Title of Invention

POLYPEPTIDES HAVING GLUCOAMYLASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME

Abstract The present invention relates to polypeptides having glucoamylase activity and isolated polynucleotides encoding said polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides. The invention also relates to the composition comprising a glucoamylase of the invention as well as the use such compositions for starch conversion processes, brewing, including processes for producing fermentation products or syrups.
Full Text

POLYPEPTIDES HAVING GLUCOAMYLASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit under 35 U.S.C. 119 of U.S. provisional application nos. 60/638,614 and 60/650,612 filed December 22, 2004 and February 7, 2005, the contents of which are incorporated herein by reference.
CROSS-REFERENCE TO A SEQUENCE LISTING
This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.
BACKGROUND OF THE INVENTION Field of the Invention
The present invention relates to polypeptides having glucoamylase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides, and to the use of glucoamylases of the invention for starch conversion to producing fermentation products, such as ethanol, and syrups, such as glucose. The invention also relates to a composition comprising a glucoamylase of the invention.
Description of the Related Art
Glucoamylase (1,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) is an enzyme, which catalyzes the release of D-glucose from the non-reducing ends of starch or related oligo-and polysaccharide molecules. Glucoamylases are produced by several filamentous fungi and yeast, with those from Aspergillus being commercially most important.
Commercially, glucoamylases are used to convert starchy material, which is already partially hydrolyzed by an alpha-amylase, to glucose. The glucose may then be converted directly or indirectly into a fermentation product using a fermenting organism. Examples of commercial fermentation products include alcohols (e.g., ethanol, methanol, butanol, 1,3-propanediol); organic acids (e.g., citric acid, acetic acid, rtaconic acid, lactic acid, gluconic acid, gluconate, lactic acid, succinic acid, 2,5-diketo-D-gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and C02), and more complex compounds, including, for example, antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, beta-carotene); hormones, and other compounds which are

difficult to produce synthetically. Fermentation processes are also commonly used in the consumable alcohol (e.g., beer and wine), dairy (e.g., in the production of yogurt and cheese), leather, and tobacco industries.
The end product may also be syrup. For instance, the end product may be glucose, but may also be converted, e.g., by glucose isomerase to fructose or a mixture composed almost equally of glucose and fructose. This mixture, or a mixture further enriched with fructose, is the most commonly used high fructose corn syrup (HFCS) commercialized throughout the world.
Boiel et al. (1984), EMBO J. 3 (5), p. 1097-1102 disclose Aspergillus niger G1 or G2 glucoamylase.
U.S. Patent No. 4,727,046 discloses a glucoamylase derived from Corticium rolfsii which is also referred to as Athelia rolfsii.
WO 84/02921 discloses a glucoamylase derived from Aspergillus awamori.
WO 99/28248 discloses a glucoamylase derived from Talaromyces emersonii.
WO 00/75296 discloses a glucoamylase derived from Thermoascus crustaceus.
It is an object of the present invention to provide polypeptides having glucoamylase activity and polynucleotides encoding the polypeptides and which provide a high yield in fermentation product production processes, such as ethanol production processes, including one-step ethanol fermentation processes from un-gelatinized raw (or uncooked) starch.
Summary of the Invention
The present invention relates to polypeptides having glucoamylase activity selected from the group consisting of:
(a) a polypeptide having an amino acid sequence which has at least 75% identity
with amino acids for mature polypeptide amino acids 1 to 556 of SEQ ID NO: 2; or
(a1) a polypeptide having an amino acid sequence which has at least 75% identity with amino acids for mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii)
which hybridizes under at least medium stringency conditions with the cDNA sequence
contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i)
or (ii); or
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence

contained in nucleotides 55 to 1737 of SEQ ID NO: 38; or (iii) a complementary strand of (i) or (ii); and
(c) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 2, or
(d) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 561 of SEQ ID NO: 37,
The present invention also relates to polynucleotides encoding polypeptides having glucoamylase activity, selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 75% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID
NO: 2;
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;
(b) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of
SEQ ID NO: 1; or
(b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of SEQ ID NO: 36;
(c) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of SEQ ID NO: 3; or
(d) a polynucleotide having at least 60% identity with nucleotides 55 to 1737 of SEQ ID NO: 38;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i) or (ii), or
(d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1737 of SEQ ID NO: 38, or (iii) a complementary strand of (i) or (ii).
In a preferred embodiment the polypeptide is derivable from a strain of the genus Trametes, preferably Trametes cingulata or the E. coli strain deposited at DSMZ and given the no. DSM 17106. Deposited strain DSM 17106 harbors plasmid HUda595 comprising a sequence identical to SEQ ID NO: 1. A specific polypeptide of the invention is the mature

polypeptide obtained when expressing piasmid pHUda440 in a suitable fungal host cell such as Aspergillus oryzae as described in Example 6.
In a second aspect the present invention relates to polypeptides having glucoamylase activity selected from the group consisting of:
(a) a polypeptide having an amino acid sequence which has at least 70% identity
with amino acids for mature polypeptide amino acids 1 to 575 of SEQ ID NO: 5; or
(a1) a polypeptide having an amino acid sequence which has at least 70% identity with amino acids for mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii)
which hybridizes under at least medium stringency conditions with the cDNA sequence
contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i)
or (ii); or
(b1) a polypeptide which is encoded by a nucieotide sequence (i) which hybridizes under at least low stringency conditions wfth nucleotides 55 to 2182 of SEQ ID NO: 39? or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii); and
(c) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 575 of SEQ ID NO: 5, or
(d) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 565 of SEQ ID NO: 40.
The present invention also relates to polynucleotides encoding polypeptides having glucoamylase activity, selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 75% identity with the mature polypeptide amino acids 1 to 575 of SEQ ID
NO: 5; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;
(b) a polynucleotide having at least 60% identity with nucleotides 55 to 2189 of
SEQ ID NO: 4; or
(b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2182 of SEQ ID NO: 39;
(c) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of
SEQ ID NO: 6; or

(d) a polynucleotide having at least 60%' identity with nucleotides 55 to 1749 of SEQ JDNO:41;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i) or (ii); or
(d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2182 of SEQ ID NO: 39, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii).
In a preferred embodiment the polypeptide is derivable from a strain of the genus Pachykytospora, preferably Pachykytospora papyracea or the £. coli strain deposited at DSMZ and given the no. DSM 17105. Deposited strain DSM 17105 harbors plasmid HUda594 comprising a sequence identical to SEQ ID NO: 4. A specific polypeptide of the invention is the mature polypeptide obtained when expressing plasmid pHUda450 in a suitable fungal host cell such as Aspergillus oryzae as described in Example 6.
In a third aspect the invention relates to polypeptides having glucoamylase activity selected from the group consisting of:
(a) a polypeptide having an amino acid sequence which has at least 60% identity
with amino acids for mature polypeptide amino acids 1 to 556 of SEQ ID NO: 26; or
(a1) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or
(a2) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or
(ii) which hybridizes under at least low stringency conditions with the cDNA sequence
contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i)
or (ii);
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42 or (iii) a complementary strand of (i) or (ii); and
(c) a variant comprising a conservative substitution, deletion, and/or insertion of
one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 26x or

(d) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 548 of SEQ ID NO: 24;
(c2) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 523 of SEQ ID NO: 43.
The present invention also relates to polynucleotides encoding polypeptides having glucoamylase activity, selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 60% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID
NO: 26; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or
(a2) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;
(b) a polynucleotide having at least 60% identity with nucleotides 117 to 2249 of SEQ ID NO: 23; or
(c) a polynucleotide having at least 60% identity with nucleotides 52 to 1719 of SEQ ID NO: 25; or
(d) a polynucleotide having at least 60% identity with nucleotides 52 to 1620 of SEQ ID NO: 42;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42, or (iii) a complementary strand of (i) or (ii), or
(d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i) or (ii).
In a preferred embodiment the polypeptide is derivable from a strain of the genus Leucopaxillus, preferably Leucopaxillus giganteus or the sequence shown in SEQ ID NO: 26. A specific polypeptide of the invention is the mature polypeptide obtained when expressing plasmid pENI3372 in a suitable fungal host cell such as Aspergillus niger as described fn Example 11.
The present invention also relates to nucleic acid constructs, recombinant expression vectors, and recombinant host cells comprising the polynucleotides in SEQ ID NOS: 1 or 3

(cDNA) or 36 or 38 (cDNA); or SEQ ID NO: 4 or 6 (cDNA) or 39 or 41 (cDNA); or SEQ ID NO: 23 or 25 (cDNA) or 42 (cDNA), respectively.
Clones that, to the best of the inventors belief, are identical to SEQ ID NO: 1 and 4 was deposited on 2 February 2005 under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure at Deutshe Sammmlung von Microorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 Braunschweig DE. The clones were giving the deposit nos. DSM 17106 and DSM 17105, respectively.
The present invention also relates to methods for producing such polypeptides having glucoamylase activity comprising (a) cultivating a recombinant host cell comprising a nucleic acid construct comprising a polynucleotide encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
The present invention also relates to processes of producing a fermentation product or syrup.
Definitions
Glucoamylase activity: The term glucoamylase (1,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) is defined as an enzyme, which catalyzes the release of D-glucose from the non-reducing ends of starch or related oligo- and polysaccharide molecules. For purposes of the present invention, glucoamylase activity is determined according to the procedure described in the 'Materials & Methods-section below.
The polypeptides of the present invention have at least 20%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100% of the glucoamylase activity of the polypeptide consisting of the amino acid sequence shown as amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37; or amino acids 1 to 575 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40; or amino acids 1 to 548 of SEQ ID NO: 24 or amino acids 1 to 556 of SEQ ID NO: 26 or amino acids 1 to 523 of SEQ ID NO: 43, respectively.
Polypeptide: The term "polypeptide" as used herein refers to a isolated polypeptide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably at least 90% pure, and even most preferably at least 95% pure, as determined by SDS-PAGE.
Substantially pure polypeptide: The term "substantially pure polypeptide" denotes herein a polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, at most

3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which it is natively associated. It is, therefore, preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99%, most preferably at least 99.5% pure, and even most preferably 100% pure by weight of the total polypeptide material present in the preparation.
The polypeptides of the present invention are preferably in a substantially pure form.
In particular, it is preferred that the polypeptides are in "essentially pure form", i.e., that the
polypeptide preparation is essentially free of other polypeptide material with which it is
natively associated. This can be accomplished, for example, by preparing the polypeptide
by means of well-known recombinant methods or by classical purification methods.
Herein, the term "substantially pure polypeptide" is synonymous with the terms "isolated polypeptide" and "polypeptide in isolated form".
Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity".
For purposes of the present invention, the degree of identity between two amino acid sequences is determined by the Clustal method (Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE™ MEGALIGN™ software (DNASTAR, Inc., Madison, Wl) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=1, gap penalty=3, windows=5, and diagonals=5.
For purposes of the present invention, the degree of identity between two nucleotide sequences is determined by the Wilbur-Lipman method (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726-730) using the LASERGENE™ MEGALIGN™ software (DNASTAR, Inc., Madison, Wl) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=3, gap penalty=3, and windows=20.
Polypeptide Fragment: The term "polypeptide fragment" is defined herein as a polypeptide having one or more amino acids deleted from the amino and/or carboxyl terminus of SEQ ID NOS: 2 or 37; or SEQ ID NOS: 5 or 40; or SEQ ID NOS: 24, 26, or 43, respectively, or homologous sequences thereof, wherein the fragment has glucoamylase activity.

