Title of Invention

"TARGETING OF TUMOR VASCULATURE USING RADIOLABELLED ANTIBODY L19 AGAINST FIBRONECTIN ED-B"

Abstract A specific binding member that binds human ED-B, wherein the specific binding member is labelled with an isotope of the kind such as herein described and comprises an antigen-binding site that comprises an antibody VH domain and an antibody VL domain, wherein the isotope is 131I and wherein the antibody VH domain comprises a VH CDR1, a VH CDR2 and a VH CDR3, wherein the VH CDR3 is the L19 VH CDR3 of SEQ ID NO. 3, the VH CDR1 is the L19 VH CDR1 of SEQ ID NO. 1, and the VH CDR2 is the L19 VH CDR2 of SEQ ID NO. 2; and wherein the antibody VL domain comprises a VL CDR1, a VL CDR2 and a VL CDR3, wherein the VL CDR3 is the L19 VL CDR3 of SEQ ID NO. 6, the VL CDR1 is the L19 VL CDR1 of SEQ ID NO. 4, and the VL CDR2 is the L19 VL CDR2 of SEQ ID NO. 5; wherein the specific binding member comprises a mini-immunoglobulin comprising said antibody VH domain and antibody VL domain fused to εS2-CH4 and dimerized.
Full Text TARGETING OF TUMOR VASCULATURE USING RADIOLABELLED ANTIBODY L19 AGAINST
FIBRONECTIN ED-B
The present invention relates to targeting of tumor
vasculature using radiolabelled antibody molecules. In
particular, the invention relates to use of antibody molecules
that bind ED-B of fibronectin, and which are of demonstrated
usefulness in tumor targeting. In different embodiments of
the present invention, antibody molecules are employed in
different molecular formats. In certain embodiments the
antibody molecules comprise human IgGl. In other embodiments
the antibody molecules are mini-immunoglobulins, such as are
generated by fusing an scFv antibody molecule to the constant
CH4 domain of a secretory IgE isoform that naturally contains
a cysteine in.its COOH terminal which forms a covalently
linked dimer. Blood clearance rate, in vivo stability and
other advantageous properties are employed in different
aspects and embodiments of the invention, e.g. in tumor
targeting. The different in vivo behavior of different
antibody molecule formats may be exploited for different
diagnostic and/or therapeutic purposes, depending on clinical
needs and disease.
Despite their enormous potential as therapeutic agents,
monoclonal antibodies (mAbs) of non-human origin have
performed poorly in clinical trials as a result of their
immunogenicity (1 Shawlert et al.,. 1985; 2 Miller et al.,
1983), poor pharmacokinetic properties (3 Hakimi et al., 1991;
4 Stephens et al., 1995) and inefficiency in recruiting
effector functions {5 Riechmann et al.,. 1988.; 6 Junghens et
al., 1990) . The recent prospect of isolating human antibody
fragments from phage display libraries (7 McCafferty et al.,
1990; 8 Lowman et al., 1991; for reviews see 9 Nilsonn et al.,
2000 and 10 Winter et al., 1994) transcends these problems,
revitalizing studies and rekindling hopes of using these
reagents to treat major diseases. Indeed, these molecules
should serve' as ideal building blocks for novel diagnostic and
therapeutic tools (11 Reichert, 2001; 12 Huls et al., 1999).
Furthermore, these antibodies can be "matured" to reach
affinities in the picomolar range (13 Pini et al., 1998), at
least desirable, if not necessary, for their clinical use.
Clinical applications of human antibody fragments for the
selective delivery of diagnostic or therapeutic agents
nonetheless require highly specific targets. In the case of
tumors, the most popular targets are cell-surface antigens,
which are usually neither abundant nor stable. Nevertheless,
during tumor progression, the micr©environment surrounding
tumor cells undergoes extensive modification that generates a
"tumoral environment" which represents a target for antibodybased
tumor therapy (14 Neri and Zardi, 1998). In fact, the
concept that the altered tumor microenvironraent is itself a
carcinogen that can be targeted is increasingly gaining
consensus. Molecules that are able to effectively deliver
therapeutic agents to the tumor microenvironment thus
represent promising and important new tools for cancer therapy
{15 Bissel, 2001; 14 Neri and Zardi, 1998).
Fibronectin is an extracellular matrix (ECM) component that is
widely expressed in a variety of normal tissues and body
fluids. Different FN isoforms can be generated by the
alternative splicing of the FN pre-mRNA, a process that is
modulated by cytokines and extracellular pH (16 Balza et al. ,
1988; 17 Carnemolla et al., 1989; 18 Borsi et al., 1990; .19
Borsi et al., 1995). The complete type III repeat ED-B, also
known as the extratype III repeat B (EIIIB), may be entirely
included or omitted in the FN molecule (20 Zardi et al.,
1987). ED-B is highly conserved in different species, having
100% homology in all mammalians thus far studied (human, rat,
mouse, dog) and 96% homology with a similar domain in chicken.
The FN isoform containing ED-B (B-FN) is undetectable
immunohistochemically in normal adult tissues, with the
exception of tissues undergoing physiological remodelling
(e.g., endometrium and ovary) and during wound healing (17
Carnemolla et al., 1989; 21 ffrench-Constant, . et al.-, 1989).
By contrast, its expression in tumors and fetal tissues is
high (17 Carnemolla et al, 1989) . Furthermore, it has .been
demonstrated that B-FN is a marker of angiogenesis (22
Castellani et al., 1994) and that endothelial cells, invading
tumor tissues migrate along ECM fibers containing B-FN "(23
Tarli et al. 1999) .
Selective targeting of tuinoral vasculature has been described
using a human recombinant antibody, scFv(L19) (13 Pini et al.,
98), specific for the B-FN isoform (24 Carnemolla et al.,
• *
1996; 23 Tarli et al.,-99; 25 Viti et al., 99; 26 Neri et al./
97; 27 Demartis et al., 2001). The antibody may be used in
both in vivo diagnostic (iromunoscintigraphy) and therapeutic
approaches entailing the selective delivery of therapeutic *
radionuclides or toxic agents to tumoral vasculature. In
addition, Birchler et al. (28 1999) showed that scFv(L19),
chemically coupled to a photosensitizer, selectively
accumulates in the newly formed blood vessels of the
angiogenic rabbit cornea model and, after irradiation with
near infrared light, mediates complete and selective occlusion
of ocular neovasculature.
More recently, Nilsson et al. (29 2001) reported that the
immunoconjugate of scFv(L19) with the extracellular domain of
tissue factor mediates selective infarction in different types
of murine tumor models. Furthermore, fusion proteins of
scFv(L19) and IL-2 or IL-12 have shown the enhanced
therapeutic efficacy of these two cytokines (30 Halin et
submitted; 31 Carnemolla et al., 2002). See also
W001/62298 for use of fusions in treatment of lesions of
pathological angiogenesis, including tumors. Finally, since
L19 reacts equally well with mouse and human ED-B, it can be
used for both pre-clinical and clinical studies.
See also PCT/GB97/01412, PCT/EP99/03210, PCT/EP01/02062 and
PCT/IB01/00382.
Different antibody formats have shown diverse behavior in
terms -of in vivo stability, clearance and performance in tumor
targeting (32 Wu et al., 2000). A mini-immunoglobulin or
small immunoprotein (SIP) is described in (33 Li et al.,
1997).
The present invention is based on preparation of,
characterization of and investigation of the in vivo
biodistribution of L19 human antibody molecules in different
formats, namely, scFv, mini-immunoglobulin and complete IgGl,
and labelling with radioisotopes.
Brier" Description of the Figures
Figure 1 shows models illustrating the structures of different
proteins. A: Model of the domain structure of a FN subunit.
The protein sequences undergoing alternative splicing are
indicated in grey. As indicated, the epitope of the
recombinant antibody LI9 is localized within the repeat ED-B.
B - D: Schemes of the constructs used to express,
respectively, L19 (scFv) (B); L19-SIP (C); and L19-IgGl/K.
Figure 2 shows growth curves of SK-MEL-28 tumor in nude mice
(triangles) and of F9 tumor in 129 mouse strain (circles). The
volume (mm3) is plotted versus time (days) . Each data point is
the average of six mice + SD.
Figure 3 shows the results of size exclusion chromatography on
the different LI9 formats. In panels A, B and C are shown
size exclusion chromatography (Superdex 200) profiles of the
L19 formats scFv, mini-immunoglobulin and IgGl, respectively,
after radioiodination. Panels D, E and F show size exclusion
chromatography (Superdex 200) profiles of plasma at the
indicated times after i.v. injection of the radioiodinated L19
formats, scFv, mini-immunoglobulin and IgGl, respectively. No
changes in the curve profiles of L19-SIP or L19-IgGl were
detected when loading plasma at different times after
injection, while 3h after L19(scFv)2 injection a second peak
of higher molecular mass was observed.
Figure 4 shows results of biodistribution experiments in SKMEL-
28 tumor-bearing mice using different radioiodinated L19
antibody molecule formats. The variations of the %ID/g in the
tumor (Figure 4A) and in the blood (Figure 4B) at the
indicated times after i.v. injection are reported. In Figure
4C the tumor-blood ratios of the %ID/g are plotted. The curves
of L19(scFv) are indicated by diamonds, of L19 miniimmunoglobulin
by squares and of L19 IgGl by triangles.
Figure 5 shows results of biodistribution experiments in F9
tumor-bearing.mice using radioiodinated L19(scFv) (squares)
and L19 mini-immunoglobulin (diamonds). The variations of the
%ID/g in the tumor (A) and in the blood (B), at the indicated
different times after injection are reported.
Figure 6 shows change in U251 tumor area (square millimetres)
over time (days) post injection of physiological saline and I-
131-L19-SIP respectively.
The present invention relates to specific binding members that
bind human ED-B of fibronectin, wherein the specific binding
members are radiolabelled with one or more isotopes selected
from the group consisting of 76Br, 77Br, 123I, 124I, 131I and 2UAt.
The invention also provides methods of producing such specific
binding members, and their use in diagnostic and therapeutic
applications.
Specific binding members of the invention showed favorable
properties in animal experiments, such as higher doses delivered
to tumor compared to red marrow, and high tumor accumulation.
In one aspect, the present invention provides a specific
binding member which binds human ED-B of fibronectin and which
comprises the LI9 VH domain and a VL domain, optionally the
L19 VL domain, wherein the specific binding member comprises a
mini-immunoglobulin comprising said antibody VH domain and
antibody VL domain fused to es2-CH4 and dimerized or comprises
a whole IgGl antibody molecule, and wherein the specific
binding member is radiolabelled with an isotope selected from
the group consisting of 76Br, 77B-r, 123I, 124I, 131I and 2nAt.
Preferably, the radioisotope is 123I or 131I, and most
preferably 131I.A radiolabel or radiolabeled molecule may be attached to the specific binding member may be labelled at e.g. a tyrosine, lysine or cysteine residue.
The L19 VH domain and L19 VL domain sequences are set out in Pini et al. (1998) J. Biol. Chem. 273: 21769-21776, those sequences being fully incorporated herein by reference to Pini et al. as if set out here.
Generally, a VH domain is paired with a VL domain to provide an antibody antigen binding site. In a preferred embodiment, the L19 VH domain is paired with the L19 VL domain, so that an antibody antigen binding site is formed comprising both the L19. VH and VL domains. In other embodiments, the L19 VH is paired with a VL domain other than the L19 VL.Light-chain promiscuity is well established in the art.
One or more CDRs may be taken from the L19 VH or VL domain and incorporated into a suitable framework. This is discussed further below. L19 VH CDR's 1, 2 and 3 are shown in SEQ ID NO.'s 4, 5 and 6 respectively. L19 VL CDR's 1, 2 and 3 are shown in SEQ ID NO.'s 1, 2 and 3, respectively.
In a preferred embodiment, the specific binding member is L19-SIP, most preferably 123I-labelled L19-SIP (herein referred to as I-123-L19-SIP) or 131I-labelled L19-SIP (herein referred to as I-131-L19-SIP).
Variants of the VH and VL domains and CDRs of which the sequences are set out herein and which can be employed in specific binding members for ED-B can be obtained by means of methods of sequence alteration or. mutation and screening.
Variable domain amino acid sequence variants of any of the VH
and VL domains whose sequences are specifically disclosed
herein may be employed in accordance with the present
invention, as discussed. Particular variants may include one
or more amino acid sequence alterations (addition, deletion,
substitution and/or insertion of an amino acid residue), maybe
less than about 20 alterations, less than about
alterations, less than about 10 alterations or less than about
5 alterations, 4, 3, 2 or 1. Alterations may be made in one
or more framework regions and/or one or more CDR's.
A specific binding member according to the invention may be
one which competes for binding to antigen with a specific
binding member which both binds ED-B and comprises an antigenbinding
site formed of the L19 VH domain and L19 VL domain.
Competition between binding members may be assayed easily in
vitro, for example using ELISA and/or by tagging a specific
reporter molecule to one binding member which can be detected
in the presence of other untagged binding member(s), to enable
identification of specific binding members which bind the same
epitope or an overlapping epitope.
Thus, further aspects of the present invention employ a
specific binding member comprising a human antibody antigenbinding
site which competes with L19 for binding to ED-B.
A specific binding member according to the present invention
may bind ED-B with at least the affinity of L19, binding
affinity of different specific binding members being compared
under appropriate conditions.
In addition to antibody sequences, a specific binding member
according to the present invention may comprise other amino
acids, e.g. forming a peptide or polypeptide, such as a folded
domain, or to impart to the molecule another functional
characteristic in addition to ability to bind antigen.
Specific binding members of the invention may carry a
detectable label, or may be conjugated to a toxin or enzyme
(e.g. via a peptidyl bond or linker).
In treatment of disorders or lesions of pathological
angiogenesis, a specific binding member of the invention may
be conjugated to a toxic molecule, for instance a biocidal or
cytotoxic molecule that may be selected from interleukin-2
(IL-2), doxorubicin, interleukin-12 (IL-12), Interferon-y (IFNy),
Tumor Necrosis Factor a (TNFa) and tissue factor
(preferably truncated tissue factor, e.g. to residues 1-219).
See e.g. W001/62298.
Specific binding members according to the invention may 'be
used in a method of treatment or diagnosis of the human or
animal body, such as a method of treatment (which may include
prophylactic treatment) of a disease or disorder in a human
patient which comprises administering to said patient an
effective amount of a specific binding member of the
invention. Preferably, a specific binding member according to
the invention is administered to the patient by parenteral
administration. Conditions treatable in accordance with the
present invention include tumors, especially solid tumors, and
other lesions of pathological angiogenesis, including,
rheumatoid arthritis, diabetic retinopathy, age-related
macular degeneration, and angiomas.
Specific binding members are well suited for radiolabelling
with isotopes selected from the group consisting of 76Br, 77Br,
123I, 124I, 131I and 211At and subsequent use in radiodiagnosis
and radiotherapy.
A yet further aspect provides a method of producing a specific
binding member of the invention, comprising labelling a
specific binding member with a radioisotope selected .from the
group consisting of 76Br, 77Br, 123I, 124I, 131I and 211At.
To radiolabel the specific binding member directly, tyrosine
moieties in the molecule may be targeted. In this- particular
procedure, the halogenide, e.g. Br~, I", At" is oxidised by an
appropriate oxidant, e.g. iodogen® (coated tubes), iodo-Beads,
chloramine-T (sodium salt of W-chloro-p-toluenesulfonamide)
etc. in the presence of the active pharmaceutical ingredient
(API).
Indirect labelling with e.g. bromine, iodine or astatine may be
performed by pre-labelling a bi-functional halogen carrier,
preferably derived from e.g. benzoic acid derivatives, Bolton-
Hunter derivatives, benzene derivatives etc. The carrier may be
transformed into an activated species to be conjugated to the eamino
group of Lysine residues or the N-terminus of the API.
This indirect method also provides a synthetic route to
radiolabel the peptide compounds chemo-selectively at the
sulfhydryl group of a cysteine moiety. The cysteine bridged
molecules may first be reduced by an appropriate reducing agent
e.g. stannous(II)chloride/ Tris(2-carboxyethyl)phosphine (TCEP)
generating free cysteine SH-groups that can react with the
halogen carrier. As functional groups for the binding maleimide
and a-brom acetamide derivatives may be employed.
A method of producing a specific binding member according to
the invention may comprise expressing nucleic acid encoding
the specific binding member prior to labelling the specific
binding member. Thus, as an earlier step, the method of
producing the specific binding member may optionally comprise
causing or allowing expression from encoding nucleic acid,
i.e. nucleic acid comprising a sequence encoding the specific
binding member. Such a method may comprise culturing host
cells under conditions for production of said specific binding
member.
A method of production may comprise a step of isolation and/or
purification of the product. The specific binding member may
be isolated and/or purified following expression from nucleic
acid, and/or recovery from host cells. The isolation and/or
purification may be prior to labelling. Alternatively or
additionally, the specific binding member may be isolated
and/or purified after labelling.
A method of production may comprise formulating the .product
into a composition including at least one additional
component, such as a pharmaceutically acceptable excipient.;
Thus, the (labelled) specific binding member may be formulated
into a composition including at least one additional component
such as a pharmaceutically acceptable excipient.
These and other aspects, of the invention are described in
further detail below.
TERMINOLOGY
Specific binding member
This describes a member of a pair of molecules which have
binding specificity for one another. The members of a
specific binding pair may be naturally derived or wholly or
partially synthetically produced. One member of the pair of
molecules has an area on its surface, or a cavity, which
specifically binds to and is therefore complementary to a
particular spatial and polar organisation of the other member
of the pair of molecules. Thus the members of the pair have
the property of binding specifically to each other. Examples
of types of specific binding pairs are antigen-antibody,
biotin-avidin, hormone-hormone receptor, receptor-ligand,
enzyme-substrate. This application is concerned with
antigen-antibody type reactions.
Antibody molecule
This describes an immunoglobulin whether natural or partly or
wholly synthetically produced. The term also covers any
polypeptide or protein comprising an antibody binding domain.
Antibody fragments which comprise an antigen binding domain
are such as Fab, scFv, Fv, dAb, Fd; and diabodies. The
present invention is concerned with whole IgGl antibody
molecules and mini-immunoglobulins comprising eS2-CH4 as
