at low levels on any normal tissue The discovery, characterization, and isolation of a novel antigen that is specifically associated with cancer(s) would be useful in many ways First, the antigen could be used to make monoclonal antibodies against the antigen An antibody would ideally have biological activity against cancer cells and be able to recruit the immune system's response to foreign antigens An antibody could be administered as a therapeutic alone or in combination with current treaments or used to prepare immunoconjugates linked to toxic agents An antibody with the same specificity but with low or no biological activity when administered alone could also be useful in that an antibody could be used to prepare an immunoconjugate with a radio-isotope, a toxin, or a chemotherapeutic agent or hposome containing a 2 WO 2005/121179 PCT/US2005/020253 chemotherapeutic agent, with the conjugated form being biologically active by virtue of the antibody directing the toxin to the antigen-containing cells [0007] One aspect desirable for an ideal diagnostic and/or therapeutic antibody is the discovery and characterization of an antigen that is associated with a variety of cancers There are few antigens that are expressed on a number of types of cancer (e.g., "pan-cancer" antigen) that have limited expression on non-cancerous cells. The isolation and purification of such an antigen would be useful for making antibodies (e.g , diagnostic or therapeutic) targeting the antigen An antibody binding to the "pan-cancer" antigen could be able to target a variety of cancers found in different tissues in contrast to an antibody against an antigen associated with only one specific type of cancer The antigen would also be useful for drug discovery (e g , small molecules) and for further characterization of cellular regulation, growth, and differentiation [0008] Transferrin receptor is broadly expressed in human tumors (Gatter et al, Transferrin receptors in human tissues their distribution and possible clinical relevance, J Clin Pathol 36, 539-545 (1983)) and plays a key role in cell proliferation and survival. Antibodies that bind to the transferrin receptor have previously been shown to be efficacious in animal tumor models In a leukemia xenograft inodel using CCRF-CEM cells (White et al, Coinbinations of anti-transferrin receptor monoclonal antibodies inhibit human tumor cell growth in vitro and in vivo evidence for synergistic antiproliferative effects, Cancer Res 50, 6295-6301 (1990)) and in a M21 human inelanoina xenograft (Trowbndge & Doiningo, Anti-transferrin receptor monoclonal antibody and toxin-antibody conjugates affect growth of human tumor cells, Nature 294,171-373(1981)), tiansfernn receptor antibodies also inhibited tumor progression [0009] The transferrin receptor has been studied as a cancer target since the 1980s using naked antibodies, toxin conjugated antibodies and transferrin-toxin conjugates (see, e g., Griffin et al, combined antitumor therapy with the chemotherapeutic drug doxorubicin and an anti-transferrin receptor immunotoxin. In vitro and in vivo studies, J Immunol 11, 12-18 (1992); Qian et al , Targeted drug delivery via the transferrin receptor-mediated endocytosis pathway, pharmacological Reviews 54, 561-587 (2002), Trowbndge & Collin et al, Structure-function analysis of the human transferrin receptor Effects of anti-receptor monoclonal antibodies on tumor growth, Curr Stud Hematol Blood Txansf 58, 139-147 (1991)), including a phase I clinical trial with the murineIgA antibody 42/6 (Brooks et al., Phase la trial of murinenninuno globulin A antitransferrin receptor antibody 42/6, clin Cancer Res J, 1259-1265(3995)) Expression of the transferrin receptor is correlated with cell proliferation and it has been suggested that this accounts for the high proportion of tumors that stain positively with transferrin receptor antibodies and 3 WO 2005/121179 PCT/US2005/020253 limited staining of normal tissues (Gatter, 1983) It is generally accepted that transferrin receptor antibodies inhibit cell proliferation by reducing the uptake of non into the cell (Keinp, Iron deprivation and cancer a view beginning with studies of monoclonal antibodies against the transferrin receptor, Histol Histopathol 12,291-296, (1997)) This can be achieved by blocking the interaction of the transferrin receptor with iron-charged transferrin or by altering the dynamics of transferrin receptor cycling and cell surface presentation The effect of blocking iron uptake in tumor cells inanifests initially as a cell cycle arrest, primarily in S-phase followed by an accuinulation of G1 phase cells (White, 1990) The ultimate end pointof iron withdrawal appears to vary from cytostasis to the induction of cell death [0010] Rat denved antibody that recognizes the murine transfeinn receptor was tested in a syngeneic inouse leukemia inodel (Savage, et al,. Effects of monoclonal antibodies that block transferrin receptor Junction on the in vivo growth of a syngeneic murineleukemia, Cancer Res 47,741-753 (1987)) This molecule significantly iinproved survival relative to controls and there was no evidence of gross toxicity or evidence of dainage to normal tissues recognized by the antibody over a four week treament period. Additionally, there were no changes in erythrocyte or white blood cell countsJ However an analysis of bone marrow progenitor cells showed a two fold decrease in CFU-e /106 cells and a less pronounced reduction iri CFU-c. Additional insight into the effect(s)of blocking the transferrin receptor can be provided by evaluating the results of a phase I clinical trial that was performed using the inouse antibody 42/6 .In this study, there was evidence of inixed tumor responses, despite the short treament [course and poor pharmacokinetics of the inouse antibody (Brooks, 1995) An evaluation of patient's treated with 42/6 showed evidence of reduced marrow BFU-e after treament with the antibody, but the result was not statistically significant Because transferrin receptor has been shown to be expressed on differentiating bone marrow progenitor cells (Helin et al ,1 Characterization and phenotypic analysis of differentiating CD34+ human bone marrow cells in liquid culture, Eur J Haeinatol 59, 318-326 (1997)) it is desirable that a therapeutic agent incorporating an anti-transferrin receptor antibody have a potential therapeutic effect that outweighs the potential for bone marrow toxicity [0011] What is needed are novel targets on the surface of diseased and/or cancer cells that maybe used to diagnose and treat such diseases and/or cancers with antibodies and other agents which specifically lecoginze the cell surface targets. There exists a further need, based on the discoveries disclosed herein, for novel antibodies and other agents which specifically lecoginze targets on the surface of cells that can inodulate, either by reducing or enhancing, the disease-proinoting activities of transferrin receptor, It is an object of this 4 WO 2005/121179 PCT/US2005/020253 invention to identify antagonists of human transferrin receptor that are capable of inhibiting its disease-associated activities It is another object to provide novel coinpounds for use in the assay of transferrin receptor, and for use as immunogens or for selecting anti-human transferrin receptor antibodies [0012] As will be described in more detail below, the present inventors have discovered a novel epitope of the human transferrin receptor, identified as the antigen target of the novel antagonists, inodulators and antibodies provided herein. SUMMARY OF THE INVENTION [0013] The invention provides for transferrin receptor antagonists, inodulators, and monoclonal antibodies that bind to transferrin receptor, which is expressed on a variety of human cancers In one aspect, the invention is a fainily of monoclonal antibodies that bind to transferrin receptor. [0014] In another aspect, the invention is a monoclonal antibody anti-transferrin receptor that is produced by the host cell line CA130 3.13C9 1A7 deposited on 8 June 2004 at the Ainerican Type Culture Collection with a Patent Deposit Designation of PTA-6055 [0015] In yet another aspect, the invention is a method of generating monoclonal antibody anti-transferrin receptor reactive with diseased and/or cancerous cells comprisingthe steps of: (a) iininunizing a host inaininal with an immunogen; (b) obtaining lyinphocytes from the inaininal, (c) fusing lyinphocytes (b) with a myeloma cell line to produce a hybndorna, (d) culturing the hybridoma of (c) to produce monoclonal antibodies, and (e) screening the antibodies to select only those antibodies which bind to diseased and/or cancerous cells or cell lines but do not bind to non-cancerous or normal cells or cell lines, or bind to normal cells at a lower level or in a different fashion [0016] In another aspect, the invention is a method of generating an anti"transferrin receptor antibody comprising culturing a host cell encoding such antibody or progeny thereof under conditions that allow production of the antibody, and purifying the anti-transferrin receptor antibody. [0017] In another aspect, the invention provides methods of generating any of the antibodies (or polypeptides) descnbed herein by expressing one or more polynucleotides encoding the antibody (which maybe separately expressed as a single light or heavy chain, or boin a light and a heavy chain are expressed from one vector) in a suitable cell, generally followed by recovenng and/or isolating the antibody or polypeptides of interest [0018] In another aspect, the invention is an anti-transferrin receptor antibody or a polypeptide (which mayor maynot be an antibody) that competitively inhibits preferential binding of an anti-transferrin receptor antibody to transferrin receptor In some 5 WO2005/121179 PCT/US2005/020253 embodiments, the invention is an antibody or a polypeptide (which mayor maynot be an antibody) that binds preferentially to the same epitope(s) on transferrin receptor as the LUCA31 antibody [0019] In another aspect, the invention is an transferrin receptor inodulator (which mayor maynot be a polypeptide) that competitively inhibits preferential binding of an anti-transferrin receptor antibody to transferrin receptor In some embodiments, the invention can be a small molecule or cheinical coinpound that binds preferentially to the same or different epitope(s) on transferrin receptor as other anti-transferrin receptor antibodies {0020] In yet another aspect, the invention is a composition comprising transferrin receptor bound by an antibody specific for an epitope of transferrin receptor In one embodiment, the antibody is anti-transferrin receptor In other embodiments, two or more anti-transferrin receptor antibodies are administered, with such antibodies mapping to two or more different epitopes of transferrin receptor In some embodiments, the anti-transferrin receptor antibody is linked to a therapeutic agent or a detectable label [0021] In another aspect, the invention is an antibody comprising a fragment or a region of a LUCA31 antibody In one embodiment, the fragment is a light chain of the antibody In another embodiment, the fragment is a heavy chain of the antibody In yet another embodiment, the fragment contains one or more variable regions from a light chain and/or a heavy chain of the antibody In yet another embodiment, the fragment contains one or more complementarity determining regions (CDRs) from a light chain and/or a heavy chain of the antibody [0022] In another aspect, the invention provides polypeptides comprising any of the following, a) one or more CDRs (or fragments thereof) from the light or heavy chain, b) three CDRs from the light chain; c) three CDRs from the heavy chain; d) three CDRs from the light chain and three CDRs from the heavy chain, e) the light chain variable region; f) the heavy chain variable region of the anti-transferrin receptor antibody In preferred embodiments, these polypeptides are selected from sequences of the LUCA31 antibody [0023] In another aspect, the invention is a humanized antibody In some embodiments, the humanized antibody comprises one or more CDRs of a non-human anti-transferrin receptor antibody In some embodiments, the humanized antibody binds to the same or different epitope(s) as other LUCA31 Generally, a humanized antibody of the invention comprises one or more (one, two, three, four, five, six, or fragments thereof) CDRs which are the same and/or derived from the CDR(s) of the original non-human anti-transferrin receptor antibody In some embodiments, the human antibody binds to the same or different epitope(s) as other anti-transferrin receptor antibodies In another aspect, the invention is a chimeric antibody comprising variable regions derived from variable regions of a heavy 6 WO 2005/121179 PCT/US2005/020253 chain and a light chain of a non-human anti-transferrin receptor antibody and constant regions derived from constant regions of a heavy chain and a light chain of a human antibody. [0024] In another aspect, the invention is an isolated polynucleotide that encodes an antibody LUCA31 that is produced by a host cell with a deposit number of ATCC No. PTA-6055, or progeny thereof This invention encoinpasses antibody polypeptides having the inherent binding or biological activities of any of the above-specified antibodies In another aspect, the invention provides polynucleotides encoding any of the antibodies (including antibody fragments) as well as any other polypeptides described herein. [0025] In another aspect, the invention is a pharmaceutical composition comprising any of the polypeptides (including any of the antibodies described herein) or polynucleotides descnbed herein, such as pharmaceutical compositions comprising an anti-transferrin receptor antibody linked to a chemotherapeutic agent, an antibody comprising a fragment of an anti-transferrin receptor antibody, a humanized antibody of a non-human anti-transferrin receptor antibody, a chimeric antibody comprising variable regions derived from variable regions of a non-human anti-transferrin receptor antibody and constant regions derived from constant regions of a human antibody, or a human antibody with one or more properties of a non-human anti-transferrin receptor antibody, or any of the anti-transferrin receptor antibody descnbed herein linked to a chemotherapeutic agent (such as a radioactive morety), and a pharmaceuticallyacceptable excipient [0026] In one aspect, the invention is a composition comprising an anti-transferrin receptor antibody bound to transferrin receptor present on a diseased or cancerous cell. In preferred embodiments, the cancer cell is selected from the group consisting of ovarian, lung, prostate, pancreatic, colon, and breast cancer cells In some embodiments, the cancer cell is isolated In some embodiments, the cancer cell is in a biological sample. Generally, the biological sample is from an individual, such as a human. [0027] In another aspect, the invention is a method of diagnosing disease in an individual by detecting transferrin receptor on cells from the individual, particularly diseases or disorders associated with inflamatory or autoimmuneresponses in individuals In other aspects of the invention, methods are provided for inodulating inflamatory or autoimmuneresponses in individuals Diseases and conditions resulting from inflamation and autoimmunedisorders that maybe subject to treament using the compositions and methods of the invention include, by way of illustration and not of limitation, multiple sclerosis, ineningitis, encephalitis, stroke, other cerebral trauinas, inflamatory bowel disease including ulcerative colitis and Crohn's disease, inyasthenia gravis, lupus, rheuinatord arthritis, asthina, acute juvenile onset diabetes, AIDS deinentia, atherosclerosis, nephritis, 7 WO 2005/121179 PCT/US2005/020253 retinitis, atopic derinatitis, psoriasis, myocardial isichemiaand acute leukocyte-mediated lung injury The antibodies of this invention find applicability in administration to individuals in need of treament for such conditions [0028] Still other indications for therapeutic use of antibodies and other therapeutic agents of the invention include administration to individuals at risk of organ or graft rejection Over recent years there has been a considerable iinproveinent in the efficiency of surgical techniques for transplanting tissues and organs such as skin, kidney, liver, heart, lung, pancieas and bone marrow Perhaps the principal outstanding problem is the lack of satisfactory agents for inducing immunotolerance in the recipient to the transplanted allograft or organ When allogeneic cells or organs are transplanted into a host (i.e , the donor and donee are different individuals from the same species), the host immune system is likely to inount an immune response to foreign antigens in the transplant (host-versus-graft disease) leading to destruction of the transplanted tissue The antibodies of this invention find applicability in administration to individuals at risk of organ or graft rejection [0029] In another aspect, the invention is a method for diagnosing whether an individual has cancer, comprising determining whether there is expression of transferrin receptor on selected cells from the individual, wherein the expression of transferrin receptor on said cells is indicative of said cancer. In some embodiments, the expression of transferrin receptor is deterinined using an anti-transferrin receptor antibody. In some embodiments, the method involves detecting the level of transferrin receptor expression from cells The term "detection" as used herein includes qualitative and/or quantitative detection (ineasuring levels) with or without reference to a control [0030] In yet another aspect, the invention is a method of diagnosing cancer in an individual by detecting transferrin receptor on or released from cells from the individual, wherein the cancer is selected from the group including but not limited to adrenal gland tumors, AIDS-associated cancers, alveolar soft part sarcoina, astrocytic tumors, bladder cancer (squainous cell carcmomna and transitional cell carcmomna), bone cancer (adainantinoina, aneurysinal bone cysts, osteochondroina, osteosarcoma), brain and spinal cord cancers, inetastatic brain tumors, breast cancer, carotid body tumors, cervical cancel, chondrosarcoina, chordoina, chroinophobe renal cell carcmomna, clear cell carcmomna, colon cancer, colorectal cancel, cutaneous benign fibrous histiocytoinas, desinoplastic small round cell tumors, ependyinoinas, Ewing's tumors, extraskeletal inyxord chondrosarcoina, fibrogenesis imperfecta ossium, fibrous dysplasia of the bone, gallbladder and bile duct cancers, gestational trophoblastic disease, gerin cell tumors, head and neck cancers, islet cell tumors, Kaposi's sarcoina, kidney cancer (nephroblastoina, papillary renal cell] carcmomna), leukemias, hpoma/beingn lipoinatous tumors, hposarcoina/maligant hpoinatous tumors, 8 WO 2005/121179 PCT/US2005/020253 liver cancer (hepatoblastoina, hepatocellular carcmomna), lymphomas, lung cancer, inedulloblastoina, inelanoma, menmgiomas, multiple endocnne neoplasia, multiple myeloma, myelodysplastic syndroine, neuroblastoina, neuroendocnne tumors, ovarian cancer, pancreatic cancels, papillary thyroid carcmomnas, parathyroid tumors, pediatnc cancers, peripheral nerve sheath tumors, phaeochroinocytoina, pituitary tumors, prostate cancer, uveal or intraocular inelanoina, rare heinatologic disorders, renal inetastatic cancer, rhabdord tumor, rhabdoinysarcoina, saicoinas, skin cancer, soft-tissue sarcoinas, squainous cell cancer,stomach cancer, synovial sarcoina, testicular cancer, thymic carcmomna, thymoma, thyroid inetastatic cancer, and uterine cancers (carcmomna of the cervix, endoinetrial carcmomna, and leiomyoma)1[0031] In another aspect, the invention as a method for aiding diagnosis of cancer (such as but not limited to ovarian, lung, prostate, pancreatic, colon, or breast cancer) in an individual comprising determining the expression of transferrin receptor in a.biological sample from the individual In some embodiments, the expression of transferrin receptor is deterinined using an anti-transferrin receptor antibody. In some embodiments, the method is detecting the level of transferrin receptor expression from cells. The transferrin receptor released from the cancer maycontribute to elevated levels of transferrin receptor or a portion thereof, being detectable in body fluids (e g , blood, salivary or gut inucinous secretions). [0032] In yet anothei aspect, the invention is a method of treating cancer by adininistenng an effective amount of an antibody that binds to transferrin receptor sufficient to reduce growth of cancerous cells In some embodiments, the antibody is an anti-transferrin receptor antibody In certain embodiments, the cancerous cells are selected from the group including but not limited to adrenal gland tumors, AIDS-associated cancers, alveolar soft part saicoina, astrocytic tumors, bladder cancer (squainous cell carcmomna and transitional cell carcmomna), bone cancer (adainantinoina, aneurysinal bone cysts, osteochondroina, osteosarcoina), brain and spinal cord cancers, inetastatic brain tumors, breast cancer, carotid body tumors, cervical cancel, chondrosaicoina, chordoina, chroinophobe renal cell carcmomna, clear cell carcmomna, colon cancer, colorectal cancer, cutaneous benign fibrous histiocytoinas, desinoplastic small round cell tumors, ependyinoinas, Swing's tumors, extraskeletal inyxord chondrosarcoina, fibrogenesis imperfecta ossium, fibrous dysplasia of the bone, gallbladder and bile duct cancers, gestational trophoblastic disease, gerin cell tumors, head and neck canceis, islet cell] tumors, Kaposi's sarcoina, kidney cancer (nephioblastoina, papillary renal cell carcinoma), leukerinas, hpoina/beingn hpoinatous tumors, hposarcoina/maligant hpoinatous tumors, liver cancer (hepatoblastoina, hepatocellular carcinoma)Iyinphoinas, lung cancer, inedulloblastoina, inelanoina, ineningioinas, multiple endocnne neoplasia, multiple myeloma, myelodysplastic syndroine, 9 WO 2005/121179 PCT/US2005/020253 neuroblastoina, neuroendocnne tumors, ovarian cancer, pancreatic cancers, papillary thyroid carcmomnas, parathyroid tumors, pediatric cancers, peripheral nerve sheath tumors, phaeochroinocytoina, pituitary tumors, prostate cancer, uveal or intraocular inelanoina, rare heinatologic disorders, lenal inetastatic cancer, rhabdord tumor, rhabdoinysarcoina, sarcoinas, skin cancer, soft-tissue sarcoinas, squainous cell cancer,stomach cancer, synovial sarcoina, testicular cancer, thymic carcmomna, thymoma, thyroid inetastatic cancer, and uterine cancers (carcmomna of the cervix, endoinetrial carcmomna, and leiomyoma) In certain preferred embodiments, the cancerous cells are selected from the group of solid tumors including but not limited to breast cancer, colon cancer, prostate cancer, lung cancer, sarcoina, renal inetastatic cancer, thyroid inetastatic cancer, and clear cell carcmomna [0033] In yet another aspect, the invention is a method of delaying developinent of inetastasis in an individual having cancer comprising administering an effective amount of at least one of a fainily of antibodies that bind specifically to transferrin receptor In one embodiment, the antibody is an anti-transferrin receptor antibody In another aspect, the invention is a method of inhibiting growth and/or proliferation of cancer cells in vitro or in an individual comprising administering an effective amount of a composition comprising an anti-transferrin receptor antibody associated with (including linked to) a chemotherapeutic agent to the cell culture or sample, or to the individual. [0034] In yet another aspect, the invention is a method of delivering a therapeutic agent to a cancerous cell in an individual by administering to the individual an effective amount of at least one ineinber of a fainily of antibodies, which bind specifically to transferrin receptor In other embodiments, an anti-transferrin receptor antibody is delivered to an individual in combination with (including linked to) another therapeutic agent [0035] In some embodiments, the anti-transferrin receptor antibody is a humanized antibody derived from a nained antibody herein (generally, but not necessarily, comprising one or more partial or intact CDRs of the antibody) In some embodiments, the anti- transferrin receptor antibody is a human antibody with one or more properties of the nained antibody In some embodiments, the chemotherapeutic agent (such as a toxin or a radioactive molecule) is delivered into the cancer cells (is internalized). In some embodiments, the agent is saponn. [0036] In another aspect, the invention is a method of treating cancer in an individual comprising administering an effective amount of a composition comprising an anti-transferrin receptor antibody associated with (including linked to) a chemotherapeutic agent to the individual [0037] The present invention further provides methods for inodulating, either by enhancing or reducing, the association of transferrin receptor with a cytoplasmic signaling partner 10 WO 2005/121179 PCT/US2005/020253 The association of transferrin receptor with a cytoplasmic signaling partner can be iinpacted by contacting a transferrin receptor molecule presenting on a cell surface, with an agent that inodulates the binding of the signaling partner to transferrin receptor Agents which block or reduce transferrin receptor association with its binding and/or signaling partners can be used to inodulate biological and pathological processes which are involved in transferrin receptor-mediated inflamation or immune responses Pathological processes involving this action include tumor-associated cell growth. [0038] Agents can be tested for their ability to block, REDUCE, enhance or otherwise inodulate i the association of transferrin receptor with a binding partner, such as an anti-transferrin receptor antibody. Specifically, an agent can be tested for the ability to inodulate such an interaction by incubating a peptide comprising the transferrin receptor interaction site (typically in its native conformation as it exists on intact living cells) with a binding partner and a test agent, and determining whether the test agent reduces or enhances the binding of the binding partnei to the transferrin receptor peptide [0039] Agonists, antagonists, and other inodulators of transferrin receptor function are expressly included within the scope of this invention These agonists, antagonists and inodulators are polypeptides that comprise one or more of the antigeruc deterininant sites in transferrin receptor, or comprise one or more fragments of such sites, vanants of such sites, or peptidomimetics of such sites These agonistic, antagonistic, and transferrin receptor inodulatory coinpounds are provided in linear or cyclized form, and optionally comprise at least one amino acid residue that is not coininonly found in nature or at least one ainide isostere These coinpounds maybe glycosylated The agonists, antagonists, and other inodulators of transferrin receptor function of this invention are desirably used in all of the embodiments and methods described above with reference to antibodies [0040] Other aspects of this invention relate to the novel epitope of the transferrin receptor identified and referredto herein as the antigen for the LUCA31 antibody This antigen is suitable for use as an immunogen and for a variety of research, diagnostic and therapeutic purposes [0041] In certain aspects, the invention is a method for arding in the diagnosis of disease in an individual comprising the steps of (I) assaying for the presence of transferrin receptor in a blood or tissue sample obtained from an individual, (n) detecting whether said sample has an increased amount of a transferrin receptormarker relative to a normal (non-diseased) blood or tissue sample, and (m) correlating an increased amount of saidmarker to a positive diagnosis or correlating the absence of an increased amount of said marker to a negative diagnosis for disease In certain embodiments, themarker is detected using an anti-transferrin receptor antibody In certain embodiments, the method is effected by a 11 WO 2005/121179 PCT/US2005/0 20253 technique selected from the group consisting of radionuclide iinaging, flow cytoinetry, and