Subsequence: The term "subsequence1' is defined herein as a nucleotide sequence having one or more nucleotides deieted from the 5' and/or 3' end of SEQ ID NO: 1, 36s or 38. respectively; or SEQ ID NO: 4, 39, or 41, or SEQ ID NO: 23, 25, or 42, respectively, or homologous sequences thereof, wherein the subsequence encodes a polypeptide fragment having glucoamylase activity.
Allelic variant: The term "allelic variant" denotes herein any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
Substantially pure polynucleotide: The term "substantially pure polynucleotide" as used herein refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered protein production systems: Thus, a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polynucleotide material with which it is natively associated. A substantially pure polynucleotide may, however, include naturally occurring 5' and 3' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99%, and even most preferably at least 99.5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form. In particular, it is preferred that the polynucleotides disclosed herein are in "essentially pure form", i.e., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively associated. Herein, the term "substantially pure polynucleotide" is synonymous with the terms "isolated polynucleotide" and "polynucleotide in isolated form." The polynucleotides may be of genomic, cDNA, RNA, semi-synthetic, synthetic origin, or any combinations thereof.
cDNA: The term "cDNA" is defined herein as a DNA molecule which can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic cell. cDNA lacks intron sequences that are usually present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA which is processed thrft,,r,h a wri^ nf stens hpfnrp annearina as mature spliced mRNA. These

steps include the removal of intron sequences by a process called splicing. cDNA derived from mRNA lacks, therefore, any intron sequences.
Nucleic acid construct: The term "nucleic acid construct" as used herein refers to a nucleic acid molecule, efther single- or double-stranded, which is isolated from a naturally occurring gene or which is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
Control sequence: The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of a polynucleotide encoding a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, pro-peptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.
Operably linked: The term "operably linked" denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence of a polypeptide.
Coding sequence: When used herein the term "coding sequence" means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG. The coding sequence may a DNA, cDNA, or recombinant nucleotide sequence.
Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Expression vector: The term "expression vector" is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide of the invention, and which is operably linked to additional nucleotides that provide for its expression.

Host cell: The term "host cell", as used herein, includes any cell type which is susceptible to transformation, transfection, transduction, and the like with a nucleic acid construct comprising a polynucleotide of the present invention.
Modification: The term "modification" means herein any chemical modification of the polypeptide consisting of the amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37; or amino acids 1 to 675 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40; or amino acids 1 to 556 of SEQ ID NO: 26 or SEQ ID NO: 1 to 548 of SEQ ID NO: 24 or SEQ ID NO: 1 to 523 of SEQ ID NO: 43, respectively, as well as genetic manipulation of the DNA encoding the polypeptides. The modification(s) can be substrtution(s), detetion(s) and/or insertions(s) of the amino acid(s) as well as replacement(s) of amino acid side chain(s).
Artificial variant When used herein, the term "artificial variant" means a polypeptide having glucoamylase activity produced by an organism expressing a modified nucleotide sequence of SEQ ID NOS: 1 or 3 (cDNA) or SEQ ID NOS: 36 or 38 (cDNA); or SEQ ID NO: 4 or 6 (cDNA), or SEQ ID NOS: 39 or 41 (cDNA); or SEQ ID NOS: 23 or 25 (cDNA) or 42 (cDNA). The modified nucleotide sequence is obtained through human intervention by modification of the nucleotide sequence disclosed in SEQ ID NO: 1 or 3, or SEQ ID NO: 36 or 38; or SEQ ID NO: 4 or 6, or SEQ ID NO: 39 or 41; or SEQ ID NO: 23 or 25 or 42, respectively.
Brief description of the Drawing
Figure 1 shows the debranching activity toward pullulan of Trametes cingulata glucoamylase compared to glucoamylases from Athelia rolfsii, Aspergillus niger, and Talaromyces emersonii.
Detailed Description of the Invention Polypeptides Having Glucoamylase Activity
In a first aspect, the present invention relates to polypeptides having an amino acid sequence which has a degree of identity to amino acids 1 to 556 of SEQ ID NO: 2, or amino acids 1-561 of SEQ ID NO: 37; or amino acids 1 to 575 of SEQ ID NO: 5 or amino acids 1-565 of SEQ ID NO: 40; or amino acids 1-556 of SEQ ID NO: 26 or amino acids 1-548 of SEQ ID NO: 24 or amino acids 1-523 of SEQ ID NO: 43 (i.e., mature polypeptide), respectively.
In an embodiment the amino acid sequence has glucoamylase activity and is at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferred at least 96%, even more preferred at

least £7%, even more preferred at least 98%, even, more preferably at least 99% identical to the mature part of SEQ ID NO: 2 or SEQ ID NO: 37 (hereinafter "homologous polypeptides").
In another embodiment the amino acid sequence has glucoamylase activity and has at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferred at least 96%, even more preferred at least 97%, even more preferred at least 98%, even more preferably at least 99% identity to the mature part of SEQ ID NO: 5 or SEQ ID NO: 40 (hereinafter "homologous polypeptides").
In an embodiment the amino acid sequence has glucoamylase activity and is at least 60%, at least 65%, at least 70%, at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, more preferred at least 96%, even more preferred at least 97%, even more preferred at least 98%, even more preferably at least 99% identical to the mature part of SEQ ID NO: 26, 24 or 43, respectively (hereinafter "homologous polypeptides").
In a preferred aspect, the homologous polypeptides have an amino acid sequence which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid from amino acids 1 to 556 of SEQ ID NO: 2, or amino acids 1 to 561 of SEQ ID NO: 37; or amino acids 1 to 575 of SEQ ID NO: 5, or amino acids 1 to 565 of SEQ ID NO: 40; or amino acids 1 to 556 of SEQ ID NO: 26 or amino acids 1 to 548 of SEQ ID NO: 24 or amino acids 1 to 523 of SEQ ID NO: 43, respectively.
A polypeptide of the present invention preferably comprises the mature amino acid sequences of SEQ ID NO: 2 or 37; or SEQ ID NO: 5 or 40; or SEQ ID NO: 26 24 or 43, respectively, or allelic variants thereof; or fragments thereof that have glucoamylase activity, e.g., the catalytic domain.
Catalytic Domain
In an aspect, the invention relates to polypeptides that comprise the catalytic region/domain of the amino acid sequences of SEQ ID NO: 2 or 37; or SEQ ID NO: 5 or 40 or SEQ ID NO: 26, 24, or 43, respectively.
The catalytic region/domain of the Trametes cingulata glucoamylase is located from amino acids 1 to 455 in SEQ ID NO: 2 or from amino acids 1 to 460 of SEQ ID NO: 37. In one embodiment the region may be considered to include the linker region from amino acids 456 to 465 of SEQ ID NO: 2 or amino acids 461 to 470 of SEQ ID NO: 37, respectively, or

pan thereof. The binding domain is encoded by polynucleotides 1423 to 1725 in SEQ ID NO: 3 or or polynucleotides 1774 to 2163 of SEQ ID NO: 36 or polynucleotides 1465 to 1737 of SEQ ID NO: 38, respectively.
The catalytic region/domain of the Pachykytospora papyracea glucoamylase is locates from amino acids 1 to 475 in SEQ ID NO: 5 or from amino acids 1 to 465 of SEQ ID NO: 40. In one embodiment the region may be considered to include the linker region from amino acid 476 to 484 of SEQ ID NO: 5 or amino scid 466 to 474 of SEQ ID NO: 40, respectively, or part thereof. The binding domain is encoded by polynucleotides 1420 to 1725 in SEQ ID NO: 6 or polynucleotides 1763 to 2182 of SEQ ID NO: 39 or polynucleotides 1477 to 1749 of SEQ ID NO: 41, respectively.
The catalytic region/domain of the Leucopaxillus giganteus glucoamylase is located from amino adds 1 to 451 of SEQ ID NO: 26 or amino acids 1 to 455 of SEQ ID NO: 24 or amino acids 1-418 of SEQ ID NO: 43, respectively. In one embodiment the region may be considered to include the linker region from amino acid 452 to 461 of SEQ ID NO: 26 or amino acids 456 to 466 of SEQ ID NO: 24 or amino acids 419 to 429 of SEQ ID NO: 43, respectively, or part thereof. The binding domain (CBM) is encoded by polynucleotides 1438 to 1719 in SEQ ID NO: 25 or polynucleotides 1854 to 2249 of SEQ ID NO: 23 or polynucleotides 1339 to 1620 of SEQ ID NO: 42, respectively.
In a preferred embodiment the invention relates to a catalytic region which has at least 60% identity, preferably at least 65% identity, more preferably at least 70% identity, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, even more preferably at least 90% identity, most preferably at least 95% identity, more preferred at least 96% identity, even more preferred at least 97% identity, even more preferred at least 98% identity, even more preferably at least 99% identity, especially 100% identity to amino acids 1 to 455 in SEQ ID NO: 2 or amino acids 1 to 460 of SEQ ID NO: 37 (Trametes); or amino acids 1 to 475 in SEQ ID NO: 5 or amino acids 1 to 465 of SEQ ID NO: 40 (Pachykytospora); or amino acids 1 to 451 in SEQ ID NO: 26 or amino acids 1 to 455 of SEQ ID NO: 24 or amino acids 1 to 418 in SEQ ID NO: 43 (Leucopaxillus), respectively, and which have glucoamylase activity (hereinafter "homologous polypeptides'1). In a preferred aspect, the homologous catalytic regions have amino acid sequences which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid from amino acids 1 to 455 of SEQ ID NO: 2 or amino acids 1 to 460 of SEQ ID NO: 37 (Trametes cingulata)] or amino acids 1 to 475 of SEQ ID NO: 5 or amino acids 1 to 465 of SEQ ID NO: 40 (Pachykytospora) or amino acids 1 to 451 in SEQ ID NO: 26 or amino acids 1 to 455 of