disclosed.
Techniques of recombinant DNA technology may be used to
produce from an initial antibody molecule other antibody
molecules which retain the specificity of the original
antibody molecule. Such techniques may involve introducing
DNA encoding the immunoglobulin variable region, or the
complementarity determining regions (CDRs), of an antibody to
the constant regions, or constant regions plus framework
regions, of a different immunoglobulin. See, for instance,
EP-A-184187, GB 2188638A or EP-A-239400.
As antibodies can be modified in a number of ways, the term
"antibody molecule" should be construed as covering any
specific binding member or substance having an antibody
antigen-binding domain with the required specificity. Thus,
this term covers antibody fragments and derivatives, including
any polypeptide comprising an immunoglobulin antigen-binding
domain, whether natural or wholly or partially synthetic.
Chimeric molecules comprising an immunoglobulin binding
domain, or equivalent, fused to another polypeptide are
therefore included. Cloning and expression of chimeric :
antibodies are described in EP-A-0120694 and EP-A-0125023":
Antigen binding domain
This describes the part of an antibody molecule which
comprises the area which specifically binds to and is
complementary to part or all of•an antigen. Where an antigen
is large, an antibody may only bind to a particular part of
the antigen, which part is termed an epitope. An antigen
binding domain may be provided by one or more antibody
variable domains (e.g. a so-called Fd antibody fragment
consisting of a VH domain). Preferably, an antigen binding
domain comprises an antibody light chain variable region (VL)
and an antibody heavy chain variable region (VH).
Specific
This may be used to refer to the situation in which one member
of a specific binding pair will not show any significant
binding to molecules other than its specific binding
partner(s). The term is also applicable where e.g. an antigen
binding domain is specific for a particular epitope which is
carried by a number of antigens, in which case the specific
binding member carrying the antigen binding domain will be
able to bind to the various antigens carrying the epitope.
Comprise
This is generally used in the sense of include, that is to say
permitting the presence of one or more features or components.
Isolated
This refers to the state in which specific binding members of
the invention, or nucleic acid encoding such binding members,
will generally be in accordance with the present invention.
Members and nucleic acid will be free or substantially free of
material with which they are naturally associated such as
other polypeptides or nucleic acids with which they are found
in their natural environment, or the environment in which they
are prepared (e.g. cell culture) when such preparation is by
recombinant DNA technology practised in vitro or in vivo.
Members and nucleic acid may be formulated with diluents or
adjuvants and still for practical purposes be isolated - for
example the members will normally be mixed with gelatin or
other carriers if used to coat microtitre plates for use in
immunoassays, or will be mixed with pharmaceutically
acceptable carriers or diluents when used in diagnosis or
therapy. Specific binding members may be glycosylated, either
naturally or by systems of heterologous eukaryotic cells (e.g.
CHO or NSO (ECACC 85110503) cells, or they may be (for example
if produced by expression in a prokaryotic cell)
unglycosylated.
By "substantially as set out" it is meant that the relevant
CDR or VH or VL domain of the invention will be either
identical or highly similar to the specified regions of which
the sequence is set out herein. By "highly similar" it is
contemplated that from 1 to 5, 'preferably from 1 to 4 such as
1 to 3 or 1 or 2, or 3 or 4, substitutions may be made in the
CDR and/or VH or VL domain.
The structure for carrying a CDR of the invention will
generally be of an antibody heavy or light chain sequence or
substantial portion thereof in which the CDR is located at a
location corresponding to the CDR of naturally occurring VH
and VL antibody variable domains encoded by rearranged
immunoglobulin genes. The structures and locations of
immunoglobulin variable domains may be determined by reference
to (Kabat, E.A. et al, Sequences of Proteins of Immunological
Interest. 5th Edition. US Department of Health and Human
Services. 1991, and updates thereof, now available on the
Internet (http://immuno.bme.nwu.edu or find "Kabat" using any
search engine).
Preferably, a CDR amino acid sequence substantially as set out
herein is carried as a CDR in a human variable domain or a
substantial portion thereof. The L19 VH CDR3 and/or L19 VL
CDR3 sequences substantially as set out herein may be used in
preferred embodiments of the present invention and it is
preferred that each of these is carried as a CDR3 in a human
heavy or light chain variable domain, as the case may be, or a
substantial portion thereof.
A substantial portion of an immunoglobulin variable domain
will comprise at least the three CDR regions, together with
their intervening framework regions. Preferably, the portion
will also include at least about '50% of either or both of the
first and fourth framework regions, the 50% being the C16
terminal 50% of the first framework region and the N-terminal
50% of the fourth framework region. Additional residues at
the N-terminal or C-terminal end of the substantial part of
the variable domain may be those not normally associated with
naturally occurring variable domain regions. For example,
construction of specific binding members of the present
invention made by recombinant DNA techniques may result in the
introduction of N- or C-terminal residues encoded by linkers
introduced to facilitate cloning or other manipulation steps.
Other manipulation steps include the introduction of linkers
to join variable domains of the invention to further protein
sequences including immunoglobulin heavy chains, other
variable domains or protein labels as discussed in more
details below.
In an IgGl antibody molecule according to the present
invention, VL domains may be attached at the C-terminal end to
antibody light chain constant domains including human CK or CA
chains, preferably CK chains.
In addition to being labelled with 76Br, 77Br, 123I,
and/or 211At, specific binding members of the invention may be
labelled with a second detectable or functional label.
Detectable labels are described below and include radiolabels .
such as radioisotopes of Technetium, Indium, Yttrium, Copper,
Lutetium or Rhenium, in particular 94B1Tc, 99mTc, 186Re, 188Re,
U1ln, 86Y, 88Y, 177Lu, 64Cu and 67Cu, which may be attached to
antibodies of the invention using conventional chemistry known
in the art of antibody imaging as described herein. Other
radioisotopes that may be used include 203Pb, 67Ga, 68Ga, 43Sc,
47Sc, ll°mln, 97Ru, 62Cu, 68CU/
86Y, 88Y, 90Y, 121Sn, 161Tb, 153Sm, 166Ho,
105Rh, 177Lu, 72Lu and 18F.
Labels also include enzyme labels such as horseradish
peroxidase. Labels further include chemical moieties such as
biotin which may be detected via binding to a specific cognate
detectable moiety, e.g. labelled avidin.
An example labelling protocol is as follows:
To radiolabel the specific binding members directly, the
cysteine bridged molecules are first reduced by an appropriate
reducing agent e.g. stannous(II)chloride, Tris(2-
carboxyethyl)phosphine (TCEP) generating free cysteine SH-groups
that can react with isotopes e.g. Tc or Re. In this particular
procedure, the permetalates obtained from an instant generator
system are reduced by a reducing agent e.g. stannous(II)chloride
in the presence of an auxiliary ligand e.g. sodium tartrate and
the API (details are provided below in the experimental
section).
Indirect labeling with e.g. indium, yttrium, lanthanides or
technetium and rhenium may be performed by pre-conjugating a
chelating ligand, preferably derived from ethylene diamine
tetraacetic acid (EDTA), diethylene triamine pentaacetic acid
(DTPA), cyclohexyl 1,2-diamine tetraacetic acid (CDTA),
ethyleneglycol-0,0"-bis(2-aminoethyl)-N,N,N',N'-diacetic acid
(HBED), triethylene tetraamine hexaacetic acid (TTHA), 1,4,7,10-
tetraazacyclododecane-N"-tetraacetic acid (DOTA), 1,4,7-
triazacyclononane-N,Nv,NS-triacetic acid (NOTA), 1,4,8,11-
tetraazacyclotetradecane-N,KT,NN X,JTN"-tetraacetic acid (TETA),
mercaptoacetyl diglycine (MAGa), mercaptoacetyl triglycine
(MAG3), mercaptoacetyl glycyl cysteine (MAGC), cysteinyl glycyl
cysteine (CGC) to either amine or thiol groups of the specific
binding member. The chelating ligands possess a suitable
coupling group e.g. active esters, maleimides, thiocarbamates or
oc-halogenated acetamide moieties. For conjugating chelating
ligands to amine groups e.g. s-NH2-groups of lysine residues
previous reduction of the L-19-SIP compound is not required.
Methods of labelling a specific binding member may comprise
conjugating an activated bi-functional halogen carrier
containing a radioiosotope selected from the group consisting
of 76Br, 77Br, 123I, 124I, 131I and 211At to a lysine residue or N
terminus, and to a cysteine residue of the specific binding
member. The method may comprise conjugating the halogen
carrier.to a lysine or cysteine residue of the specific
binding member, or to the N terminus of the specific binding
member. Either or both of (i) a cysteine residue and (ii) a
lysine residue or the N terminus, may be labelled with the
same or a different radioisotope according to the invention.
Specific binding members of the present invention are designed
to be used in methods of diagnosis or treatment in human or
animal subjects, preferably human. The specific binding
members are especially suitable for use in methods of
radiotherapy and radiodiagnosis.
Accordingly, further aspects of the invention provide methods
of treatment comprising administration of a specific binding
member as provided, pharmaceutical compositions comprising
such a specific binding member, and use of such a specific
binding member in the manufacture of a medicament for
administration, for example in a method of making a medicament
or pharmaceutical composition comprising formulating the
specific binding member with a pharmaceutically acceptable
excipient.
Clinical indications in which a specific binding member of the
invention may be used to provide therapeutic benefit include
tumors such as any solid tumor, also other lesions of
pathological angiogenesis, including rheumatoid arthritis,
diabetic retinopathy, age-related macular degeneration, and
angiomas.
Specific binding members according to the invention may be
used in a method of treatment of the human or animal body,
such as a method of treatment {which may include prophylactic
treatment) of a disease or disorder in a human patient which
comprises administering to said patient an effective amount of
a specific binding member of the invention. Preferably, the
treatment is radiotherapy. Conditions treatable in accordance
with the present invention are discussed elsewhere herein.
Specific binding members according to the invention may be
used in SPECT imaging, PET imaging and therapy. Preferred
isotopes for SPECT imaging include 123I and 131I. A preferred
isotope for PET is 124I. 131I is a preferred isotope for use in
therapy.
Due to the use of different isotopes of one element for
imaging and therapy the biodistribution of the respective
immunoconjugates is identical. This is an advantage compared
with other approaches which are using U1ln-labeled derivatives
for imaging in order to predict the biodistribution of the
respective 90Y-labeled therapeutic derivatives because the
biodistribution of corresponding U1ln and 90Y labeled
derivatives could be different; see Carrasquillo J.A. et al.
(1999) J Nucl Med 40: 268-276.
Accordingly, further aspects of the invention provide methods
of treatment comprising administration of a specific binding
member as provided, pharmaceutical compositions comprising
such a specific binding member, and use of such a specific
binding member in the manufacture of a medicament for
administration, for example in a method of making a medicament
or pharmaceutical composition comprising formulating the
specific binding member with a pharmaceutically' acceptable
excipient.
In accordance with the present invention, compositions
provided may be administered to individuals. Administration
is preferably in a "therapeutically effective amount", this
being sufficient to show benefit to a patient. Such benefit
may be at least amelioration of at least one symptom. The
actual amount administered, and rate and time-course of
administration, will depend on the nature and severity of what
is being treated. Prescription of treatment, e.g. decisions
on dosage etc, is within the responsibility of general
practitioners and other medical doctors. Appropriate doses of
antibody are well known in the art; see Ledermann J.A. et al.
(1991) Int J. Cancer 47: 659-664; Bagshawe K.D. et al. (1991)
Antibody, Immunoconjugates and Radiopharmaceuticals 4: 915-
922.
A composition may be administered alone or in combination with
other treatments, either simultaneously or sequentially
dependent upon the condition to be treated.
Specific binding members of the present invention, including
those comprising an antibody antigen-binding domain, may be
administered to a patient in need of treatment via any
suitable route, usually by injection into the bloodstream
and/or directly into the site to be treated, e.g. tumor.
Preferably, the specific binding member is parenterally
administered. The precise dose will depend upon a number of
factors, the route of treatment, the size and location of the
area to be treated (e.g. tumor), the precise nature of the
antibody (e.g. whole IgGl antibody molecule, miniimmunoglobulin
molecule), and the nature of any detectable
label or other molecule attached to the antibody molecule. A
r '
typical antibody dose will be in the range 10-50 mg.
This is a dose for a single treatment of an adult patient,
which may be proportionally adjusted for children and infants,
and also adjusted for other antibody formats in proportion to
molecular weight. Treatments may be repeated at daily, twiceweekly,
weekly or monthly intervals, at the discretion of"the
physician.
Specific binding meinbers of the present invention will usually
be administered in the form of a pharmaceutical composition,
which may comprise at least one component in addition to the
specific binding member.
Thus pharmaceutical compositions according to the present
invention, and for use in accordance with the present
invention, may comprise, in addition to active ingredient, a
pharmaceutically acceptable excipient, carrier, buffer,
stabiliser or other materials well known to those skilled in
the art. Such materials should be non-toxic and should not
interfere with the efficacy of the active ingredient. The
precise nature of the carrier or other material will depend on
the route of administration, which may be oral, or by
injection, e.g. intravenous.
22
For intravenous, injection, or injection at the site of
affliction, the active ingredient will be in the form of a
parenterally acceptable aqueous solution which is pyrogen-free
and has suitable pH, isotonicity and stability. Those of
relevant skill in the art are well able to prepare suitable
solutions using, for example, isotonic vehicles such as Sodium
Chloride Injection, Ringer's Injection, Lactated Ringer's
Injection. Preservatives, stabilisers, buffers, antioxidants
and/or other additives may be included, as required.
A composition may be administered alone or in combination with
other treatments, either simultaneously or sequentially
dependent upon the condition to be treated. Other treatments
may include the administration of suitable doses of pain
relief drugs such as non-steroidal anti-inflammatory drugs
(e.g. aspirin, paracetamol, ibuprofen or ketoprofen) or
opiates such as morphine, or anti-emetics.
The present invention provides a method comprising causing or
allowing binding of a specific binding member- as provided
herein to ED-B. As noted, such binding may take place in
vivo, e.g. following administration of a specific binding
member, or nucleic acid encoding a specific binding member, or
it may take place in vitro, for example in ELISA, Western
blotting, immunocytochemistry, immuno-precipitation or
affinity chromatography.
The amount of binding of specific binding member to ED-B may
be determined. Quantitation may be related to the amount of
the antigen in a test sample, which may be of diagnostic
interest, which may be of diagnostic interest.
The reactivities of antibodies on a sample may be determined
by any appropriate means. Radioimmunoassay (RIA) is one
possibility. Radioactive labelled antigen is mixed with
unlabelled antigen (the test sample) and allowed to bind to
the antibody. Bound antigen is physically separated from
unbound antigen and the amount of radioactive antigen bound to
the antibody determined. The more antigen there is in the
test sample the less radioactive antigen will bind to the ,
antibody. A competitive binding assay may also be used with
non-radioactive antigen/ using antigen or an analogue linked
to a reporter molecule. The reporter molecule may be a
fluorochrome, phosphor or laser dye with spectrally isolated
absorption or emission characteristics. Suitable
fluorochrom.es include fluorescein, rhodamine, phycoerythrih
and Texas Red. Suitable chromogenic dyes include
diaminobenzidine.
Other reporters include macromolecular colloidal particles or
particulate material such as latex beads that are coloured,
magnetic or paramagnetic, and biologically or chemically
active agents that can directly or indirectly cause detectable
signals to be visually observed, electronically detected or
otherwise recorded. These molecules may be enzymes which
catalyse reactions that develop or change colours or cause
changes in electrical properties, for example. They may be
molecularly excitable, such that electronic transitions
between energy states result in characteristic spectral
absorptions or emissions. They may include chemical entities
used in conjunction with biosensors. Biotin/avidin or
biotin/streptavidin and alkaline phosphatase detection systems
may be employed.
The signals generated by individual antibody-reporter
conjugates may be used to derive quantifiable absolute or
relative data of the relevant antibody binding in samples
(normal and test).
The present invention further extends to a specific binding
member which competes for binding to ED-B with any specific
binding member which both binds the antigen and comprises a V
domain including "a CDR with amino acid substantially as set
out herein, preferably a VH domain comprising VH CDR3 of SEQ
ID NO. 3. Competition between binding members may be assayed
easily in vitro, for example by tagging a specific reporter
molecule to one binding member which can be detected in the
presence of other untagged binding member(s), to enable
identification of specific binding members which bind the same
epitope or an overlapping epitope. Competition may be
determined for example using the ELISA as described in
Carnemolla et al. (24 1996).
As stated above, methods of producing specific binding members
according to the invention may comprise expressing encoding
nucleic acid, and may optionally involve culturing host cells
under conditions for production of the specific binding
member. Specific binding members and encoding nucleic acid
molecules and vectors according to or for use in the present
invention may be provided isolated and/or purified, e.g. from
their natural environment, in substantially pure or