immunohistochemistry BRIEF DESCRIPTION OF THE DRAWINGS [0042] Figure 1 shows an lininunoprecrpitation using LUCA31 monoclonal antibody on SW480 cell lysates, followed by a western blot using LUCA31 monoclonal antibody and visualized using ECL+ detection system (Ainershain) [0043] Figure 2 shows LUCA31 (shaded) and EGF (white) receptor antibody staining of 32 cell line FACS array [0044] Figure 3 shows that LUCA31 does not bind to a sample of purified transferrin receptor Arrow indicates the position of transferrin receptor in the gel [0045] Figure 4 shows an analysis of LUCA31 binding to HCT15 cells in the presence of known transferrin receptor antibodies [0046] Figure 5 shows FACS analysis of CHO cells using LUCA31 Cells were txansfected with pDEF vector alone (left panel) or pDEF vector containing the human transferrin receptor (right panel) [0047] Figure 6A shows the effect of transferrin on LUCA31 binding to HCT15 cells Figure 6B shows the effect of LUCA31 on transferrin binding to HCT15 cells. {0048} Figure 7 shows the results of cheinotherapy combination'studies using paclitaxel alone or a combination of pachtaxel and 5ug/inl LUCA31 antibody - Cell proliferation was ineasured by tntiated thyrindine incorporation [0049] Figure 8 shows the effect of lOOug/inl transferrin on the activity of LUCA31 and 42/6 in HCT15 (A), HCT116 (B) and LOVO (C) cells [0050] Figure 9 shows the effect of 5ug/inl LUCA31 on HCT15 cell cycle progression DNA content of treated and control cells was deterinined by propidiuin Arrows indicate areas of histogiain indicative of S-phase anest and cell death. [0051] Figure 10 shows the activity of LUCA31 in a human tumor cell line panel Figure 10A shows FACS analysis of LUCA31 binding to cell lines denved from breast and prostate cancers Data is plotted as a function of inean fluorescent intensity and EGFR staining is included as a standard. Figure 10B shows inaxiinuin activity of LUCA31 (ineasured in 0 5% seruin) in breast and prostate cancer cell lines. Data values represent the inaxiinuin inhibition of cell proliferation observed using a five-pointdose titration of antibody between lOug/inl and 0 6ug/inl. [0052] Figure 11 shows the activity of LUCA31 in a human hematological tumor cell line panel Figure 11A shows FACS analysis of LUCA31 binding to cell lines denved from 12 WO 2005/121179 PCT/US 2005/020253 hematological cancer lines Figure 11B shows inaxiinuin activity of LUCA31 (measured in 0 5% seruin) in hematological cancer lines [0053] Figure 12A is a giaph showing the in vitro activity of LUCA31 on the growth of 786-0 cell] line Figure 12B is a giaph showing the in vitro activity of LUCA31 on SKMES-1 cell line Figure 2C is a graph showing the in vitro activity of LUCA31 on SKBR3 cell line. Figuie 2D is a graph showing the in vitro activity of LUCA31 on Colo205 cell line [0054] Figure 13 is a graph showing the effect of 1AJCA31 and Mab-ZAP (an anti-IgG conjugate to saponn) on the growth of human colon carcmomna cell line Colo205 [0055] Figure 14 shows the effect of LUCA31 on leukocyte proliferation LUCA31 and the control IgGl antibody 1B7 11 were coinpared in a normal human leukocyte prolifeiation assay Cells were stiinulated using PHA and effects on cell proliferation deterinined by tntiated thyinidine incorporation Data is plotted as a function of percent inhibition (relative to no-antibody control) relative to antibody concentration [0056] Figure 15 shows the effect of LUCA31 on CD34+ bone marrow progenitor cells. LUCA31 and the control IgGl antibody 1B7 11 were coinpared in a cell proliferation assay using two seeding densities of bone marrow progenitor cells [0057] Figure 16 shows the effect of LUCA31 on HCT15 tumor growth. Figure 16A shows inedian tumor voluine ineasureinents Figuie 16B shows inean tumor voluine ineasureinents, with error bars For each experiinental group, data is plotted until the first animal presents with a tumor greater than 1000inin3 DETAILED DESCRIPTION OF THE INVENTION [0058] The invention provides a novel epitope of the human transferrin receptor (referred to herein as theLUCA3l epitope), which is expressed on cancerous cells of various tissue types, including but not limited to breast, colon, lung, and prostate cancers Further, the invention provides monoclonal antibodies and polypeptides that bind to this transferrin receptor epitope and methods making and using these antibodies and polypeptides to diagnose and treat various diseases human cancers associated with expression and/or over-expression of transferrin receptor [0059] One issue that has been raised with previous transferrin receptor antibodies arises from ine relatively widespread profile of tissue distribution of the epitope to which these antibodies bind. The present invention relates to an antibody, herein sometiines referred to as the LUCA31 antibody,that has robustanti-proliferative activity in many solid tumor cell lines The LUCA31 antibody has been found to bind to an epitope on the human 13 WO 2005/121179 PCT/US2005/020253 transferrin receptor that shows a unique and more limited normal tissue distribution than other transferrin receptor antibodies Staining of brain endothehuin, a tissue normally ennched in transferrin receptor (see e.g., Jeffenes et al, Transfeinn receptor on endothehuin of brain capillaries, Nature 572, 162-163 (1984), Orte, et al, A comparision of blood-brain hairier and blood-nerve barrier endothelial cell inarkers, Anat Einbryol 199, 509-517 (1999), Rothenberger et al., Corncident expression and distribution of inetanotransferrin and transfer) in receptor in human brain capillary endothehuin, Brain Res 712.117-121(1996)), shows very limited reactivity with LUCA31 The pancreas, including islet cells, has been shown to stain positively with transferrin receptor antibodies (Gattei, 1983), but we have seen limited pancreatic tissue staining with LUCA31 Additionally, published data shows transferrin receptor is present in both Kupfer cells and hepatocytes within the liver (Garter, 1983), however analyses with LUCA31 did not show liver tissue staining Taken together, the robust activity and unique tissue distribution profile of the LUCA31 epitope provides rationale that LUCA31 and related antibodies are distinct from other transferrin receptor antibodies and mayprovide a significant therapeutic and coininercial advantage I General Techniques [0060] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recoinbinant techniques), inicrobiology, cell biology, biocheinistry and iininunology, which are within the skill of the art Such techniques are explained fully in the literature, such as, Molecular Cloning A Laboratory Manual, second edition (Sainbrook et al, 19S9) Cold Spring Harbor Press, Ohgonucleotide Synthesis (M J Gait, ed , 1984), Methods in Molecular Biology, Huinana Press, Cell Biology A Laboratory Notebook (J E Celhs, ed , 1998) Acadeinic Press, Aniinal Cell Culture (RI Freshney, ed , 1987), Inn oductwn to Cell and Tissue Culture (J.P Mather andPE Roberts, 1998) Plenuin Pi ess, Cell and Tissue Culture Laboratory Procedures (A Doyle, J.B. Griffiths, and D G. Newell, eds., 1993-8) J Wiley and Sons, Methods in Enzyinology (Acadeinic Press, Inc), Handbook of Experiinental Immunology (D M Weir and C C Blackwell, eds ), Gene Transfer Vectors for Maininalian Cells (J M Miller and M P Calos, eds , 1987), Current Protocols in Molecular Biology (F.M Ausubel et al., eds , 1987), PCR. The Polyinerase Chain Reaction, (Mullis et al, eds , 1994); Current Protocols in Immunology (J.E Cohgan et al., eds , 1991), Short Pi otocols in Moleculai Biology (Wiley and Sons, 1999), Iininunobiology (C.A. Janeway and P. Travers, 1997), Antibodies (P Finch, 1997); Antibodies a practical approach (D Catty , ed , IRL Press, 1988-1989); Monoclonal antibodies a practical approach (P Shepherd and C 14 WO 2005/121179 PCT/US2005/020253 Dean, eds , Oxford University Press, 2000); Using antibodies a laboratory inanual (E Harlow and D Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M Zanetti and J D Capra, eds , Harwood Acadeinic Publishers, 1995), and Cancer- Principles and Practice of Oncology (V T DeVita et al, eds , J B Lippincott Coinpany, 1993) // Definitions [0061] "Transfeinn receptor" refers to that polypeptide antigen with a molecular weight of approxiinately 90kD to lOOkD against which the antibodies of the present invention are directed The transferrin receptor is a cell surface protein bound by anti-transferrin receptor antibodies and present on several normal tissues including colon and duodenuin and several types of carcmomnas. This antigen mayhave more than one different epitope The novel epitope of the human transferrin receptor to which the antibody LUCA31 binds is referred to heiein as the LUCA31 epitope, and is of particular interest in this invention It is currently believed that transferrin receptor, and the LUCA31 epitope, maybe over-expressed in certain cancer cells in comparision to their normal tissue counterparts In certain embodiments, references generally to characteristics of the transferrin receptor are intended to refer specifically [0062] Agonists, antagonists, and other inodulators of transferrin leceptor function are expiessly included within the scope of this invention These agonists, antagonists and inodulators are polypeptides that coinpnse one or more of the antigeinc deterininant sites in transferrin receptor, or coinpnse one or more fragments of such sites, variants of such sites, or peptidomimetics of such sites These agonistic, antagonistic, and transferrin receptor inodulatory coinpounds are provided in linear or cyclizedform, and optionally coinpnse at least one amino acid residue that is not coininonly found in nature or at least one ainide isostere These coinpounds maybe glycosylated [0063] More specifically, the term "transferrin receptor inodulator" as used herein is defined as any coinpound that (1) is capable of disrupting or blocking the interaction between human transferrin receptor and its native ligands or an anti-transferrin receptor antibody, (2) is capable of binding to human transferrin receptor and its native ligands or an anti-transferrin receptor antibody; (3) contains an antigeinc site that can be used in the raising of antibodies capable of binding to human transferrin receptor and its native ligands or an anti-transferrin receptor antibody, (4) contains an antigeinc site that can be used in the screening of antibodies capable of binding to human transferrin receptor and its native ligands or an anti-transferrin receptor antibody, (5) contains an antigenic site that an be used in the raising of antibodies capable of disrupting or blocking the interaction between human transferrin receptor and its native ligands or an anti-transferrin receptor antibody, (6) 15 WO 2005/121179 PCT/US2005/020253 contains an antigenic site that can be used in the screening of antibodies capable of disrupting or blocking the interaction between human transferrin receptor and its native ligands or an anti-transferrin receptor antibody transferrin receptor inodulators maybe "transferrin receptor agonists" 01 "transferrin receptor antagonists" depending on whether their activity enhances or inhibits normal transferrin receptor biological activity, respectively [0064] Transferrin receptor agonists, antagonists and inodulators include transferrin receptor variants, transferrin receptor peptide antagonists, peptidommetics, and small molecules, anti-transferrin receptor antibodies and Iininunoglobulin variants, amino acid variants of human transferrin receptor including amino acid substitution, deletion, and addition vanants, or any combination thereof, and chimeric iininunoglobulins The transferrin receptor agonists, antagonists and inodulators of this invention are based on the inventors' identification of the transferrin receptor doinains involved in the binding of human transferrin receptor to its native ligands or anti-transferrin receptor antibodies Thus, the invention provides transferrin receptor agonists, antagonists and inodulators with molecular structures that duplicate or iniinic one or more of the anti-transfernn receptor binding doinains of human transferrin receptor. [0065] As used herein, the term "transferrin receptor vanant" denotes any amino acid vanant of human transferrin receptor, including amino acid substitution, deletion, and addition vanants, or any combination thereof. The definition encoinpasses chimeric molecules such as human transferrin receptor/non-human chiineras and other hybnd molecules Also included in the definition is any fragment of a transferrin receptor variant molecule that coinpnses the vanant or hybrid region(s) of the molecule [0066] An "antibody" is an immunoglobulin molecule capable of specific binding to a target, such as a carbohydrate, polynucleotide, lipid, polypeptide, etc , through at least one antigen recognition site, located in the vanable legion of the immunoglobulin molecule As used herein, the term encoinpasses not only intact polyclonal or monoclonal antibodies, but also fragments theieof (such as Fab, Fab', F(ab')2, Fv), single chain (ScFv), inutants thereof, naturally occurring vanants, fusion proteins comprisingan antibody portion with an antigen recognition site of the lequrred specificity, humanized antibodies, chimeric antibodies, and any other inodified configuration of the immunoglobulin molecule that coinpnses an antigen recognition site of the required specificity. [0067] A "monoclonal antibody" refers to a hoinogeneous antibody population wherein the monoclonal antibody is comprised of amino acids (naturally occurring and non-naturally occurring) that are involved in the selective binding of an antigen Monoclonal 16 WO 2005/121179 PCT/US2005/020253 antibodies are highly specific, being directed against a single antigenic site The term "monoclonal antibody" encoinpasses not only intact monoclonal antibodies and full-length monoclonal antibodies, but also fragments thereof (such as Fab, Fab', F(ab')2,Fv), single chain (ScFv), inutants thereof, fusion proteins comprising an antibody portion, humanized monoclonal antibodies, chimeric monoclonal antibodies, and any other inodified configuration of the lininunoglobuhn molecule that comprises an antigen recognition site of the lequired specificity and the ability to bind to an antigen It is not intended to be limited as legards to the source of the antibody or the inanner in which it is inade (e g , by hybudoina, phage selection, recoinbinant expression, transgenic animals, etc) The term includes whole iininunoglobulxns as well as the fragments etc described above under the definition of "antibody" [0068) "Huinanized" antibodies refer to a chimeric molecule, generally prepared using recoinbinant techniques, having an antigen binding site derived from an iininunoglobuhn from a non-human species and the reinaining lininunoglobulrn structure of the molecule based upon the structure and/or sequence of a human immunoglobulin The antigen-binding site maycomprise either coinplete variable doinains fused onto constant doinains or only the complementarity determining legions (CDRs) grafted onto appropriate frainework regions in the variable doinains Antigen binding sites maybe wild type or inodified by one or more arruno acid substitutions. This eliininates the constant region as an immunogen in human individuals, but the possibility of an immune response to the foreign variable region xeinains (LoBuglio, A F etal, (1989) Proc Natl Acad Sci USA 86 4220-4224) Another appioach focuses not only on providing human-derived constant regions, but inodifying the vanable regions as well so as to reshape thein as closely as possible to human form It is Icnown that the variable regions or both heavy and light chains contain three complementarity-determining regions (CDRs) which vary in response to the antigens in question and deterinine binding capability, flanked by four frainework regions (FRs) which are relatively conserved in a given species and which putatively provide a scaffolding for the CDRs When nonhuman antibodies are prepared with respect to a particular antigen, the variable legions can be "reshaped" or "humanized" by grafting CDRs derived from nonhuman antibody on the FRs present in the human antibody to be inodified Application of this approach to various antibodies has been reported by Sato, K ,etal, (1993) Cancer Res 53 851-856 Riechinann, L , et ah, (1988) Nature 332 323-327; Verhoeyen, U,etal, (3988) Science 239 1534-1536; Kettleborough, C A,etal, (1991) Protein Engineering 4 773-3783, Maeda, H ,etal, (1991) Huinan Antibodies Hybndoina 2 124-134, Gorinan, S. D., et al, (1991) Proc Natl Acad Sci USA 88-4181-43 85; Teinpest, P R , etal, (1991) Bio/Technology 9 266-271, Co, M S,etal, (1993) Proc Natl Acad Sci USA 88 2869- 17 WO 2005/123379 PCT/US2005/020253 2S73, Carter, V,eta£, (1992) Proc Natl Acad Sci USA 89 4285-4289, and Co, M S et ai, (1992) J Immunol 148-1149-1154 In some embodiments, humanized antibodies pieserve all CDR sequences (for example, a humanized inouse antibody which contains all six CDRs from the inouse antibodies) In other embodiments, humanized antibodies have one or more CDRs (one, two, three, four, five, six) which are altered with respect to the original antibody, which are also terined one or more CDRs "derived from" one or more CDRs from the original antibody [0069] An epitope that "specifically binds" or "preferentially binds" (used interchangeably herein) to an antibody or a polypeptide is a term well understood in the ait, and methods to deterinine such specific or preferential binding are also well known in the art A molecule is said to exhibit "specific binding" or "pieferential binding" if it reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular cell or substance than it does with alternative cells or substances An antibody "specifically binds" or "preferentially binds" to a target if it binds with greater affinity, avidity, more readily, and/or with greater duration than it binds to other substances For example, an antibody that specifically or preferentially binds to a tiansferrin receptor epitope is an antibody that binds this transferrin receptor epitope with greater affinity, avidity, more readily, and/or with gieater duration than it binds to other transferrin receptor epitopes or non-transferrin receptor epitopes It is also understood by reading this definition that, for example, an antibody (or morety or epitope) that specifically or preferentially binds to a first target mayor maynot specifically or preferentially bind to a second target As such, "specific binding" or "pieferential binding" does not necessarily require (although it can include) exclusive binding Generally, but not necessarily, reference to binding ineans preferential binding [0070] The term "iininunologically active" in reference to an epitope being or "reinaining iininunologically active" refers to the ability of an antibody (e g , anti-transferrin receptor antibody) to bind to the epitope under different conditions, for example, after the epitope has been subjected to reducing and denaturing conditions [0071] Different biological functions are associated with anti-transferrin receptor antibodies, including, but not limited to, ability to bind to transferrin receptor (including transferrin receptor on cancer cells, including but not limited to ovarian, prostate, pancreatic, lung, colon, or breast cancer cells), ability to bind to a portion of transferrin receptor that is exposed on the surface of a living cell in vin o or in vivo; ability to deliver a chemotherapeutic agent to cancerous cells (such as ovarian, prostate, pancieatic, lung, colon, or breast cancer cells) expressing transferrin receptor; ability to deliver a therapeutic agent or detectablemarker into cancer cells expressing transferrin receptor As discussed herein, 18 WO 2005/121179 PCT/US2005/020253 polypeptides (including antibodies) of the invention mayhave any one or more of these characteristics [0072] An "anti-transferrin receptor equivalent antibody" or "anti-transferrin receptor equivalent polypeptide" lefers to an antibody or a polypeptide having one or more biological functions associated with an anti-transferrin receptor antibody, such as, for example binding specificity. [0073] As used herein, "agent" refers to a biological, pharmaceutical, or cheinical coinpound Non-liiniting examples include siinple or coinplex organic or inorganic molecule, a peptide, a protein, an okgonucleotide, an antibody, an antibody derivative, antibody fragment, a vitainin derivative, a carbohydrate, a toxin, or a chemotherapeutic coinpound Vanous coinpounds can be synthesized, for example, small molecules and oligoiners {e g , oligopeptides and ohgonucleotides), and synthetic organic coinpounds based on vanous core structures, [n addition, vanous natural sources can provide coinpounds for screening, such as plant or animal extracts, and the like. A skilled artisan can readily recognize that there is no liinit as to the structural nature of the agents of the present invention [0074] Agents that are einployed in the methods of this invention can be randoinly selected or rationally selected or designed As used herein, an agent is said to be randoinly selected when the agent is chosen randoinly without considering the specific sequences involved in the association of transferrin receptor with its native binding partners or known antibodies An example of randoinly selected agents is the use of a cheinical library or a peptide coinbinatonal library [0075] As used heiein, an agent is said to be rationally selected or designed when the agent is chosen on a noinandoin basis that takes into account the sequence of the target site and/or its conformation in connection with the agent's action. With respect to anti-transferrin receptor agents, it is currently believed that there are at least three epitopes on transferrin ieceptor against which antibodies can be raised and therefore at least three sues of action for agents that block transferrin receptor/anti-transferrin ieceptor interaction This invention also encoinpasses agents that act at the sites of interaction between transferrin receptor and its native binding partner, although other ligands and their active transferrin receptor-interactive sites are also encoinpassed within the scope of this invention, whether cunently known or later identified Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up the contact sites of the receptor/hgand and/or transform receptor/anti-transferrin receptor antibody coinplex For example, a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to an epitope appearing on transferrin receptor as it is exposed on the surface of a living cell in its native 19 WO 2005/121179 PCI7US2005/020253 environinent Such an agent will reduce or block the association of the anti-transferrin receptor antibody with transferrin receptor, or the association of transferrin receptor with its native ligand, as desired, by binding to the anti-transferrin receptor antibody or to the native ligand [0076] As used herein, the term "labeled", with regard to the antibody, is intended to encoinpass direct labeling of the antibody by coupling (i e , physically linking) a detectable substance, such as a radioactive agent or a fluorophore (e.g fluorescein isothiocyanate (FITC) or phycoerythnn (PE)) to the antibody, as well as indirect labeling of the probe or antibody by reactivity with a detectable substance [0077] As used herein, the term "association", with regard to the antibody, includes covalent and non-covalent attachinent or binding to an agent (e g., chemotherapeutic agent). The antibody can be associated with an agent (e g , chemotherapeutic agent) by direct binding or indirect binding via attachinent to a coininon platform, such that the antibody directs the localization of the agent to the canceious cell to which the antibody binds and wherein the antibody and agent do not substantially dissociate under physiological conditions such that the agent is not targeted to the same cancerous cell to which the antibody binds or such that the agent's potency is not decieased [0078] A "biological sample" encoinpasses a variety of sample types obtained from an individual and can be used in a diagnostic or inonitoring assay The definition encoinpasses saliva, blood and other liquid sainples of biological origin, solid tissue sainples such as a biopsy speciinen or tissue cultures or cells derived therefrom, and the progeny theieof, for example, cells obtained from a tissue sample collected from an individual suspected of having cancer, in preferred embodiments from ovary, lung, prostate, pancreas, colon, and breast tissue The definition also includes sainples that have been inanipulated in any way after their procureinent, such as by treament with reagents, solubihzation, or enrichinent for certain coinponents, such as proteins or polynucleotides, or einbedding in a seini-solid or solid inatrix for sectioning purposes The term "biological sample" encoinpasses a clinical sample, and also includes cells in culture, cell supernatants, cell lysates, seruin, plasina, biological fluid, and tissue sainples [0079] A "host cell" includes an individual cell or cell] culture that can be or has been a recipient for vector(s) for incorporation of polynucleotide inserts Host cells include progeny of a single host cell, and the progeny maynot necessarily be coinpletely identical (in inorphology or in genoinic DNA coinpleinent) to the original parent cell due to natural, accidental, or deliberate inutation A host cell includes cells transfected in vivo with a polynucleotide(s) of this invention 20 WO 2005/121179 PCT/US2005/020253 [0080] As used herein, "delaying developinent of inetastasis" ineans to defer, hinder, slow, retard, stabilize, and/or postpone developinent of inetastasis This delay can be of varying lengths of time, depending on the history of the cancer and/or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encoinpass prevention, in that the individual does not develop the inetastasis [0081] An "effective amount" of a pharmaceutical composition, in one embodiment, is an amount sufficient to effect beneficial or desired results including, without limitation, clinical results such as shrinking the size of the tumor (in the cancer context, for example, breast or prostate cancer), retardation of cancerous cell growth, delaying the developinent of inetastasis, decreasing syinptoins resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other inedications required to treat the disease, enhancing the effect of another inedication such as via targeting and/or internahzation, delaying the progression of the disease, and/or prolonging survival of individuals An effective amount can be administered in one or more administrations For purposes of this invention, an effective amount of drug, coinpound, or pharmaceutical composition is an amount sufficient to reduce the proliferation of (or destioy) cancerous cells and to reduce and/or delay the developinent, or growth, of inetastases of cancerous cells, either directly or indirectly. In some embodiments, an effective amount of a drug, coinpound, or pharmaceutical composition mayor maynot be achieved in conjunction with another drug, coinpound, or pharmaceutical composition. Thus, an "effective amount" maybe considered in the context of administering one or more chemotherapeutic agents, and a single agent maybe considered to be given in an effective amount if, in conjunction with one or more other agents, a desirable result maybe or is achieved. While individual needs vary, deterinination of optiinal ranges of effective amounts of each coinponent is within the skill of the art Typical dosages comprise 0 1-to 100 ing/kg/body weight Theprefened dosages comprise 1-to 100-ing/kg/body weight The inost preferred dosages comprise 10-to 100-ing/kg/body weight [0082] As used herein, a nucleic acid molecule or agent, antibody, composition or cell, etc , is said to be "isolated" when that nucleic acid molecule, agent, antibody, composition, or cell, etc is substantially separated from containinant nucleic acid molecules, antibodies, agents, compositions, or cells, etc from its original source [0083] An "individual" is a vertebrate, preferably a inaininal, more preferably a human Maininals include, but are'not limited to, farin animals, sport animals, pets, priinates, inice