SEQ ID NO: 2424 or amino acids 1 to 418 in SEQ ID NO: 43 (Leucopaxilius giganteus), respectively.
Binding Domain
In another aspect, the invention relates to polypeptides having carbohydrate-binding affinity, preferably starch-binding affinity.
The binding domain in Trametes glucoamylase is located from amino acid 466 to 556 of SEQ ID NO: 2 and is encoded by polynucleotides 1420 to 1725 in SEQ ID NO: 3 or is located from amino acid 471 to 561 of SEQ ID NO: 37 and is encoded by polynucleotides 1465 to 1737 in SEQ ID NO: 38.
The binding domain in Pachykytospora glucoamylase is located from amino acid amino acid 485 to 575 is SEQ ID NO: 5 {Pachykytspora) and is encoded by polynucleotides 1423 to 1725 in SEQ ID NO: 6 or is located from amino acid 475 to 565 of SEQ ID NO: 40 and is encoded by polynucleotides 1477 to 1749 in SEQ ID NO: 41.
The binding domain in Leucopaxilius glucoamylase is located from amino acid 463 to 556 of SEQ ID NO: 26 or from amino acids 467 to 548 of SEQ ID NO: 24 or from amino acids 430 to 523 of SEQ ID NO: 43, respectively, and is encoded by polynucleotides 1854 to 2249 in SEQ ID NO: 23 or polynucleotides 1438 to 1719 in SEQ ID NO: 25 or polynucleotides 1339 to 1620 in SEQ ID NO: 42, respectively.
Consequently, in this aspect the invention relates to a polypeptide having carbohydrate-binding affinity, selected from the group consisting of:
(a) i) a polypeptide comprising an amino acid sequence which has at least 60%
identity with amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID
NO: 37, respectively; or
ii) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively; or
iii) a polypeptide comprising an amino acid sequence which has at least 60% identity
with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively;
(b) a polypeptide which is encoded by a nucleotide sequence which hybridizes under low
stringency conditions with a polynucleotide probe selected from the group consisting of
(i) the complementary strand of nucleotides 1420 to 1725 of SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively;

(ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively;
(iii) the complementary strand of nucleotides 1438 to 1719 of SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively; (c) a fragment of (a) or (b) that has carbohydrate binding affinity.
In a preferred embodiment the carbohydrate binding affinity is starch-binding affinity.
In a preferred embodiment the invention relates to a polypeptide having carbohydrate binding affinity which has at least 60% identity, preferably at least 70% identity, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, even more preferably at least 90% identity, most preferably at least 95% identity, more preferred at least 96% identity, even more preferred at least 97% identity, even more preferred at least 98% identity, even more preferably at least 99% identity, especially 100% identity to amino acids 466 to 556 in SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively, (Tramefes), or amino acids 485 to 575 in SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, (Pachykytospora), or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43, respectively {Leucopaxillus), respectively.
In a preferred aspect, homologous binding domains have amino acid sequences which differs by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, most preferably by two amino acids, and even most preferably by one amino acid from amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively, (Trametes cingulata) or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, (Pachykytospora) or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43, respectively {Leucopaxillus), respectively.
In another embodiment the invention relates to a polypeptide having carbohydrate-binding affinity, selected from the group consisting of:
(a) a polypeptide which is encoded by a nucleotide sequence which hybridizes under low stringency conditions, preferably under medium, more preferably under high stringency conditions with a polynucleotide probe selected from the group consisting of
(i) the complementary strand of nucleotides 1420 to 1725 of SEQ ID NO: 3 or nucleotides 1465 to 1737 in SEQ ID NO: 38, respectively;
(ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 in SEQ ID NO: 41, respectively;

(iii) the complementary strand of nucleotides 1438 to 1719 of SEQ ID NO: 25 or nucleotides 1854 to 2249 in SEQ ID NO: 23 or nucleotides 1339 to 1620 in SEQ ID NO: 42, respectively; (b) a fragment of (a) that has carbohydrate-binding affinity.
The invention also relates to a polypeptide having carbohydrate-binding affinity, where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion of an amino acid as compared to amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37 (Trametes)\ or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40 (Pachykytospora); or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43(Leucopaxillus)l respectively.
The invention also relates to a polypeptide having carbohydrate-binding affinity, where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion of an amino acid as compared to the amino acid sequence encoded by the carbohydrate-binding domain encoding part of the polynucleotide sequences shown in position 1420 to 1725 in SEQ ID NO: 3 or position 1465 to 1737 in SEQ ID NO: 38; or position 1423 to 1725 of SEQ ID NO: 6 or position 1477 to 1749 in SEQ ID NO: 41; or position 1438 to 1719 of SEQ ID NO: 25 or position 1854 to 2249 in SEQ ID NO: 23 or nucleotides 1339 to 1620 in SEQ ID NO: 42, respectively.
Hybrids
The glucoamylases or catalytic regions of the invention may be linked, via a linker sequence or diredtly, to one or more foreign binding domains (also referred to as binding modules (CBM)). A "foreign" binding domain is a binding-domain that is not derived from the wild-type glucoamylases of the invention in question. The binding-domain is preferably a carbohydrate-binding domain (i.e., having affinity for binding to a carbohydrate), especially a starch-binding domain or a cellulose-binding domain. Preferred binding domains are of fungal or bacterial origin. Examples of specifically contemplated starch-binding domains are disclosed in WO 2005/003311 which is hereby incorporated by reference.
In a preferred embodiment the linker in a glucoamylase of the invention is replaced with a more stable linker, i.e., a linker that is more difficult to cut than the parent linker. This is done to avoid that the binding-domain is cleaved off. Specifically contemplated stable linkers include the Aspergillus kawachii linker:
Mill IAAAT STSKATTSSSSSSAAATTSSS (SEQ ID NO: 22)

Thus, in a preferred embodiment the invention relates to a hybrid glucoamyiase having the amino acid sequence shown in SEQ ID NO: 2 or 37 r respectively, wherein the native linker located from amino acids 456 to 465 of SEQ ID NO: 2 or from amino acids 461 to 470 in SEQ ID NO: 37, respectively, or part thereof, is replaced with the Aspergillus kawachii linker shown in SEQ ID NO: 22.
Thus, in another preferred embodiment the invention relates to a hybrid glucoamyiase having the amino acid sequence shown in SEQ ID NO: 5 or 40, respectively, wherein the native linker located from 476 to 484 in SEQ ID NO: 5 or from amino acids 466 to 474 in SEQ ID NO: 40, respectively, or part thereof is replaced with the Aspergillus kawachii linker shown in SEQ ID NO: 22.
Thus, in another preferred embodiment the invention relates to a hybrid glucoamyiase having the amino acid sequence shown in SEQ ID NO: 26 or 24, respectively, wherein the native linker located from 452 to 462 in SEQ ID NO: 26 or from amino acids 456 466 in SEQ ID NO: 24 or from amino acids 419 to 429 in SEQ ID NO: 24, respectively, or part thereof is replaced with the Aspergillus kawachii linker shown in SEQ ID NO: 22.
Thus, the invention also relates to hybrids consisting of a glucoamyiase of the invention or catalytic domain of the invention having glucoamyiase activity fused to a stable linker (e.g., Aspergillus kawachii linker) and one or more carbohydrate-binding domains, e.g., a carbohydrate-binding module (CBM) disclosed in WO 2005/003311 on page 5, line 30 to page 8, line 12, hereby incorporated by reference.
Hybridization
In another aspect, the present invention relates to polypeptides having glucoamyiase activity which are encoded by polynucleotides (i) which hybridizes under at least low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleotide sequence with nucleotides 55 to 2166 of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36, respectively (Trametes genomic DNA), or (ii) which hybridizes under at least medium stringency conditions, preferably medium-high stringency conditions, more preferably high stringency conditions, and more preferably very high stringency conditions with a nucleotide sequence with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38, respectively (Trametes cDNA), or (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii) (J. Sambrook, E.F. Frrtsch, and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York). A subsequence of SEQ ID NOS: 1 or 3, or SEQ ID NOS: 36 or 38 (Trametes) contains at

least 100 contiguous nucleotides or preferably at least 200 continguous nucleotides. Moreover, the subsequence may encode a polypeptide fragment which has giucoamyiase activity.
The invention also relates to isolated polypeptides having giucoamyiase activity which are encoded by polynucleotides (i) which hybridizes under at least low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleotide sequence with nucleotides 55 to 2189 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39, respectively (Pachykytospora genomic DNA), or (is) which hybridizes under at least medium stringency conditions, preferably medium-high stringency conditions, more preferably high stringency conditions, and even more preferably very high stringency conditions with a nucleotide sequence with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41, respectively (Pachykytospora cDNA), or (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii).
The invention also relates to isolated polypeptides having giucoamyiase activity which are encoded by polynucleotides (i) which hybridizes under at least low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleotide sequence with nucleotides 117 to 2249 of SEQ ID NO: 23 {Leucopaxillus genomic DNA), or (ii) which hybridizes under at least low stringency conditions, preferably medium, more preferably medium-high stringency conditions, more preferably high stringency conditions, and even more preferably very high stringency conditions with a nucleotide sequence with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25 or nucleotides 52 to 1620 of SEQ ID NO: 42 (Leucopaxillus cDNA), or (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii)
The nucleotide sequence of SEQ ID NO: 1, 3, 36, or 38, respectively, or a subsequence thereof, or the nucleotide sequence of SEQ ID NO: 4, 6, 39, or 41, respectively, or a subsequence thereof, or the nucleotide sequence of SEQ ID NO: 23, 25 or 42, respectively, or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or 37, respectively, or a fragment thereof, or the amino acid sequence of SEQ ID NO: 5 or 40, respectively, or a fragment thereof, or the amino acid sequence of SEQ ID NO: 26, 24, or 43, respectively, or a fragment thereof, may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides having giucoamyiase activity from strains of different genera or species according to methods well known in the art. In particular, such

probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 14, preferably at least 25, more preferably at least 35, and most preferably at least 70 nucleotides in length. It is however, preferred that the nucleic acid probe is at least 100 nucleotides in length. For example, the nucleic acid probe may be at least 200 nucleotides, preferably at least 300 nucleotides, more preferably at least 400 nucleotides, or most preferably at least 500 nucleotides in length. Even longer probes may be used, e.g., nucleic acid probes which are at least 600 nucleotides, at least preferably at least 700 nucleotides, more preferably at least 800 nucleotides, or most preferably at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.
A genomic DNA or cDNA library prepared from such other organisms may, therefore, be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide having glucoamylase activity. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA which is homologous with SEQ ID NO: 1, 3, 36, or 38, respectively, or a subsequence thereof, or SEQ ID NO: 4, 6, 39 or 41, respectively, or a subsequence thereof, or SEQ ID NO: 23, 25, or 42, respectively, or a subsequence thereof, the carrier material is used in a Southern blot.
For purposes of the present invention, hybridization indicates that the nucleotide sequences hybridize to labeled nucleic acid probes corresponding to the nucleotide sequence shown in SEQ ID NO: 1, 3, 36 or 38, respectively, or SEQ ID NO: 4, 6, 39, or 41, respectively, or SEQ ID NO: 23, 25, or 42, respectively, its complementary strands, or subsequences thereof, under low or medium to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using X-ray film.
In a preferred embodiment, the nucleic acid probe is nucleotides 55 to 2166 of SEQ »NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36, or nucleotides 1 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38 (Trametes cDNA). In a preferred embodiment, the nucleic acid probe is nucleotides 55 to 2186 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39 or nucleotides 1 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41 {Paohykytospora cDNA). In a preferred

embodiment, the nucleic acid probe is nucleotides 117 to 2249 of SEQ ID NO: 23 or nucleotides 52 to 1719 of SEQ ID NO: 25 (Leucopaxilius cDNA) or nucleotides 52 to 1620 of SEQ ID NO: 42 (Leucopaxilius cDNA). In other preferred aspect, the nucleic acid probe is a polynucleotide sequence which encodes the catalytic region between amino acids 1 and 455 of SEQ ID NO: 2 or amino acids 1 to 460 of SEQ ID NO: 37 (Trametes) or between amino acids 1 and 475 of SEQ ID NO: 5 or amino acids 1 to 465 of SEQ ID NO: 40 (Pachykytospora) or between amino acids 1 and 455 of SEQ ID NO: 24 or amino acids 1 to 451 of SEQ ID NO: 26 or amino acids 1 to 418 of SEQ ID NO: 43 (Leucopaxilius).
In another aspect the invention relates to nucleic acid probes that encode the binding domain in amino acids 466 to 456 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively, or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, or amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids 430 to 523 of SEQ ID NO: 43, respectively.
In another preferred aspect, the nucleic acid probe is the mature polypeptide coding region of SEQ ID NOS: 1, 3, 36 or 38, respectively (Trametes). In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region of SEQ ID NOS: 4, 6, 39 or 41 (Pachykytospora). In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region of SEQ ID NOS: 23, 25, or 42 (Leucopaxilius). In another preferred aspect, the nucleic acid probe is the part of the sequences in plasmids pHUda595 and pHUda594, respectively, coding for the mature polypeptides of the invention Plasmids pHUda595 and pHUda594, which are contained in Escherichia coli DSM 17106 and Escherichia coli DSM 17105, respectively, encode polypeptides having glucoamylase activity.
For long probes of at least 100 nucleotides in length, low to very high stringency conditions are defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micro g/ml sheared and denatured salmon sperm DNA, and either 25% formamide for low stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally. .
For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS preferably at least at 50°C (low stringency), more preferably at least at 55°C (medium stringency), more preferably at least at 60°C (medium-high stringency), even more preferably at least at 65°C (high stringency), and most preferably at least at 70°C (very high stringency).

For short probes which are about 15 nucleotides to about 70 nucleotides in length. stringency conditions are defined as prehybridization, hybridization, and washing post-hybridization at about 5°C to about 10°C below the calculated Tm using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCI, 0.09 M Tris-HCI pH 7.6, 6 mM EDTA, 0.5% NP-40, 1X Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.
For short probes which are about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5°C to 10°C below the calculated Tm.
Under salt-containing hybridization conditions, the effective Tm is what controls the degree of identity required between the probe and the filter bound DNA for successful hybridization. The effective Tm may be determined using the formula below to determine the degree of identity required for two DIMAs to hybridize under various stringency conditions.
Effective Tm = 81.5 + 16.6(log MfNa*]) + 0.41 (%G+C) - 0.72(% formamide)
(See www.ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm)
The G+C content of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 1 is 60.5%. The G+C content of SEQ ID NO: 3 (cDNA) or nucleotides 55 to 1725 of SEQ ID NO: 3 is 62.3%.
The G+C content of SEQ ID NO: 4 or nucleotides 55 to 2189 of SEQ ID NO: 4 is 60.7%. The G+C content of SEQ ID NO: 6 (cDNA) or nucleotides 55 to 1725 of SEQ ID NO: 6 is 63.7%.
For medium stringency, the formamide is 35% and the Na+ concentration for 5X SSPE is 0.75 M. Applying this formula to these values, the Effective Tm is 79.0°C.
Another relevant relationship is that a 1% mismatch of two DNAs lowers the Tm by 1.4°C. To determine the degree of identity required for two DNAs to hybridize under medium stringency conditions at 42°C, the following formula is used:
% Homology = 100 - [(Effective Tm - Hybridization Temperature)/1.4] (See www.ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm)
Applying this formula to the values, the degree of identity required for two DNAs to hybridize under medium stringency conditions at 42°C is 100 - [(79.0 - 42)/1.4] = 51%.
Variants
In a further aspect, the present invention relates to artificial variants comprising a conservative substitution, deletion, and/or insertion of one or more amino acids in SEQ ID NOS: 2, 5, 24, 26, 37, 40, and 43, respectively, or the mature polypeptide thereof.

Preferably, amino acid changes are of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.
Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions which do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L Hill, 1979, //?, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, AlaA/al, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/He, LeuA/al, Ala/Glu, and Asp/Gly.
In addition to the 20 standard amino acids, non-standard amino acids (such as 4-hydroxyproline, 6-W-methyl lysine, 2-aminoisobutyric acid, isovaline, and alpha-methyl serine) may be substituted for amino acid residues of a wild-type polypeptide. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for amino acid residues. "Unnatural amino acids" have been modified after protein synthesis, and/or have a chemical structure in their side chain(s) different from that of the standard amino acids. Unnatural amino acids can be chemically synthesized, and preferably, are commercially available, and include pipecolic acid, thiazolidine carboxyiic acid, dehydroproline, 3- and 4-methylproline, and 3,3-dimethylproline.
Alternatively, the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like.
Essential amino acids in the parent polypeptides can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (i.e., glucoamylase activity) to

identify amino acid residues that are critical to the activity of the molecule. See aiso; Hilton et a/., 199S: J. Biol. Chem. 271: 4699-4708. The active site of the enzymes or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et a/., 1992, Science 255: 306-312; Smith et a/., 1992, J. Mol. Biol. 224: 899-904; Wlodaveref a/., 1992, FEBS Lett. 309:59-64. The identities of essential amino acids can also be inferred from analysis of identities with polypeptides which are related to a polypeptide according to the invention.
Single or multiple amino acid substitutions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et a/., 1991, Biochem. 30:10832-10837; U.S. Patent No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et a/., 1986, Gene 46:145; Ner et a/., 1988, DNA 7:127).
Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells. Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.
The total number of amino acid substitutions, deletions and/or insertions of amino acids in position 1 to 556 of SEQ ID NO: 2 or position 1 to 561 of SEQ ID NO: 37 {Trametes glucoamylase); or in position 1 to 575 in SEQ ID NO: 5 or position 1 to 565 in SEQ ID NO: 40 (Pachykytospora glucoamylase) or position 1 to 556 of SEQ ID NO: 26 or position 1 to 548 of SEQ ID NO: 24 or position 1 to 523 of SEQ ID NO: 43 (Leucopaxilus glucoamylase), respectively, is 10, preferably 9, more preferably 8, more preferably 7, more preferably at most 6, more preferably at most 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1.
Sources of Polypeptides Having Glucoamylase Activity
A polypeptide of the present invention may be obtained from microorganisms of any genus. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the polypeptide encoded by a nucleotide

sequence is produced by the source or by a strain in which the nucleotide sequence from the source has been inserted, in a preferred aspect, the polypeptide obtained from a given source is secreted extraceliulariy.
In a preferred embodiment, the glucoamylase of the invention derived from the class Basidiomycetes. In a more preferred embodiment a glucoamylase of the invention is derived from a strain of the genus Trametes, more preferably from a strain of the species Trametes cingulata, or deposited clone DSM 17106, or a strain of.the genus Pachykytospora more preferably a strain of the species Pachykytospora papyracea, or the deposited clone DSM 17105, or a strain of the genus Leucopaxillus, more preferably a strain of the species Leucopaxillus giganteus.
It will be understood that for the aforementioned species, the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.
The Trametes cingulata strain was collected in Zimbabwe in the period from 1995 to 1997.
The Pachykytospora papyracea strain was collected in Zimbabwe in the period from 1995 to 1997.
The Leucopaxillus giganteus strain was collected in Denmark in 2003.
Furthermore, such polypeptides may be identified and obtained from other sources including microorganisms isolated from nature (e.g., soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from natural habitats are well known in the art. The polynucleotide may then be obtained by similarly screening a genomic or cDNA library of another microorganism. Once a polynucleotide sequence encoding a polypeptide has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques which are well known to those of ordinary skill in the art (see, e.g., Sambrook et a/., 1989, supra).
Polypeptides of the present invention also include fused polypeptides or cleavable fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) encoding another polypeptide to a nucleotide sequence (or a portion thereof) of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fused polypeptide is under control of the same oromoterfs} and terminator.