homogeneous form, or, in the case of nucleic acid, free or
substantially free of nucleic acid or genes origin other than
the sequence encoding a polypeptide with the required
function.
Nucleic acid used according to the present invention may
comprise DNA or RNA and may be wholly or partially synthetic.
Reference to a nucleotide sequence as set out herein
encompasses a DNA molecule with the specified sequence, and
encompasses a RNA molecule with the specified sequence in
which 0 is substituted for T, unless context requires
otherwise.
Systems for cloning and expression of a polypeptide in a
variety of different host cells are well known. Suitable host
cells include bacteria, mammalian cells, yeast and baculovirus
systems. Mammalian cell lines available in the art for
expression of a heterologous polypeptide include Chinese
hamster ovary cells, HeLa cells, baby hamster kidney cells,
NSO mouse melanoma cells and many others. A common, preferred
bacterial host is E. coll.
The expression of antibodies and antibody fragments in
prokaryotic cells such as E. coli is well established in the
art. For a review, see for example Pltickthun, A.
Bio/Technology 9: 545-551 (1991). Expression in eukaryotic
cells in culture is also available to those skilled in the art
as an option for production of a specific binding member, see
for recent reviews, for example Ref, M.E. (1993)
Biotech. 4: 573-576; Trill J.J. et al. (1995) Curr. Opinion
Biotech 6: 553-560.
Suitable vectors can be chosen or constructed, containing
appropriate regulatory sequences, including promoter
sequences, terminator sequences, polyadenylation sequences,
enhancer sequences, marker genes and other sequences as
appropriate. Vectors may be plasmids, viral e.g. 'phage, or
phagemid, as appropriate. For further details see, for
example, Molecular Cloning: a Laboratory Manual: 3nd edition,
Sambrook et al., 2001, Cold Spring Harbor Laboratory Press.
Many known techniques and protocols for manipulation of
nucleic acid, for example in preparation of nucleic acid
constructs, mutagenesis, sequencing, introduction of DNA into
cells and gene expression, and analysis of proteins, are
described in detail in Current Protocols in Molecular Biology,
Second Edition, Ausubel et al, eds., John Wiley & Sons, 1992.
The disclosures of Sambrook et al. and Ausubel et al. are
incorporated herein by reference.
A method of producing a specific binding member according to
the invention may further comprise introducing encoding
nucleic acid into a host cell. The introduction may employ
any available technique. For eukaryotic cells, suitable
techniques may include calcium phosphate transfection, DEAEDextran,
electroporation, liposome-mediated transfection and
transduction using retrovirus or other virus/ e.g. vaccinia
or, for insect cells, baculovirus. For bacterial cells,
suitable techniques may include calcium chloride
transformation, electroporation and transfection using
bacteriophage.
The introduction may be followed by causing or allowing
expression from the nucleic acid, e.g. by culturing host cells
under conditions for expression of the gene.
In one embodiment, the nucleic acid of the invention is
integrated into the genome (e.g. chromosome) of the host cell.
Integration may be promoted by inclusion of sequences which
promote recombination with the genome, in accordance with
standard techniques.
Further aspects and embodiments of the present invention will
be apparent to those skilled in the art in the light of. the
present disclosure including the following experimental
exemplification. Methods for synthesis and labelling of the
specific binding members of the.present'invention are more fully
illustrated in the following examples. These examples are shown
by way of illustration and not by way of limitation.All
documents mentioned anywhere in this specification and
incorporated by reference.
EXPERIMENTAL EXEMPLIFICATION OF ASPECTS AND EMBODIMENTS OF THE
PRESENT INVENTION
1. Preparation and characterisation of specific binding
members according to the present invention
The following examples use radiolabelled peptide compounds,
1,1 Synthesis of I-131-L19-SIP (Chloramine-T Method)
200 ug L19-SIP in 230ul PBS (0.2 M PBS, pH 7.4) were placed in
a reaction vial, mixed with 185 MBq [131IJNaI, and reacted with
30 uL of a freshly prepared solution of Chloramine-T (2 mg/mL)
in 0.2 M PBS (pH 7.4). After 1 min, 50 uL of a solution of
Na2S205 (10 mg/mL in PBS 0.2 M, pH 7.4). 131I-labeled L19-SIP
was purified by gel-chromatography using, a NAP-5 column
^ (Amersham, Eluent: PBS), pre-blocked with 5 ml of 0.5 % bovine
serum albumin in PBS.
Radiochemical yield: 45.7 %.
Radiochemical purity: 88.3 % (SDS-PAGE).
Specific activity: 31.7 MBq/nmdl.
Immunoreactivity: 76 %
1.2 Synthesis of I-131-L19-SIP (iodogen method)
800 ug L19-SIP in 800 ul PBS (0.2 M PBS, pH 7.4) and 500 MBq
[131I]NaI were mixed and placed in a reaction vial (iodogen
tube, Pierce Inc.)- The mixture was shaken gently, over a
period of 30 min at room temperature. 131I-labeled L19-SIP was
purified by gel-chromatography using a NAP-5 column (Amersham,
Eluent: PBS), pre-blocked with 5 ml of 0.5 % bovine serum
albumin in PBS.
Radiochemical yield:93.2 %.
Radiochemical purity: 91.1 % (SDS-PAGE).
Specific activity: 46.6 MBg/nmol.
Immunoreactivity: 78 %
1.3 Synthesis of J-123-L19-SIP (iodogen method)
200 ug L19-SIP in 230 ul PBS (0.2 M PBS, pH 7.4) and 200 MBq
[123I]NaI were mixed and placed in a reaction vial (iodogen
tube, Pierce Inc.). The mixture was shaken gently, over a
period of 30 min at room temperature. 123I-labeled L19-SIP was
purified by gel-chromatography using a NAP-5 column (Amersham,
Eluent: PBS), pre-blocked with 5 ml of 0.5 % bovine serum
albumin in PBS.
Radiochemical yield: 81.6 %. .
Radiochemical purity: 89.6 % (SDS-PAGE).
Specific activity: 61.2 MBq/nmol.
Immunoreactivity: 84 %
1.4 Synthesis of I-124-L19-SIP (iodogen method)
200 pg L19-SIP in 230 PBS (0.2 M PBS, pH 7.4) and 50 MBq
[123I]NaI were mixed and placed in a reaction vial (iodogen
tube, Pierce Inc.). The mixture was shaken gently, over a
period of 30 min at room temperature. 124I-labeled L19-SIP was
purified by gel-chromatography using a NAP-5 column (Amersham,
Eluent: PBS), pre-blocked with 5 ml of 0.5 % bovine serum
albumin in PBS.
Radiochemical yield:84.5 %.
Radiochemical purity: 89.6 % (SDS-PAGE).
Specific activity: 22.8 MBq/nmol.
Immunoreactivity: 86 %
1.5 Synthesis of (3-(4-hydroxy-3-[1311]iodo-phenyl) -
propionate) -LIB-SIP
500 pg (3-(4-hydroxy-phenyl)-N-(sulfonato-succinimidyl)
propionate) was dissolved in 1 mL of DMSO. Ten microliters of
Chloramine-T (5 mg/ml in PBS) were mixed with 74 MBq [131I]NaI,
neutralized with 15 pL of PBS (0.2 M, pH 7.4). One microliter
of the (3-(4-hydroxy-phenyl)-N-(sulfonato-succinimidyl)
propionate) solution is added to the Chloramine-T/[131I]NaI
solution and the mixture is allowed to react for 1 min. The
reaction is stopped by the addition of 40 pL of a solution of
Na2S205 (10 mg/mL in PBS 0.2 M, pH 7.4), followed by the
immediate addition of 200 pg L19-SIP in 230 pi borate buffer
(0.2 M PBS, pH 8.5).
(3- (4-hydroxy-3-[131IJ iodo-phenyl) -propionate) -L19-SIP was
purified by gel-chromatography using a NAP-5 column (Amersham,
Eluent: PBS), pre-blocked with 5 ml of 0.5 % bovine serum
albumin in PBS.
30
Radiochemical yield:37.2 %.
Radiochemical purity: 94.6 % (SDS-PAGE).
Specific activity: 10.3 MBq/nmol.
Immunoreactivity: 69 %
1,6 .MIRD calculations of I-131-L19-SIP
Based on biodistribution data in tumor-bearing mice absorbed
doses of the 1-131 labeled L19-SIP could be calculated by the
MIRD formalism. Biokinetic modeling was performed with the %
ID data of I-131-L19-SIP in human glioblastoma (U251) bearing
mice. The residence times were calculated as the areas under
the curve of bi- and mono-exponential functions integrated
from zero to infinity including the biological and physical
half-life of the compound.
Considering the mouse organs as both the radiation source and
the radiation target absorbed organ doses as self-to-self
doses (no radiation cross fire) could be estimated for 1-131-
L19-SIP using S-values from the MIRDOSE 3.1 software.
Mouse organ doses (raGy/ MBq):
Liver 50
Kidneys 160
Spleen 50
Lung 220
Ovaries 180-410 {depending on ovulation cycle status
and ED-B expression)
Uterus 600 (depending on ovulation cycle status and
ED-B expression)
Testis 55
Blood 130
Red Marrow 50 (calculation based on the blood dose).
Tumor 940 (calculated for a 100 mg tumor)
Using the calculated residence times in the MIRDOSE 3.1
program human absorbed doses can be estimated for the 1-131-
L19-SIP.
Human organ doses (mGy/ MBq):
Adrenals 9.46E-02
Brain 1.64E-02 .
Breasts . 7.33E-02
Gall bladder l.OOE-01
LLI Wall 4.47E-01
Small Intestine 1.10E-01
Stomach 9.45E-02
ULI Wall 2.11E-01
Heart Wall 6.22E-02
Kidneys 1.86E-01
Liver 7.46E-02
Lungs -' 7.04E-02
Muscle 8.71E-02
Ovaries 8.07E-01
Pancreas 1.15E-01
Red Marrow 9.11E-02
Bone Surface 9.74E-02
Skin 7.20E-02
Spleen 7.11E-02
Testes 2.38E-01
Thymus 8.55E-02
Thyroid 8.54E-02
Urin Bladder Wall 7.19E-01
Uterus 4.72E-01
Total Body 8.78E-02
EPF DOSE EQUIV 3.60E-01
EFF DOSE 3.21E-01
It was concluded that the Red Marrow and the reproductive
organs (ovaries/ uterus and testes) would be the dose limiting
organs. Nevertheless, the therapeutic window based on the
dosimetric calculations looked favorable and promising. A
Tumor dose to Red Marrow dose ratio of 18 was found. Thus, I32
131-L19-SIP displayed a remarkable 18-fold higher dose
delivered to the tumor than to the red marrow,
1,7 Tumor treatment study after single i.v, injection of I-
131-L19-SIP into tumor bearing nude .mice
I-131-L19-SIP was injected once intraveneously into U251
(glioblastoma) bearing nude mice (body weight about 27 g) , The
investigated doses were 37 MBq and 74 MBq, respectively. In
addition, a control group of animals (injected once with
physiological saline) was investigated. During the days after
injection, the tumor size (given in mm2) was determined using a
caliper.
The growth of U251 tumors in nude monitored after single
intravenous injection of physiological saline and I-131-L19-
SIP, respectively, is shown in Figure 6.
A single injection of the I-131-L19-SIP with 74 MBq per animal
showed a pronounced effect on the growth of 0251-tumors
resulting in a stasis for 18 days. The same was true for the
low dose group (37 MBq) except a slight tumor growth which was
started during the last 5 days for the low dose group. In
contrast, tumors of the control group grew continuously during
the whole observation period.
The results of this investigation show excellent potential of
I-131-L19-SIP for the treatment of solid tumors.
1.8 Imaging of I-123-L19-SIP after single i.v. injection into
tumor bearing nude mice
The substance of the invention was injected intraveneously in
a dose of about 9.25 MBq into F9 (teratocarcinoma) bearing
nude mice (body weight about 25 g). Gamma-camera imaging was
carried out at various times after administration of the
substance.
By planar scintigraphy of I-123-L19-SIP in. F9
(teratocarcinoma) bearing nude mice 4 hours after injection
and 24 hours after injection, the tumor could be clearly
depicted. At 4 hours after injection, besides the strong
uptake in the tumor only a slight background in the rest of.
the -body (not bound to a particular organ but derived from the
blood pool) could be detected. Whereas the signal in the tumor
maintained, the background signal in the rest of the body
disappeared over time. Thus, at 24 hours post injection only
the tumor could be detected.
The results of this investigation shows the excellent
potential of I-123-L19-SIP for the imaging of solid tumors.
2. further Examples and Experiments
MATERIALS AND .METHODS .
Preparation and expression of scFvf small immunoprotein (SIP)
and IgGl constructs scFv
The scFv(L19) (Figure 1A) is an affinity matured (Kd=5.4xlO~
UM) antibody fragment specifically directed against the ED-B
domain of fibronectin (13 Pini et al., 1998). The scFv(D1.3)
(7 McCafferty et al.; 26 Neri et al., 1997), a mouse-anti-hen
egg white lysozyme scFv, was used as a control. These scFvs
were expressed in E. Coli strain HB2151 (Maxim Biotech, San
Francisco CA) according to Pini et al. (34 1997).
Mini-immunoglobulin
To construct the L19 small immunoprotein (L19-SIP) gene
(Figure 1C) the DNA sequence coding for the scFv(Ll9) was
amplified by Polymerase Chain Reaction (PCR) using Pwo DNA
Polymerase (Roche), according to manufacturer' s
recommendations, with primers BC-618
(gtgtgcactcggaggtgcagctgttggagtctggg - SEQ ID NO, 8) and BC-
619 (gcctccggatttgatttccaccttggtcccttggcc - SEQ ID NO. 9),
containing ApaLI and BspEI restriction sites, respectively.
The amplification product was inserted ApaLI/BspEI in the pUTeSIP
vector, which provides the scFv gene with a secretion
signal, required for secretion of proteins in the
extracellular medium. The pUT-eSIP vector was obtained from
the previously described pUT-SIP-long (33 Li et al., 1997)
after substituting the human constant yl~CH3 domain with the
CH4 domain of the human IgE secretory isoform IgE-S2 (es2-CH4;
35 Batista et al., 1996). CH4 is the domain that allows
dimerization in the IgE molecule and the ss2 isoform contains a
cysteine at the carboxyterminal end, which stabilizes the IgE
dimer through an inter-chain disulphide bond. In the final SIP
molecule the ScFv{L19) was connected to the eS2-CH4 domain by a
short GGSG linker. The SIP gene was then excised from the
plasmid pUT-eSIP-LI 9 with Hindlll and EcoRI restriction
enzymes and cloned into the mammalian expression vector pcDNAS
(Invitrogen, Groningen, The Netherlands), which contains the
Cytoraegalovirus (CMV) promoter, in order to obtain the
construct pcDNA3-L!9-SIP.
The DNA sequence coding for scFv(D1.3) was amplified using the
primers BC-721 (ctcgtgcactcgcaggtgcagctgcaggagtca - SEQ ID NO.
10) and BC-732 (ctctccggaccgtttgatctcgcgcttggt - SEQ ID NO.
11) and inserted ApaLI/BspEI in the pUT-eSIP vector. The D1.3-
SIP gene, was then excised from the pUT-eSIP-D1.3 with HindiII
and EcoRI restriction enzymes and cloned into pcDNA3, in order
to obtain the construct pcDNA3-Dl.3-SIP.
These constructs were used to transfect SP2/0 murine myeloma
cells (ATCC, American Type Culture Collection, Rockville, MD,
USA) using FuGENE 6 Transfection Reagent (Roche), followingthe
protocol for adherent cells, optimized by the
manufacturer. Transfectomas were grown in DMEM supplemented
with 10% FCS and selected using 750 ug/ml of Geneticin (G418,
Calbiochem, San Diego, CA).
IgGl
To prepare complete IgGl, the variable region of the L19 heavy
chain (L19-VH), together with its secretion peptide sequence,
was excised with Hindlll and Xhol from the previously
described L19-pUTeSlP and inserted in the pUC-IgGl vector,
containing the complete human yl constant heavy chain gene.
The recombinant IgGl gene was then excised from the pUC-IgGl-
L19-VH with Hindlll and EcoRI and cloned into pcDNA3, to
obtain the construct pcDNA3-Ll9-IgGl.
For the preparation of the complete L19 light chain, L19-VL
was amplified from the L19-pUT-eSIP (described above) by PCR
using the primers BC-696 (tggtgtgcactcggaaattgtgttgacgcagtc -
SEQ ID NO. 12) and BC-697 (ctctcgtacgtttgatttccaccttggtcc -
SEQ ID NO. 13), containing ApaLI and BsiWI restriction sites,
respectively. After digestion with ApaLI and BsiWI, the
amplification product was inserted in the vector pUT-SEC-hCK
containing the secretion signal sequence and the sequence of
the human constant K light chain. The recombinant light chain
gene was then excised from pUT-SEC-hCK-L19-VL with Hindlll and
Xhol and inserted in the pCMV2A mammalian expression vector,
derived from a pcDNAS Vector by removing the resistance gene
to 6418, to obtain the construct pCMV2A-L19-K.
Equimolar ..amounts of these constructs were used to cotransf ect
SP2/0 murine myeloma cells as described above. Geneticin
selected clones were screened in ELISA for the ability to
secrete chimeric immunoglobulin, complete of-heavy and light
chains.
All DNA constructs were purified using the Maxiprep system
from Qiagen (Hilden, Germany), and the DNA sequences of both
strands of the constructs were confirmed using the ABI PRISM
dRhodamine Terminator Cycle Sequencing Ready Reaction Kit
(Perkin Elmer, Foster City, CA). All restriction enzymes (RE)
were from Roche Diagnostics (Milan, Italy), with the exception
of BsiWI {New England Biolabs, Beverly, MA) . After RE
digestion, inserts and vectors were recovered from agarose
gels using'the Qiaquick method {Qiagen).
Purification and quality control of antibodies
Immunoaffinity chromatography was performed to purify the
different antibodies according to the procedure described by
Carnemolla et al. (24 1996).
ED-B conjugated to Sepharose 4B (Amersham Pharmacia Biotech.,
Uppsala, Sweden) following manufacturer's instructions (24
Carnemolla et al., 96) was used to immunopurify all different
LI9 antibody formats, while a column of hen egg white lysozyme
(Sigma, St.Louis, USA) conjugated to Sepharose 4B (Amersham
Pharmacia) was used for D1.3 antibodies.
The immunopurified antibody formats L19-SIP and L19-IgGl
required no further purification and were dialyzed against
PBS, pH 7.4, at +'4°C. Since scFvs obtained from immunoaffinity
chromatography are made up of two forms, monomeric and
dimeric, a second purification step, as described by Demartis
et al. (27 2001), was required to isolate the latter form.
Batches of the different antibody formats were prepared and
analyzed using SDS-PAGE under reducing and non-reducing
conditions, inununohistochemistry, size exclusion
chromatography (Superdex 200, Amersham Pharmacia Biotech) and
ELISA experiments.
Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis
(SDS-PAGE), Enzyme Linked Immune/absorbent Assay. (EL ISA) , size
exclusion chromatography and iiomunohistochemistry
Screening ELISA experiments on the conditioned culture media
were performed according to Carnemolla et al. (24 1996). To "
reveal the expression of the different L19 antibody formats;
the recombinant fragment 7B89 (24 Carnemolla et al., 1996),
containing the ED-B domain of FN, that includes the epitope
recognized by the L19, was immobilized on Maxisorp
immunoplates (Nunc, Roskilde, Denmark). To detect D1.3
antibodies in ELISA experiments, hen egg white chicken
lysozyrae (Sigma) was immobilized on NH2 surface EIA plates
(Costar, Cambridge, MA) . A peroxidase-conjugated rabbit anti
human IgE . .(Pierce, Rockford, IL), diluted according to
manufacturer's recommendations, was used as secondary antibody
to detect SIPs. A peroxidase-conjugated rabbit anti human IgG
(Pie-rce) was used in the case of IgGl. For the scFvs
containing the tag sequence FLAG, a mouse anti-human FLAG
monoclonal antibody (M2, Kodak) and a peroxidase-conjugated
goat anti-mouse antibody (Pierce) were used as secondary and
tertiary antibodies, respectively. In all cases the
immunoreactivity with the immobilized antigen was detected
using the substrate ABTS for peroxidase (Roche) and
photometric absorbance at 405 run was measured.
A Superdex 200 (Amersham Pharmacia) chromatography column was
used to analyze the gel filtration profiles of the purified
antibodies under native conditions using fast protein liquid
chromatography (FPLC; Amersham Pharmacia).
Immunohistochemistry on different tissue cryostat sections was
performed as described by Castellani et al.(22 1994) and 4-18%
gradient SDS-PAGE was carried out according to Carnemolla et
al. (17 1989) under reducing and non-reducing conditions.
Animals and cell lines
Athymic-nude mice (8 week-old nude/nude GDI females) were
obtained from Harlan Italy (Correzzana, Milano, Italy),
(clone SvHsd) strain mice (8-10 weeks old, female) were
obtained from Harlan UK (Oxon, England). Mouse embryonal