and rats [0084] The teiins "polypeptide", "ohgopeptide", "peptide" and "protein" are used interchangeably herein to refer to polyiners of amino acids of any length The polyiner inay 21 WO 2005/121179 PCT/US2005/020253 be linear or branched, it maycoinpose inodified amino acids, and it maybe interrupted by non-amino acids The terins also encoinpass an amino acid polyinei that has been inodified naturally or by intervention, for example, disulfide bond formation, glycosylation, hpidation, acetylation, phosphorylation, or any other inanipulation or inodification, such as conjugation with a labeling coinponent Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc ), as well as other inodifications known in the art It is understood that, because the polypeptides of this invention are based upon an antibody, the polypeptides can occur as single chains or associated chains. [0085] Also encoinpassed within the scope of the invention are peptidoinrinetics of the transferrin receptor peptide agonists, antagonists and inodulators (including anti-transferrin receptor antibodies) described herein Such peptidomimetics include peptides wherein at least one amino acid residue is substituted with an amino acid residue that is not coininonly found in nature, such as the D isomei of the amino acid or an N-alkylated species of the amino acid. In other embodiments, peptidomimetics are constructed by replacing at least one ainide bond (-C( dbd O)--NH-) in a transferrin receptor peptide agonist, antagonist or inodulators with an ainide isostere Suitable annde isosteres include - CH.sub 2 -NH--, - CH.sub.2 --S-, -CH.sub 2 --S(O) sub n -- (where n is 1 or 2), --CH sub.2 -CH.sub.2 --, --CH dbd CH-- (E or Z), -C( dbd O)-CH sub 2 ~, -CH(CN)-NH~, --C(OH)--CH.sub 2 -, and "O~C( dbd O)-NH- The ainide bonds in a transferrin receptor peptide agonist, antagonist or inodulator that are suitable candidates for replaceinent with ainide isosteres include bonds that are hydiolyzable by the endogenous esterases or proteases of the intended subject of transferrin receptor peptide agonist, antagonist or inodulator treament [0086] As used herein, "substantially pure" refers to inaterial that is at least 50% pure (i e., free from containinants), more preferably at least 90 % pure, more preferably at least 95% pure, more preferably at least 98% pure, more pieferably at least 99% pure, or greater, pure [0087] "Toxin" refers to any substance, which effects an adverse response within a cell For example, a toxin directed to a cancerous cell would have an adverse, sometiines deleterious effect, on the cancerous cell. Examples of toxins include, but are not limited to, radiorsotopes, cahchearincin, and inaytansinords [0088] As used herein, "treament" or "treating" is an approach for obtaining beneficial or desired results including and preferably clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, one or more of the following: reducing the proliferation of (or destroying) cancerous cells or other diseased, reducing inetastasis of cancerous cells found in cancers, shrinking the size of the tumor, decreasing syinptoins resulting from the disease, increasing the quality of life of those 22 WO 2005/121179 PCT/US2005/020253 suffering from the disease, decreasing the dose of other inedications requned to treat the disease, delaying the progression of the disease, and/or prolonging survival of individuals /// Methods of making antibodies andpolypeptides [0089] Methods of making monoclonal antibodies are known in the art One method which maybe einployed is the method of Kohlei and Milstein, Nature 256:495-497 (1975) or a inodification thereof Typically, monoclonal antibodies are developed in non-human species, such as inice In general, a inouse or rat is used for iininunization but other animals mayalso be used The antibodies are pioduced by iininunizing inice with an iininunogeinc amount of cells, cell extracts, or piotein preparations that contain human transferrin receptor. The immunogen can be, but is not limited to, primary cells, cultured cell lines, cancerous cells, nucleic acids, or tissue. In one embodiment, cultured human tumor cell lines are used In another embodiment, human bladder or pancreatic progenitor cells are used. Cells used for iininunization, for example, human fetal kidney, bladder cells or human pancreatic progenitor cells, maybe cultured for a period of time (at least 24 hours) prior to their use as an immunogen. Cells (e g , human fetal kidney, bladder cells or human pancreatic progenitor cells) maybe used as immunogens by theinselves or in combination with a non-denaturing adjuvant, such as Ribi In general, cells should be kept intact and preferably viable when used as immunogens Intact cells mayallow antigens to be better detected than ruptured cells by the iininunized animal Use of denaturing or harsh adjuvants, e g., Freud's adjuvant, mayinpture the human fetal kidney or other cells and therefore is discoui aged The immunogen maybe administered multiple tiines at periodic intervals such as, bi-weekly, or weekly, or maybe administered in such a way as to inaintain viability in the animal {e g , in a tissue recoinbinant). Example 2 describes methods used to generate anti-transferrin receptor antibodies and maybe used to generate other monoclonal antibodies, which bind to transferrin receptor [0090] In one embodiment, monoclonal antibodies, which bind to transferrin receptor are obtained by using host cells that over-expiess transferrin receptor as an immunogen Such cells include, by way of example and not by limitation, human fetal kidney cells and human colon cancer cells [0091] To inonitor the antibody i esponse, a small biological sample (e g , blood) maybe obtained from the animal and tested for antibody titer against the immunogen The spleen and/or seveial large lyinph nodes can be reinoved and dissociated into single cells If desired, the spleen cells maybe screened (after reinoval of non-specifically adherent cells) by applying a cell suspension to a plate or to a well coated with the antigen B-cells, 23 WO 2005/121179 PCT/US2005/020253 expressing ineinbrane-bound immunoglobulin specific for the antigen, will bind to the plate, and are not rinsed away with the rest of the suspension. Resulting B-cells, or all dissociated spleen cells, can then be fused with myeloma cells {e g , X63-Ag8 653 and those from the Salk Institute, Cell Distribution Center, San Diego, CA) Polyethylene glycol (PEG) may be used to fuse spleen or lyinphocytes with myeloma cells to form a hybndorna The hybridoina is then cultured in a selective inediuin (e.g , hypoxanthine, aininoptenn, thyinidine inediuin, otherwise known as "HAT inediuin")- The resulting hybndoinas are then plated by liiniting dilution, and are assayed for the production of antibodies that bind specifically to the immunogen (e g , surface of the human fetal kidney cells, surface of cancer cell lines, Ag-transferrin receptor, fetal bladder sections, etc ) using FACS or immunohistochemistry (IHC screening) The selected monoclonal antibody-secreting hybndoinas are then cultured either in vitro (e g , in tissue culture bottles or hollow fiber reactors), or in vivo {e g , as ascites in inice) Example 3 pi ovides further details about the methods utilized to obtain and screen an anti-transferrin receptor antibody [0092] As another alternative to the cell fusion technique, EBV iininortalized B cells maybe used to produce monoclonal antibodies of the subject invention The hybndoinas are expanded and subcloned, if desired, and supernatants are assayed for anti-immunogen activity by conventional assay procedures (e g , FACS, IHC, radiorininunoassay, enzyine lininunoassay, fluorescence iininunoassay, etc) [0093] In another alternative, monoclonal antibody anti-LUCA31 and any other equivalent antibodies can be sequenced and produced lecoinbinantly by any ineans known in the art (e g , huinainzation, use of transgeinc inice to produce fully human antibodies, phage display technology, etc ) In one embodiment, anti-transferrin receptor monoclonal antibody is sequenced and the polynucleotide sequence is then cloned into a vector for expression or propagation The sequence encoding the antibody of interest maybe inaintained in a vector in a host cell and the host cell can then be expanded and fiozen for future use. [0094] Example 4 shows the nucleic acid and corresponding translated protein sequence of the kappa light chain of the anti-transferrin receptor monoclonal antibody LUCA31 including the native signal sequence. [0095] Example 4 also shows the nucleic acid and corresponding translated protein sequence of the G1 heavy chain of the anti-transferrin receptor monoclonal antibody LUC A31. [0096] The polynucleotide sequence of monoclonal antibody LUCA31 and any other equivalent antibodies maybe used for genetic inanipulation to generate a "humanized" antibody, to iinprove the affinity, or other characteristics of the antibody The general principle in humanizing an antibody involves retaining the basic sequence of the antigen- 24 WO 2005/121179 PCT/US 2005/020253 binding portion or the antibody, while swapping the non-human reinainder of the antibody with human antibody sequences There are fourgeneralsteps to humanize a monoclonal antibody These are (1) determining the nucleotide and predicted amino acid sequence of the starting antibody light and heavy variable doinains (2) designing the humanized antibody, i e , deciding which antibody frainework region to use during the humanizing process (3) the actual humanizing methodologies/techniques and (4) the transfecfcon and expression of the humanized antibody. See, for example, U S. Patent Nos 4,816,567, 5,807,715, 5,866,692; and 6,331,4(5 [0097] A number of "humanized" antibody molecules comprising an antigen-binding site derived from a non-human iininunoglobuhn have been described, including chimeric antibodies having rodent or inodified rodent V regions and their associated complementarity determining regions (CDRs) fused to human constant doinains. See, for example, Winter et al Nature 349 293-299 (1991), Lobugho et al Proc Nat Acad Sci USA 86 4220-4224 (1989), Shaw etal J Immunol 138 4534-4538 (1987), and Brown etal Cancer Res 47 3577-3583 (1987) Other references describe rodent CDRs giafted into a human supporting frainework region (FR) prior to fusion with an appropriate human antibody constant doinain See, for example, Riechinann et al Nature 332 323-327 (1988), Verhoeyen et al Science 239 1534-1536 (1988), and Jones et al. Nature 321 522-525 (1986) Another reference describes rodent CDRs supported by recombinantly veneered rodent frainework regions See, for example, European Patent Publication No 519,596 These "humanized" molecules are designed to ininiinize unwanted immunological response toward rodent anti-human antibody molecules, which liinits the duration and effectiveness of therapeutic applications of those moreties in human recipients. Other methods of humanizing antibodies that mayalso be utilized are disclosed by Daugherty et al, Nucl Acids Res, 19 2471-2476 (1991) and in U S. Patent Nos 6,180,377; 6,054,297, 5,997,867, and 5,866,692 [0098] The invention also encoinpasses single chain variable region fragments ("scFv") of antibodies of this invention, such asLUCA31. Single chain variable region fragments are inade by linking light and/or heavy chain variable regions by using a short linking peptide Bird et al (1988) Science 242 423-426 describes example of linking peptides which bridge approxiinately 3 5 nin between the carboxy terininus of one variable region and the amino terininus of the other variable region Linkers of other sequences have been designed and used, Bird et al (1988). Linkeis can in turn be inodified for additional functions, such as attachinent of drugs or attachinent to solid supports The single chain variants can be produced either recombinantly or synthetically For synthetic production of scFv, an autoinated synthesizer can be used For lecoinbinant production of scFv, a suitableplasmid 25 WO 2005/121179 PCT/US2005/020253 containing polynucleotide that encodes the scFv can be introduced into a suitable host cell, either eukaryotic, such as yeast, piant, insect or inaininalian cells, or prokaryotic, such as E coli Polynucleotides encoding the scFv of interest can be inade by routine inanipulations such as hgation of polynucleotides The resultant scFv can be isolated using standard protein purification techniques known in the art. [0099] The invention includes inodifications to transform receptor agonists, antagonists, inodulators and antibodies, including functionally equivalent antibodies and polypeptides that do not significantly affect their properties and variants that have enhanced or decreased activity Modification of polypeptides is routine practice in the art and need not be described in detail herein Examples of inodified polypeptides include polypeptides with conservative substitutions of amino acid residues, one or more deletions or additions of amino acids which do not significantly deletenously change the functional activity, or use of cheinical analogs Ainino acid residues which can be conservatively substituted for one another include but are not limited to glycine/alainne, vahne/isoleucine/Ieucine, asparagine/glutainine, aspartic acid/glutainic acid, senne/tbreonine, lysine/arginine, and phenylalanine/tryosine These polypeptides also include glycosylated and nonglycosylated polypeptides, as well as polypeptides with, other post-translational inodifications, such as, for example, glycosylation with different sugars, acetylation, and phosphorylation Preferably, the amino acid substitutions would be conservative, 1 e , the substituted amino acid would possess siinilar cheinical properties as that of the original amino acid Such conservative substitutions are known in the ait, and examples have been provided above Ainino acid inodifications can range from changing or inodifying one or more amino acids to coinplete redesign of a region, such as the variable region. Changes in the variable region can alter binding affinity and/or specificity. Other methods of inodification include using coupling techniques known in the art, including, but not hinited to, enzyinatic ineans, oxidative substitution and chelation Modifications can be used, for example, for attachinent of labels for iininunoassay, such as the attachinent of radioactive moreties for radiorininunoassay Modified polypeptides are inade using established procedures in the art and can be screened using standard assays known in the art. [00100] The invention also encoinpasses fusion proteins comprising one or more fragments or regions from the polypeptides and antibodies of this invention In one embodiment, a fusion polypeptide is provided that comprises at least 10 contiguous amino acids of variable light chain region and at least 10 amino acids of variable heavy chain region. In another embodiment, the fusion polypeptide contains a heterologous lininunoglobuhn constant region In another embodiment, the fusion polypeptide contains a light chain variable region and a heavy chain variable region of an antibody produced from a 26 WO 2005/121179 PCT/US2005/020253 hybridoma deposited with the ATCC as described herein. For purposes of this invention, an antibody fusion protein contains one or more anti-transferrin receptor polypeptides and another amino acid sequence to which it is not attached in the native molecule, for example, a heteiologous sequence or a hoinologous sequence from another region [00101] An anti-transferrin receptor polypeptide, and other transferrin receptor agonists, antagonists and inodulators can be created by methods known in the art, for example, synthetically or recombinantly One method of producing transferrin receptor peptide agonists, antagonists and inodulators involves cheinical synthesis of the polypeptide, followed by treament under oxidizing conditions appropriate to obtain the native conformation, that is, the correct disulfide bond linkages This can be accoinplished using methodologies well known to those skilled in the art (see Kelley, R. F. & Winkler, M E in Genetic Engineering Principles and Methods, Setlow, J K , ed , Plenuin Press, N Y , vol 12, pp 1-19 (1990), Stewart, J M & Young, J. D Solid Phase Peptide Synthesis Pierce Cheinical Co Rockford,Ill (1984), see also U S Pat Nos 4,105,603,3,972,859, 3,842,067, and 3,862,925) [00102] Polypeptides of the invention maybe conveniently piepared using solid phase peptide synthesis (Meinfield, J Ain Chein. Soc , 85 2149 (1964), Houghten, Proc Natl. Acad Sci USA 82 5132 (1985)) [00103] In yet another alternative, fully human antibodies maybe obtained by using coininercially available inice that have been engineered to express specific human immunoglobulin proteins Transgeinc animals that are designed to produce a more desirable (e g , fully human antibodies) or more lobust immune response mayalso be used for generation of humanized or human antibodies. Examples of such technology are Xenoinouse (tm) from Abgeinx, Inc (Freinont, CA) and HuMAb-Mouse(r) and TC Mouse(tm) from Medarex, Inc. (Pnnceton, NJ) [00104] In an alternative, antibodies maybe inade lecoinbinantiyand expressed using any method known in the art Antibodies maybe inade recombinantly by first isolating the antibodies inade from host animals, obtaining the gene sequence, and using the gene sequence to express the antibody lecoinbinantly in host cells (e g., CHO cells). Another method that maybe einployed is to express the antibody sequence in plants (e.g , tobacco) or transgeinc milk Methods for expressing antibodies recombinantly in plants or milk have been disclosed See, for example, Peeters, et al (2001) Vaccine 19:2756; Lonberg, N and D Huszar (1995) Int Rev Immunol 13*65, and Pollock, et al (1999) J Immunol Methods 231 147 Methods for making derivatives of antibodies, e.g , humanized, single chain, etc are known in the art In anothei alternative, antibodies maybe inade recombinantly by 27 WO 2005/121179 PCT/US2005/020253 phage display technology See, for example, U S Patent Nos 5,565,332, 5,580,717; 5,733,743, 6,265,150, and Winter et al, Annu Rev. Immunol 12 433-455 (1994) [00105] The antibodies or protein of interest maybe subjected to sequencing by Edinan degi adation, which is well known to those of skill in the art The peptide information generated from inass spectroinetry or Edinan degradation can be used to design probes or pniners that are used to clone the protein of interest [00106] An alternative method of cloning the protein of interest is by "panning" using purified transferrin receptor or portions thereof for cells expressing the antibody or protein of interest. The "panning" procedure is conducted by obtaining a cDNA library from tissues or cells that express the antibody or protein of interest, over-exprssing the cDNAs in a second cell type, and screening the transfected cells of the second cell type for a specific binding to transferrin receptor Detailed descriptions of the methods used in cloning inaininalian genes coding for cell surface proteins by "panning" can be found in the art See, for example, Aruffo, A and Seed, B Proc Natl Acad. Sci USA, 84, 8573-8577 (1987) and Stephan,J et al, Endocrinology 140 5841-5854(1999) [00107] cDNAs encoding anti-transferrin receptor antibodies, and other transferrin receptor peptide agonists, antagonists and inodulators can be obtained by reverse transenbing the inRNAs from a particular cell type according to standard methods in the ait Specifically, inRNA can be isolated using various lytic enzyines or cheinical solutions according to the procedures set forth in Sainbrook, et al supra or extracted by coininercially available nucleic-acid-binding resins following the accoinpanying instructions provided by inanufacturers (e g , Qiagen, Invitrogen, Pioinega) The synthesized cDNAs are then introduced into an expression vector to produce the antibody or protein of interest in cells of a second type It is iinplied that an expression vector inust be rephcable in the host cells either as episomes or as an integral part of the chioinosoinal DNA. Suitable expression vectors include but are not limited to plasrruds, viral vectors, including adenoviruses, adeno-associated viruses, retroviruses, and cosinids. [00108] The vectors containing the polynucleotides of interest can be introduced into the host cell by any of a number of appropnate ineans, including electroporation, transfection einploying calciuin chlonde, rubidiuin chlonde, calciuin phosphate, DEAE-dextran, or other substances, microprojectible bombardment; hpofection, and infection (e g , where the vector is an infectious agent such as vaccinia virus) The chorce of introducing vectors or polynucleotides will often depend on features of the host cell. [00109] Any host cells capable of over-expressing heterologous DNAs can be used for the purpose of isolating the genes encoding the antibody, polypeptide or protein of interest Non-limiting examples of inaininalian host cells include but not limited to COS, HeLa, and 28 WO 2005/121179 PCT/US2005/020253 CHO cells Preferably, the host cells express the cDNAs at a level of about 5 fold higher, more preferably 10 fold higher, even more preferably 20 fold higher than that of the corresponding endogenous antibody or protein of interest, if present, in the host cells Screening the host cells for a specific binding to transferrin receptor is effected by an iininunoassay or FACS A cell over-expressing the antibody or protein of interest can be identified [00110] Various techniques are also available which maynow be einployed to produce inutant transferrin receptor peptide agonists, antagonists, and inodulators which encodes for additions, deletions, or changes in amino acid sequence of the resultant protein relative to the parent transferrin receptor peptide agonist, antagonist or inodulator molecule [00111] The invention includes polypeptides comprising an amino acid sequence of the antibodies of this invention The polypeptides of this invention can be inade by procedures known in the art The polypeptides can be produced by proteolytic or other degradation of the antibodies, by recoinbinant methods (l e , single or fusion polypeptides) as described above or by cheinical synthesis Polypeptides of the antibodies, especially shorter polypeptides up to about 50 amino acids, are conveniently inade by cheinical synthesis Methods of cheinical synthesis are known in the ait and are coininercially available. For example, an anti-transferrin receptor polypeptide could be produced by an autoinated polypeptide synthesizer einploying the solid phase method. IV Methods for screening polypeptides and monoclonal antibodies [00112] Several methods maybe used to screen polypeptides and monoclonal antibodies that bind to transferrin receptor It is understood that "binding" refers to biologically or iininunologically relevant binding, i e , binding which is specific for the unique antigen for which the iininunoglobuhn molecule is encoded, or to which the poLypeptide is directed It does not refer to non-specific binding that mayoccur when an iininunoglobuhn is used at a very high concentration against a non-specific target In one embodiment, monoclonal antibodies are screened for binding to transferrin receptor using standard screening techniques In this inanner, anti-transferrin receptor monoclonal antibody was obtained. In accordance with the Budapest Treaty, a hybridoma which produces anti-transferrin receptor monoclonal antibodies has been deposited in the Ainencan Type Culture Collection (ATCC) 10801 University Blvd , Manassas VA 20110-2209 on 8 July 2004 with a Patent Deposit Designation of PTA-6055 [00113] Monoclonal antibodies that bind to transferrin receptor are screened for binding to cancerous tissues and non-cancerous cells In one embodiment, monoclonal antibodies 29 WO 2005/121179 PCT/US2005/020253 which bind to transferrin receptor and that are also cross reactive to human cancerous cells or tissues, but not to normal cells or tissues to the same degree, are selected. One method that maybe einployed for screening is immunohistochemistry (IHC). Standard iininunohistocheinical techniques are known to those of average skill in the art See, for example, Aniinal Cell Culture Methods (J P Mather and D Barnes, eds , Acadeinic Press, Vol 57, Ch 18 and 19, pp 314-350,3998). Biological sainples (e g , tissues) maybe obtained from biopsies, autopsies, or necropsies To ascertain if transferrin receptor is present only on cancerous cells, an ti-transferrin receptor antibodies maybe used to detect the presence of transferrin receptor on tissues from individuals with cancer while other non-cancerous tissues from the individual suffenng from cancer or tissues from individuals without cancer are used as a control The tissue can be einbedded in a solid or seini-solid substance that prevents dainage during freezing (e g , agarose gel or OCT) and then sectioned for staining Cancers from different organs and at different grades can be used to screen monoclonal antibodies Examples of tissues that maybe used for screening purposes include but are not limited to ovary, breast, lung, piostate, colon, kidney, skin, thyroid, brain, heart, liver,stomach, nerve, blood vessels, bone, upper digestive tract, and pancreas Examples of different cancer types that maybe used for screening purposes include but are not limited to carcmomnas, adenocarcmomnas, sarcoinas, adenosarcoinas, lymphomas, and leukerruas [00114] In yet another alternative, cancerous cells lines such as BT474 (ATCC# HTB-20), MCF7 (ATCC# HTB-22), MDA-175 (ATCC# HB-25), MDA-361 (ATCC# HB-27), SK-BK-3 (ATCC# HTB-30), A549 (ATCC# CCL-185), CaLu3 (ATCC# HTB-55) SKMES1 (ATCC# HTB-58), ES-2 (ATCC# CRL-1978), SKOV3 (ATCC# HTB-77), AsPC-1 (ATCC# CRL-1682), HPAFII (ATCC# CRL-1997), Hs700T (ATCC# HTB-147), Colo205 (ATCC# CCL-222), HT29 (ATCC# HTB-38), SW4S0 (ATCC# CCL-228), SW948 (ATCC# CCL-237), 293 (ATCC# CRL-1573), 786-O (ATCC# CRL-1932), A49S (ATCC# HTB-44), Caki2 (ATCC# HTB-47), Cos7 (ATCC# CRL-1651), RL 30 WO 2005/121179 PC T/US 2005/020253 not limited to, ovary, breast, lung, prostate, colon, kidney, skin, thyroid, aortic sinooth inuscle, and endothelial cells can be used as negative controls The cancerous or non-cancerous cells can be grown on glass slides or coverslips, or on plastic surfaces, or prepared in a CellArray(tm), as described in WO 01/43869, and screened for the binding of antibody using IHC as described above for tissues. Alternatively, cells maybe reinoved from the growth surface using non-proteolytic ineans and spun into a pellet, which is then einbedded and treated as tissues for IHC analysis as described above Cells maybe inoculated into iininunodeficient animals, a tumor allowed to grow, and then this tumor maybe harvested, einbedded, and used as a tissue source for IHC analysis In another alternative, single cells maybe screened by incubating with the primary antibody, a secondary "reportei" antibody linked to a fluorescent molecule and then analyzed using a fluorescent activated cell-sorting (FACS) inachine [00115] Several different detection systems maybe utilized to detect binding of antibodies to tissue section. Typically, iinrnunohistocheinistry involves the binding of a primary antibody to the tissue and then a secondary antibody reactive against the species from the primary antibody was generated and conjugated to a detectablemarker (e g , horseradish peroxidase, HRP, or diarinnobenzedine, 3DAB). One alternative method that maybe used is polyclonal inirror iinage coinpleinentary antibodies or polyMICA PolyMICA (polyclonal Mirror Iinage Coinpleinentary Antibodies) technique, described by D C. Manghain and P G Isaacson (Histopathology (1999) 35(2) 129-33), can be used to test binding of primary antibodies (e g , anti-transferrin receptor antibodies) to normal and cancerous tissue Several kinds of polyMICA(tm) Detection kits are coinineicially available from The Binding Site Liinited (P O Box 4073 Birininghain B29 6AT England) Product No HK004 D is a polyMICA1M Detection kit which uses DAB chroinagen. Product No HK004 A is a polyMICA(tm) Detection kit which uses AEC chroinagen. Alternatively, the primary antibody maybe directly labeled with the detectablemarker [00116} The first step in IHC screening to select for an appropriate antibody is the binding of primary