Polynucleotides
The present invention also relates to isolated polynucleotides having a nucleotide sequence which encode a polypeptide of the present invention. In a preferred aspect, the nucleotide sequence is set forth in any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively. In another more preferred aspect, the nucleotide sequence is the sequence contained in plasmid pHuda595 or pHuda594 that is contained in Escherichia coli DSM 17106 and Escherichia coli DSM 17105, respectively. In another preferred aspect, the nucleotide sequence is the mature polypeptide coding region of any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively. The present invention also encompasses nucleotide sequences which encode a polypeptide having the amino acid sequence of any of SEQ ID NO: 2, 5, 24, 26, 37, 40, or 43, respectively, or the mature polypeptide thereof, which differs from SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42 respectively, by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively, which encode fragments of SEQ ID NO: 2, 5, 24, 26, 37, 39, 40, or 43 respectively, that have glucoamylase activity.
The present invention also relates to mutant polynucleotides comprising at least one mutation in the mature polypeptide coding sequence of any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively, in which the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 556 of SEQ ID NO: 2, amino acids 1 to 575 of SEQ ID NO: 5, amino acids 1 to 548 of SEQ ID NO: 24, amino acid 1 to 556 of SEQ ID NO: 26, amino acids 1 to 561 of SEQ ID NO: 37, amino acids 1 to 565 of SEQ ID NO: 40, or amino acids 1 to 523 of SEQ ID NO: 43, respectively.
The techniques used to isolate or clone a polynucleotide encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the polynucleotides of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et a/., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) may be used. The polynucleotides may be cloned from a strain of the genera Trametes, Pachykytospora, Leucopaxillus or other or related organisms and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the nucleotide sequences.

The present invention also relates to polynucleotides having nucleotide sequences which have a degree of identity to the mature polypeptide coding sequence of SEQ ID NO: 1 (i.e., nucleotides 55 to 2166), or SEQ ID NO: 3 (i.e., nucleotides 55 to 1725), or SEQ ID NO: 4 (i.e., nucleotides 55 to 2182), or SEQ ID NO: 6 (i.e., nucleotides 55 to 1725), or SEQ ID NO: 25 (i.e., nucleotides 52 to 1719), or SEQ ID NO: 38 (i.e., nucleotide 55 to 1737), or SEQ ID NO: 41 (i.e., nucleotide 55 to 1749), or SEQ ID NO: 42 (i.e., nucleotide 55 to 1620), respectively, of at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more prefer ably 96%, even more 97%, even more 98%, and most preferably at least 99% identity, which encode an active polypeptide.
Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide. The term "substantially similar* to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g., artificial variants that differ in specific activity, thermostability, pH optimum, or the like. The variant sequence may be constructed on the basis of the nucleotide sequence presented as the mature polypeptide encoding region of any of SEQ ID NO: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively, e.g., subsequences thereof, and/or by introduction of nucleotide substitutions, which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence. For a general description of nucleotide substitution, see, e.g., Ford et al., 1991, Protein Expression and Purification 2: 95-107.
It will be apparent to those skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active polypeptide. Amino acid residues essential to the activity of the polypeptide encoded by an isolated polynucleotide of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, mutations are introduced at every positively charged residue in the molecule, and the resultant mutant molecules are tested for glucoamylase activity to identify amino acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic

resonance analysis, crystallography or photoaffinity labelling (see; e.g., de Vos et a/., 1992, Science 255: 306-312; Smith ei a/., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et a/., 1992, FEBS Letters 309: 59-64).
The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, (i) which hybridize under low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferabfy high stringency conditions, and most preferably very high stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36,respectively, or (ii) which hybridize under medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38, respectively, or (iii) a complementary strand of (i) or (ii); or allelic variants and subsequences thereof (Sambrook et a/., 1989, supra), as defined herein.
The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, (i) which hybridize under low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39, respectively, or (ii) which hybridize under medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii); or allelic variants and subsequences thereof (Sambrook et a/., 1989, supra), as defined herein.
The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, (i) which hybridize under low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) which hybridize under low stringency conditions, preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with nucleotides the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25 or nucleotides 52 to 1620 of SEQ ID NO: 42, respectively, or (iii) a complementary strand of (i) or (ii); or allelic variants and subsequences thereof (Sambrook et a/., 1989, supra), as defined herein.

The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a population of DNA under low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 55 to 2166 of SEQ ID NO: 1 or nucleotides 55 to 2166 of SEQ ID NO: 36, respectively, or (ii) hybridizing a population of DNA under medium, medium-high, high, or very high stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3 or nucleotides 55 to 1737 of SEQ ID NO: 38, respectively, or (iii) a complementary strand of (i) or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having glucoamylase activity.
The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a population of DNA under low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 55 to 2189 of SEQ ID NO: 4 or nucleotides 55 to 2182 of SEQ ID NO: 39, respectively,, or (ii) hybridizing a population of DNA under medium, medium-high, high, or very high stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6 or nucleotides 55 to 1749 of SEQ ID NO: 41, respectively,, or (iii) a complementary strand of (i) or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having glucoamylase activity.
The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a population of DNA under low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) hybridizing a population of DNA under medium, medium-high, high, or very high stringency conditions with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25 or nucleotides 52 to 1620 of SEQ ID NO: 42, respectively, or (iii) a complementary strand of (i) or (ii); and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having glucoamylase activity.
Nucleic Acid Constructs
The present invention also relates to.nucleic acid constructs comprising an isolated polynucleotide of the present invention operably linked to one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
An isolated polynucleotide encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well known in the art.

The control sequence may De an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence contains transcriptional control sequences which mediate the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (g/a4), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium venenatum glucoamylase (WO 00/56900), Fusarium venenatum Dana (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Fusarium oxysporum trypsin-like protease (WO 96/00787), Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase); and mutant, truncated, and hybrid promoters thereof..
In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraIdehyde-3-phosphate dehydrogenase (ADH1,ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionine (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanes et a/., 1992, Yeast 8: 423-488.
The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

Preferred terminators for filamentous fungal host ceils are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger aipha-glucosidase, and Fusarium oxysporum trypsin-like protease.
Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et a/., 1992, supra.
The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 51 terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleotide sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.
Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.
The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal

peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. However, any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.
Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.
Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et a/., 1992, supra.
The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (apnE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836).
Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences. Other examples of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene which is amplified in the

presence of methotrexate, and the metallothionein genes which are amplified with heavy metais. In these cases, the nucleotide sequence encoding the polypeptide would be operably linked with the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acids and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites. Alternatively, a nucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about expression of the nucleotide sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids.
The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chrqmosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
The vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
Examples of suitable markers for yeast host cells are ADE2, H1S3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase),

bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well a» equivalents thereof. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.
The* vectors of the present invention preferably contain an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication which functions in a cell. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.
Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et a/., 1991, Gene 98:61-67; Cullen et a/., 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.

More than one copy of a polynucleotide of the present invention may be inserted into the host ceil to increase production of the gene product. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the hctst cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to o*ne skilled in the art (see, e.g., Sambrook et ai, 1989, supra).
Host Cells
The present invention also relates to recombinant host cells, comprising a polynucleotide of the present invention, which are advantageously used in the recombinant production of the polypeptides. A vector comprising a polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.
In a preferred aspect, the host cell is a fungal cell. "Fungi* as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et ai, In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et ai, 1995, supra, page 171) and all mitosporic fungi (Hawksworth et ai, 1995, supra).
In a more preferred aspect, the fungal host cell is a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfect! {Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, FA, Passmore, S.M., and Davenport, R.R., eds, Soc. App. Bacterioi Symposium Series No. 9, 1980).
In an even more preferred aspect, the yeast host cell is a Candida, Hansenula, Kiuyveromyces, Pichia, Saccharomyces, Schi20saccharomyces, or Yarrowia cell.

In a most preferred aspect, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyven\ Saccharomyces norbensis or Saccharomyces oviformis cell, in another most preferred aspect, the yeast host cell is a Kluyveromyces lactis cell. In another most preferred aspect, the yeast host cell is a Yarrowia lipolytica cell.
In another more preferred aspect, the fungal host cell is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et a/., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
In an even more preferred aspect, the filamentous fungal host cell is an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
In a most preferred aspect, the filamentous fungal host cell is an Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell. In another most preferred aspect, the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell. In another most preferred aspect, the filamentous fungal host cell is a Bjerkandera adusta, Cen'poriopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Cen'poriopsis rivulosa, Ceriporiopsis subrufa, or Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor mieheit Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiaium, Trichoderma reesei, or Trichoderma viride strain cell.

Fungal ceils may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton ef a/., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods for transforming Fusaiium species are described by Malardier ef a/., 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et a/., 1983, Journal of Bacteriology 153: 163; and Hinnen ef a/., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.
Methods of Production
The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide. Preferably, the cell is of the genus Trametes, Pachykytospora, or Leucopaxillus, and more preferably Trametes cingulata, Pachykytospora papyracea, or Leucopaxillus giganteus.
The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a host cell under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
The present invention also relates to methods for producing a polypeptide of the present invention, comprising (a) cultivating a host cell under conditions conducive for production of the polypeptide, wherein the host cell comprises a nucleotide sequence having the mature polypeptide coding region of SEQ ID NOS: 1, 3, 4, 6, 23, 25, 36, 38, 39, 41, or 42, respectively, wherein the nucleotide sequence encodes a polypeptide which consists of amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37, respectively; or amino acids 1 to 575 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40, respectively; or amino acids 1 to 556 of SEQ ID NO: 26 or amino acids 1 to 548 of SEQ ID NO: 24 or amino acids 1 to 523 of SEQ ID NO: 43, respectively, and (b) recovering the polypeptide.
In the production methods of the present invention, the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods well known in the art. For example, the cell may be cultivated by shake flask cultivation, and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state

fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
The polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide as described herein.
The resulting polypeptide may be recovered using methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
The polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Rycten, editors, VCH Publishers, New York, 1989).
Plants
The present invention also relates to a transgenic plant, plant part, or plant cell which has been transformed with a nucleotide sequence encoding a polypeptide having glucoamylase activity of the present invention so as to express and produce the polypeptide in recoverable quantities. The polypeptide may be recovered from the plant or plant part. Alternatively, the plant or plant part containing the recombinant polypeptide may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, payability, and Theological properties, or to destroy an antinutritive factor.
The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot). Examples of monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as Festuca, Lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).