teratocarcinoma cells (F9), human melanoma derived cells (SKMEL-
28) and mouse myeloma cells (SP2/0) were purchased from
American Type Culture Collection (Rockville, MD). To induce
tumors, nude mice were subcutaneously injected with 16xl06 SKMEL-
28 cells, and 129 strain mice with 3xl06 F9 cells. The
tumor volume was determined with the following formula:
(d)2xDxO,52, where d and D are, respectively, the short and
long dimensions (cm) of the tumor, measured with a caliper.
Housing, treatments and sacrifice of animals were carried out
according to national legislation (Italian law no. 116 of 27
January, 1992) regarding the protection of animals used for
scientific purposes.
Radioiodination of recombinant antibodies
Radioiodination of proteins was achieved following the
Chizzonite indirect method (36 Riske et al.,1991) using IODOGEN
Pre-coated lodination tubes (Pierce) to activate Na125I
(NEW Life Science Products, Boston, MA) according to
manufacturer's recommendations. In the reported experiments,
1.0 mCi of Na125I was used for OSmg of protein. The
radiolabeled molecules were separated from free 125I using PD10
(Amersham Pharmacia) columns pre-treated with 0.25% BSA and
equilibrated in PBS. The radioactivity of the samples was
established using a Crystal Y~counter (Packard Instruments/
Milano, Italy). The immunoreactivity assay of the radiolabeled
protein was performed on a 200ul ED-B Sepharose column
saturated with 0.25% BSA in PBS. A known amount of
radioiodinated antibody, in 200yl of 0.25% BSA in PBS,
applied on top and allowed to enter the column. The column was
.then rinsed with 1.5 ml of 0.25% BSA in PBS to remove nonspecifically
bound antibodies. Finally, the immunoreactive
bound material was eluted using 1.5 ml of. 0.1M TEA/ pHll. The
radioactivity of unbound and bound material was counted and
the percentage of immunoreactive antibodies was calculated.
Immunoreactivity was always higher than 90%.
To further analyze the radioiodinated antibodies a known
amount of radiolabeled protein in 200ul was loaded onto the
Superdex 200 column. The retention volume of the different
proteins did not vary after radioiodination. For the three
radioiodinated L19 antibody formats and their negative
controls, the radioactivity recovery from the Superdex 200
column was 100% (Figure 3A, 3B. and 3C). .
Biodistribution experiments
To block non-specific accumulation of 125 Iodine in the stomach
and concentration in thyroid, 30 minutes before injection of
the radiolabeled antibodies mice orally received 20 mg of
sodium perchlorate (Carlo Erba, Italy) in water. This
procedure was repeated at 24h intervals 'for the duration of
biodistribution experiments. Tumor-bearing mice were injected
in the tail vein with 0,1 nmoles of the different radiolabeled
antibodies (corresponding to 6 ug for scFvs, 8 ug for SIPs and
18 ug for IgGs) in lOOpl of saline. Three animals were
sacrificed per time point, the different organs including
tumor were excised, weighed, counted in a Y~counter and then
fixed with 5% formaldehyde in PBS, pH 7.4, to be processed for
microautoradiographies, performed according to Tarli et al.
(23 1999).
The blood was sampled also for plasma preparation to determine
the stability of the radiolabeled molecules in the blood
stream using the already described immunoreactivity test and
the gel filtration analysis. In both cases 200 ul of plasma
were used. The radioactive content of the different organs was
expressed as percentage of injecte.d dose per gram (%ID/g) .
The blood clearance parameters of the radioiodinated
antibodies was fitted with a least squares minimization
procedure, using the Macintosh Program Kaleidagraph (Synergy
Software, Reading PA, USA) and the equation:
X (t) - A exp (-(alpha t)) + B exp (-(beta t)
where X (t) is the %ID/g of radiolabeled antibody at time t.
This equation describes a bi-exponential blood clearance
profile, in which the amplitude of the alpha phase is defined
as A x 100 / (A + B) and the amplitude of the beta elimination
phase is defined as B x 100 / (A + B). Alpha and beta are rate
parameters related to the half-lives of the corresponding
blood clearance "phases. Tl/2 (alpha phase) = *. In2/alpha =
0.692.../alpha Tl/2 (beta phase) = In2/alpha = 0.692... /
alpha. X(0) was assumed to be equal to 40%, corresponding to ;
blood volume of 2.5 ml in each mouse.
RESULTS
Antibody preparation
Using the variable regions of L19 (13 Pini et al., 1998)
different antibody formats (scFv, mini-immunoglobulin and
complete human IgGl) and their performance in vivo in
targeting tumoral vasculature.
Figure 1 shows the constructs used to express the different,
L19 antibody formats. Similar constructs were prepared-using
the variable regions of the scFv specific for a non-relevant
antigen (D1.3; 7 McCafferty; 26 Neri et al., 1997).
To obtain SIPs and IgGl, SP2/0 murine myeloma cells were
transfected with the constructs shown in Figure 1 and stable
transfectomas were selected using G418. The best producers
were determined by ELISA and these clones were expanded for
antibody purification. The purification of all three L19
antibody formats was based on immunoaffinity chromatography
using recombin.ant ED-B conjugated to Sepharose. The yields
were of about 8 mg/1 for scFv(L19), 10mg/l for L19-SIP, 3 mg/1
for L19-IgGl. For the control proteins were used scFv(D1.3)
specific for hen-egg lysozyme, and, using the variable regions
of scFv D1.3, D'1,3-SIP was constructed. These two. antibodies
were purified on hen-egg lysozyme conjugated to Sepharose. The
yields were of 8 and 5 mg/1, respectively. As control for L19-
IgGl we used commercially available human IgGl/K (Sigma),
SDS-PAGE analysis of the three purified L19 formats was
performed, under both reducing and non-reducing conditions.
For scFv(L19)., the apparent mass was, as expected, about 28
kDa under both reducing and non-reducing conditions (not
shown). The L19-SIP showed a molecular mass of nearly 80 kDa
under non-reducing conditions, and had a mass of about 40 kDa
under reducing conditions. The results demonstrated that more
than 95% of the native molecule exists as a covalently-linked
dimer. L19-IgGl showed, as expected, a main band of about 180
kDa under non-reducing conditions, while, under reducing
conditions, it showed two bands corresponding to the heavy
chain of about 55 kDa and the light chain of about 28 kDa.
Elution profiles of the three L19 antibody formats analyzed by
size exclusion chromatography (Superdex 200) were obtained. In
all three cases a single peak with a normal distribution, and
representing more than 98%, was detected. Using a standard "
calibration curve, the apparent molecular masses were 60 kDa
for scFv(L19)2, 80kDa for L19-SIP and ISOkDa for L19-IgGl. In
addition, molecular aggregates that are often present in
recombinant protein preparations and that may invalidate the
results obtained in in vivo studies were demonstrated to be
absent. SDS-PAGE and size exclusion chromatography (Superdex
200) performed on the purified control proteins gave similar
results.
Using these three different L19 antibody formats,
immunohistochemical analyses were performed on cryostat
sections of SK-MEL-28 human melanoma induced in nude mice, and
of F9 murine teratocarcinoma induced in 129 strain mice.
Optimal results were obtained at concentrations as low as
0.25-0.5 nM. All three purified LIB antibodies recognized
identical structures.
In vivo stability of the radiolabeled L19 antibody formats
For in vivo biodistribution studies, SK-MEL-28 human melanoma
and F9 murine teratocarcinoma were used. SK-MEL-28 tumor has a
relatively slow growth rate while, F9 tumor grows rapidly
(Figure 2). Therefore, the use of SK-MEL-28 tumor enabled
long-lasting experiments (up to 144h), while F9 tumor was
induced for short biodistribution studies (up to 48h). All the
biodistribution experiments were performed when the tumors
were approximately 0.1-0.3 cm3. For comparison of the various
antibody formats, equimolar amounts (0.1 nmol) in lOOul of
sterile saline were injected. Before injection, the
radioiodinated compounds were filtered 0.22 urn and the
immunoreactivity and gel filtration profile were.checked (see
Materials and Methods). Immunoreactivity of the radiolabeled
proteins was always more than 90%.
Figure 3 A-C reports the profiles of the gel filtration
analysis (Superdex 200) of the radioiodinated L19 antibody
formats.
Blood samples were taken from treated animals at the different
time intervals from injection and the radioactivity present in
plasma was analyzed for immunoreactivity and by gel filtration
chromatography. Gel filtration profiles showed a single major
peak, having the molecular mass of the injected protein, for
all three L19 antibody formats. Only the profile of the scFv
revealed a second peak having a higher molecular mass,
suggesting formation of aggregates (Figure 3 D-F).
Furthermore, the formation of large molecular mass aggregates
not eluting from the Superdex 200 column, was observed for
scFv(L19)2. In fact, while the recovery from the Superdex 200
column was 90-100% of the applied radioactivity for both L19-
SIP and L19-IgG, the yield of the loaded radioactivity of
scFv(L19)2 was about 55%. The retained radioactivity was
recovered only after washing the chromatography column with
0.5M NaOH, demonstrating that large aggregates were blocked on
the column filter (Table 1).
Table 1 also reports the results of the immunoreactivity test
performed on plasma (see Materials and Methods). Over the time
of the experiments, L19-SIP and L19-IgGl maintained the same
immunoreactivity in plasma as the starting reagents. On the
contrary, already 3 hours after injection the immunoreactivity
of scFv(L19)2 in plasma was reduced to less than 40%.
Comparative biodistribution experiments
Tables 2 a, b, c and Figure 4 report the results obtained in
the biodistribution experiments with the radiolabeled LI9
antibodies in SK-MEL-28 tumor bearing mice.
Tables 2 a,b,c show, at different times from i.v. injection of
the radiolabeled antibodies, the average (±SD) of the %ID/g of
tissues and organs, including tumors.
In Figure 4 are depicted the variations of the %ID/g of the
different antibody formats in tumor (A) and blood (B) at the
different times of the experiments, as well as the ratios (C)
between the %ID/g in tumor and blood. All three LI9 antibody
formats selectively accumulated in the tumor and the ratio of
the %ID/g of tumor and other organs are reported in Table 3.
As demonstrated by microautoradiography, the antibodies .
accumulate only on the tumor vasculature, whereas no specific
accumulation on the vasculature of normal organs was seen. By
contrast, no specific accumulation of the radioiodinated
control molecules in either tumors or normal tissues was found
(Tables 2 a, b, c) .
All three L19 antibody formats showed a clearance that was
mediated mainly by the kidney, as determined by counting the
urine samples. As expected, clearance rate was faster for
scFv(L19)2 and slower for the complete L19-IgGl. Fitting of
the curve with a biexponential function yielded the half-live
values reported in Table 4.
Figure 5 depicts the variations in the %ID/g (±SD) of tumor
and blood obtained with the radioiodinated scFv(L19)2 and L19-
SIP using the F9 teratocarcinoina tumor model. Due to the high
angiogenic activity of F9 teratocarcinoma, accumulation of
radioactive molecules in this tumor was 3 to 4 times higher, 3
and 6 h after i.v. injection than in SK-MEL-28 tumor and was
persistently higher for the 48h duration of the experiment. As
for SK-MEL-28 tumor, specific accumulation in tumor
vascuiature was confirmed by microautoradiography, while no
specific tumor accumulation was seen after injection of the
control molecules. In Table 5 are reported the %ID/g of
L19(scFv) and L19SIP, at different times after i.v. injection,,
in F9 tumors and other organs.
Synthesis of reduced L19-SIP
To a solution of 375pg (5nmol) L19-SIP in 422ul PBS were added
50ul TCEP-solution (14.34mg TCEPxHCl/5ml aqueous Na2HP04, 0.1M,
pH = 7.4). The reaction mixture was gently shaken for Ih at
37°C. Reduced L19-SIP was purified by gel-chromatography using
a NAP-5 column (Amersham, Eluant: PBS). SDS-PAGE analysis of
the isolated product proofed the quantitative transformation
of L19-SIP to reduced L19-SIP.
Yield: 100.3ug/200ul PBS (26.7%).
Synthesis of Tc-99m-L19-SIP
3.0 mg disodium-L-tartrate were placed in a vial followed by
addition of 100.3pg reduced L19-SIP in 200ul PBS and the
solution was diluted with lOOul aqueous Na2HPO4-buffer (1M, pH
- 10..5) . 85pl Tc-99m generator eluate (24h) and lOpl SnCl2-
solution (5mg SnCl2/lml 0.1M HC1) were added. The reaction
mixture was shaken for 0.5h at 37°C. Tc-99m-labeled L19-SIP
was purified by gel-chromatography using a NAP-5 column
(Ameishain, Eluant: PBS) .
Radiochemical yield: 35.6%.
Radiochemical purity: 90.2% (SDS-PAGE).
Specific activity: 26.4MBq/nmol.
Immunoreactivity: 91.4%
Synthesis of Tc-99m-MAG2-L19-SIP Carboxy methyl-t-butyl
disulfide
A solution of 21.75ml (0.312mol) 1-mercapto-acetic acid,
43.5ml (0.312mol) triethylamine and lOOg (0.312mol) N-(tert.-
butylthio)-N,N'-di-BOC-hydrazine in 11 EtOH (abs.) was heated
under reflux (N2-atmosphere) for 60h. EtOH was evaporated under
reduced pressure to a final volume of about 200ml. The residue
was poured in 1.81 H20 and the pH of the resulting suspension
was adjusted to 7.14 using Smolar NaOH. Di-BOC-hydrazine was
filtered off and the pH of the resulting solution was adjusted
to 2.2 using half-concentrated HC1. Crude material was
extracted from water 3x with 600 ml CH2C12. The combined
organic layers were dried over MgSC>4 and the solvent was
evaporated under reduced pressure yielding 41.Ig (80%) as a
yellow oil. The material was pure enough for further
synthesis.
N-(benzyloxycarbonyl-Gly)Gly t-butyl ester (Z-(N-Gly)Gly tbutyl
ester
A solution of 35.02g (114mmol) Z-Gly-OSuccinimide and 15g
(114mmol) Gly-O-'Bu in 1.41 CH2C12 was stirred under atmosphere at room temperature for 20 h. The organic layer was
washed 3x with 250ml 1% aqueous citric acid, 2x with 200ml
half-saturated aqueous NaHC03 and Ix with 200ml water. The
organic layer was dried over anhydrous MgS04. Evaporation of
CH2C12 under reduced pressure yielded 36.5 g (99%) Z-Gly-Gly-0-
as a yellow oil. The crude material was pure enough for
further synthesis.
Gly-Gly t-butyl ester
36.5 g (113 mmol) of Z-Gly-Gly-CBu were dissolved in 11 THF
followed by the addition of 3.65 g palladium on charcoal (10
%) . The mixture was stirred under H2 atmosphere (latm) for 3h
at room temperature. The suspension was purged with N2,
filtered (PTFE-filter: Q.45um) and the filtrate was
concentrated under reduced pressure yielding 20.3g (95%) Gly-
Gly-0-fcBu as a yellow oil. The crude material was pure enough
for further synthesis.
Carboxy methyl-t-butyl disulfide glycyl glycine t-butylester
A solution of 23.85g (115.6mmol) DCC in 430ml CH2C12 was
dropwise added to a .solution of 21.76 g (115.6 mmol) Gly-GlyO-
Bu, 20.84 g (115.6 ramol) Carboxy methyl-t-butyl disulfide
and 13.3 g (115.6 mmol) NHS in 1 1 CH2C12. The resulting,
suspension was stirred over night under N2-atmosphere at room
temperature. After filtration the resulting solution was
washed 3x with 400ml half-saturated aqueous NaHC03 and Ix with
400 ml water. The dried organic layer (MgS04) was evaporated
under reduced pressure. The crude product was purified by
chromatography on silica gel using a solvent gradient ranging
from CH2Cl2/MeOH 99:1 to CH2Cl2/MeOH 98.5:1.5. 26.1g (64 %) were
isolated as a yellow oil.
Mercaptoacetyl glycyl glycine
26.32g (75.09mmol) Carboxy methyl-t-butyl disulfide glycyl
glycine t-butyl ester were dissolved in 233ml TFA under N2-
atmosphere. The resulting solution was stirred for 20min at
room temperature. TFA was evaporated under reduced pressure
(5-10 x 10~2mbar) and the resulting oil was dried under
stirring for additional 2h (5-10 x 10~2mbar) , After addition of
250ml Et20 a white powder precipitated and the suspension was
stirred for 3h. The material was filtered off and resuspended
in 100ml Et20. The resulting suspension was stirred over night,
the product was filtered off and the material was dried at
room temperature under reduced pressure yielding 20.46g
(92.5%) as a white powder.
Mercaptoacetyl glycyl glycine NHS ester
Mercaptoacetyl glycyl glycine (Ig, 3.4 mmol) and Nhydroxysuccinimide
(391 mg, 3.4 mmol) are combined in a dry
round bottom flask and dissolved in anhydrous DMF (4 ml). DCC
(700 mg, 3.4 mmol) in anhydrous dioxane (2 ml) was added while
stirring the reaction mixture. Within 15 min a precipitate
(DCU) begins to form. After 1 h the precipitate is removed by
vacuum filtration. The precipitate was washed with cold
dioxane. The dioxane was removed from the filtrate. The
product was precipitated.from the remaining DMF solution by
adding diethylether. The product was isolated by filtration,
washed with cold diethylether, and dried in a vacuum
desiccator overnight. Yield: 1.33 (99 %).
Synthesis of Tc-99m-MAG2-s-HN(lys) -L19-SIP
200 ug (2.66 nmol) non-reduced L19-SIP in 111 ul PBS were
diluted with 300 ul of sodium borate buffer (0.1M, pH 8.5) and
dialyzed 2 x 1 h with 200ml of phosphate buffer (0.1M, pH 8.5)
employing a Slide.-A-Lyzer 10,000 MWCO (Pierce Inc., Rockford,
IL, U.S.A.). 50 ul of mercaptoacetyl glycyl glycine NHS ester
solution (0.50 mg dissolved in 500 ul of phosphate buffer,
0.1M, pH 8.5) were added and the reaction mixture was heated
for 3 h at 37°C. The reaction mixture was dialyzed 2 x 1 h and
1'x 17 h (over night) with 200 ml of phosphate buffer (0.1M,
pH 8.5) each, employing the Slide-A-Lyzer 10,000 MWCO (Pierce
Inc., Rockford, IL, U.S.A). 3.0 mg disodium-L-tartrate were
added to the vial followed by addition of. 90 ul Tc-99m
generator eluate- (eluated daily) and 25ul SnCla-solution (5mg
SnCl2/lml 0.1M HC1) were added. The reaction mixture was shaken
for 0.5h at 37°C. Tc-99m-labeled L19-SIP was purified by gelchromatography
using a NAP-5 column (Amersham, Eluent: PBS).
Radiochemical yield:55.1 %'.
Radiochemical purity: 94.5 % (SDS-PAGE).
Specific activity: 15.2 MBg/nmol.
Immunoreactiviiy: 81.1 %Synthesis of Re-188-LI9-SIP
3.0 mg disodium-L-tartrate were placed in a vial followed by
addition of 150ug reduced L19-SIP-SH in 310ul PBS and the
solution was diluted with lOOul aqueous Na2HP04-buffer (1M, pH
= 10.5). lOOul Re-188 generator eluate and 50ul SnCl2-solution
(5mg SnCl2/lml 0.1M HC1) were added. The reaction mixture was
shaken for 1.5h at 37°C. Re-188-labeled LIB-SIP was purified
by gel-chromatography using a NAP-5 column (Amersham, Eluent:
PBS) .
Radiochemical yield:34.8 %.
Radiochemical purity: 97.2 .% (SDS-PAGE) .
Specific activity: 13.5 MBq/nmol.
Immunoreactivity: 91.7 %
Synthesis of reduced L19-SIP for specific conjugation of EDTA,
CDTA, TETA, DTPA, TTHA, HBED, DOTAf NOTA, DO3A, and a like
type chelators to the Cysteine-SH group
50ul TCEP-solution (14.34mg TCEPxHCl/5ml aqueous Na2HPC4r 0.1M,
pH = 7.4} were added to a solution of 375ug (5 nmol) L19-SIP
in 422ul PBS. The reaction mixture was gently shaken for In at
37 °C. Reduced L19-SIP was purified by gel-chromatography using
a NAP-5 column (Amersham, Eluent: sodium acetate buffer, Q.1M,
pH 5.0). SDS-PAGE analysis of the isolated product proofed the
quantitative transformation of L19-SIP into reduced L19-SIP.
Yield: 105.7ug/200ul (28.2%).
Synthesis of In-111-MX-DTPA-Ma 1 eimide-S (Cys) -Ll 9-SIP-R
(R = reduced,)
105 ug (2.8 nmol) reduced L19-SIP in 200 ul of sodium acetate
buffer (0.1M, pH 5) were reacted with 50ul of dissolved
1,4,7-triaza-2-(N-maleimido ethylene p-amino)benzyl-l,7-
bis(carboxymethyl}-4-carboxymethyl 6-methyl heptane (0,25rag
DTPA-Maleimide in 500ul sodium acetate buffer 0.1M pH 5) for
3 h at 37°C. The reaction mixture was dialyzed 2 x 1 h with