antibodies raised in inice (e g , anti-transferrin receptor antibodies) to one or more lrninunogens (e g , cells or tissue sainples) In one embodiment, the tissue sample is sections of frozen tissue from different organs The cells or tissue sainples can be either cancerous or non-cancerous. [00117] Frozen tissues can be prepared, sectioned, with or without fixation, and IHC performed by any of a number of methods known to one fainiliar with the art. See, for example, Stephan et al Dev Biol 212* 264-277 (1999), and Stephanetal Endocrinology 140-5841-54(1999) 31 W° 2005/121179 PCT/US2005/020253 V Methods of character izing anti-transferrin receptor antibodies [00118] Several methods can be used to characterize anti-transferrin receptor antibodies One method is to identify the epitope to which it binds Epitope mapping JS coininercially available from various sources, for example, Pepscan Systeins (Edelhertweg 15, 8219 PH Lelystad, The Netherlands) Epitope mapping can be used to deterinine the sequence to which an anti-transferrin receptor antibody binds The epitope can be a linear epitope, i e , contained in a single stretch of arruno acids, or a conformational epitope formed by a three-diinensional interaction of amino acids that maynot necessarily be contained in a single stretch Peptides of varying lengths (e g., at least 4-6 amino acids long) can be isolated or synthesized (e g., recombinantly) and used for binding assays with anti-transferrin receptor antibody The epitope to which anti-transferrin receptor antibody binds can be deterinined in a systematic screening by using overlapping peptides derived from the extracellular sequence and determining binding by anti-transferrin receptor antibody [00119] Yet another method that can be used to characterize ananti-transferrin receptor antibody is to use coinpetition assays with other antibodies known to bind to the same antigen, i e , transferrin receptor to deterinine if anti-transferrin receptor antibodies binds to the same epitope as other antibodies Examples of coininercially available antibodies to transfenin receptor maybe available and maybe identified using the binding assays taught herein Coinpetition assays are well known to those of skill in the art, and such procedures and illustrative data are detailed further in the Examples Anti-transferrin receptor antibodies can be further charactenzed by the tissues, type of cancer or type of tumor to which they bind [00120] Another method of characterizing anti-transferrin leceptor antibodies is by the antigen to which it binds Anti-transferrin receptor antibodies were used in "Western blots with cell lysates from various human cancers As is known to one of skill in the art, Western blotting can involve running cell lysates and/or cell fractions on a denaturing or non-denaturing gel, transferring the proteins to nitrocellulose paper, and then probing the blot with an antibody (e g , anti-transferrin receptor antibody) to see which proteins are bound by the antibody This procedure is detailed further in the Examples. The band to which anti-transferrin receptor antibody bound was isolated and further analyzed using inass spectroscopy The antigen to which anti-transferrin receptor antibody binds was found to be transferrin receptor Transfeinn receptor is associated with various human cancers of different tissues including but not limited to colon, lung, breast, prostate, ovary, pancreas, kidney as well as other types of cancer such as sarcoina Further description of transferrin receptor is given in the Examples below 32 WO 2005/121179 PCT/US2005/020253 VI Methods of diagnosing cancer using anti-transferrin receptor antibodies and transfei i in receptor inodulators [00121] Monoclonal antibodies to transferrin receptor inade by the methods disclosed herein inaybe used to identify the presence or absence of cancerous cells in a variety of tissues, including but not limited to, ovary, breast, lung, prostate, colon, kidney, pancreas, skin, thyiord, brain, heart, liver,stomach, nerve, blood vessels, bone, and upper digestive tract, for purposes of diagnosis Monoclonal antibodies to transferrin receptor inade by the methods disclosed herein mayalso be used to identify the presence or absence of cancerous cells, or the level thereof, which are circulating in blood after their release from a solid tumor Such circulating antigen maybe an intact transferrin receptor antigen, or a fragment thereof that retains the ability to be detected according to the methods taught heiein. Such detection maybe effected by FACS analysis using standard methods coininonly used in the art. [00122] These uses can involve the formation of a coinplex between transferrin receptor and an antibody that binds specifically to transferrin receptor. Examples of such antibodies include but are not limited to those anti-transferrin receptor monoclonal antibodies produced by the hybridoma deposited in the ATCC with the designation PTA-6055 The formation of such a coinplex can be in vitro or in vivo. Without being bound by theory, monoclonal antibody anti-transferrin receptor can bind to transferrin receptor through the extracellular doinain of transferrin receptor and maythen be internalized [00123] In a preferred embodiment of the diagnostic methods of this invention, the antibody bears a detectable label Examples of labels that maybe used include a radioactive agent or a fluorophore, such as fTuororsotinocyanate or phycoerythrin [00124] As with othei known antibodies used coininercially for diagnostic and therapeutic purposes, the taiget antigen of this invention is broadly expressed in normal tissue It is also up regulated in some tumors Theiefore, the particular dosages and routes of delivery of the antibodies of this invention as used for diagnostic or therapeutic agents will be tailored to the particular tumor or disease state at hand, as well as to the particular individual being treated. [00125] One method of using the antibodies for diagnosis is in vivo tumor iinaging by linking the antibody to a radioactive or radioopaque agent, administering the antibody to the individual and using an x-ray or other iinaging inachine to visualize the localization of the labeled antibody at the surface of cancer cells expressing the antigen The antibody is administered at a concentration that proinotes binding at physiological conditions. WO 2005/121179 PCT/US2005/020253 [00126] In vitro techniques for detection of transferrin receptor are routine in the art and include enzyine linked immunosorbent assays (ELISAs), iininunoprecipitations, immunofluorescence, enzyine iininunoassay (El A), radiorininunoassay (RIA), and Western blot analysis [00127] In aspects of this invention, methods of radiorinaging of tumors or neoplasins, or of ineasuring the effectiveness of a method of treament with a radiolabelled antibody, comprising the step of administering a radiolabelled, tumor-specific antibody to an individual following the practice of this invention The radiolabelled antibody maybe a monoclonal or polyclonal antibody comprising a radiolabel, preferably selected from the group consisting of Technetiuin-99in, Indiuin-Ill, Iodine-131, Rheinuin-186,Rbeniuin-188, Sainanuin-153, Lutetinin-177, Copper-64, Scandiuin-47, Yttnuin-90 Monoclonal antibodies labelled with therapeutic radionuclides such as Iodine-131, Rheinuin-188, Holrinuin-166, Sainanuin-153 and Scandiuin-47, which do not coinproinise the iininunoreactivity of antibodies and are not broken down in vivo, are especially preferred The person skilled in the art will appreciate that other radioactive isotopes are known, and maybe suitable for specific applications The radiorinaging maybe conducted using Single Photon Einission Coinputer Toinography (SPECT), Position Einission Toinography (PET), Coinputer Toinography (CT) or Magnetic Resonance Iinaging (MRI). Correlative iinaging, which perinits greater anatoinical definition of location of inetastases located by radiorininunorinaging, is also conteinplated [00128] In other methods, the cancerous cells are reinoved and the tissue prepared for lininunohistocheinistry by methods well known in the art {e g., einbedding in a freezing coinpound, freezing and sectioning, with or without fixation; fixation and paraffin einbedding with or without various methods of antigen retrieval and counterstaining) The monoclonal antibodies mayalso be used to identify cancerous cells at different stages of developinent The antibodies mayalso be used to deterinine which"individuals' tumors express the antigen on their surface at a pre-determined level and are thus candidates for immunotherapy using antibodies directed against said antigen The antibodies may recognize both primary and inetastasizing cancers of the ovary, prostate and pancreas and primary cancers of the lung that express transferrin receptor As used herein, detection may include qualitative and/or quantitative detection and mayinclude coinparing the level ineasured to a normal cell for an increased level of expression of transferrin receptor in cancerous cells , [00129] The invention also provides methods of aiding diagnosis of cancer (such as ovarian, lung, pancreatic, prostate, colon, or breast cancer) in an individual using any antibody that binds to transferrin receptor and any other methods that can be used deterinine 34 WO 2005/121179 PCT/US2005/020253 the level of transferrin receptor expression As used herein, methods for "aiding diagnosis" ineans that these methods assist in making a clinical deterinination regarding the classification, or nature, of cancer, and mayor maynot be conclusive with respect to the definitive diagnosis Accordingly, a method of aiding diagnosis of cancer can comprise the step of detecting the level of transferrin receptor in a biological sample from the individual and/or determining the level of transferrin receptor expression in the sample Antibodies recognizing the antigen or a portion thereof mayalso be used to create diagnostic iininunoassays for detecting antigen released or secreted from living or dying cancer cells in bodily fluids, including but not limited to, blood, saliva, urine, pulinonary fluid, or ascites fluid [00130] Not all cells in a particular tumor of interest will express transferrin receptor, and cancerous cells in other tissues mayexpress transferrin receptor, thus an individual should be screened for the piesence or absence of transferrin receptor on cancerous cells to deterinine the usefulness of iininunotheiapy in the individual The anti-transferrin receptor antibodies inade by the methods disclosed herein maybe used to deterinine whether an individual diagnosed with cancer maybe deeined a candidate for iininunotheiapy using antibodies directed against transferrin receptor In one embodiment, a cancerous tumor or a biopsy sample maybe tested for expression of transferrin receptor, using antibodies directed against transferrin receptor Individuals with cancer cells that express transferrin receptor are suitable candidates for immunotherapy using antibodies directed against transferrin receptor Staining with anti-transferrin receptor antibody mayalso be used to distinguish cancerous tissues from normal tissues [00131] Methods of using anti-transferrin receptor antibodies for diagnostic purposes are useful both before and after any form of anti-cancer treament, e g., cheinotherapy or radiation therapy, to deterinine which tumors are inost likely to respond to a given treament, prognosis for individual with cancer, tumor subtype or origin of inetastatic disease, and progression of the disease or response to treament [00132] The compositions of this invention are also suitable for diagnosis of disease states other than cancer, using the methods generally descnbed above in application with other diseased (non-cancerous) cells Disease states suitable for use in the methods of this invention include, but are not limited to, diseases or disorders associated with inflamatory or autoimmuneresponses in individuals The methods descnbed above maybe used for inodulating inflamatory or autoimmuneresponses in individuals. Diseases and conditions resulting from inflamation and autoimmunedisorders that maybe subject to diagnosis and/or treament using the compositions and methods of the invention include, by way of illustration and not of limitation, multiple sclerosis, ineningitis, encephalitis, stroke, other 35 WO 2005/121179 PCT/US2005/020253 cerebral trauinas, inflamatory bowel disease including ukerative colitis and Crohn's disease, inyastheina gravis, lupus, rheuinatord aithntis, asthina, acute juvenile onset diabetes, AIDS deinentia, atherosclerosis, nephritis, retiintis, atopic derinatitis, psoriasis, myocardial isichemiaand acute leukocyte-mediated lung injury. [00133] Still other indications for diagnostic and/or therapeutic use of antibodies and other therapeutic agents of the invention include administration to individuals at risk of organ or graft rejection Over recent years there has been a considerable iinproveinent in the efficiency of surgical techniques for transplanting tissues and organs such as skin, kidney, liver, heart, lung, pancreas and bone marrow Perhaps the principal outstanding problem is the lack of satisfactory agents for inducing immunotolerance in the recipient to the transplanted allograft or organ When allogeneic cells or organs are transplanted into a host (I e , the donor and donee are. different individuals from the same .species), the host immune system is likely to inount an immune response to foreign antigens in the transplant (host-versus-graft disease) leading to destruction of the transplanted tissue [00134] Uses described anywhere in this application that recite their use for anti-transferrin receptor antibodies also encoinpass the use of other transferrin receptor agonists, antagonists and inodulators as described herein In such embodiments, the transferrin receptor agonists, antagonist or other non-antibody inodulator is !substituted for the transferrin receptor antibody in the steps described, and alterations within the scope of the ordinarily skilled practitioner are inade to tailor the method to the substituted transferrin receptor inodulatory composition. VII Coinpositions of this invention [00135] This invention also encoinpasses compositions, including pharmaceutical compositions, coinposing anti-transferrin receptor antibodies, polypeptides derived from anti-transferrin receptor antibodies, polynucleotides comprising sequence encoding anti-transferrin receptor antibodies, and other agents as described herein As used herein, compositions furthei comprises one or more antibodies, polypeptides and/or proteins that bind to transferrin receptor, transferrin receptor agonists, antagonists, inodulators, and/or one or more polynucleotides comprising sequences encoding one or more antibodies, polypeptides and pi oteins that bind to transferrin receptor [00136] The invention further provides for conjugates of any .transferrin receptor peptide agonist, antagonist or inodulator, and additional cheinical structures that support the intended function or functions of the particular transferrin receptor peptide agonist, antagonist or inodulator These conjugates include transferrin receptor peptide agonist, antagonist or inodulator covalently bound to a inacromolecule such as any insoluble, solid 36 WO 2005/121179 PCT/US2005/020253 supportmatrixused in the diagnostic, screening or purification procedures discussed heiein Suitable inatrix inaterials include any substance that is cheinically inert, has high porosity and has large numbers of functional groups capable of forming covalent linkages with peptide ligands Examples of inatrix inaterials and procedures for preparation of inatrix-hgand conjugates are desciibed in Dean et al (eds) Affinity Chroinatography A Practical Approach, IRL Press (1985); Lowe, "An Introduction to Affinity Chroinatography", in Work et al (eds) Laboratory Techniques in Biocheinistry and Molecular Biology, Vol 7, Part II, North-Holland (1979); Porath et al, "Biospecific Affinity Chroinatography", in Neurath et al (eds), The Proteins, 3rd ed , Vol 1, pp 95-178 (1975), and Schott, Affinity Chroinatography, Dekker (1984) [00137] Also provided herein are conjugates of transferrin receptor peptide agonist, antagonist or inodulator and any reporter morety used in the diagnostic procedures iiscussed heiein. 30138] The transferrin receptor peptide agoinst, antagonist or inodulator agents, polypeptides and proteins of this invention, including anti-transferrin receptor antibodies, are further identified and characterized by any (one or more) of the following criteria (a) ability to bind to transferrin receptor (including transferrin receptor on cancer cells, including but not limited to ovarian, prostate, pancreatic, lung, colon, or breast cancer cells), (b) ability to competitively inhibits preferential binding of a known anti-transferrin receptor antibody to transferrin receptor, including the ability to preferentially bind to the same transferrin receptor epitope to which the original antibody preferentially binds; (c) ability to bind to a portion of transferrin receptor that is exposed on the surface of a living cell in vitro or in vivo, (d) ability to bind to a portion of transferrin receptor that is exposed on the surface of living cancer cells, such as but not limited to ovarian, prostate, pancreatic, lung, colon, or breast cancer cells, (e) ability to deliver a chemotherapeutic agent or detectablemarker to cancerous cells (such as but not limited to ovarian, prostate, pancreatic, lung, colon, or breast cancer cells) expressing transferrin receptor; (f) ability to deliver a therapeutic agent into cancerous cells (such as but not limited to ovarian cancer cells) expressing transferrin receptor [00139] In some embodiments, the antibody of the invention is an antibody that is produced by a host cell with a deposit number of ATCC No. PTA-6055, or progeny thereof The present invention also encoinpasses various formulations of antibodies produced by these deposited hybridoinas and equivalent antibodies or po3ypeptide fragments (e g , Fab, Fab', F(ab% F(ab) Fc, etc), chimeric antibodies, single chain (ScFv), inutants thereof, fusion proteins comprising an antibody portion, humanized antibodies, and any other inodified configuration of any of these or equivalent antibodies that comprises an 37 WO 2005/121179 PCT/US2005/020253 antigen (transferrin receptor), recognition site of the required specificity The invention also provides human antibodies displaying one 01 more of the biological characteristics of an anti-transferrin receptor fainily ineinber The equivalent antibodies of the anti-tiansfernn receptor fainily (including humanized antibodies and human antibodies), polypeptide fragments, and polypeptides coinposing any of these fragments are identified and characterized by any (one or more) of the five criteria described above. [00140] In some embodiments, the antibodies, polypeptides and proteins of the invention that bind to transferrin receptor are antibodies, polypeptides and proteins that competitively inhibit preferential binding of a herein-specified anti-transferrin receptor antibody to transferrin receptor. In some embodiments, the antibodies, the polypeptides and the proteins preferentially bind to the same epitope on transferrin receptor as the antibody LUCA31 preferentially binds [00141] Accordingly, the invention provides any of the following (or compositions, including pharmaceutical compositions, comprising any of the following) (a) an antibody produced by the host cell with a deposit number identified above or its piogeny, (b) a humanized form of such an antibody, (c) an antibody comprising one or more of the light chain and/or heavy chain variable regions of such an antibody, (d) a chimeric antibody comprising variable regions hoinologous or denved from variable legions of a heavy chain and a light chain of such an antibody, and constant regions hoinologous or denved from constant regions of a heavy chain and a light chain of a human antibody, (e) an antibody comprising one or more of the light chain and/or heavy chain CDRs (at least one, two, thiee, four, five, or six) of such an antibody, (f) an antibody comprising a heavy and/or a light chain of such an antibody, (g) a human antibody that is equivalent to such an antibody A humanized form of the antibody mayor maynot have CDRs identical to that original antibody, or antibody produced by a host cell with a deposit number identified above Deterinination of CDR regions is well within the skill of the ait. In'some embodiments, the invention provides an antibody which comprises at least one CDR that is substantially hoinologous to at least one CDR, at least two, at least three, at least four, at least 5 CDRs of an antibody produced by one of the above-identified deposited hybndoinas (or, in some embodiments substantially hoinologous to all 6 CDRs of one of these antibodies, or derived from one of these antibodies), or antibody produced by the host cell with a deposit number identified above Other embodiments include antibodies that have at least two, three, four, five, or six CDR(s) that are substantially hoinologous to at least two, three, four, five or six CDRs of an antibody produced from a hybridoina deposited as identified herein, or denved from such an antibody It is understood that, for purposes of this invention, binding specificity and/or overall activity (which maybe in terins of delivering a chemotherapeutic 38 WO 2005/121179 PCT/US2005/020253 agent to or into cancerous cells to reduce the growth and/or proliferation of cancer cells, to induce apoptotic cell death in the cancer cell, to delay the developinent of inetastasis, and/or treating palliatively) is generally retained, although the extent of activity mayvary coinpared to an antibody produced by a deposited hybridoma (maybe gieater or lesser) The invention also provides methods of making any of these antibodies Methods of making antibodies are known in the art and are described herein [00142] The invention also provides polypeptides comprising an amino acid sequence of the antibodies of the invention In some embodiments, the polypeptide comprises one or more of the light chain and/or heavy chain variable regions of the antibody In some embodiments, the polypeptide comprises one or more of the light chain and/or heavy chain CDRs of the antibody In some embodiments, the polypeptide comprises three CDRs of the light chain and/or heavy chain of the antibody In some embodiments, the polypeptide comprises an amino acid sequence of the antibody that has any of the following at least 5 contiguous amino acids of a sequence of the original antibody, at least 8 contiguous amino acids, at least about 10 contiguous amino acids, at least about 15 contiguous amino acids, at least about 20 contiguous amino acids, at least about 25 contiguous amino acids, at least about 30 contiguous amino acids, wherein at least 3 of the amino acids are from a variable legion of the antibody In one embodiment, the variable region is from a light chain of the original antibody In another embodiment, the variable region is from a heavy chain of the antibody In another embodiment, the 5 (or more) contiguous amino acids are from a complementarity-deteiinining region (CDR) of the antibody [00143] In some embodiments of this invention, cells of this invention that express transform receptor, a portion of transferrin receptor, anti-transferrin receptor antibodies or othei transferrin receptor-binding polypeptides of this invention are administered directly to an individual to inodulate then- in vivo transferrin receptor biological activity VIII Methods of using transferrin receptor inodulators and anti-transfen in receptor antibodies for therapeutic pw poses [00144] Monoclonal antibodies to transferrin receptor maybe used for therapeutic purposes in individuals with cancer or othei diseases. Therapy with anti-transferrin receptor antibodies can involve formation of coinplexes both in vitro and in vivo as descnbed above In one embodiment, monoclonal antibody anti-transferrin receptor can bind to and reduce the proliferation of cancerous cells It is understood that the antibody is administered at a concentration that proinotes binding at physiological {e g, in vivo) conditions In another embodiment, monoclonal antibodies to transferrin receptor can be used for immunotherapy directed at cancerous cells of different tissues such as colon, lung, breast, prostate, ovary, 39 WO 2005/121179 PCT/US2005/020253 pancreas, kidney and other types of cancer such as sarcoina In another embodiment, monoclonal antibody anti-transferrin receptor alone can bind to and reduce cell division in the cancer cell In another embodiment, monoclonal antibody anti-transfen in receptor can bind to cancerous cells and delay the developinent of inetastasis In yet another embodiment, an individual with cancer is given palliative treament with anti-transferrin receptor antibody Palliative treament of a cancer individual involves treating or lessening the adverse syinptoins of the disease, or iatiogeinc syinptoins resulting from other treaments given for the disease without directly affecting the cancer progression This includes treaments for easing of pain, nutritional support, sexual problems, psychological distress, depression, fatigue, psychiatric disorders, nausea, voiniting, etc. [00145] In such situations, the anti-transferrin receptor antibody maybe administered with agents that can enhance 01 duect an individual's own immune response, such as an agent that strengthens ADCC [00146] In yet another embodiment, anti-transferrin receptor antibody be conjugated to or associated with a radioactive molecule, toxin (e g , calicheainicin), chemotherapeutic molecule, liposomes or other vesicles containing chemotherapeutic coinpounds and administered to an individual in need of such treament to target these coinpounds to the cancer cell containing the antigen recognized by the antibody and thus eliininate cancerous or diseased cells Without being limited to any particular theory, the anti-transferrin receptor antibody is internalized by the cell bearing transferrin receptor at its surface, thus delivering the conjugated morety to the cell to induce the therapeutic effect In yet another embodiment, the antibody can be einployed as adjuvant therapy at the time of the surgical reinoval of a cancer expressing the antigen in order to delay the developinent of inetastasis The antibody can also be administered before surgery (neoadjuvant therapy) in an individual with a tumor expressing the antigen in order to decrease the size of the tumor and thus enable or siinplify surgery, spare tissue during surgery, and/or decrease the resulting disfigureinent [00147] Cell cycle dosing is conteinplated in the practice of this invention. In such embodiments, a chemotherapeutic agent is used to synchronize the cell cycle of the tumor or other target diseased cells at a pre-deterinined stage Subsequently, administration of the anti-transferrin receptor antibody of this invention (alone or with an additional therapeutic morety) is inade. In alternative embodiments, an anti-transferrin receptor antibody is used to synchronize the cell cycle and reduce cell division prior to administration of a second round of treament; the second round maybe administration of an anti-transferrin receptor antibody and/or an additional therapeutic morety 40 WO 2005/121179 PCT/US2005/020253 [00148] Cheinotherapeutic agents include radioactive molecules, toxins, also referred to as cytotoxins or cytotoxic agents, which includes any agent that is detriinental to the viability of cancerous cells, agents, and hposomes or other vesicles containing chemotherapeutic coinpounds Examples of suitable chemotherapeutic agents include but are not limited to 1-dehydrotestosterone, 5-fluorouiacil decarbazine, 6-inercaptopunne, 6-thioguanine, actinoinycin D, adnainycin, aldesleukin, alkylating agents, allopunnol sodiuin, altretainine, ainifosiine, anastrozole, anthrainycin (AMC)), anti-rintotic agents , cis-dichlorodiainine platinuin (II) (DDP) cisplatin), diainino dichloro platinuin, anthracyclines, antibiotics, antiinelabolites, asparaginase, BCG hve (intravesical), betainethasone sodiuin phosphate and betainethasone acetate, bicalutainide, bleoinycin sulfate, busulfan, calciuin