Examples of dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea: bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana.
Examples of plant parts are stem, callus, ieaves, root, fruits, seeds, and tubers as well as the individual tissues comprising these parts, e.g., epidermis, mesophyll, parenchyme, vascular tissues, meristems. Specific plant cell compartments, such as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part. Furthermore, any plant cell, whatever the tissue origin, is considered to be a plant part. Likewise, plant parts such as specific tissues and cells isolated to facilitate the utilisation of the invention are also considered plant parts, e.g., embryos, endosperms, aleurone and seeds coats.
Also included within the scope of the present invention are the progeny of such plants, plant parts, and plant cells.
The transgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with methods known in the art. In short, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the plant host genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.
The expression construct is conveniently a nucleic acid construct which comprises a polynucleotide encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleotide sequence in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).
The choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or transit sequences, is determined, for example, on the basis of when, where, and how the polypeptide is desired to be expressed. For instance, the expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmental, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory, sequences are, for example, described by Tague et a/., 1988, Plant Physiology 86: 506.
For constitutive expression, the 35S-CaMV, the maize ubiquitin 1, and the rice actin 1 promoter may be used (Franck et a/., 1980, Cell 21: 285-294, Christensen et a/., 1992, Plant Mo. Biol. 18: 675-689; Zhang et a/., 1991, Plant Cell 3: 1155-1165). Organ-specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato

tubers, and fruits (Edwards & CoruzzL 1990., Ann. Rev, Genet 24: 275-303); or from metabolic sink tissues such as meristems (ito et a/., 1994, Plant MoL Biol. 24: 863-878), a seed specific promoter such as the giutelin, prolamin, globulin, or albumin promoter from rice (Wu ef a/., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et a/., 1998, Journal of Plant Physiology 152: 708-711), a promoter from a seed oil body protein (Chen et ai, 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Brassica napus, or any other seed specific promoter known in the art, e.g., as described in WO 91/14772. Furthermore, the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka ef a/., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et a/., 1995, Molecular and General Genetics 248: 668-674), or a wound inducible promoter such as the potato pin2 promoter (Xu et a/., 1993, Plant Molecular Biology 22: 573-588). Likewise, the promoter may inducible by abiotic treatments such as temperature, drought, or alterations in salinity or induced by exogenously applied substances that activate the promoter, e.g., ethanol, oestrogens, plant hormones such as ethylene, abscisic acid, and gibberellic acid, and heavy metals.
A promoter enhancer element may also be used to achieve higher expression of a polypeptide of the present invention in the plant. For instance, the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention. For instance, Xu et al., 1993, supra, disclose the use of the first intron of the rice actin 1 gene to enhance expression.
The selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.
The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser ef a/., 1990, Science 244: 1293; Pdtrykus, 1990, Bio/Technology 8: 535; Shimamoto ef a/., 1989, Nature 338: 274).
Presently, Agrobacterium fume/ac/ens-mediated gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38) and can also be used for transforming monocots, although other transformation methods are often used for these plants. Presently, the method of choice for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or

developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 155-162; Vasil et a/., 1992, Bio/Technology 10: 667-674). An alternative method for transformation of monocots is based on protoplast transformation as described by Omirulleh etaL, 1993, Plant Molecular Biology 21: 415-428.
Following transformation, the transformants having incorporated the expression construct are selected and regenerated into whole plants according to methods well-known in the art. Often the transformation procedure is designed for the selective elimination bf selection genes either during regeneration or in the following generations by using, for example, co-transformation with two separate T-DNA constructs or site specific excision of the selection gene by a specific recombinase.
The present invention also relates to methods for producing a polypeptide of the present invention comprising (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding a polypeptide having glucoamylase activity of the present invention under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
Compositions
The present invention also relates to compositions comprising a polypeptide of the present invention. Preferably, the compositions are enriched in such a polypeptFde. The term "enriched" indicates that the glucoamylase activity of the composition has been increased, e.g., by an enrichment factor of 1.1.
The composition may comprise a polypeptide of the present invention as the major enzymatic component, e.g., a mono-component composition. Alternatively, the composition may comprise multiple enzymatic activities, such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, haloperoxidase, invertase, laccase, lipase, mannosidase, oxidase, pectinolytic enzyme, peptidoglutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase. The additional enzyme(s) may be produced, for example, by a microorganism belonging to>the genus Aspergillus, preferably Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae\ Fusarium, preferably Fusahum bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusahum graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum,

Fusarium suiphureum, Fusarium toruloseum. Fusariurn trichothecioides, or Fusarium venenaium] Humicola, preferably Humicola insolens or Humicola lanuginosa] or Trichoderma, preferably Trichoderma harzianum, Trichoderma koningii., Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.
The polypeptide compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. For instance, the polypeptide composition may be in the form of a granulate or a microgranulate. The polypeptide to be included in the composition may be stabilized in accordance with methods known in the art.
Combination of glucoamvlase and acid alpha-amvlase
According to this aspect of the invention a glucoamylase of the invention may be combined with an acid alpha-amylase in a ratio of between 0.3 and 5.0 AFAU/AGU. More preferably the ratio between acid .alpha-amylase activity and glucoamylase activity is at least 0.35, at least 0.40, at least 0.50, at least 0.60, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 13, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.85, or even at least 1.9 AFAU/AGU. However, the ratio between acid alpha-amylase activity and glucoamylase activity should preferably be less than 4.5, less than 4.0, less than 3.5, less than 3.0, less than 2.5, or even less than 2.25 AFAU/AGU. In AUU/AGI the activities of acid alpha-amylase and glucoamylase are preferably present in a ratio of between 0.4 and 6.5 AUU/AGI. More preferably the ratio between acid alpha-amylase activity and glucoamylase activity is at least 0.45, at least 0.50, at least 0.60, at least 0.7, at least 0.8, at least 0.9, at least 1.0, at least 1.1, at least 1.2, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, at least 1.8, at least 1.9, at least 2.0, at least 2.1, at least 2.2, at least 2.3, at least 2.4, or even at least 2.5 AUU/AGI. However, the ratio between acid alpha-amylase activity and glucoamylase activity is preferably less than 6.0, less than 5.5, less than 4.5, less than 4.0, less than 3.5, or even less than 3.0 AUU/AGI.
Above composition is suitable for use in a starch conversion process mentioned below for producing syrup and fermentation products such as ethanol.
Examples are given below of preferred uses of the polypeptide compositions of the invention. The dosage of the polypeptide composition of the invention and other conditions under which the composition is used may be determined on the basis of methods known in the art.

Combination of Trametes chouiata qiucoamviase with another qiuooamvlase and an acid aipha-amvlase
The Trametes cingulata glucoamylase of the invention have been found to have a 4-7 folds higher alpha-1 ,6-debranching activity than other giucoamylases, such as Athelia rolfsii, Aspergillus niger and Talaromyces emersonii (see Example 12).
Therefore, according to the invention the Trametes cingulata glucoamylase may be combined with acid alpha-amylase and further another glucoamylase. Such combination of enzymes would be suitable in processes comprises starch conversion, include ethanol production, including one step fermentation processes.
The alpha-amylase may be any alpha-amylase. In a preferred embodiment the alpha-amylase is any of those listed in the uAlpha-Amylase"-section below. In a preferred embodiment the alpha-amylase is a fungal alpha-amylase, especially those disclosed below in the "Fungal Alpha-Amylases'-section, especially the Aspergillus kawachii alpha-amylase. Preferred are also hybrid alpha-amylases disclosed below in the "Fungal hybrid alpha-amylase"~section below, including hybrids disclosed in U.S. Patent Publication no. 2005/0054071 (hybrids listed in Table 3 is especially contemplated), and further the hybrids disclosed in co-pending US application no. 60/638,614, including especially the Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28 herein and SEQ ID NO: 100 in US 60/638,614); Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29 herein and SEQ ID NO: 101 in U.S. application no. 60/638,614); and Meripilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO: 30 herein and SEQ ID NO: 102 in U.S. application no. 60/638,614).
The glucoamylase may be any glucoamylase, including giucoamylases of fungal or bacterial origin selected from the group consisting of Aspergillus giucoamylases, in particulars, nigerG1 or G2 glucoamylase (Boel et a-l. (1984), EMBO J. 3 (5), p. 1097-1102), or variants thereof, such as disclosed in WO 92/00381, WO 00/04136 add WO 01/04273 (from Novozymes, Denmark); the A. awamori glucoamylase (WO 84/02921), A. oryzae (Agric. Biol. Chem. (1991), 55 (4), p. 941-949), or variants or fragments thereof. Other Aspergillus glucoamylase variants include variants to enhance the thermal stability: G137A and G139A (Chen et al. (1996), Prot. Eng. 9, 499-505); D257E and D293E/Q (Chen et al. (1995), Prot. Engng. 8, 575-582); N182 (Chen et al. (1994), Biochem. J. 301, 275-281); disulphide bonds, A246C (Fierobe et al. (1996), Biochemistry, 35, 8698-8704; and introduction of Pro residues in position A435 and S436 (Li et al. (1997), Protein Engng. 10, 1199-1204. Other giucoamylases include Corticium rolfsii glucoamylase (US patent no. 4,727,046) also referred to as Athelia rolfsii, Talaromyces giucoamylases, in particular, derived from Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (US patent