200ml of sodium acetate buffer (0.1M, pH 6) employing a Slide-
A-Lyzer 10,000 MWCO (Pierce Inc./ Rockford, IL, U.S.A.).
80 p.1 [In-Ill] InCl3 solution (HCl, IN, 40 MBq, Amersham Inc.)
were added and the reaction mixture was heated at 37°C for 30
min.
In-111 labeled DTPA-Maleimide-S(Cys)-L19-SIP was purified by
gel-chromatography using a NAP-5 column (Amersham, Eluent:
PBS) .
Radiochemical yield:51.6 %.
Radiochemical purity: 97.2 % (SDS-PAGE).
Specific activity: 7.9 MBq/nmol.
Immunoreactivity: 88.5 %
Synthesis of MX-DTPA-Malelmide (lf4,7-triaza-2-(N-maleimido
ethylene p-amino)benzyl-l, 7-bis (carboxymethyl) -4-carboxymethyl
6-methyl heptane)
512 mg (1 mmol) of {[3-(4-Amino-phenyl)-2-(bis-carboxymethylamino)-
propyl]-[2-(bis-carboxymethyl-amino)-propyl]-amino}-
acetic acid (Macrocyclics Inc. Dallas, TX, U.S.A.) and 707 mg
(7 mmol) triethylamine were dissolved in 3 ml dry DMF. 400 mg
(1,5 mmol) of 3-(2, 5-Dioxo-2,5-dihydro-pyrrol-l-yl)-propionic
acid 2,5-dioxo-pyrrolidin-l-yl ester (Aldrich) in 1 ml dry DMF
were added drop-wisely. The solution was stirred for 5 h at
50° C. 30 ml of diethylether were added slowly. The reaction
mixture was stirred for further 30 min. The precipitate was
collected by filtering. The crude product was purified by RPHPLC
(acetonitrile- : water- : trifluoracetic acid / 3 : 96,9
: 0,1 99,9 : 0 : 0,1) . Yield: 61% (405 mg, -0,61 mmol). MSESI:
664 = M+ +1. . -
Synthesis of In-lll-MX-DTPA-e-HN(Lys) -L19-SIP
200 pg (2.66 nmol) non-reduced L19-SIP in 111 pi PBS were
diluted with 300 pi of sodium borate buffer (0.1M, pH 8.5) and
dialyzed 2 x 1 h with 200ml of sodium borate buffer (0.1M, pH
8.5) employing a Slide-A-Lyzer 10,000 MWCO (Pierce Inc.,
Rockford, IL, U.S.A.). 50 ul of 1,4,7-triaza-2-(pisothiocyanato)
benzyl-l,7-bis(carboxymethyl)-4-carboxymethyl-
6-methyl heptane (MX-DTPA) solution (0.33 mg MX-DTPA dissolved
in 500 pi of sodium borate buffer, 0.1M, pH 8.5) were added
and the reaction mixture was heated for 3 h at 37°C. The
reaction mixture was dialyzed 2 x 1 h and 1 x 17 h (over
night) with 200 ml of sodium acetate buffer (0.1M, pH 6.0)
each, employing the Slide-A-Lyzer 10,000 MWCO (Pierce Inc.,
Rockford, IL, U.S.A.).
80 ul [In-lll]InCl3 solution (HC1, IN, 40 MBq, Amersham. Inc.)
were added and the reaction mixture was heated at 37°C for 30
min. In-Ill labeled MX-DTPA-E-HN (Lys)-L19-SIP was purified by
gel-chromatography using a NAP-5 column (Amersham, Eluent:
PBS) .
Radiochemical yield:72.4 %.
Radiochemical purity: 80.3 % (SDS-PAGE).
Specific activity: 8.8 MBq/nmol.
Immunoreactivity: 77.5 %
Synthesis of In-Ill -DOTA-C-Benzyl-p-NCS -s-HN(Lys)-L19-SIP
200 pg (2.66 nmol) non-reduced L19-SIP in 108 pi PBS were
diluted with 300 pi of sodium borate buffer (0.1M, pH 8.5) and
dialyzed 2 x 1 h with 200ml of sodium borate buffer (0.1M, pH
8.5) employing a Slide-A-Lyzer 10,000 MWCO (Pierce Inc.,
Rockford, IL, U.S.A.). 50 pi of 1,4,7,10-tetraaza-2-(p53
isothiocyanato)benzyl cyclododecane-1,4,1,10-tetraacetic acid
(benzyl-p-SCN-DOTA, Macrocyclics Inc., Dallas TX, U.S.A.)
solution (1.5 mg benzyl-p-SCN-DOTA dissolved in 5 ml of sodium
borate buffer, 0.1M, pH 8.5) were added to the solution and
the reaction mixture was heated for 3 h at 37°C. The reaction
mixture was dialyzed 2 x 1 h and 1 x 17 h (over night) with
200 ml of sodium acetate buffer (0.1M, pH 6.0) each, employing
the Slide-A-Lyzer 10,000 MWCO (Pierce Inc., Rockford, IL,
U.S.A.) .
80 pi [In-lll]InCl3 solution (HC1, IN, 40 MBq, Amersham Inc.)
were added and the reaction mixture was heated at 37°C for 30
.rain. In-Ill labeled DOTA-C-Benzyl-p-NCS-e-HN(Lys)-L19-SIP was
purified by gel-chromatography using a NAP-5 column (Amersham,
Eluent: PBS).
Radiochemical yield:70.8 %.
Radiochemical purity: 92.1 % (SDS-PAGE).
Specific activity: 10.1 MBq/nmol.
Immunoreactivity: 75.1 %
Synthesis of Y-88-MX-DTPA-s-HN(Lys)-L19-SIP
200 pg (2.66 nmol) non-reduced L19-SIP in-110 pi PBS were
diluted with 300 ul of sodium borate buffer (0.1M, pH 8.5) and
dialyzed 2 x 1 h with 200ml of sodium borate buffer (0.1M, p!J
8.5) employing a Slide-A-Lyzer 10,000 MWCO (Pierce Inc.,
Rockford, IL, U.S.A.). 50 ul of MX-DTPA solution (0.33 mg MXDTPA
dissolved in 500 pi of sodium borate buffer, 0.1M, pH
8.5) were added and the reaction mixture was heated for 3 h at
37°C. The reaction mixture was dialyzed 2 x 1 h and 1 x 17 h
(over night) with 200 ml of sodium acetate buffer (0.1M, pH
6.0) each, employing the Slide-A-Lyzer 10,000 MWCO (Pierce
Inc., Rockford, IL, U.S.A.).
100 jil [Y~88]YC13 solution (HC1, IN, 75 MBq, Oak Ridge National
Lab.) were added and the reaction mixture was heated at 37°C
for 30 min. Y-88 labeled MX-DTPA-e-HN(Lys)-L19-SIP was
purified by gel-chromatography using a NAP-5 column (Amersham,
Eluent: PBS).
Radiochemical yield: 68.1 %.
Radiochemical purity: 91.5 % (SDS-PAGE).
.Specific activity: 11.4 MBq/nmol.
Immunoreactivity: 70.5%
Synthesis of Lu-177 -DOTA-C-Benzyl-p-NCS -e-HN(Lys)-L19-SIP
200 ug (2.66 nmol) non-reduced L19-SIP in 120 ul PBS were
dissolved with 300 pi of sodium borate buffer (0.1M, pH 8.5)
and dialyzed 2 x 1 h with 200ral of sodium borate buffer (0.1M,
pH 8.5) employing a Slide-A-Lyzer 10,000 MWCO (Pierce Inc.,
Rockford, IL, U.S.A.). 50 ul of benzyl-p-SCN-DOTA solution
(1.5 mg dissolved in 5 ml of sodium borate buffer, 0.1M, pH
8.5) were added and the reaction mixture was heated for 3 h at
37°C. The reaction mixture was dialyzed 2 x 1 h and 1 x 17 h
(over night) with 200 ml of sodium acetate buffer (0.1M, pH ,
6.0) each, employing the .Slide-A-Lyzer 10,000 MWCO (Pierce
Inc., Rockford, IL, U.S.A.).
200 ul [Lu-177]LuCl3 solution (HC1, IN, 80 .MBq, NRH-Petten,
Netherlands) were added and the reaction mixture was heated at
37°C for 30 min. Lu-177 labeled DOTA-C-Benzyl-p-NCS-s-HN(Lys)-
L19-SIP was purified by gel-chromatography using a NAP-5
column (Amersham, Eluent: PBS).
Radiochemical yield:72.2 %.
Radiochemical purity: 94.9 % (SDS-PAGE).
Specific activity: 18.3 MBq/nmol.
Immunoreactivity: 73,4 %
Organ distribution and excretion of In-lll-MX-DTPA-L19-SIP
after a single i.v. injection into tumor-bearing nude mice
The labeled peptides of the invention were injected
intravenously in a dose of about 37 kBq into F9
{teratocarcinoma)-bearing animals (body weight about 25 g) .
The radioactivity concentration in various organs, and the
radioactivity in the excreta, was measured using a y counter
at various times after administration of the substance.
The biodistribution of In-lll-MX-DTPA-L19-SIP in F9
(teratocarcinoma)-bearing nude mice (mean ± SD, n=3) is shown
in Table 6.
Organ distribution and excretion of Tc-99m-L19-SIP after a
single i.v. injection into tumor-bearing nude mice
Labeled peptides were injected intravenously in a dose of about
56 kBq into F9 (teratocarcinoma)-bearing animals (bodyweight
about 25 g). The radioactivity concentration in various organs,
and the radioactivity in the excreta .was measured using a y
counter at various times after administration of the substance.
In addition, the tumor to blood ratio was found at various times
on the basis of the concentration of the peptide in tumor and
blood.
The biodistribution of Tc-99m-L19-SIP in F9 (teratocarcinoma)-
bearing nude mice (mean ± SD, n=3) is shown in Table 7,
The tumor to blood ratio of Tc-99m~Ll9-SIP in F9
(teratocarcinoma) -bearing nude mice (mean ± SD, n=3) is shown
in Table 8.
Radiolabeled peptides proved to possess favorable properties in
animal experiments. For example, Tc-99m-L19-SIP and In-111-MXDTPA-
8-HN(Lys)-L19-SIP displayed high tumor accumulation of
17.2 (Tc-99m ) or 12.9 (In-Ill) % injected dose per gram (ID/g)
at 1 hour post injection (p.i.}. Significant tumor retention of
9.4 (Tc-99m) or 13.0 (In-Ill) % ID/g at 24 hours p.i. was
observed. Thus, tumor uptake is significantly higher compared to
'Other known In-Ill or Tc-99m labeled antibody fragments (e.g.
Kobayashi et al., J. Nuc. Med., Vol. 41(4), pp. 755 - 762, 2000;
Verhaar et al., J. Nuc. Med., Vol. 37(5), pp. 868 - 872, 1996).
The compound's blood clearance lead to tumor/blood ratios of
13:1 and 6:1 respectively, at 24 h p.i.
Most remarkably In-lll-MX-DTPA-8-HN (Lys)-L19-SIP displayed
significantly lower kidney uptake and retention (22.5 % ID/g)
than other highly retained In-111 labeled recombinant antibody
fragment (120 % ID/g) described e.g. by Kobayashi et al. at 24 h
p.i. Kidney retention is a very common problem and usually
hampers the use of lanthanide labeled compounds in radiotherapy.
The experimental results demonstrate the excellent potential
of the radioimmunoconjugates described herein for diagnostic
and therapeutic applications, preferably applied to the
patient by parenteral administration.
DISCUSSION
The observation that cytotoxic anticancer drugs localize more
efficiently in normal tissues than in tumors (37 Bosslet et
al., 1998) prompted a wave of studies investigating the
possibility of selective drug delivery to tumors. The.
effective targeting of tumors, however, has two main
requisites: 1) a target in the tumor that is specific,
abundant, stable and readily .available for ligand molecules
coming from the bloodstream, and 2) a ligand molecule with
suitable phariuakokinetic properties that is easily diffusible
from the bloodstream to the tumor and with a high affinity for
the target to ensure its efficient and selective accumulation
in the tumor.
Due to its distinctive features the tumor microenvironment is
a possible pan-tumoral target. In fact, tumor progression
induces (and subsequently needs) significant modifications in
tumor micro-environment components, particularly those of the
extracellular matrix (ECM). The molecules making up the ECM of
solid tumors differ both quantitatively and qualitatively from
those of the normal ECM. Moreover, many of these tumor ECM
components are shared by all solid tumors, accounting for
general properties and functions such 'as cell invasion (both
normal cells into tumor tissues and cancer cells into normal
tissues) and angiogenesis. Of the numerous molecules
constituting the modified tumor ECM, the present inventors
have focused attention on a FN isoform containing the ED-B
domain (B-FN).
B-FN is widely expressed in the ECM of all solid tumors thus
far tested and is constantly associated with angiogenic
processes (22 Castellani et al., 1994), but is otherwise
undetectable in normal adult tissues (17 Carnemolla et al,,
1989). Targeted delivery of therapeutic agents to the
subendothelial ECM overcomes problems associated with
interstitial hypertension of solid tumors (38 Jain et al.
1988; 39 Jain, 1997; 40 Jain RK, 1999).
L19 (13 Pini et al. 1998; 25 Viti, Cane.Res., 23 Tarli, et
al.,- 1999), an scFv with a high affinity (Kd=5.4xlO~uM) for
the ED-B domain of FN, selectively and efficiently accumulates
in vivo around tumor neo-vasculature and is able to
selectively transport and concentrate in the tumor mass any
one of a. number of therapeutic molecules to which it is
conjugated (28 Birchler et al., 1999; 29 Nilsson, et al.,
2001; 30 Halin et al.2002; 31 Carnemolla et al., 2002). The
ability of LI9 to selectively target tumors has also been
demonstrated in patients using scintigraphic techniques.
The present specification reports on labelling of small
immunoprotein. (SIP) with radioisotopes, use of the
radiolabelled SIP, and on tumor vascular targeting performance
and pharmacokinetics of three different LI9 human antibody
formats: the scFv, the mini-immunoglobulin/small immunoprotein
and complete human IgGl.
The SIP molecule was obtained by fusion of the scFv(L19) to
the eCH4 domain of the secretory isoform 82 of human IgE. The
eCH4 is the domain that allows dimerization of IgE molecules
and the S2 isoform contains a cysteine at the COOH terminal
that covalently stabilizes the dimer through an interchain
disulphide bond (35 Batista et al., 1996). The IgE binding
sites for FceRI reside in the CH3 domain (41 Turner and Kinet,
1999; 42 Vangelista et al., 1999; 43 Garman et al., 2000), so
scFv fused to eCH4 domain in accordance with embodiments of
the present invention does not activate any signalling leading
to hypersensitivity reactions.
The performance of these three formats in two different tumor
models in mouse has been studied: in rnurine F9 teratocarcinoma
and human SK-MEL-28 melanoma. The first is a rapidly growing
tumor that, once implanted, kills the animals in about two
weeks. SK-MEL-28 tumor, on .the other hand, presents a biphasic
growth curve, with an early, fast, growth phase followed by a
second, slower, phase. It has previously been shown that the
amount of ED'-B in F9 teratocarcinoma remains stable during
tumor growth (23 Tarli, et al., 1999); by contrast, ED-B
accumulates in SK-MEL-28 melanoma proportionally to the
ability of the tumor to grow (23 Tarli et al., 1999), with
abundant ED-B being found in the first phase and a lesser
amount in. the second. The use of SK-MEL-28 melanoma tumor
allowed long-term biodistribution studies without dramatic
variations of tumoral mass (Figure 2) that could give rise to
misinterpretation of results.
Comparative studies of the three LI9 antibody formats in terms
of stability in vivo showed that L19-SIP and L19-IgGl
maintained, for the duration of experiments (144h), the same
immunoreactivity and molecular mass in plasma as before
injection. By contrast, scFv(L19) rapidly lost its
immunoreactivity in plasma and generated aggregates that were
too large to enter the gel filtration chromatography column.
Such aggregation of the scFv is very likely responsible for
the ratio between %ID/g of tumor and lung, since aggregates
could accumulate in the microvasculature of the lung (Table
3). For all three formats, the blood clearance is mediated
mainly via the kidney, showing a biphasic curve with an a and
a p phase, reported in Table 4, which is inversely
proportional to molecular size.
The accumulation of the different antibody formats in the
tumors studied was a consequence of the clearance rate and in
vivo stability of the molecules. Using the scFv, the maximum
percent injected dose per gram (%ID/g) was observed 3h after
injection of the radiolabeled antibody and then rapidly
decreased. Using the SIP, the %ID/g in tumors was 2-5 times
higher than that of the scFv, reaching a maximum 4-6 hours
after injection. This pattern was observed in both F9 and SKMEL-
28 tumors. By contrast, the accumulation of IgGl in tumors
rose constantly during the experiments. However, due to its
slow clearance, the tumor-blood ratio of the %ID/g after 144
hours was only about 3, compared to a ratio of 1Q for the scFv
and 70 for the SIP after the same period of time (Figure 4).
The same distinctive properties of in vivo stability,
clearance and tumor targeting performance shown by the three
antibody formats studied here may be exploited for different
diagnostic and/or therapeutic purposes, depending on the
clinical needs and disease. For instance, radiolabeled
antibodies showing good tumor-organ and tumor-blood ratios
soon after injection are necessary for in vivo diagnostic
immunoscintigraphy, mainly because short half-life isotopes
are used in such analysis.
Different approaches are possible using antibody as a vehicle
for therapeutic agents: delivery of substances that display
their therapeutic effects after reaching their targets (e.g.,
photosensitisers activated only on the targets), for which the
absolute amount delivered to the tumor is relevant; delivery
of substances that exert their therapeutic and toxic effects
even before reaching the target (e.g., the ^-emitter Yttrium-
90), for which particular attention must be given to the ratio
of the area under the curves of tumor and blood accumulation
as a function of time, in order to minimize the systemic
toxicity and to maximize the anti-tumor therapeutic effect.
L19-SIP, for instance, seems to offer the best compromise of
molecular stability, clearance rate and tumor accumulation.
Similar fusion proteins composed of scFv antibody fragments
bound to a dimerizing domain have already been described (44
Hu et al, 1996; 33 Li et al., 1997), but in both cases the
human Y1CH3 was used as the dimerizing domain. The usage of
the human eS2CH4 domain provides an easy way of getting a
covalent stabilization of the dimer. In addition, the
disulphide bridge formed by the C-terminal cysteine residues
can be easily reduced in mild enough conditions to preserve
the overall structure of the molecule, thus providing a
readily accessible reactive group for radiolabelling or
chemical conjugation. This feature seems particularly
promising in the view of the clinical potential.
L19-IgGl gathers abundantly in tumors, and even though this
accumulation is offset by a slow blood clearance rate, the
three step procedure to remove circulating antibodies may be
used to allow its use not only for therapeutic purposes but
also for diagnostic immunoscintigraphy (45 Magnani et al.
2000) .
REFERENCES
1. Shawler et al. J.Immunol., 135: 1530-1535, 1985
2. Miller et al. Blood, 62: 988-995, 1983.
3. Hakimi et al. J.Immunol,, 147: 1352-1359,19-91.
4. Stephens et al. Immunology, 85: 668-674, 1995.
5. Riechmann et al. Nature, 332: 323-327, 1988.
6. Junghans et al. Cancer Res., 50: 1495-1502, 1990.
7. McCafferty et al. Nature, 348: 552-554, 1990.
8. Lowman et al. Biochemistry, 30: 10832-10838, 1991
9. Nilsonn et al. Advanced Drug Delivery Reviews, 43: 165-
196, 2000.
10. Winter et al. Annu.Rev.Immunol., 12: 433-455, 1994.
11. Reichert. Nature Biotech., 19: 819-822, 2001.
12. Huls et al. Nature Biotech., 17: 276-281, 1999,
13. Pini et al. J Biol Chem, 273: 21769-21776, 1998.
14. Neri and Zardi. Advanced Drug Delivery Reviews, 31: 43-52,
1998.
15. Bissel and Radisky. Nature Reviews - Cancer., 1: 46-54,
2001
16. Balza et al. FEES Lett., 228: 42-44, 1988
17. Carnemolla et al. J, Cell. Biol., 108: 1139-1148, 1989
18. Borsi et al. FEES Lett., 261: 175-178, 1990
19. Borsi et al. J. Biol.Chem., 270: 6243-6245, 1995.
20. Zardi .et al. EMBO J.r 6: 2337-2342, 1987.
21. ffrench-Constant et al. J.Cell Biol., 109: 903-914, 1989.
22. Castellani et al. Int J Cancer, 59: 612-618, 1994
23. Tarli et al. Blood, 54:192-198, 1999.
24. Carnemolla et al. Int J Cancer, 68: 397-405, 1996
25. Viti et al. Cancer Res, 59: 347-353, 1999.
26. Neri et al. Nature Biotechnol, 15: 1271-1275, 1997.
27. Demartis et al. Eur J Nucl Med, 28: 4534-4539, 2001,
28. Birchler et al. Nat Biotechnol, 27: 984-988, 1999
29. Nilsson et al. Cancer Res., 61: 711-716, 2001.
30. Halin et al. Nature Biotechnol. In the press, 2002.
31. Carnemolla et al. Blood , 99 :, 2002
32. Wu et al. Proc. Nat. Acad. Sci. U.S.A., 97: 8495-8500,
2000.
33. Li et al. Protein Engineering, 10: 731-736, 1997
34. Pini et al. J. Immunol. Methods, 205: 171-183, 1997.
35. Batista et al. J. Exp. Med., 184: 2197-205, 1996.
36. Riske et al. J.Biol. Chem., 266: 11245-11251, 1991.
37. Bosslet et al. Cancer Res., 55:1195-1201, 1998.
38. Jain and Baxter. Cancer Res., 48: 7022-7032, 1988.
39. Jain. Vascular and interstitial physiology of tumors. Role
in cancer detection and treatment. In: R.Bicknell, C.E.
Lewis and N. Ferrara (eds). Tumour Angiogenesis, pp. 45-
59. New York: Oxford University Press, 1997.
40. Jain. Annu. Rev. Biomed. Eng., 1: 241-263, 1999.
41. Turner and Kinet. Nature, 402 Suppl., B24-B30, 1999.
42. Vangelista et. al. Jour. Clin. Invest., 103:1571-1578,
1999.
43. Carman et al.Nature, 406": 259-266, 2000.
44. Hu et al. Cancer Res., 56: 3055-3061, 1996.
45. Magnani et al. Br. J. Cancer, 82: 616-620, 2000.
(Table Removed)
- Immunoreactivity (%) and radioactivfty recovery (%) from Superdex200 were determined in plasma as described in
Materials and Methods.
-To normalize, the results of the immunoreactivity test are referred to the percentage values of the immunoreactivity
before i.v. injection.
- not determined(Table Removed)