leucouorin, calicheainjcin, capecitabine, carboplatin, loinustine (CCNU), carinustine (BSNU), Chlorainbucil, Cisplatin, Cladnbine, Colchicin, conjugated estrogens, Cyclophosphainide, Cyclotbosphainjde, Cytarabine, Cytarabine, cytochalasin B, Dacarbazine, dactinoinycin (formerly actinoinycin), dauntrubicin HC1, daunorucbicin citrate, denileukin diftitox, Dexxazoxane, Dibroinoinannitol, dihydroxy anthracin dione, Docetaxel, dolasetron inesylate, doxorubicin HC1, dronabinol, E coh L-asparaginase, einetine, epoetin alfa, Eiwinia L-asparaginase, estenfied estrogens, estradiol, estrainustine phosphate sodiuin, ethidiuin broinide, ethinyl estiadiol, etidronate, etoposide citrororuin factor, etoposide phosphate, filgrastiin, floxundine, fluconazole, fludaiabine phosphate, fluorouracil, flutainide, foliinc acid, geincitabine HC1, glucocorticords, goserehn acetate, grainicidin D, granisetron HC1, hydioxyuiea, idarubicin HC1, ifosfarinde, interferon alfa-2b, innotecan HC1, letrozole, leucovonn calciuin, leuprolide acetate, levarinsole HC1, hdocaine, loinustine, inaytansinord, inechlorethainine HC1, inedroxypiogesterone acetate, inegestrol acetate, inelphalan HC1, inercaptipunne, inesna, inethotrexate, inethyltestosterone, inithrainycin, initoinycin C, initotane, inatoxantrone, inlutainide, octreotide acetate, ondansetron HC1, pachtaxel, painidionate disodiuin, pentostatin, pilocarpine HC1, pliinycin, pohfeprosan 20 with carinustine iinplant, porfiiner sodiuin, piocaine, procarbazine HC1, propranolol, ntuxiinab, sargrainostiin, stieptozotocin, tainoxifen, taxol, teinposide, tenoposide, testolactone, tetracaine, thioepa chlorainbucil, thioguainne, thiotepa, topotecan HC1, toreinrfene citrate, ti'astuzuinab, tretinoin, vatrubicin, vinblastine sulfate, vincnstine sulfate, and vmorelbine tartrate [00149] In a preferred embodiment, the cytotoxin is especially effective in dividing or lapidly dividing cells, such that non-dividing cells are relatively spared from the toxic effects [00150] The antibodies of the invention can be internalized within the diseased or carcmomna cells to which they bind and are therefore particularly useful for therapeutic 41 WO 2005/121179 PCT/US2005/020253 applications, for example, delivering into the cells toxins that need to be internalized for their adverse activity Examples of such toxins include, but not limited to, saponn, cahcheainicin, aunstatin, and inaytansinord [00151] The antibodies or polypeptides of the invention can be associated (including conjugated or linked) to a radioactive molecule, a toxin, or other therapeutic agents, or to liposomes or other vesicles containing therapeutic agents covalentjy or non-covalently, directly or indirectly The antibody maybe linked to the radioactive molecule, the toxin, or the chemotherapeutic molecule at any location along the antibody so long as the antibody is able to bind its target transferrin receptor [00152] A toxin or a chemotherapeutic agent maybe coupled (e g , covalently bonded) to a suitable monoclonal antibody either directly or indirectly (e g , via a linker group, or, alternatively, via a linking molecule with appropriate attachinent sites, such as a platform molecule as described in U S patent 5,552,391) The toxin and chemotherapeutic agent of the present invention can be coupled directly to the particular targeting proteins using methods known in the art. For example, a duect reaction between an agent and an antibody is possible when each possesses a substituent capable of reacting with the other For example, a nucleophilic group, such as an amino or sulfhydryl group, on one maybe capable of reacting with a carbonyl-contaiinng group, such as an anhydride or an acid halide, or with an alkyl group containing a good leaving group (e g., a hahde) on the other [00153] The antibodies or polypeptides can also be linked to a chemotherapeutic agent via a inicrocarner Microcarner refers to a biodegiadable or a non-biodegradable particle which is insoluble in water and which has a size of less than about 150, 120 or 100 inin in size, more coininonly less than about 50-60 j,iin, preferably less than about 10, 5, 2 5,2 or 1.5 jxin Microcarners include "nanocarneis", which are inicrocainers have a size of less than about 1 u,in, prefeiably less than about 500 nin Such particles are known in the art. Solid phase inicrocarners maybe particles formed from biocoinpatible naturally occurring polyiners, synthetic polyiners or synthetic copolyiners, which mayinclude or exclude inicrocarners formed from agarose or cioss-hnkecl agarose, as well as other biodegradable inaterials known in the art Biodegradable solid phase inicrocarners maybe formed from polyiners which are degradable (e.g , poly(lactic acid), poly(glycohc acid) and copolyiners thereof) orerodible (e g , poly(ortho esters such as 3,9-diethylidene-2,4,8;30-tetraoxaspiro[5.5]undecane (DETOSU) or poly (anhydrides), such as poly(anhydndes) of sebacic acid) under inaininalian physiological conditions Microcarners mayalso be liquid phase (e g , orl orlipid based), such liposomes, iscoins (immune-stiinulating coinplexes, which are stable coinplexes of cholesterol, and phosphohpid, adjuvant-active saponin) without antigen, or droplets or inicelles found in orl-in-water or water-in-orl einulsions, 42 WO 2005/121179 PCT/US2005/020253 provided the liquid phase inicrocainers are biodegradable Biodegradable liquid phase inicrocarners typically incorporate a biodegradable orl, a number of which are known in the ait, including squalene and vegetable orls. Microcarners are typically spherical in shape, but rincrocaineis that deviate from spherical shape are also acceptable (e g , ellipsord, rod-shaped, etc ) Due to their insoluble nature (with lespect to water), inicrocarners are filteiable from water and water-based (aqueous) solutions. [00154] The antibody 01 polypeptide conjugates of the present invention mayinclude a bifunctional linker that contains both a group capable of coupling to a toxic agent or chemotherapeutic agent and a group capable of coupling to the antibody A linker can function as a spacer to distance an antibody from an agent in order to avord interference with binding capabilities A Iinkei can be cleavable or non-cleavable. A linker can also serve to increase the cheinical reactivity of a substituent on an agent or an antibody, and thus increase the coupling efficiency An inciease in cheinical reactivity mayalso facilitate the use of agents, or functional groups on agents, which otherwise would not be possible The bifunctional linker can be coupled to the antibody by ineans that are known in the art For example, a linker containing an active estei morety, such as an N-hydroxysuccinirrade ester, can be used for coupling to lysine residues in the antibody via an ainide linkage In another example, a linker containing a nucleophihc ainine or hydxazine residue can be coupled to aldehyde groups produced by glycolytic oxidation of antibody carbohydrate residues In addition to these direct methods of coupling, the linker can be indirectly coupled to the antibody by ineans of an interinediate carrier such as an aininodextran In these embodiments the inodified linkage is via eithei lysine, carbohydrate, or an interinediate earner In one embodiment, the linker is coupled site-selectively to free thiol residues in the piotein Moreties that are suitable for selective coupling to thiol groups on proteins are well known in the art Examples include disulfide coinpounds, ct-halocarbonyl and o> halocarboxyl coinpounds, and inaleiinides When a nucleophihc ainine function is piesent in the same molecule as an a-halo caibonyl or carboxyl group the potential exists for cyclization to occur via intramolecular alkylation of the ainine Methods to prevent this problem are well known to one of ordinary skill in the art, for example by preparation of molecules in which the ainine and a-halo functions are separated by inflexible groups, such as aryl groups or trans-allcenes, that make the undesired cyclization stereochenucally disfavored See, for example, U S PatentNo 6,441,163 for preparation of conjugates of inaytansinords and antibody via a disulfide morety [00155] One of the cleavable linkers that can be used for the preparation of antibody-diug conjugates is an acid-labile linker based on cis-acoinhc acid that takes advantage of the acidic environinent of different intracellular compartments such as the endosomes 43 WO 2005/121179 PCT/US2005/020253 encountered during receptor mediated endocytosis and the lysosomes. See, for example, Shen et al, Bwchein Biophys Res Coininun. 102 1048-1054 (1981) for the prepai ation of conjugates of daunonibicin with inacrornoleculai carriers, Yang et a] ,/ Natl Cane Inst 80 1154-1159 (1988) for the preparation of conjugates of daunorubicin to an anti-inelanoina antibody; Dillinan et al, Cancer Res 48 6097-6102 (1988) for using an acid-labile linker in a siinilar fashion to prepare conjugates of daunorubacin with an anti-T cell antibody; Trouet et al, Proc Natl Acad. Sci. 79 626-629 (1982) for linking daunorubicin to an antibody via a peptide spacer arin [00156] An antibody (or polypeptide) of this invention maybe conjugated (linked) to a radioactive molecule by any method known to the ait For a discussion of methods for radiolabeling antibody see "Cancer Therapy with Monoclonal AntibodiesT", D. M. Goldenberg ed (CRC Press, Boca Raton, 1995) [00157] Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal inUS Patent No 4,676,980. The formation of cross-hnked antibodies can target the immune system to specific types of cells, for example, cancer or diseased cells expressing transferrin receptor [00158] This invention also provides methods of delaying developinent of inetastasis in an individual with cancer (including, but not limited to, prostate, lung, breast, ovarian, pancreatic, or colon cancer) using an anti-transferrin receptor antibody or other embodiments that bind to transferrin receptor linked to a chemotherapeutic agent In some embodiments, the antibody is a humanized or chimeric form of a non-human anti-transferrin receptor antibody [00159] In yet another embodiment, the antibody can be einployed as adjuvant therapy at the time of the surgical reinoval of a cancer expressing the antigen in order to delay the developinent of inetastasis The antibody or antibody associated with a chemotherapeutic agent can also be administered before surgery (neoadjuvant therapy) in an individual with a tumor expressing the antigen in order to deciease the size of the tumor and thus enable or siinplify surgery, spare tissue during surgery, and/or decrease the resulting disfigureinent. [00160] In yet another embodiment, any of the transferrin receptor binding embodiments described herein can bind to transferrin receptor-expressing cancerous cells and induces an active immune response against the cancerous cells expressing transferrin receptor In some cases, the active immune response can cause the death of the cancerous cells (e g , antibody binding to cancer cells inducing apoptotic cell death), or inhibit the growth (e g , block cells cycle progiession) of the cancerous cells In other cases, any of the novel antibodies desenbed herein can bind to cancerous cells and antibody dependent cellulai cytotoxicity (ADCC) can eliininate cancerous cells to which anti-transferrin receptor binds 44 VO 2005/121179 PCT/US2005/020253 Accordingly, the invention provides methods of stiinulating an immune response comprising administering any of the compositions descnbed heiein (00161} In some cases, antibody binding can also activate both cellular and huinoral immune responses and reciuit more natural killer cells or increased production of cytokines (e g , IL-2, IFN-g, IL-12, TOF-a, TNF-b, etc) that further activate an individual's immune system to destroy cancel ous cells In yet another embodiment, anti-transferrin receptor antibodies can bind to cancerous cells, and inacrophages or other phagocytic cell can opsonize the canceious cells [00162] Various formulations of anti-transferrin receptor antibodies or fiaginents thereof maybe used for administration In some embodiments, anti-transferrin receptor antibodies or fragments thereof maybe administered neat. In addition to the pharinacologically active agent, the compositions of the present invention maycontain suitable pharmaceuticallyacceptable earners comprising excipients and auxiliaries that are well known in the art and are lelatively inert substances that facilitate adiniinstiation of a pharinacologically effective substance or which facilitate processing of the active coinpounds into prepaiations that can be used pharmaceuticallyfor dehvery to the site of action For example, an excipient can give form or consistency, or act as a diluent Suitable excipients include but are not limited to stabilizing agents, wetting and einulsifying agents, salts for varying osinolanty, encapsulating agents, buffers, and skin penetration enhancers [00163] Suitable formulations for parenteral administration include aqueous solutions of the active coinpounds in watei-soluble form, for example, water-soluble salts In addition, suspensions of the active coinpounds as appropriate for orly injection suspensions maybe administered Suitable hpophilic solvents or vehicles include fatty orls, for example, sesame orl, or synthetic fatty acid esters, for example, ethyl oleate or tnglycendes Aqueous injection suspensions maycontain substances that increase the viscosity of the suspension and include, for example, sodiuin cai boxy inethyl cellulose, sorbitol,Hnd/or dextian Optionally, the suspension mayalso contain stabilizers Liposomes can also be used to encapsulate the agent for delivery into the cell [00164] The pharmaceutical formulation for systemic administration according to the invention maybe formulated for enteral, parenteral or topical administration Indeed, all three types of formulation maybe used siinultaneously to achieve systemic administration of the active ingredient Excipients as well as formulations for parenteral and nonparenteial drug delivery are set forth in Reinington, The Science and Pi actice of Pharinacy 20th Ed Mack Publishing (2000) 45 WO 2005/121179 PCT/US2005/020253 [00165] Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof [00166] Generally, these agents are formulated for administration by injection {e g., intrapentoneally, intravenously, subcutaneously, intiainuscularly, etc ), although other forms of administration {e g , oral, inucosal, etc) can be also used Accordingly, anti-transferrin receptor antibodies are pieferably coinbined with pharmaceuticallyacceptable vehicles such as saline, Ringer's solution, dextrose solution, and the like [00167] The particular dosage regiinen, i e , dose, tiining and repetition, will depend on the particular individual and that individual's inedical history Geneially, a dose of at least about 100 ug/kg body weight, more preferably at least about 250 ug/kg body weight, even more preferably at least about 750 ug/kg body weight, even more preferably at least about 3 ing /kg body weight, even more pieferably at least about 5 ing /kg body weight, even more preferably at least about 10 ing/kg body weight is administered [00168] Einpirical considerations, such as the half-life, generally will contribute to the deterinination of the dosage Antibodies, which are coinpatible with the human immune system, such as humanized antibodies or fully human antibodies, maybe used to prolong half-life of the antibody and to prevent the antibody being attacked by the host's immune system. Frequency of administration maybe deterinined and adjusted over the course of therapy, and is based on reducing the number of cancerous cells, inaintaining the reduction of cancerous cells, leducing the proliferation of cancerous cells, or delaying the developinent of inetastasis Alternatively, sustained continuous lelease formulations of anti-transferrin receptor antibodies maybe appropriate. Various formulations and devices for achieving sustained release are known in the art [00169] In one embodiment, dosages for anti-transferrin receptor antibodies maybe deterinined einpirically in individuals who have been given one or more administration(s) Individuals are given increinental dosages of an anti-transferrin receptor antibody. To assess efficacy of anti-transferrin receptor antibodies, amarker of the specific cancer disease state can be followed These include direct ineasureinents of tumor size via palpation or visual observation, indirect ineasureinent of tumor size by x-ray or other iinaging techniques, an iinproveinent as assessed by direct tumor biopsy and inicroscopic exainination of the tumor sample, the ineasureinent of an indirect tumormarker (e.g y PSA for prostate cancer), a decrease in pain or paralysis, iinproved speech, vision, breathing or other disability associated with the tumor, increased appetite, or an increase in quality of life as ineasured by accepted tests or prolongation of survival It will be apparent to one of skill in the art that the dosage will vary depending on the individual, the type of cancer, the stage 46 WO 2005/121179 PCT/US 2005/020253 of cancel, whether the cancer has begun to inetastasize to other location in the individual, and the past and concurrent tieatinents being used [00170] Other formulations include suitable delivery forms known in the ait including, but not limited to, carriers such ashposomes See, for example, Mahato et al (]997) Pkarrru Res 14 853-859 Lrposornal preparations include, but are not bruited to, cytofectins, inultilainellai vesicles and uinlainellar vesicles [00171] In some embodiments, more than one antibody maybe present The antibodies can be monoclonal or polyclonal Such compositions maycontain at least one, at least two, at least three, at least four, at least five different antibodies that are reactive against carcmomnas, adenocarcmomnas, sai coinas, or adenosarcoinas Anti-transferrin receptor antibody can be adinixed with one or more antibodies reactive against carcmomnas, adenocarcmomnas, sarcoinas, or adenosarcoinas in organs including but not limited to ovary, breast, lung, prostate, colon, kidney, skin, thyiord, bone, upper digestive tract, and pancreas In one embodiment, a inixture of different anti-transferrin receptor antibodies is used A inixture of antibodies, as they are often denoted in the art, maybe particularly useful in treating a broader range of population of individuals [00172] The following examples are provided to illustrate, but not to liinit, the invention EXAMPLES [00173] Certain Materials and Methods referred to in the following Examples are presented at the end of this section Example 1 Preparation of cancer cell hues as an immunogen [00174] Whole cells isolated 1roin tissue or from cell culture were used as an immunogen for producing monoclonal antibodies that are specific for surface antigens lepresentative of a particular cell type. Such methods, suitable for the practice of this invention, are described inUS Patent* 6,541,225 Generally, to produce monoclonal antibodies directed to cell-surface antigens of a specific cell type, it is desirable to iininunize non-transformed B cells with viable and intact cells of that type, preferably with those cells whose surfaces that are free of seruin Cell lines that are suitable for the generation of monoclonal antibodies against the antigen transferrin receptor, such as but not limited to LUCA31, include BT-474 (ATCC# HTB-20), MDA-MB-175VII (ATCC# HB-25), MDA-MB-361 (ATCC # HB-27), SKBR3 (ATCC# HTB-30), SKMES-1 (ATCC# HTB-58), ES-2 (ATCC# CRL-1978), SKOV3 (ATCC# HTB-77), HPAFII (ATCC# CRL-1997), Hs700T (ATCC# HTB-147), Colo205 (ATCC# CCL-222), HT-29 (ATCC#HTB-38), 47 WO 2005/121179 PCT/US2005/020253 SW480 (ATCC# CCL-228), SW948 (ATCC# CCL-237), A498 (ATCC# HTB-44) and Caki-2 (ATCC# HTB-47) [00175] The cells were grown in the appropriate nutrient inedia suppleinented with growth factors, but free of seiuin Iininunization with cells that have been propagated in a seruin-suppleinented inediuin can have extreine disadvantages Seiurn contains a coinplex inixtuie of small and large biomolecules with undefined activities These biomolecules can adhere to the surfaces of cells and thereby leading to the generation of antibodies cross-reacting with molecules not representative of the specific cell type Additionally, binding of seruin biomolecules to the cell surface maylead to the inasking of desired cell surface antigen targets A number of seruin-free inedia pieparations are coininercially known and publicly available, such as for example, F12/DME (11) nutnent inedia with the following suppleinents- insulin (10 {.ig/inl final concentration), epiderinal growth factor (EGF) (5 ng/inl final concentration), seleinous acid (2 5 x 10"s M final concentration), and porcine pituitary extract (PPE) (5 ^il/inl final concentration) [00176] To harvest the cells, the cell inonolayers were rinsed once with calciuin- and inagnesiuin-free Hanks saline solution, incubated in lOinM EDTA in Hanks saline solution at 37C for 15 ininutes The cells were detached from the culture surface by gentle pipetting. The cell suspension was pelleted by centnfugation at lOOOxg for 5 ininutes The supernatant was reinoved and cells were resuspended in seruin-free inediuin with non-denatunng adjuvant as appropriate Example 2 Generation of monoclonal antibodies [00177] A non-denaturing adjuvant (Ribi, R730, Conxa, Hainilton MT) was rehydrated to 2 inl in phosphate buffered saline 100 //I of this rehydi ated adjuvant was then gently inixed with some of the cell pellet from Example 1 to be used for iininunization Approxiinately 106 human fetal kidney cells per inouse were injected into Balb/c inice via footpad, approxiinately once or twice a week The precise iininunization schedule is as follows. Day zero, iininunization plus Ribi. Day 3, iininunization plus Ribi Day 7, immunization plus Ribi. Day 24, iininunization ininus Ribi Day 29, iininunization ininus Ribi. Day 32, iininunization ininus Ribi Day 36, iininunization ininus Ribi Day 44, iininunization ininus Ribi Day 51, iininunization ininus Ribi. Day 69, bleed for titer test Day 71. Immunization plus Ribi Day 74, iininunization plus Ribi. Day 81, iininunization plus Ribi Day 91, profusion boost (no Ribi). Day 104, harvest nodes for fusion i [00178] At Day 69, a drop of blood was drawn from the tail of each iininunized animal to test the titer of antibodies against the cell line used to iininunize using FACS analysis 4S WO 2005/121179 PCT/US2005/020253 When the titer reached at least I 2000, the inice were sacrificed using C02 followed by cervical dislocation Lyinph nodes were harvested for hybridoma preparation (00179] Lyinphocytes from inice were fused with the inouse myeloma line X63-Ag8 653 using 35% polyethylene glycol 4000 On day 10 following the fusion, the hybridoma supernatants were screened for the presence of the iininunizing cells- specific monoclonal antibodies by fluorescence activated cell sorting (FACS). Conditioned inediuin from each hybridoma was incubated for 30 ininutes with an aliquot of human fetal kidney cells After incubation, the cell sainples were washed, resuspended in 0 1 inl diluent and incubated with 1 pig/inl of FITC conjugated F(ab')2 fragment of goat anti-inouse IgG for 30 inin at 4 C The cells were washed, resuspended in 0.2 inl FACS diluent and analyzed using a FACScan (cin) cell analyzer (Becton Dickinson; San Jose, CA) Hybndoina clones were selected for further expansion, cloning, and characterization based on their binding to the surface of the human fetal kidney cells by FACS A hybridoma making a monoclonal antibody designated LUCA33 that binds an antigen designated Ag~transferrin receptor and an epitope on that antigen designated Ag-transferrin receptor 1 was selected. Example 3 Purification of anh-transferrin receptor antibodies, including- LUCA31 [00180] Huinan cancer cells such as but not limited to SKMES-1, 786-O, and Colo205 cell lines were detached from tissue culture flasks in the presence of 10 0 inM EDTA, centnfuged at 1400 rpin for 5 ininutes and resuspended in PBS containing 1 % BSA and 2inM EDTA (FACS diluent) The cells were counted and adjusted to 107 cells/inl About 0 1 inl of cells were incubated with lOOfxl FACS diluent for 30 ininutes at 37 C. Monoclonal antibodies that bind to the human cancer cell lines were punfied from tissue culture supernatant using piotein-G affinity chroinatography The following inaterials were used for the antibody purification process, hybridoma tissue culture supernatant, Iininunopure (G) IgG binding buffer (Pierce #21011 Rockford, IL), Iininunopure IgG Elution Buffer (Pierce #21009), concentrated HC1 (for adjusting pH), Corning 1 liter PES (polyether sulfone), 0 22 [xin filter (Corning #431098, Corning, NY), Ainershain Pharinacia AKTA Explorer Systein (Ainershain Biosciences, Piscataway, NJ), Protein-G Sepharose 4 Fast Flow (Ainershain Biosciences #17-0618-03), Stopping buffer consisting of 3M Potassiuin thi ocy an ate/5 OinM Tns pH 7 8, and PBS (phosphate buffered saline), 3M Tns pH9.0 [00181] To purify the inouse anti-hutransferrin receptor antibody referred to herein as LUCA31, the voluine of the supernatant was ineasured and an equal voluine of binding buffer was added to the supernatant The inixture was allowed to equilibrate to rooin 49 WO 2005/121179 PCT/US2005/020253 teinperature The supernatant was clarified by passage through a 0 22 µm filter The supernatant was loaded onto a protein-G Sepharose coluinn using the AKTA Explorer system (Ainershain Biosciences) and then washed with 5-iO coluinn voluines of binding buffer The monoclonal antibody was eluted with the elution buffer, and fractions were collected The fractions were neutralized upon elution with the addition of 3M Tns, pH 9 0 to einpty tubes (1/60 voluine of the fractions). The peak fractions containing the monoclonal antibody were pooled The pooled sainples was injected into a pre-wetted shdealyzer cassette (10,000 MW cutoff, Pierce #66810) and dialyzed in lx PBS at 4 C (with 3 buffer changes of at least 4 hours of dialysis per change) The purified monoclonal antibody was sterile filtered (02µm Acrodisc) and stored at 2-8 C. [00182] A sample of purified antibody is taken for deterinination of concentration by UV absorbance (A2S0) and SDS-polyaeryhrinde gel electrophoresis (SDS-PAGE) SDS-PAGE is run under both non-reducing and reducing conditions for analysis of molecular weight, identification of the typical banding pattern of monoclonal antibodies and assessinent of punty [00183] After purification of theLUCA31 monoclonal antibody from the hybridoma supernatant, it was re-tested for binding to human fetal kidney cells The cell sainples were prepared as described above and incubated with the purified antibody at various concentrations After incubation the cells were washed, resuspended in 01ml diluent and incubated with 1 \xg of FITC conjugated F(ab) '2 fragment of goat anti-inouse IgG for 30 ininutes at 4 C The cells were washed, resuspended in 0 5 inl FACS diluent and analyzed using a FACScan cell sorter (Becton Dickinson, San Jose, CA) A shift to the right on the FACScan histograin indicated that the purified antibody still bound to human fetal kidney cells [00184] In other experiinents, the binding of the LUCA31 antibody to transferrin receptor was tested using live cell ELISA The following method was used, although other methods coininonly known in the field are applicable. Cells (HT-29, SKOV3, SKMES-1, SW480, SKBR-3, and HP AMI) were grown in 10% fetal bovine seruin (FBS) containing inedia to confluency on tissue culture treated 96-well plates (Falcon) Cells were washed with PBS and then incubated with 50u.l of desired antibodies at a desired concentration in Hank's Balanced Salt Solution (HBSS) containing 1% BSA and 0 1% sodiuin azide for 1 hour at rooin teinperatuie The cells were then washed three tiines with 100µl per well of HBSS before incubation with horseradish peroxidase (HRP) secondary antibody (50µl per well diluted in HBSS) for 30 ininutes at rooin teinperature The cells were finally washed three tiines with HBSS and the color change substrate (TMB substiate, KPL) was added to 50 WO 2005/121179 PCT/US2005/020253 each well at IOOµ1 per well The color change leaction was stopped with the addition of lOOµl per well of 1M phosphoric acid The plates were then read at 0 D 450nm