no. Re. 32,153). Talaromyces duponti, Talaromyces thermophiius (US patent no. 4,557.215), Rhizopus nivius (e.g. the enzyme available from Shin Nihon Chemicals, Japan, under the tradename "CU CONC"), Humicola grisea var. thermoidea (e.g. ATCC 16453, NRRL 15222, NRRL 15223, NRRL 15224, NRRL 15225).
Bacterial glucoamylases contemplated include glucoamylases from the genus Clostridium, in particular C. thermoamylolyticum (EP 135,138), and C. thermohydrosulfuricum (WO 86/01831).
Examples of commercially available compositions comprising other glucoamylase include AMG 200L; AMG 300 L; SAN™ SUPER, SAN™ EXTRA L, SPIRIZYME™ PLUS, SPIRIZYME™ FUEL, SPIRIZYME™ B4U and AMG™ E (from Novozymes A/S); OPTIDEX™ 300 (from Genencor Int.); AMIGASE™ and AMIGASE™ PLUS (from DSM); G-ZYME™ G900, G-ZYME™ and G990 ZR (from Genencor Int.).
In a specific embodiment the Trametes cingulata glucoamylase of the invention is combined with glucoamylase derived from one of Aspergillus niger, Athea ro/fe/7, or Talaromyces emersonii and the Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29 herein and SEQ ID NO: 101 in U.S. application no. 60/638,614).
Uses
The present invention is also directed to process/methods for using the polypeptides having glucoamylase activity of the invention.
Uses according to the invention include starch conversion of starch to e.g., syrup and fermentation products, including ethanol and beverages. Examples of processes where a glucoamylase of the invention may be used include the ones described in: WO 2004/081193, WO 2004/080923, WO 2003/66816, WO 2003/66826, and WO 92/20777 which are hereby all incorporated by reference.
Production of fermentation products
Processes for producing fermentation products from gelatinized starch-containing material
In this aspect the present invention relates to a process for producing a fermentation product, especially ethanol, from starch-containing material, which process includes a liquefaction step and separately or simultaneously performed saccharification and fermentation step(s).
The invention relates to a process for producing a fermentation product from starch-containing material comprising the steps of:
(a) liquefying starch-containing material in the presence of an alpha-amylase;

(b) saccharifying the liquefied material obtained in step (a) using a glucoamyiase of the invention;
(c) fermenting the saccharified material using a fermenting organism.
The fermentation product, such as especially ethanol, may optionally be recovered after fermentation, e.g., by distillation. Suitable starch-containing starting materials are listed in the section "Starch-containing materials"-section below. Contemplated enzymes are listed in the "Enzymesn-section below. The fermentation is preferably carried out in the presence of yeast, preferably a strain of Sacchammyces. Suitable fermenting organisms are listed in the "Fermenting Organismsn-section below. In a preferred embodiment step (b) and (c) are carried out simultaneously (SSF process).
In a particular embodiment, the process of the invention further comprises, prior to the step (a), the steps of:
x) reducing the particle size of the starch-containing material, preferably by milling;
y) forming a slurry comprising the starch-containing material and water.
The aqueous slurry may contain from 10-40 wt-%, preferably 25-35 wt-% starch-containing material. The slurry is heated to above the gelatinization temperature and alpha-amylase, preferably bacterial and/or acid fungal alpha-amyiase, may be added to initiate liquefaction (thinning). The slurry may in an embodiment be jet-cooked to further gelatinize the slurry before being subjected to an alpha-amylase in step (a) of the invention.
More specifically liquefaction may be carried out as a three-step hot slurry process. The slurry is heated to between 60-95°C, preferably 80-85°C, and alpha-amylase is added to initiate liquefaction (thinning). Then the slurry may be jet-cooked at a temperature between 95-140°C, preferably 105-125°C, for 1-15 minutes, preferably for 3-10 minute, especially around 5 minutes. The slurry is cooled to 60-95°C and more alpha-amylase is added to finalize hydrolysis (secondary liquefaction). The liquefaction process is usually carried out at pH 4.5-6,5, in particular at a pH between 5 and 6. Milled and liquefied whole grains are known as mash.
The saccharification in step (b) may be carried out using conditions well know in the art. For instance, a full saccharification process may lasts up to from about 24 to about 72 hours, however, it is common only to do a pre-saccharification of typically 40-90 minutes at a temperature between 30-65°C, typically about 60°C, followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF). Saccharification is typically carried out at temperatures from 30-65°C, typically around 60°C, and at a pH between 4 and 5, normally at about pH 4.5.

The most widely used process in ethanol production is the simultaneous saccharification and fermentation (SSF) process, in which there is no holding stage for the saccharification, meaning that fermenting organism, such as yeast and enzyme(s) may be added together. When doing SSF it is common to introduce a pre-saccharification step at a temperature above 50°C, just prior to the fermentation.
In accordance with the present invention the fermentation step (c) includes, without limitation, fermentation processes used to produce alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and COz); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, beta-carotene); and hormones. Preferred fermentation processes include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art.
Processes for producing fermentation products from un-qelatinized starch-containing
In this aspect the invention relates to processes for producing a fermentation product from starch-containing material without gelatinization of the starch-containing material. In one embodiment only a glucoamylase of the invention is used during saccharification and fermentation. According to the invention the desired fermentation product, such as ethanol, can be produced without liquefying the aqueous slurry containing the starch-containing material. In one embodiment a process of the invention includes saccharifying milled starch-containing material below the gelatinization temperature in the presence of a glucoamylase of the invention to produce sugars that can be fermented into the desired fermentation product by a suitable fermenting organism.
Examples 7 and 8 below disclose production of ethanol from un-gelatinized (uncooked) milled corn using glucoamylases of the invention derived from Trametes cingulata and Pachykytospora papyracea. Both glucoamylases show significantly higher ethanol yields compared to corresponding processes carried out using glucoamylases derived from Aspergillus niger or Talaromyces emersonii, respectively.
Accordingly, in this aspect the invention relates to a process for producing a fermentation product from starch-containing material comprising:
(a) saccharifying starch-containing material with a glucoamylase having
i) the sequence shown as amino acids 1 to 556 in SEQ ID NO: 2 or amino
acids 1 to 561 in SEQ ID NO: 37, or a glucoamylase having at least 75% identity thereto, and/or

ii) the sequence shown as amino acids 1 to 575 in S5Q iD NO: 5 or amino
acids 1 to 565 in SEQ ID NO: 40. or a glucoamyiase having at ieast 70% identity thereto, and/or
iit) the sequence shown as amino acids 1 to 548 in SEQ ID NO: 24 or amino acids 1 to 556 in SEQ ID NO: 26 or amino acids 1 to 523 in SEQ ID NO: 43, or a glucoamyiase having at least 60% identity thereto,
at a temperature below the initial gelatinization temperature of said starch-containing material,
(b) fermenting using a fermenting organism.
Steps (a) and (b) of the process of the invention may be carried out sequentially or simultaneously.
The term "initial gelatinization temperature" means the lowest temperature at which gelatinization of the starch commences. Starch heated in water begins to gelatinize between 50'C and 75'C; the exact temperature of gelatinization depends on the specific starch, and can readily be determined by the skilled artisan. Thus, the initial gelatinization temperature may vary according to the plant species, to the particular variety of the plant species as well as with the growth conditions. In the context of this invention the initial gelatinization temperature of a given starch-containing material is the temperature at which birefringence is lost in 5% of the starch granules using the method described by Gorinstein. S. and Lii. C, Starch/Starke, Vol. 44 (12) pp. 461-466 (1992).
Before step (a) a slurry of starch-containing material, such as granular starch, having 20-55 wt.-% dry solids, preferably 25-40 wt,-% dry solids, more preferably 30-35% dry solids of starch-containing material may be prepared. The slurry may include water and/or process waters, such as stillage (backset), scrubber water, evaporator condensate or distillate, side stripper water from distillation, or other fermentation product plant process water. Because the process of the invention is carried out below the gelatinization temperature and thus no significant viscosity increase takes place, high levels of stillage may be used if desired. In an embodiment the aqueous slurry contains, from about 1 to about 70 vol.-% stillage, preferably 15-60% voi.-% stillage, especially from about 30 to 50 vol.-% stillage.
The starch-containing material may be prepared by reducing the particle size, preferably by milling, to 0.05 to 3.0 mm, preferably 0.1-0.5 mm. After being subjected to a process of the invention at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or preferably at least 99% of the dry solids of the starch-containing material is converted into a soluble starch hydrolysate.

The process of the invention is conducted at a temoerature below the initial gelatrnization temperature. Preferably the temperature at which step (a) is carried out is between 30-75°C, preferably between 45-60°C.
In a preferred embodiment step (a) and step (b) are carried out as a simultaneous saccharification and fermentation process. In such preferred embodiment the process is typically carried at a temperature between 28°C and 36°C, such as between 29°C and 35°C, such as between 30°C.and 34°CT such as around 32°C. According to the invention the temperature may be adjusted up or down during fermentation.
In an embodiment simultaneous saccharification and fermentation is carried out so that the sugar level, such as glucose level, is kept at a low level such as below 6 wt.-%, preferably below about 3 wt.-%, preferably below about 2 wt.-%, more preferred below about 1 wt-%., even more preferred below about 0.5%, or even more preferred 0.25% wt.-%, such as below about 0.1 wt.-%. Such low levels of sugar can be accomplished by simply employing adjusted quantities of enzyme and fermenting organism. A skilled person in the art can easily determine which quantities of enzyme and fermenting organism to use. The employed quantities of enzyme and fermenting organism may also be selected to maintain low concentrations of maltose in the fermentation broth. For instance, the maltose level may be kept below about 0.5 wt.-% or below about 0.2 wt.-%.
The process of the invention may be carried out at a pH in the range between 3 and 7, preferably from pH 3.5 to 6, or more preferably from pH 4 to 5.
Starch-containing materials
Any suitable starch-containing starting material, including granular starch, may be used according to the present invention. The starting material is generally selected based on the desired fermentation product. Examples of starch-containing starting materials, suitable for use in a process of present invention, include tubers, roots, stems, whole grains, corns, cobs, wheat, barley, rye, milo, sago, cassava, tapioca, sorghum, rice peas, beans, or sweet potatoes, or mixtures thereof, or cereals, sugar-containing raw materials, such as molasses, fruit materials, sugar cane or sugar beet, potatoes, and cellulose-containing materials, such as wood or plant residues, or mixtures thereof. Contemplated are both waxy and non-waxy types of corn and barley.
The term "granular starch" means raw uncooked starch, i.e., starch in its natural form found in cereal, tubers or grains. Starch is formed within plant cells as tiny granules insoluble in water. When put in cold water, the starch granules may absorb a small amount of the liquid and swell. At temperatures up to 50°C to 75°C the swelling may be reversible. However, with higher temperatures an irreversible swelling called "gelatinization" begins.