WE CLAIM
1. A specific binding member that binds human ED-B, wherein the specific binding member is labelled with an isotope of the kind such as herein described and comprises an antigen-binding site that comprises an antibody VH domain and an antibody VL domain, wherein the isotope is 131I and wherein the antibody VH domain comprises a VH CDRl, a VH CDR2 and a VH CDR3, wherein the VH CDR3 is the L19 VH CDR3 of SEQ ID NO. 3, the VH CDRl is the L19 VH CDRl of SEQ ID NO. 1, and the VH CDR2 is the L19 VH CDR2 of SEQ ID NO. 2; and wherein the antibody VL domain comprises a VL CDRl, a VL CDR2 and a VL CDR3, wherein the VL CDR3 is the L19 VL CDR3 of SEQ ID NO. 6, the VL CDRl is the L19 VL CDRl of SEQ ID NO. 4, and the VL CDR2 is the L19 VL CDR2 of SEQ ID NO. 5; wherein the specific binding member comprises a mini-immunoglobulin comprising said antibody VH domain and antibody VL domain fused to S2-CH4 and dimerized.
2. A specific binding member as claimed in claim 1, which specific binding member competes for binding to ED-B with an ED-B-binding domain of an antibody comprising the L19 VH domain and the L19 VL domain.
3. A specific binding member as claimed in claim 1 or claim 2 comprising the L19 VH domain.
4. A specific binding member as claimed in claim 3 comprising the L19 VL domain.
5. A specific binding member as claimed in claim 4 wherein the antibody VH domain and antibody VL domain are within an scFv antibody molecule fused to S2-CH4.
6. A specific binding member as claimed in claim 5 wherein the scFv antibody molecule is fused to S2-CH4 via a linker peptide.