Example 4 Sequencing of LUCA31 [00185] RT-PCR with the degenerate oligos listed in the Materials and Methods section yielded distinct bands using MVHrevl and rev2 with MVHfwd9 for the heavy chain. For the light chain, the combination or MVLrev with both MVLfwd2 and fwd5 yielded product The PCR prograin used includes a 10-minute incubation at 72°C for use in Topo cloning PCR products were ligated to the pCR2 1 Topo TA cloning vector following the inanufactiner's protocol Twenty colonies of each hgation were picked for inini preps and those with the correct sized inserts were subinitted to inicrocheinistry for sequencing with M13andM13rev [00186] Consensus sequence was derived for each PCR product, used in a BLAST seaich, and representative inini preps were chosen to proceed with cloning Luca31 Light Chain [00187] The Luca31 LC generated with MVLrev and MVLfwd2 had an incoinplete Vregion The LC generated with MVLfwd5 was coinplete Clone 5.19 was chosen for use as the teinplate in the next step of cloning PCR priiners were designed to incorporate a Hindlll site and optiinal Kozak at the 5' end, and aBbsI site at the 3' end of the VL region Priiner Naine Sequence __ Luca31 VL fwd GAAAACCAAGCTTACCGCCACCATGGATTTTCAGGTGCAG Luca31 VLrev CGGGAAGATGAAGACAGATGGTGCAGCATCAGCCCG 51 WO 2005/121179 PCT/US2005/020253 [00188] PCR was earned out on LC clone 5.19 and the resultant band was gel extracted, digested with Hindll and Bbsl, then hgated to the 8 5 kb pDEF2B/Kappa vector fragment, digested with the same enzyines, to yield pDEF2B/Luca31 LC Mini-preps were sequenced with pniners 96-91 and CM-KR and a correct clone was chosen to seed a inaxi prep culture [00189] Light chain expression vectors were created by hgating the 1776 bp NotI - Xbal LC fragment from pDEF2B/Luca31 LC to the 11 7 kb pNEF32 or 19 4 kb pNEF5 NotI -Xbal vector fragments, to create pNEF32/Luca31 LC and pKEF5/Luca31 .LC Luca31 Heavy Chain [00190] The Luca31 HC PCR products differed only in their 3' ends, as MVHrevl and rev2 are slightly offset from each other A consensus sequence was generated, and contains two rare codons, but the DNA sequence is clear at those sites Clone 9R1 1 was chosen for use as the teinplate in the next step of cloning PCR pniners were designed to incorporate a HindHI site and optiinal Kozak sequence at the 5' end and an Nhel site at the 3' end of the VH region Priiner Naine Sequence Luca31 VHfwd GAAAACCAAGCTTGCCGCCACCATGGATTGGGTGTGGAAC Luca31 VHiev GCCCTTGGTGCTAGCTGCAGAGACAGTGACCAGAGT [00191] PCR was carried out on HC clone 9R1 1 and the resultant band was gel extracted, digested with Hindlll and Nhel, then hgated to the 9.3 kb pICFSP IgGl NH or pICFSP.IgG4 NH HindIII - Nhel vector fragments to create pICFSP.Luca31 Gl or G4.HC, respectively [00192] Heavy chain expiession vectors were created by bgating the 3 2 NotI - Xbal HC fragments from pICFSP Luca31 Gl or G4 HC to the 12 kb pDEF32 or 19 7 kb pDEF14 NotI - Xbal vector fragments to create pDEF32/Luca31 Gl HC, pDEF14/Luca31 Gl HC, pDEF32/Luca31 G4.HC and pDEF14/Luca31 G4 HC 52 WO 2005/121179 PCT/US2005/020253 [00193] All-in-one expression vectors [00194] pDEF14 all in one expression vectors were created by ligating the 19.7 kb pDEFI4 NotI - Xbal vector fragment to a 3.4 kb Bglll - Xbal pDEF2B/Luca31 LC light chain fragment and a 6 5 kb NotI - BainHI pICFSP/Luca31 GI to create pDEF14/Luca31 1 [00195] The following sequences were deterinined. WO 2005/121179 PCT/US2005/020253 Suininary View of Contig "Consensus Aligninent Topo LC5" >LC Lig5 2 #1 GGGACGTCGA CATGGATTTT CAGGTGCAGA TTTTCAGCTT #1> ATGGATTTT CAGGTGCAGA TTTTCAGCTT #1> ATGGATTTT CAGGTGCAGA TTTTCAGCTT #1 GGGACGTCGA CATGGATTTT CAGGTGCAGA TTTTCAGCTT >LC Lig5 2 #41 CCTGCTAATC AGTATCTCAG TTGTAATGTC CAGAGGAGAA #41 CCTGCTAATC AGTATCTCAG TTGTAATGTC CAGAGGAGAA >LC Lig5.2 #81 AATGTGCTCA CCCAGTCTCC AGCAATCATG TCTGCATCTC #81 AATGTGCTCA CCCAGTCTCC AGCAATCATG TCTGCATCTC >LC Lig5 2 #121 TAGGGGAGAA GGTCACCATG AGCTGCAGGG CCAGCTCAAG #121 TAGGGGAGAA GGTCACCATG AGCTGCAGGG CCAGCTCAAG >LC Lig5 2 #161 TGTAAATTAC ATATACTGGT ACCAGCAGAA GTCAGATGCC #161 TGTAAATTAC ATATACTGGT ACCAGCAGAA GTCAGATGCC >LC Lig5.2 #201 TCCCCCAAAC TGTGGATTTA TCACACATCC AACCTGGCTC #201 TCCCCCAAAC TGTGGATTTA TCACACATCC AACCTGCCTC >LC Lig5.2 #241 CTGGAGTCCC AGCTCGCTTC AGTGGCAGTG GGTCTCGGAA #241 CTGGAGTCCC AGCTCGCTTC AGTGGCAGTG GGTCTGGGAA >LC Lig5 2 #281 CTCTTATTCT CTCACAATCA GCAGCATGGA GGGTGAAGAT #281 CTCTTATTCT CTCACAATCA GCAGCATGGA GGGTGAAGAT 54 55 WO 2005/121179 PCT/US2005/020253 56 WO 2005/121179 PCT/US2005/020253 WO 2005/121179 PCT/US2005/020253 Example 5 Western blot analysis of transferrin receptor expression in cancer cell line SW480 [00196] Renal cell carcmomna cells SW480 (ATCC# CCL-228) were grown to confluency on 175 cin2 culture dishes The confluent inonolayer was washed three tiines with Hank's Balanced Salt Solution (HBSS-f containing no sodiuin bicarbonate or phenol 57 WO 2005/121179 PCT/US2005/020253 red, buffered with 30inM HEPES, pH 7 4, Sigina Cheinicals) and biotinylated with 200 µg of sulfo-NHS-LC-biotin (Pierce Endogen) for 30 ininutes at looin teinperature The cells were then washed with HBSS+ containing 0.1M Tns, pH 7 4 (Sigina Cheinicals) and incubated in HBSS+ containing 0 1M Tns, pH 7 4 for 15 ininutes at rooin teinpeiature The cells were finally washed three tiines with HBSS+ and lysed by incubation for 5 ininutes, on ice, in lysis buffer (HBSS+ with 2% Triton X-100, 2inM PMSF, 0 1% sodiuin azide, and 1 tablet per 5inl lysis buffer of EDTA free coinplete rruni-protease cocktail (Roche Molecular Biocheinicals)) [00197] Cells were scraped in lysis buffer and lysates collected. Lysates were centrifuged at 14,000 x g for one hour at 4 C. The clarified lysate was then pre-cleared for 2 hours at 4 C with 5 ui of human IgG conjugated (Iing/inl) CNBr4MB sepharose beads (Ainershain Pharinacia) Huinan IgG beads were centnfuged and reinoved, and then the pre-cleared lysate was then incubated with monoclonal antibody LUCA31 conjugated to CNBr 4MB Sepharose beads (conjugated at 1 mg/ml) for 2 hours at 4 C The LUCA31 beads were centnfuged and reinoved after the 2-hour incubation Both the human IgG and the LUCA31 beads were individually washed three tiines with 1 inl of lysis buffet and then washed three tiines with linl HBSS+. The washed beads were eluted by the addition of 30 Ml of SDS-PAGE sample buffer and borling at 99 C for 5 ininutes [00198] The sainples were then resolved on a 4-20% Novex giadient gel (Invitrogen), and transferred onto 0.2nin nitrocellulose ineinbrane (Invitrogen) and visualized by horse radish peroxidase (HRP) conjugated streptavidin (Pierce Endogen) or western blotted with 5µg/blotof LUCA31. [00199] For detection with HRP conjugated streptavidin, the nitrocellulose was first blocked for 1 hour with blocking buffer (5% non-fat dry milk in Tns-buffered saline with 0 05% Tween-20 (TBST)) HRP conjugated streptavidin was diluted into TBST at 1 M-g/inl and exposed to the nitrocellulose for 30 ininutes at rooin teinperature The nitrocellulose was washed three tiines in TBST before visualization with ECL+ (Ainershain) [00200] For western blotting with LUCA31, the nitrocellulose was siinilarly blocked for 1 houi in blocking buffer. The nitrocellulose was then incubated in a heat sealed plastic pouch containing ll of 5 u,g/ml LUCA31 diluted in blocking buffer The nitrocellulose was washed 3 tiines with TBST before incubation with 10inl of l(µg/ml HRP conjugated donkey anti-inouse IgG (heavy and light chain specific, cross adsorbed against bovine, chicken, goat, guinea pig, Synan hainsters, horse, human, rabbit, sheep seruin proteins, Jackson Iininunoresearch Cat. #709-035-149) for 1 hour at rooin teinperature The 58 WO 2005/121179 PCT/US2005/020253 nitrocellulose was finally washed three tiines with TBST and visualized by ECL+ (.Aineishain) [002011 Figure 1 shows theimmunoprecipationof SW480 cell lysate with LUCA31 and then a westei n blot using LUC A31 antibody The arrow pornts to the unique band with the approxiinate molecular weight of 90-100 kDa Example 6 Immunohistochemistry methods [00202] Frozen tissue sainples from cancer patients were einbedded in OCT coinpound and quick-frozen in isopentane with dry ice. Cryosections were cut with a Leica 3050 CM inictiotoine at thickness of 8-10 ^in and thaw-inounted on SuperFrost Plus slides (VWR #48311-703) The sections were fixed with 75% acetone/25% ethanol at 10 C and allowed to air-dry 2-4 hours at rooin teinperature The fixed sections were stored at -80 C until use [00203] For immunohistochemistry, the tissue sections were retrieved washed in Tris buffered 0 05% Tween (TB-T) and blocked in blocking buffer (TB-T, 5% normal goat seruin and lOOi^g/inl avidin) for 30 ininutes at rooin teinperature The slides were then incubated with the anti-transferrin receptor and control monoclonal antibodies diluted in blocking buffer (1 /ig/inl) for 60-90 ininutes at looin teinperature The sections were then washed three tiines with the blocking buffer The bound monoclonal antibodies were detected with a goat anti-inouse IgG + IgM (H+L) F(ab')2-peioxidase conjugates and the peioxidase substrate diarinnobenzidine (1 ing/inl, Sigina cat No. D 5637) inOlM sodinin acetate buffer pH 5 05 and 0 003% hydrogen peroxide (Sigina cat No H1009) The stained slides were counter-stained with heinatoxylin and exainined under Nikon inicroscope [00204] In some cases, paraffin einbedded formaldehyde-fixed tissues were used for immunohistochemistry after appropriate antigen retrieval methods were einployed One such antigen retrieval method is described in Manghain and Isaacson, Histopathology 35 129-33 (1999) Other methods of antigen retrieval and/or detection maybe used by one skilled in the art Results from siinilar experiinents performed using frozen tissues or, where appropriate, fixed tissue with antigen retrieval and polyMICA detection were performed The binding of anti-transferrin receptor antibody to a variety of normal and cancer tissues was assessed In all cases, antibody binding in control fixed tissues was correlated with that of frozen tissues The results from frozen tissues were only used if the two did not inatch in the controls. [00205] For convenience, a suininary of the coinbined results of several experiinents using frozen surgical tissue from different sources is shown below in Table 1 and Table 2. 59 WO 2005/121179 PCT/US2005/020253 Table 2. Distribution of LUCA31 epitope in human tumor tissues Tissue Type Results Prostate +/- focal staining on 1 out of 4 tumors screened 3/4 tumors negative Colon 3+ staining (5/5 tumors screened) ' Kidney 1-2+ focal staining on 4/5 tumors screened, Negative on 1/5 tumors screened Lung 2-3+ staiinng on 6/7 tumors screened, Negative on 1/7 tumors screened Ovary Variable, 1-3+ focal staining on 4/4 tumors screened Pancreas Variable, 1-3+ staining on 5/5 tumors screened Breast 1+ on 2/2 tumors screened Table 1. Distribution of LUCA31 epitope in normal human tissues Tissue Type Results Skin 1+ on sebaceous gland and subset of sweat glands Lung Negative except for 3+ on inaciophages Kidney Negative except for 1 -2+ on few tubules Pancreas Negative except for 1+ staining on a few scattered cells Liver focal 2+ staining on hepatocytes (-10%) Colon 3+ on upper half or third of the inucosa, 1+ on iniddle one third of the inucosa Duodenuin [00206] [002071 3+ on inucosa (inostly basolateral) Example 7 Iininiinocytocherinstrv results [00208] Monoclonal antibody LUCA31 was used to test reactivity with various cell lines from different types of tissues The results were scored as '+' for weak positive staining, '++' for inoderate positive staining, '+++' for strong positive staining and '-' for negative staining [00209] Iininunohistocheinistry results were obtained using CellArray(tm) technology, as described in WO 01/43869 Cells from different established cell lines were reinoved from the growth surface without using proteases, packed and einbedded in OCT coinpound The cells were frozen and sectioned, then stained using a standard IHC protocol [00210] Results of the binding of the LUCA31 antibody to various established human normal and tumor cell lines are coinpiled for convenience in Table 3 The experiinents 60 WO 2005/121179 PCT/US2005/020253 represented in Table 3 include Live-cell ELISA and CellArray(tm) binding experiinents using the methods described herein [00211] [00212] TABLE 3 Reactivity Reactivity Cell Live Cell Cell line ATCC# Organ Cell Type | Array ELISA Norinal inaininary HMEC CC-2251 * Breast epithelial - Endothelial Norinal human HuVEC Priinary cells adult - Ductal BT474 HTB-20 Breast carcmomna + MCF7 HTB-22 Breast Adenocarcmomna Ductal MDA175 HB-25 Breast carcmomna + MDA361 HB-27 Breast Adenocarcmomna ++ SK-BR-3 HTB-30 Breast Adenocaicinoina + + 9979 RAVEN Lung Lung cancer line + A549 CCL-185 Lung Carcinoina , , Sinall cell CA130 RAVEN Lung carcmomna +++ CaLu3 HTB-55 Lung Adenocarcmomna Squainous SKMES1 HTB-58 Lung carcmomna + + ES-2 CRL-1978 Ovary Caicrnoina + !___ SKOV3 HTB-77 Ovary Adenocarcmomna + + 9926 RAVEN Pancreas Adenocarcmomna ++ AsPC-1 CRL-1682 Pancreas Adenocarcmomna HPAFII [ CRL-19971 Pancreas [Adenocarcmomna[ + | 61 WO 2005/121179 PCT/US2005/02025 Hs700T HTB-147 Pancreas Adenocarcmomna + Ascites colorectal Colo205 CCL-222 Colon adenocarcmomna ++ Colorectal HT-29 HTB-3 8 Colon adenocarcmomna + + Colorectal SW480 CCL-228 Colon adenocarcmomna ++ + Colorectal SW948 CCL-237 Colon adenocarcmomna ++ Transformed with adenovirus5 293 CRL-1573 Kidney DNA - Renal Cell 786-O CRL-1932 Kidney Caicinoina - A498 HTB-44 Kidney Caicinoina + Clear cell Caki2 HTB-47 Kidney carcmomna ++ Kidney (African I Green SV40 Cos 7 CRL-1651 Monkey) tiansformed - RL65 CRL-10345 Lung (Rat) - Einbryo Fibroblast, SV4C SVT2 CCL-163 1 (Mouse) transformed 22RV1 CRL-2505 Prostate Carcinoina , DXJ145 HTB-81 Prostate Adenocarcmomna LNCaP ' CRL-1740 Prostate Carcinoina + PC3 CRL-143 5 Pi ostate Adenocarcmomna Prostate cancer TDH-1 RAVEN Prostate line + Hs746T HTB-135 Stoinach Carcinoina ' NCI-N87 |CRL-5822l Stoinach | Carcinoina : 62 WO 2005/121179 PCT/US2005/020253 CC-2251 BioWhittaker [00213] Monoclonal antibody LUCA31 was used to test reactivity with ghoina-denved cell lines Iininunocytocheinistry results were obtained using siinilar protocols as described above for the CellArray(tm) technology The glioina-denved cell lines were reinoved from the growth surface without using proteases, packed and einbedded in OCT coinpound. The cells were frozen and sectioned, then stained using a standard IHC protocol. LUCA31 was positive on 21 out of 25 glioina-denved cell lines screened Staining intensity ranged from +/- to 2+ staining Example 8 Additional LUCA cell line screening [00214] Analysis of tumor cell line distribution. LUCA31 epitope expression was evaluated using a panel of 32 human tumor cell lines representing colorectal, non-small cell lung and pancreatic cancers. The binding of LUCA31 to the target cells was deterinined relative to an internal antibody standard (anti-EGF receptor) and the data plotted as a function of inean fluorescent intensity The distribution of LUCA31 staining is shown in Figure 2. The results of the epitope expression experiinents indicated LUCA31 has a broad range of staining intensities across the cell panel Example 9 Cell Proliferation assays [00215] To deterinine the biological activity of the LUCA31 antibody we tested it in cell proliferation assays, as described elsewhere herein, that ineasure tntiated thynudine incorporation Assays were performed for the same 32 cell lines represented in the FACS array and an additional five cell lines that we had shown previously were recognized by this antibody. We tested the antibody for activity using both standard (30%) and low (0 5%) seruin conditions. The decision to test for activity using both seruin conditions was based on experience with the inouse EGF receptor antibody 225 (murineprecursor of cetuximab) which is only active using reduced seruin conditions. [00216] Each antibody was tested using five concentrations (10, 5,2 5, 1 25 and 0 6ug/inl) of antibody and the results coinpared to a no-antibody control Each assay was performed in triplicate The result of the primary screen of cells is suininarized in Table 4 and indicates LUCA31 is broadly active in tins panel of cell lines Shaded cells represent positive scores with the numbers representing inaxiinuin inhibition of cell proliferation (I e 90=90% growth inhibition) [00217] Inhibition of cell prolifeiation equal to or greater than 40% was scored as positive This threshold indicates that the antibody exhibits intrinsic biological activity, consistent with experience with trastuzuinab and the EGF receptor antibody 225, both of 63 WO 2005/121179 PCT/US2005/020253 64 which induce a 40-50% reduction in cell proliferation in this assay The LUCA31 antibody was particularly active in this assay, often substantially reducing cell proliferation under low seruin conditions The influence of seruin concentration on the activity of this antibody is siinilar to what is observed for the EGFR antibody 225 using either ASPC-1 or A431 cells WO 2005/121179 PCT/US2005/020253 Example 10 AdditionalIHCAnalysis [002181 LUCA31 was evaluated using a panel of normal (brain, colon, heart, liver, kidney, lung, pancreas, small intestine, spleen) and tumor (breast, colon, lung, pancreatic; tissues as described in Materials and Methods. Staining was first optiinized using tissues identified by Raven as staining positive Subsequent to optiinization, tissues were evaluated for iininunoreactivity using peroxidase conjugated secondary antibodies and scored for intensity A suininary of the IHC data produced using LUCA31 at 0 lug/inl is presented in Table 5 For LUCA31 the strongest staining in normal tissues is seen in colon and small intestine with limited staining observed in other tissues Example 11. Isolation and Chai actenzation oftransferrin receptor antigen [00219] To identify the antigen to which LUCA31 was reactive, animmunoprecipation(Ippt) experiment was performed For Ippt, 30 175cin2 flasks of SW480 cells were lysed with 30inl of lysis buffer The lysis buffer consisted of Hanks balanced salt solution (HBSS+) fortified with 2% Triton X-100, protease inbibitor cocktail (1 tablet per 5inl lysis buffer of coinplete mm EDTA free protease cocktail from Roche Molecular Biocheinicals), 0 1 % sodiuin azide, and 2inM PMSF The cell lysate was clarified at 24,000xg for 30 ininutes at 4°C before being passed over a coluinn consisting of linl Protein G (Ainershain Pharinacia). The pre-cleared SW480 lysate was then incubated with Protein G absorbed transferrin receptor (10;µg transferrin receptor was pre-incubated for 30 ininutes at rooin 65 WO 2005/121179 PCT/US2005/020253 teinp with 5µl Protein G) for 2 hours at 4°C The beads (both the pre-clear Protein G beads and the Protein G absorbed transferrin receptor beads) were then washed three tiines with lysis buffer before elution with 30 µl SDS sample buffer (3%SDS, 20% glycerol, lOinM DTT, 2% Broinophenol blue, 0 1M Tns, pH8 0) Twenty-five inicrohters of the eluate was then resolved by SDS-PAGE and visualized through Cooinassie staining Five inicrohters of the eluate was resolved by SDS-PAGE and further transferred to nitrocellulose for western blotting [00220] The blot was then probed with LUCA31 and developed using a Western Blotting Kit (Invitrogen Cat. No WB7103) to confirin antigen recognition By western blotting the transferrin receptor and inouse IgG eluate against transferrin receptor, a protein unique to the transferrin receptor eluate (90-lOOkDa) was observed By Cooinassie staining, there was observed to be a transferrin receptor unique protein at ~100kD Stained protein bands from the NuPAGE gel are excised using clean scalpel blades and are placed in clean Eppendorf tubes Excised bands are stored at -20°C until used for protein identification by inass spectroinetry. Example 12 Characterization of the antigen to which LUCA31' binds using Mass Spectroinetry (MS/MS) 66 WO 2005/121179 PCT/US2005/020253 [00221] The antigen to which LUCA31 binds was isolated as described in Example J 1 and subjected to Tandein inass spectroscopy according to the method of Kane et al. J Bio Chem 2002 June 21,277(25) 22115-8, Epub May 06 Proteins were separated by SDS-PAGE, and the gel stained with collordal Cooinassie Blue reagent (Invitrogen) Proteins of interest were digested in gel with trypsin The tryptic peptides were sequenced by inicrocapillary liquid chroinatography MS/MS on an ion trap inass spectroineter (Therino-Finnigan LCDQ DECA XP), as described in Wu et al., Nature 405 477-482 (2000) The lesults of this yielded one pblypeptide with a inass consistent with a fragment of the transferrin receptor [00222] To confirin whether LUCA31 binds to the transferrin receptor we performed experiinents using a preparation of purified transferrin receptor derived from human placenta As shown in Figure 3, anotheranti-transferrin receptor antibody, LUCA29 and the coininercially available ;transferrin receptor antibody BER-T9 both bind to punfied transferrin receptor, but LUCA31 does not Siinilar results were achieved when this experiment was repeated with a different preparation of transferrin receptor (data not shown) i [00223] We interpreted these data to indicate that LUCA31 eithei binds to a protein that interacts with the transferrin receptor or binds to an epitope that is not well represented in the sample of punfied inaterial. To refine our understanding of the LUCA31 target we performed the following experiinents. a., Antibody coinpetition analysis We evaluated the capacity of known transferrin receptor antibodies to coinpete with LUCA31 for binding to HCT15 cells The results of this experiment are shown in Figure 4, A and B We found the capacity of biotinylated LUC A31 to bind to HCT15 cells was fully inhibited by antibody 42/6 and partially inhibited by OVCA26, LUCA29 and KID21 The 0VCA18 antibody increased binding of LUCA31 to cells and the other transferrin receptor antibodies did not appear to affect LUCA31 binding Figure 4B deinonstrates the negative control antibody 1B7 11 has no effect on LUCA31 binding and that non-biotinylated LUCA31 fully blocks the binding of the biotinylated antibody Based on these observations, we propose that LUCA31 mayrecognize an epitope that is stabhzed or induced by the OVCA18 antibody and that this epitope maybe linked, functionally, to the transferrin binding site. What makes this observation particularly interesting is that OVCA18 also stiinulates cell proliferation (data not shown) and stiinulates binding of transferrin to cells (see Figure 6 below) Taken together, these data are 67 WO 2005/121179 PCT/US2005/020253 consistent with the idea that LUCA31 is binding to the transferrin receptor, but do not rule out the possibility that the antibody might have bound to an associated factor that shares a binding site with a subset of the transferrin receptor antibodies b. Expression of transferrin receptor in CHO cells. To further clarify the LUCA31 epitope we cloned and expressed the full-length human transferrin receptor in CHO cells, as described in Materials and Methods As shown in Figure 5, FACS analysis of LUCA31 staining of CHO cells was coinparable to the level of staining observed with secondary antibody alone. In contrast, CHO cells transfected with the transferrin receptor construct showed substantial staining with LUC A31 relative to the secondary antibody reagent These data, along with the antibody coinpetition study results, indicate that LXJCA31 binds directly to the transferrin receptor. . Putative Mechanisin of Action Our current data is consistent with the idea that the LUCA31 antibody binds directly to the transferrin receptor, but that it mayinteract with an epitope that is not coininonly recognized by monoclonal antibodies (inAbs) that specifically bind transferrin receptor Transferrin receptor antibodies have been shown previously to block cell proliferation by restncting iron trasport via perturbation of transferrrin receptor endocytosas or by blocking the binding of transferrin to the receptor. To deterinine whether LUCA31 and transferrin coinpete for binding to the receptor, we exainined the interaction of LUCA31 and transferrin in cell binding assays Increasing concentrations of transferrin did not appreciably affect the binding of LUCA31' to cells, but did reduce the binding of the benchinark transferrin receptor antibody 42/6 (Figure 6A) Interestingly, the addition of LUC A31 increased the binding of transferrin to cells whereas the benchinark antibody 42/6 inhibited tiansferrin binding (Figure 6B) These results indicate that, unlike 42/6, LUCA31 binds to a site that does not overlap with transferrin binding'. This is interesting, considenng the observation that 42/6 does inhibit LUCA31 binding to cells. We also exainined the effect of the OVCA18 antibody in these studies because of its effect on LUC A31 binding to cellst Like LUCA31, the OVCA18 antibody also increased transfenin binding to cells, but to a lesser degree 68 WO 2005/321179 PCT/US2005/020253 Example 13 Additional Tissue Binding Studies 69 [00224] Target Expression and distribution Because our data is consistent with the idea that LUC A31 binds to an epitope present on the transferrin receptor, we felt that it was iinportant to evaluate the tissue distribution and expression of the LUCA31 epitope in comparision with the transferrin receptor Previous studies had indicated LUCA31 did not stain liver, pancreas or brain sections and that these tissues are normally recognized by transferrin receptor inAbs To extend on this, we analyzed the staining pattern of three known transferrin receptor antibodies (H68.4, BERT9 and DF1513) and LUCA31 using three sainples of each of these tissues, and including colon as a reference tissue. The suininary of this experiment is shown in Table 6. WO 2005/121179 PCT/US2005/020253 [00225] The results of this experiment are consistent with previous studies and show LUCA31 does not produce the same tissue staining pattern of prototypical transferrin receptor antibodies. These results support the concept that the LUC A31 antibody recognizes an epitope that is distributed in a pattern that is distinct from epitopes recognized by other transferrin receptor antibodies and maypiovide for a more favorable therapeutic index than other transferrin receptor antibodies However, the pancreas and brain endothehuin starinng.at lOug/inJ suggests that the LUCA31 epitope is present in these tissues, but maybe less abundant than colon and some tumor sainples [00226] We also exainined the staining of additional tumor tissues with LUCA31 to better establish the incidence of epitope expression in cancers. Previously, this antibody was deinonstrated to be positive on human colon carcmomna, human pancreatic carcinoma and human lung carcmomna In this study we evaluated additional lung, pancreatic, and colon carcmomna sainples to better establish the incidence of positive reactivity of this antibody LUCA31 was positive on 4 of 4 colon carcmomna patients; 2 of 2 pancreatic carcmomna patients, and 2 of 2 lung carcmomna patients (Table 7). All tumors were positive at both 1 ug/inl and 10 ug/inl Colon and lung carcmomnas had strong intensity staining at 1 ug/inl whereas pancreatic carcmomnas had weak intensity staining at lug/inl and inoderate intensity staining at lOug/inl of antibody These results are consistent with other data showing that the LUCA31 epitope is expressed in tumor tissues. 70 WO 2005/121179 PCT/US2005/020253 Example 14 FACS analysis ofRBCs. platelets and leukocytes [00227] An analysis of LUCA31 staining of red blood cells, platelets and leukocytes was performed to evaluate antigen expression in the blood coinpartinent No staining was observed in any of these cell populations. This is also contradictory to published reports on transferrin receptor expression in inonocyte and lyinphocyte populations However, because transferrin receptor expression is induced in stiinulated lyinphocytes relative to non-proliferating lyinphocytes (Neckers & Cossinan, Transferrin receptor induction in nntogen-stiinulated human T lyinphocytes is required for DNA synthesis and cell division and is regulated by interleukw 2, Proc Natl Acad Sci USA 80,3494-3498 (1983)), we extended our analysis by exainining the staining of T-lyinphocytes stiinulated with PHA using LUCA31 (Table 8) As references, we used the transferrin receptor antibodies LUCA29 and BERT9, as well as alpha2 and beta 1 integrin antibodies as standards for lyinphocyte staining Unlike the results of our analysis of the tissue sainples, we did not observe a difference between LUCA31 and the other transferrin inAbs in this assay Notes -Unless noted the entire population had the indicted staining level -The abbreviation "sub" indicates that a distinct subpopulation showed activity and the reinainder was negative --"B" cells in this table represent CD3 negative lyinphocytes 71 WO 2005/121179 PCT/US2005/020253 -"T" cells in this table represent CD3 positive lyinphocytes [00228) Because transferrin receptor has been shown to be expressed on differentiating bone marrow progenitor cells (Helin et al, Characterization andphenotypic analysis of differentiating CD34+ human bone marrow cells in liquid culture, Eur J Haeinatol 59, 318-326( 1997)), we also performed experiinents to exainine whether the LUCA31 epitope is also expressed in bone marrow derived cells. To do this, we obtained CD34 enriched bone marrow cells and evaluated thein by FACS using LUCA31 and another antibody having different specificity, KID20 i [00229] The data from this experiment is shown in Table 9, which shows human bone marrow progenitor staining by other antibodies Antibody stainin'g of both unstiinulated and growth factor stiinulated cells was deterinined by FACS and the results presented as the percentage of antibody stained cells In untreated cells LUCA31 staining was very siinilar to results obtained with the transferrin receptor antibody BERT9.J When cells were cultured for 72 hrs in the presence of growth factors, including GM-CSF, SCF, IL3 and EPO, the proportion of LUCA31 and BERT9 staining cells increased These results are siinilar to what we observed with proliferating lyinphocytes and indicate the LUC A31 epitope is also expressed in growth factor stiinulated bone marrow progenitor cell populations Progenitor ceil stiinulation conditions 5ng/inl rGM- CSF 50ng/inl rSCF 5ng/in! rlL-3 5uints/inl EPO Example] 5 Activity assays 72 WO 2005/121179 PCT/US2005/020253 [00230] To more fully characterize the activity of this molecule, we studied a panel of cells that have been validated in xenograft tumor models (human xenograft cell panel) and deinonstrated the antibody is highly active alone, and in combination with cheino therapeutics. Because we have shown LUC A31 interacts with the transferrin receptor, we have benchinarked its activity relative to the well studied IgA transferrin receptor antibody 42/6 (Trowbndge & Lopez, 1982) As shown in Table 10, LUCA31 is active in all of the cell lines in our prioritized xenograft panel and coinpares favorably with the ant-transferrin receptor antibody 42/6 [00231] The LUCA31 antibody was also tested in the xenograft cell panel in combination with the cheinotheiapy agents cainptothecin, carboplatin, doxorubicin, geincitabine and paclitaxel For each agent, the addition of LUCA31 resulted in an additive effect, indicating the antibody is not likely to antagonize the action of oncolytic agents Representative data for the combination of LUCA31 with chemotherapeutics in HCT116 cells is shown in Figuie 7 The results from the LUCA31 cheinotherapy combination studies are coinparable to the results we obtained when we exainined cheinotherapy pairings with the Her2 targeting antibody Transtuzumab [00232] The activity of LUCA31 is inaxiinal in low seruin conditions, suggesting that coinponents available in fetal bovine seiuin (FBS) attenuate the ability of this antibody to block cell proliferation The capacity of the 42/6 antibody to block proliferation of solid tumor cell lines has also been shown to be inaxiinal in low seruin conditions and that this is 73 WO 2005/121179 PCT/US2005/020253 due to the coinpetition between the antibody and transferrin (Taetle, R , and Honeysett, J. M (1 987) Effects of monoclonal anti-transferrin receptor antibodies on in vitro growth of human solid tumor cells Cancer Res 47, 2040-2044). Although LUCA31 does not appear to coinpete with transferrin for binding to the transferrin receptor, we performed experiinents to deterinine whether the reduced activity of LUCA31 in )0% FBS is a result of increased transferrin in the cell culture inediuin [00233] To address this question we added iron charged transferrin to low seruin inedia and exainined the activity of both LUC A31 and 42/6 using the xenograft tumor cell line panel We found the activity of both LUCA31 and 42/6 is reduced when holo-transferrin is added to cell culture inediuin Figure 8 shows data for the three cell lines inost sensitive to LUCA31, HCT15, HCT116 and LOVO at 0 and lOOug/inl transferrin In HCT15 cells, LUC A31 retains good activity in the presence of added transferrin [00234] This is consistent with the capacity of this antibody to inaintain activity in 10% seruin as well Taken together, these data suggest that the capacity of LUCA31 to block cell proliferation can be attenuated by transferrin and support the idea that the restricted activity of inis antibody in 10% seruin containing cell culture conditions is due to the increased concentration of transferrin Despite evidence for reduced activity of the antibody 42/6 in high seruin, this and other transferrin receptor antibodies have been shown to be active in animal cancer models, suggesting that the capacity of the molecules to work in vivo is not negated by seruin transferrin levels. Example 16 Cell Cycle Analysis [00235] To further define the inechanisin of action of LUCA31, we exainined how the antibody affected the progression of HCT15 cells through the cell cycle As shown in Figure 9, treament of HCT15 cells with LUCA31 for 24 firs resulted in a reduction in the proportion of 2N content (G1) cells and increased the population of cells with DNA content consistent with S-phase arrest Additionally, the HCT15 cells treated with LUCA31 also showed an increased proportion of cells with a DNA content Example 17 Effect ofLUCA31 on tumor cell lines 74 WO 2005/121179 PCT/US2005/020253 [00236] To explore the potential activity of this molecule in additional tumor types, LUCA31 was tested in solid tumor cell lines derived from prostate (DU145, LNCap) and breast (MCF7, MDA-MB-231, MDA-MB-435, ADR-Res) (Figure 10) Expression of the LUCA31 epitope was siinilar in each of the cell lines, but LUCA31 appeared to be inost active in the MCF7 cells These results are coinparable to the data produced using the colon, Jung and pancreatic cancers [00237] In addition to the solid tumor cell lines, we also surveyed for LUCA31 activity using cell derived from lymphomas, leukemias and multiple myelomas We felt this was iinportant because inost of the studies published using the benchinark transferrin receptor antibody (42-6) were performed with hematological cancer cell lines (see e g., Savage, 1987, Tiowbndge & Lopez, Monoclonal antibody to transferrin receptor blocks transferrin binding and inhibits human tumor cell growth in vitro, Proc Natl Acad'Sci USA 79, 1175-1179 (1982), White, 1990) The results from these experiinents, sriown in Figure 11, deinonstrate the LUCA31 epitope was inost highly expressed in the CCRF-CEM cell line, but was also found in the other cell lines studied (Figure 11A) LUCA31 was active in each of these cell lines, in some.cases reducing cell proliferation to 10% of the control value (Figure 1 IB) This activity was superior to the benchinark antibody 42-6 (data not shown) and was inaxiinal with reduced seruin 75 WO 2005/121179 PCT/US2005/020253 Example 18 Effect ofLUCA31 on cancer cell lines 786-O. SKMES-J. MDA-MB-175VII andColo205 [00238] The ability of the antibodies to reduce cell number in vitro when grown as a inonolayer can be assessed using cell inonolayers grown in the presence or absence of varying amounts of test or control punfied antibody and the change in cell number assessed using MTT MTT is a dye that ineasures the activity of initochondnal enzyines and correlates with relative viable cell number Cells of interest were plated and grown in F12/DMEM (1 1) growth inediuin suppleinented with 10% fetal bovine seruin in 96 well plates. The following cell lines were plated at the following densities in triplicate wells of a 96 well dish 786-O, Colo205, MDA-MB-175VII, and SKMES-l at 1800, 1500, 2500 and 1500 cells/well, respectively Iininediately after plating, LUCA3I was added. The cells were incubated at 37°C in a huinidified incubator at 5% CO2/air for 5 days At the end of the assay, MTT was dissolved in PBS (5ing/inl) and added directly to wells at 1 10 dilution Plates were placed back in incubator for 4 hours. After the incubation, inediuin was reinoved and 100 ]i\ DMSO was added to solubihze the MTT precipitate. Plates were lead atOD 540nin [00239] At 20[xg/inl LUCA31 inhibited the growth of renal cell adenocarcmomna 786-O 54% (average of 3 experiinents), colorectal adenocarcmomna Colo205 37% (average of 4 experiinents'), breast ductal carcmomna MDA-MB-175VH 35% (average of 2 experiinents) and lung squainous carcmomna SKMES-l 45% (average of 3 experiinents) [00240] Representative graphed lesults of the effects of LUCA31 are shown in Figure 12 Figure 12A shows representative graphed results of the effects of LUCA31 on 786-O cells. Figure 12B shows representative graphed results of the effects of LUCA31 on Colo205 cells Figure 12C shows representative graphed results of the effects of LUCA31 on SKMES-l cells Example 19 Internahzation ofL UCAS1 and toxin-coningated anti-inouse JgG [00241] Mab-ZAP (Advanced Targeting Systeins, San Diego, CA) is an anti-inouse IgG conjugated to saponn, a toxin that inhibits protein synthesis This toxin is iinperineable to the cell ineinbrane If a monoclonal antibody is bound to a cell-surface antigen that is internalizable, the toxin-conjugate can bind to the bound monoclonal and, thereby, be internalized and eventually kill the cell. Being dependent upon internahzation for deinonstration of toxic activity, the Mab-ZAP can serve to evaluate whether or not a given surface antigen will serve as a suitable target for any toxin that is dependent upon 76 WO 2005/121179 PCT/US2005/020253 internalization to express cell toxic effects As such, the Mab-ZAP serves as a inodel for such internahzation-dependent toxins such as inaytansinords and cahcheainicin [00242] For testing the inteinahzation of LUCA31 and saponn conjugated anti-inouse lgGby tumor cells and effect of killing the tumor cells after internalization of saponn, human colon tumor cells, Colo205 were reinoved from stock flasks with 10 inJVl EDTA and centnfuged Cells were resuspended at 50,000/ inl in appropriate inediuin and 100 jA plated per well in 96 well plates Antibody LUCA31 was added iininediately to appropriate wells as a lOx concentrate, to make a final concentration of 10 ug/inl After 15 ininutes at rooin teinperature Mab-ZAP (Cat # IT-04, Advanced Targeting Systeins, San Diego CA) was added to appropriate wells as lOx concentrate, to make final concentrations from 0 001 nM to 10 nM After 4 days growth, MTT was added (stock 5 ing/inl PBS,1 10 dilution in well) for 4 hrs at 37 C The inediuin was then reinoved from all wells and 100 ^I/well DMSO was added The plates were gently swirled to solubihze the blue MTT precipitate and the plates were read at O D 540 nin. [00243] Theie was a decrease in MTT staining in Colo205 cells in the presence of LUCA31 as coinpared to staining in the absence of LUCA31 This indicates that the growth of Colo205 cells was inhibited in the piesence of LUCAS 1 and Mab-ZAP and these results are indicative of LUCA31 and toxin-conjugated anti-inouse IgG were internalized in Colo205 cells [00244] Results of an internalization experiment according to the methods of this Example are shown in Figure 13 Example 20 Activity with lyinphocyte and bone marrow cells [00245] To deterinine whether the staining of lyinphocytes and borie marrow progenitor cells by LUCA31 is predictive of antiprohferative activity in these cells, we developed tntiated thyinidine-based cell proliferation assays using human peripheral blood leukocytes and CD34 selected bone marrow progenitor cells For both of these cell populations we used the same cytokine cocktail that was einployed to deterinine LUCA31 epitope staining To test the effect of LUCA31 on human leukocytes, we stiinulated isolated PBMCs with PHA/IL-2 alone, or in the presence of varying amounts of either a control IgGl antibody or LUCA31. The results of this experiment (Figure 14) show that LUCA31 potently inhibited the incorporation of tntiated thyinidine in the proliferating leukocyte population, resulting in nearly 90% inhibition of cell proliferation. [00246] To evaluate the effect of LUCA31 on bone marrow progenitor cells we performed a siinilar assay, this time using CD34 selected human bone marrow denved cells stiinulated with a cytokine/growtb factor cocktail that included EPO, IL-3, SCF and GM- 77 WO 2005/121179 PCT/US2005/020253 CSF For this experiment we coinpared LUCA31 to the contiol IgGl antibody 1B7 11 using two different cell seeding densities The results of this experiment (Figure 15) show that LUCA31 reduced cell prohfeiation to 20% of control levels In comparision, the control antibody had a inodest effect Taken together, these experiinents indicate that LUCA31 can potently inhibit the proliferation of both tumor cells, as well as normal cells derived from both the peripheral blood and bone marrow compartments [00247] The effect of LUCA31 on the bone marrow derived cells is particularly iinportant to note, considering the potential toxicity liability. As discussed above, there was some evidence of bone marrow suppression in a human phase I trial of the transferrin receptor antibody 42-6 (Brooks et al, 1995) Our data is consistent with the idea that LUCA31, like other transferrin receptor antibodies, can inhibit tumor cell proliferation, but mayalso iinpact the proliferation of bone marrow progenitor cell populations However, it is believed that LUCA31 has significantly reduce toxicity, relative to previously known transferrin receptor antibodies Example 21. In vivo biology [00248} The results of our in vitro studies with tumor denved cell lines showed LUCA31 has broad activity within the panel of cell lines that we have translated into xenograft models LUCA31 was particularly active in blocking the proliferation of the colon carcmomna cell line HCT15 Based on these results we chose to test the effect of LUCA31 in an established HCT15 tumor xenograft inodel alone, and in combination with geincitabine In this study, groups of 15 inice were treated twice weekly with 500ug of antibody for four weeks Geincitabine was dosed on a q3d x2 schedule at 120ing/kg, which is near the MTD Treatinent was initiated when tumor voluines averaged 70inin3. The results of this study are shown in Figure 16 In Figure 16A, the inedian tumor voluines are shown and in Figure 16B, the inean tumor voluines with error bars are piesented In this experiment, the LUCA31 antibody produced a tumor growth delay of greater than 14 days, relative to the saline control. Geincitabine produced a 20-day tumor growth delay and the combination of LUCA31 and geincitabine produced a tumor growth delay of 18 days relative to geincitabine alone. [00249] The results of this experiment indicate the LUCA31 antibody is active in this tumor inodel and the data coinpares favorably with cetuximab in colorectal tumor models Based on what we understand about LUCA31, and without being limited to a particular inechainsin, it is presently believed that the effect of this antibody on tumor cells is dnven priinarily through intrinsic activities mediated through its interaction with the transferrin receptor Because LUCA31 is a inouse IgG 1 molecule and the Fc doinain of this isotype 78 WO 2005/121179 PCT/US2005/020253 has low affinity for Fc receptors, ADCC mediated destruction of tumor cells is unlikely to contribute substantially to the tumor growth delay. [00250] An antibody with increased affinity to inouse Fc receptors maybe more effective at controlling tumor growth, via receptor cross linking as well as via enhanced immune effector function To address this concept, a human chimeric LUCA31 molecule that contains the human IgGl Fc doinain has been inade [00251] Materials and Methods referenced in the Examples. Luca31 V region cloning and expression vector construction [00252] Introduction: Luca31 RNA was extracted from hybridoina cell lines expressing the inouse antibody and the vanable regions of heavy and light chains were pulled out by RT-PCR from cDNA The V-iegions were inserted into CHEF1 inaininalian expression vectors Materials and Methods RNA extraction The QIAGEN RNeasy Mini Kit (Cat No 74106) was used to extract RNA from frozen hybridoina cell pellets cDNA. Roche's "lsl Strand cDNA Synthesis Kit for RT-PCR (AMV)M (Cat No 1 483 188) was used to geneiate cDNA. The reaction was run with and without RT to generate a negative control for the PCR reaction RT-PCR PCR was earned out on the cDNA teinplate, using Padina's "ShortPCR" prograin, and reagents from Clontech's Advantage PCR kit 2 pi cDNA reaction 5 pll OX buffer 2 uJ each primer 1 pi dNTP inix 1 pi Advantage polyinerase dH2O to 50 pi 79 WO 2005/121179 PCT/US2005/020253 [00253] Negative controls (no RT cDNA) were run for each primer combination The degenerate priiners used contain sequence for the signal sequences rather than siinply the CHI doinain of the V regions 80 WO 2005/121179 PCT/US2005/020253 Degenerate Priiners for inouse antibody V regions MVH 1 ACTAGTCGACATGAAATGCAGCTGGGTCATSTTCTTC MVH2 ACTAGTCGACATGGGATGGAGCTRTATCATSYTCTT MVH 3 ACTAGTCGACATGAAGWTGTGGTTAAACTGGGI I I I I MVH 4 ACTAGTCGA'CATGRACTTTGGGYTCAGCTTGRTTT MVH 5 ACTAGTCGACATGGACTCCAGGCTCAATTTAGTTTTCCTT MVH 6 ACTAGTCGACATGGCTGTCYTRGSGCTRCTCTTCTGC MVH 7 ACTAGTCGACATGGRATGGAGCKGGRTCTTTMTCTT MVH 8 ACTAGTCGACATGAGAGTGCTGATTCTTTTGTG MVH 9 ACTAGTCGACATGGMTTGGGTGTGGAMCTTGCTATTCCTG MVH 10 ACTAGTCGACATGGGCAGACTTACATTCTCATTCCTG MVH 11 ACTAGTCGACATGGATTTTGGGCTGATTI I I I I IATTG MVH 12 ACTAGTCGACATGATGGTGTTAAGTCTTCTGTACCTG i . MVL 1 ACTAGTCGACATGAAGTTGCCTGTTAGGCTGTTGGTGCTG MVL2 ACTAGTCGACATGGAGWCAGACACACTCCTGYTATGGGT MVL 3 ACTAGTCGACATGAGTGTGCTCACTCAGGTCCTGGSGT7G MVL 4 ACTAGTCGACATGAGGRCCCCTGCTCAGWTTYTTGGMWTCTTG MVL 5 ACTAGTCGACATGGATTTWCAGGTGCAGATTWTCAGCTTC MVL 6 ACTAGTCGACATGAGGTKCYYTGYTSAGYTYCTGRGG MVL 7 ACTAGTCGACATGGGCWTCAAGATGGAGTCACAKWYYCWGG MVL 8 ACTAGTCGACATGTGGGGAYCTKTTTYCMMTTTTTCAATTG MVL 9 ACTAGTCGACATGGTRTCCWCASCTCAGTTCCTTG MVL 10 ACTAGTCGACATGTATATATGTTTGTTGTCTATTTCT MVL 11 ACTAGTCGACATGGAAGCCCCAGCTCAGCTTCTCTTCC MVL rev TACGACCCGGGACTGGATGGTGGGAAGATGGA MVH rev1 TACGACCCGGGGGAGTTAGTTTGGGCAGCAGATCC MVH rev2 TACGACCCGGGAGCAGATCCAGGGGCCAGTGGATA Vector construction [00254] Restriction enzyines and ligase used were purchased from Roche, NEB or Proinega legations were transformed into cheinically coinpetent XLIO-Gold cells from Stratagene and plated on LBM/Carb agarose plates Colonies were picked into LBM with either 100 or 50 fxg/inl caibeincillin for inini preps. [00255] Miin-preps and inaxi-preps were done with QIAGEN kits For inaxi preps of large vectors (pDEF14 and pNEF5), 200 inl overnight cultures were grown up and the cells were pelleted QIAGEN^s protocol was followed, doubling all voluines of PI, P2 and P3 as if preparing 2 X 100 'inl cultures. Following the first spin, all supernatants were applied to one coluinn, effectively concentrating DNA yields The expression vectors were sequenced 81 WO 2005/121179 PCT/US2005/020253 through the coding regions prior to transfection in CHO cells and were analyzed by restriction digest Tissue analysis of LUCA31 staining [00256] LUCA31 and coininercial transferrin receptor antibodies were assessed using frozen tissue sections Tissue sections were fixed for 10 ininutes ,in 100% acetone at -20C, then placed in wash buffer prior to the first blocking solution step. Wash buffer= IX TBS with 0.05% Tween 20/ Diluent= 20% human seruin, 2% BSA in wash buffer [00257] Staining protocol. 1) H2O2 Block: DAKO Peroxidase Blocking Reagent, cat# 003715, 15 ininutes 2) Protein Block: 20% human seruin, 2% BSA in wash buffer 3) Avidin/Biotiri Block: Vector cat# sp-2001; 15 ininutes with Avidin (A) Rinse X2 wash/ 15 ininutes with 4) Biotin (B) blot off and add primary antibody 5) l°Antibody: ;(see table) 1 hour 6) Wash X3 after11° 7) 3° (see table) 30 ininutes/ Wash X3 8) DAB: DAKO DAB+. Cat# K3468, 1 drop DAB per inl of supplied buffer (package instruction) Stop reaction with H2O when developed 9) Counterstain: Gills Heinatoxvlin. 1 quick dip followed by several nnses Blue 5 ininutes in tap H2O 10) Dehydiate to xylene and coveislip with inounting inediuin Slide Id loand2° itJ HI696 02 02Liver Zyined H68 4 inouse IgGJ anti-huiinn TR (Cattf 13- 6800), used at 10u.g/in1 i 2&3° Mouse envision catfl K40QI #2 H1696 02 02 Ltver S,"nt,i Cru? BER-T9 inouse IgGI anil-human TR (Cattt sc-19675) .uscdat J0ng/inI 2&3" Mouse envision catfl K4001 33HI696 02 02 Liver A. ne-M* ' , (tm) Abeain DF1513 inouse IgGI anti-human TR antibody (cat# ab223). used at 10|jg/in! 2&3" Mouse envision cat# K4001 #4Hl696 02 02 Liver Luca 31 inouse IgGI used at 0 10(ig/inl 2&3° Mouse envision cattf K4QQ1 #5 HI696 02 01 Zyined H68 4 inouse lgGl anti-human TR Liver used at I0ng/inl 2&3° Mouse envision catfl K4Q01 "6 H1696 02 01 Snnta Cru2 BER-T9 inouse IgGI anti-human TR (Cattf LlVer sc-19675) ,usedat lOng/inl 2&3° Mouse envision calf/ K4001 S7H1696 02 0I Abeain DF1513 inouse IgGI anti-human TR antibody Liver (cat# ab223),, used at JOjig/in! 2&3° Mouse envision catf'k4Q01 82 83 WO 2005/121179 PCT/US2005/020253 84 WO 2005/121179 PCT/US2005/020253 WO 2005/121179 PCT/US2005/020253 Antibody bioassay [00258] Assay performed in 96 well flat bottoin tissue culture plates. [00259] Dayl Prepare cells to use- # cells plated depends on the cell line (1000-6000/weIl), Add cells to the wells in a voluine of 200 ul RPMI1640 +10% fetal bovine seruin (FBS) Incubate overnight!(r) 37 °C [00260] Day2 Aspirate inedia from wells and add back 150ul coinplete inedia, inen 50ul of 4x antibody dilutions (lOug/inl, 5ug/inl, 2 5ug/inl, 1 25 ug/inl 0 6|ug/inl) or negative control. Perform antibody dilutions in triplicate Incubate overnight @ 37 °C [00261] Day 3 continue incubation at 37 DC for 48 hrs [00262] Day5 Note - before pulsing, spin the plates with seini-adherent cells (e g. Colo205) Pulse with 1 uCi of 3H-thyinidine (in 20 ul coinplete growth inediuin) Incubate from 6 hours to overnight [00263] Day6 Add 20uI of 0 5% SDS (inade in D-PBS) to wells - final cone, of SDS is 0.05% Fieeze the cells in the freezer -80 °C for about 60 ininutes Harvest and count tritiated thyinidine incorporation in cellular DNA 85 WO 2005/121179 PCT/US2005/020253 Expression of human transferrin receptor in CHO cells and staining with LUCA31 [00264] Huinan transferrin receptor was PCR ainplified from human cDNA using the following priiners 5'- GAA TTC TGC AGG GGA TCC GCC ACC ATG ATG GAT CAA GOT AGA TCA GCATTCTC-3' 5'- CTC GAG CGG CCG CCA CTG TTA AAA CTC ATT GTC AAT GTC CC -3' and the full length transferrin receptor gene was cloned into a inodified pDEF2 vector to create the expression vector TFRC-pDEF99TORA The TFRC-pDEF99TORA expression construct was transfected in to CHO cells using Mirus TrcinsYT transfection reagents and by electroporation using Pvu I digested linearplasmid. Cells were selected by limited dilution Applicable methods disclosured in US PATENT NO 5,888,809 are hereby incorporated byreference [00265] To evaluate LUCA31 staining, cell lines were subjected to FACS and florescent inicroscopy An aliquot of cells were incubated on ice for 30 inin with LUCA31 antibody diluted to 100ng/inJ, washed and then incubated with a 1 200 dilution of a FITC conjugate anti-inouse antibody The washed cells were then evaluated by FACS or directly viewed using the fluorescent inicroscope No detection of florescent staining was seen in the untransfected CHO cells or in CHO cells transfected with vector alone A 50 fold signal over background was detected using the FL1 channel by FACS in the cells transfected with the TFRC-pDEF99TORA vector relative to the expression vector alone. 86 WO 2005/121179 PCT/US2005/020253 [00266] FACS analysis FACS buffer (D-PBS + .1% BSA) BSA (endotoxin free) _-inouse IgG FITC conjugate (Sigina #F-2883 - 1 200 dilution in FACS buffer) 1% Forinaldehyde (in D-PBS) FACS tubes (Falcon #2052) 96 well, polystyrene, round bottoin, cell culture plate (Corning/Cbstar #3799) Protocol - Resuspend cells in 200J D-PBS - Vortex gently - Add 50_l appropriate leagent (antibody, isotype control, inedia ) to each well and vortex gently - Incubate on ice/30 ininutes. - Centrifuge (1100 RPM / 5 ininutes) and reinove (flick) inedia - Vortex gently - Wash once in 200_I D-PBS (centrifuge, flick, vortex gently) - Resuspend in 200J _-inouse IgG FITC conjugate (1 200 dilution in FACS buffer) and vortex gently - Incubate in the daik (forl), on ice/30 ininutes - Centrifuge (1100 RPM / 5 ininutes) and reinove (flick) inedia. - Vortex gently - Wash once in 200_l D-PBS (centrifuge, flick, vortex gently). - Resuspend in 200J 1% formaldehyde (in D-PBS) and transfer to FACS tubes - Read FL1 fluorescence intensity on FACS. 87 WO 2005/121179 PCT/US2005/020253 [00267] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various inodifications or changes in light theieof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent or patent application were specifically and individually indicated to be so incorporated by reference 88 WO 2005/121179 PCT/US2005/020253 WE CLAIM : 1. An isolated antibody or antigen-binding fragment thereof, wherein said antibody or said fragment comprises the three complementarity determining regions from the light chain and the three complementarity determining regions from the heavy chain of the antibody expressed by hybridoma having ATCC No. PTA-6055 or progeny thereof. 2. The isolated antibody or antigen-binding fragment as claimed in claim 1, wherein said antibody is expressed by hybridoma ATCC No. PTA-6055 or progeny thereof, or said fragment is a fragment of said antibody expressed by hybridoma ATCC No. PTA-6055 or progeny thereof. 3. An isolated nucleic acid comprising a polynucleotide sequence encoding the antibody or antigen-binding fragment as claimed in claim 1. 4. The nucleic acid as claimed in claim 3, wherein the nucleic acid is operably linked to a promoter. 5. The nucleic acid as claimed in claim 4, wherein the promoter and the nucleic acid are contained in an expression vector. 6. The nucleic acid as claimed in claim 3, wherein the antibody is a monoclonal antibody. 7. A method of producing a substantially purified antibody that specifically binds to the LUCA31 epitope on human transferrin receptor, comprising the steps of: a. growing a cell line transformed with the nucleic acid as claimed in claim 3 under conditions in which the antibody is expressed; and b. harvesting the expressed antibody. 8. A method of producing a substantially purified antibody that specifically binds to the LUCA31 epitope on human transferrin receptor, comprising the steps of: a. growing the hybridoma having ATCC No. PTA-6055 or progeny thereof under conditions in which the antibody as claimed in claim 1 is expressed; and b. harvesting the expressed antibody. 9. The method as claimed in claim 7, wherein the antibody is a monoclonal antibody. 10. The method as claimed in claim 8, wherein said antibody comprises an antigen- binding fragment of the antibody expressed by the hybridoma ATCC No. PTA- 6055 or progeny thereof. 11. A pharmaceutical composition comprising a therapeutically effective dose of the antibody or antigen-binding fragment thereof of any as claimed in claims 1-2 together with a pharmaceutically acceptable carrier. 12. The pharmaceutical composition as claimed in claim 11, wherein the composition comprises an additional therapeutic moiety. 13. An antibody expressed by hybridoma ATCC No. PTA-6055 or progeny thereof. 14. An antibody comprising an antigen-binding fragment of the antibody expressed by hybridoma ATCC No. PTA-6055 or progeny thereof. The invention provides further characterization of the disease and cancerassociaied antigen, transferrin receptor. The invention also provides a novel family of antibodies that bind to the transferrin receptor, methods of diagnosing and treating various human cancers and diseases that express transferrin receptor.