7. A specific binding member as claimed in claim 6 wherein the linker peptide has the amino acid sequence GGSG (SEQ ID NO. 7).
8. A method of producing a specific binding member as claimed in any one of claims 1 to 7, the method comprising labelling a specific binding member with the isotope 131I of the kind such as herein described.
9. A method as claimed in claim 8, wherein the labelling comprises oxidising a halogenide of the kind such as herein described in the presence of the specific binding member, wherein the halogenide is 131I.
10. A method as claimed in claim 8, wherein the labelling comprises conjugating an activated bi-functional halogen carrier containing a radioiosotope to a lysine or a cysteine residue or to the N terminus of the specific binding member, wherein the radioiosotope is 131I.
11. A method as claimed in any one of claims 8 to 10, wherein the method comprises expressing nucleic acid encoding the specific binding member prior to the labelling.
12. A method as claimed in claim 11, comprising culturing host cells under conditions for production of the specific binding member.
13. A method as claimed in any one of claims 8 to 12, wherein it optionally comprises isolating and/or purifying the specific binding member.
14. A method as claimed in any one of claims 8 to 13, wherein it optionally comprises formulating the specific binding member into a composition including at least one additional component.
15. A method as claimed in any one of claims 8 to 14, wherein it optionally comprises binding the specific binding member to ED-B or a fragment of ED-B.