Documents:

03761-kolnp-2006 abstract.pdf

03761-kolnp-2006 assignment.pdf

03761-kolnp-2006 claims.pdf

03761-kolnp-2006 correspondence others.pdf

03761-kolnp-2006 description (complete).pdf

03761-kolnp-2006 drawings.pdf

03761-kolnp-2006 form 1.pdf

03761-kolnp-2006 form 3.pdf

03761-kolnp-2006 form 5.pdf

03761-kolnp-2006 international publication.pdf

03761-kolnp-2006 pct others.pdf

03761-kolnp-2006 priority document.pdf

03761-kolnp-2006-assignment-1.1.pdf

03761-kolnp-2006-correspondence-1.1.pdf

03761-kolnp-2006-form-3-1.1.pdf

3761-KOLNP-2006-(19-10-2011)-ABSTRACT.pdf

3761-KOLNP-2006-(19-10-2011)-AMANDED CLAIMS.pdf

3761-KOLNP-2006-(19-10-2011)-DESCRIPTION (COMPLETE).pdf

3761-KOLNP-2006-(19-10-2011)-EXAMINATION REPORT REPLY RECIEVED.pdf

3761-KOLNP-2006-(19-10-2011)-FORM 1.pdf

3761-KOLNP-2006-(19-10-2011)-FORM 13.pdf

3761-KOLNP-2006-(19-10-2011)-FORM 2.pdf

3761-KOLNP-2006-(19-10-2011)-OTHERS.pdf

3761-KOLNP-2006-(19-10-2011)-PETITION UNDER RULE 137-1.1.pdf

3761-KOLNP-2006-(19-10-2011)-PETITION UNDER RULE 137.pdf

3761-KOLNP-2006-CORRESPONDENCE 1.1.pdf

3761-kolnp-2006-form 18.pdf

3761-KOLNP-2006-FORM 3 1.1.pdf