16. A method comprising binding a specific binding member that binds ED-B as claimed in any one of claims 1 to 7 to ED-B or a fragment of ED-B.
17. A method as claimed in claim 15 or claim 16 wherein said binding takes place in vitro.
18. A method as claimed in any one of claims 15 to 17 comprising determining the amount of binding of specific binding member to ED-B or a fragment of ED-B.

Documents:

788-DELNP-2006-Abstract (13-01-2010).pdf

788-delnp-2006-abstract.pdf

788-DELNP-2006-Assignment-(17-02-2012).pdf

788-DELNP-2006-Claims (13-01-2010).pdf

788-delnp-2006-Claims-(23-05-2011).pdf

788-delnp-2006-claims.pdf

788-DELNP-2006-Correspondence Others-(17-02-2012).pdf

788-delnp-2006-Correspondence Others-(23-05-2011).pdf

788-DELNP-2006-Correspondence-Others (13-01-2010).pdf

788-DELNP-2006-Correspondence-Others (16-11-2009).pdf

788-DELNP-2006-Correspondence-Others-(23-03-2010).pdf

788-delnp-2006-correspondence-others-1.pdf

788-delnp-2006-correspondence-others.pdf

788-DELNP-2006-Description (Complete) (13-01-2010).pdf

788-delnp-2006-description (complete).pdf

788-DELNP-2006-Drawings (13-01-2010).pdf

788-delnp-2006-drawings.pdf

788-DELNP-2006-Form-1-(23-03-2010).pdf

788-delnp-2006-form-1.pdf

788-DELNP-2006-Form-16-(17-02-2012).pdf

788-delnp-2006-form-18.pdf

788-delnp-2006-form-2.pdf

788-DELNP-2006-Form-3 (13-01-2010).pdf

788-delnp-2006-Form-3-(23-05-2011).pdf

788-delnp-2006-form-3.pdf

788-delnp-2006-form-5.pdf

788-DELNP-2006-GPA (13-01-2010).pdf

788-delnp-2006-gpa.pdf

788-delnp-2006-pct-101.pdf

788-delnp-2006-pct-105.pdf

788-delnp-2006-pct-210.pdf

788-delnp-2006-pct-220.pdf

788-delnp-2006-pct-237.pdf

788-delnp-2006-pct-301.pdf

788-delnp-2006-pct-304.pdf

788-delnp-2006-pct-306.pdf

788-delnp-2006-pct-308.pdf

788-delnp-2006-pct-311.pdf

788-delnp-2006-pct-401.pdf

788-delnp-2006-pct-409.pdf

788-delnp-2006-pct-416.pdf

788-DELNP-2006-Petition 137-(23-03-2010).pdf

788-DELNP-2006-Petition-137 (13-01-2010).pdf

abstract.jpg


Patent Number 249028
Indian Patent Application Number 788/DELNP/2006
PG Journal Number 39/2011
Publication Date 30-Sep-2011
Grant Date 23-Sep-2011
Date of Filing 16-Feb-2006
Name of Patentee PHILOGEN S.P.A.
Applicant Address LA LIZZA 7, I-53100 SIENA, ITALY
Inventors:
# Inventor's Name Inventor's Address
1 CHRISTOPH-STEPHAN HILGER LANGENAUER WEG 24, 13503 BERLIN, GERMANY
2 LAURA BORSI LABORATORY OF CELL BIOLOGY, ISTITUTO NAZIONALE PER LA RICERCA SUL CANCRO, LARGO ROSANNA BENZI 10, I-16132 GENOVA, ITALY.
3 BARBARA CARNEMOLLA LABORATORY OF CELL BIOLOGY, ISTITUTO NAZIONALE PER LA RICERCA SUL CANCRO, LARGO ROSANNA BENZI 10, I-16132 GENOVA, ITALY.
4 ENRICA BALZA LABORATORY OF CELL BIOLOGY, ISTITUTO NAZIONALE PER LA RICERCA SUL CANCRO, LARGO ROSANNA BENZI 10, I-16132 GENOVA, ITALY.
5 PATRIZIA CASTELLANI LABORATORY OF CELL BIOLOGY, ISTITUTO NAZIONALE PER LA RICERCA SUL CANCRO, LARGO ROSANNA BENZI 10, I-16132 GENOVA, ITALY.
6 LUCIANO ZARDI LABORATORY OF CELL BIOLOGY, ISTITUTO NAZIONALE PER LA RICERCA SUL CANCRO, LARGO ROSANNA BENZI 10, I-16132 GENOVA, ITALY.
7 MATTHIAS FRIEBE RAUSCHSTRASSE 8, 13509 BERLIN, GERMANY
PCT International Classification Number A61K 51/10
PCT International Application Number PCT/EP2004/009733
PCT International Filing date 2004-09-01
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 03255633.4 2003-09-10 EPO
2 60/501,881 2003-09-10 EPO