Granular starch to be processed may be a highly refined starch quality, preferably at least 90%s at least 95%, at least 97% or at least 9S.5% pure or it may be a more crude starch containing material comprising milled whole grain including non-starch fractions such as germ residues and fibers. The raw material, such as whole grain, is milled in order to open up the structure and allowing for further processing. Two milling processes are preferred according to the invention: wet and dry milling. In dry milling whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein) and is often applied at locations where the starch hydrolysate is used in production of syrups. Both dry and wet milling is well known in the art of starch processing and is equally contemplated for the process of the invention.
The starch-containing material is reduced in size, preferably by milling, in order to expose more surface area. In an embodiment the particle size is between 0.05 to 3.0 mm, preferably 0.1-0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the milled starch-containing material fit through a sieve with a 0.05 to 3.0 mm screen, preferably 0.1-0.5 mm screen.
Fermentation Products
The term "fermentation product" means a product produced by a process inducting a fermentation step using a fermenting organism. Fermentation products contemplated according to the invention include alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and C02); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12l beta-carotene); and hormones. In a preferred embodiment the fermentation product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol or products used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry. Preferred beer types comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-alcohoi beer, low-alcohol beer, low-calorie beer or light beer. Preferred fermentation processes used include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art.
Fermenting Organisms
"Fermenting organism" refers to any organism, including bacterial and fungal organisms, suitable for use in a fermentation process and capable of producing desired a fermentation product. Especially suitable fermenting organisms are able to ferment, i.e.,

convert, sugars, such as glucose or ma!tose: directly or indirectly into the desired fermentation product. Examples of fermenting organisms include fungal organisms, such as yeast. Preferred yeast includes strains of Saccharomyces spp., in particular, Saccharomyces cerevisiae. Commercially available yeast include, e.g., Red Star™/Lesaffre Ethanol Red (available from Red Star/Lesaffre, USA) FALI (available from Fleischmann's Yeast, a division of Burns Philp Food Inc., USA), SUPERSTART (available from Alltech), GERT STRAND (available from Gert Strand 'AB, Sweden) and FERMIOL (available from DSM Specialties).
ENZYMES
Glucoamvlase
The glucoamylase is preferably a glucoamylase of the invention. However, as mentioned above a glucoamylase of the invention may also be combined with other glucoamylases.
The glucoamylase may added in an amount of 0.001 to 10 AGU/g DS, preferably from 0.01 to 5 AGU/g DS, such as around 0.1, 0.3, 0.5, 1 or 2 AGU/g DS, especially 0.1 to 0.5 AGU/g DS or 0.02-20 AGU/g DS, preferably 0.1-10 AGU/g DS.
Alpha-Amvlase
The alpha-amylase may according to the invention be of any origin. Preferred are alpha-amylases of fungal or bacterial origin.
In a preferred embodiment the alpha-amylase is an acid alpha-amylase, e.g., fungal acid alpha-amylase or bacterial acid alpha-amylase. The term "acid alpha-amylase" means an alpha-amylase (E.C. 3.2.1.1) which added in an effective amount has activity optimum at a pH in the range of 3 to 7, preferably from 3.5 to 6, or more preferably from 4-5.
Bacterial Alpha-Amvlases
According to the invention a bacterial alpha-amylase may preferably be derived from the genus Bacillus.
In a preferred embodiment the Bacillus alpha-amylase is derived from a strain of 6. licheniformis, 6. amyloliquefaciens, B. subtilis or B. stearothermophilus, but may also be derived from other Bacillus sp. Specific examples of contemplated alpha-amylases include the Bacillus licheniformis alpha-amylase (BLA) shown in SEQ ID NO: 4 in WO 99/19467, the Bacillus amyloliquefaciens alpha-amylase (BAN) shown in SEQ ID NO: 5 in WO 99/19467, and the Bacillus stearothermophilus alpha-amylase (BSG) shown in SEQ ID NO: 3 in WO 99/19467. In an embodiment of the invention the alpha-amylase is an enzyme having a

degree of identity of at least 50%: preferably at least 70%, more preferred at least 80%, even more preferred at least 90%, such as at least 95%, at least 96%, at least 97%, at least 93% or at least 99% identity to any of the sequences shown as SEQ ID NOS: 1, 2, 3, 4, or 5, respectively, in WO 99/19467.
The Bacillus alpha-amylase may also be a variant and/or hybrid, especially one described in any of WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059, arid WO 02/10355 (all documents hereby incorporated by reference). Specifically contemplated alpha-amylase variants are disclosed in US patent nos. 6,093,562, 6,297,038 or US patent no. 6,187,576 (hereby incorporated by reference) and include Bacillus stearothermophilus alpha-amylase (BSG alpha-amylase) variants having a deletion of one or two amino acid in position 179 to 182, preferably a double deletion disclosed in WO 1996/023873 - see e.g., page 20, lines 1-10 (hereby incorporated by reference), preferably corresponding to delta(181-182) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO: 3 disclosed in WO 99/19467 or deletion of amino acids 179 and 180 using SEQ ID NO: 3 in WO 99/19467 for numbering (which reference is hereby incorporated by reference). Even more preferred are Bacillus alpha-amylases, especially Bacillus stearothermophilus alpha-amylase, which have a double deletion corresponding to delta(181-182) and further comprise a N193F substitution (also denoted 1181* + G182* + N193F) compared to the wild-type BSG alpha-amylase amino acid sequence set forth in SEQ ID NO: 3 disclosed in WO 99/19467.
The alpha-amylase may also be a maltogenic alpha-amylase. A "maltogenic alpha-amylase" (glucan 1,4-alpha-maltohydrolase, E.G. 3.2.1.133) is able to hydrolyze amylose and amylopectin to maltose in the alpha-configuration. A maltogenic alpha-amylase from Bacillus stearothermophilus strain NCIB 11837 is commercially available from Novozymes A/S, Denmark. The maltogenic alpha-amylase is described in US patent nos. 4,598,048, 4,604,355 and 6,162,628, which are hereby incorporated by reference.
Bacterial Hybrid Alpha-Amylases
A hybrid alpha-amylase specifically contemplated comprises 445 C-terminal amino acid residues of the Bacillus licheniformis alpha-amylase (shown as SEQ ID NO: 4 in WO 99/19467) and the 37 N-terminal amino acid residues of the alpha-amylase derived from Bacillus amyloliquefaciens (shown as SEQ ID NO: 3 in WO 99/194676), with one or more, especially all, of the following substitution:
G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using the
Bacillus licheniformis numbering). Also preferred are variants having one or more of the following mutations (or corresponding mutations in other Bacillus alpha-amylase

backbones): H154Y, A181T, N190F, A209V and Q264S anci/or deletion of two residues between positions 176 and 179, preferably deletion of E178 and G179 (using the SEQ ID NO: 5 numbering of WO 99/19467).
The bacterial alpha-amyiase may be added in amounts as are well-known in the art. When measured in KNU units (described below in the "Materials & Methods"-section) the alpha-amyiase activity is preferably present in an amount of 0.5-5,000 NU/g of DS, in an amount of 1-500 NU/g of DS, or more preferably in an amount of 5-1,000 NU/g of DS, such as 10-100 NU/g DS.
Fungal Alpha-Amvlases
Fungal acid alpha-amylases include acid alpha-amylases derived from a strain of the genus Aspergillus, such as Aspergillus oryzae, Aspergillus niger, Aspergillus kawachii alpha-amylases.
A preferred acid fungal alpha-amyiase is a Fungamyl-like alpha-amyiase which is preferably derived from a strain of Aspergillus oryzae. In the present disclosure, the term "Fungamyl-like alpha-amyiase" indicates an alpha-amyiase which exhibits a high identity, i.e. more than 70%, more than 75%, more than 80%, more than 85% more than 90%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99% or even 100% identity to the mature part of the amino acid sequence shown in SEQ ID NO: 10 in WO 96/23874.
Another preferred acid alpha-amyiase is derived from a strain Aspergillus niger. In a preferred embodiment the acid fungal alpha-amylase is the one from A. niger disclosed as ttAMYA_ASPNG" in the Swiss-prot/TeEMBL database under the primary accession no. P56271 and described in more detail in WO 89/01969 (Example 3). The acid Aspergillus niger acid alpha-amylase is also shown as SEQ ID NO: 1 in WO 2004/080923 (Novozymes) which is hereby incorporated by reference. Also variants of said acid fungal amylase having at least 70% identity, such as at least 80% or even at least 90% identity, such as at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO; 1 in WO 2004/080923 are contemplated. A suitable commercially available acid fungal alpha-amylase derived from Aspergillus niger is SP288 (available from Novozymes A/S, Denmark).
In a preferred embodiment the alpha-amylase is derived from Aspergillus kawachii and disclosed by Kaneko et al. J. Ferment. Bioeng. 81:292-298(1996) "Molecular-cloning and determination of the nudeotide-sequence of a gene encoding an acid-stable alpha-amylase from Aspergillus kawachii"; and further as EMBL:#AB008370.

The fungal acid aipha-amylase may 3lso be a wild-type enzyme comprising a carbohydrate-binding module (CBM) and an alpha-amylase catalytic domain (i.e., a none-hybrid), or a variant thereof. In an embodiment the wild-type acid alpha-amylase is derived from a strain of Aspergillus kawachii.
Fungal Hybrid Alpha-Amylases
In a preferred embodiment the fungal acid alpha-amylase is a hybrid alpha-amylase. Preferred examples of fungal hybrid alpha-amylases include the ones disclosed in WO 2005/003311 or U.S. Patent Publication no. 2005/0054071 (Novozymes) or US patent application no. 60/638,614 (Novozymes) which is hereby incorporated by reference. A hybrid alpha-amylase may comprise an alpha-amylase catalytic domain (CD) and a carbohydrate-binding domain/module (CBM) and optional a linker.
Specific examples of contemplated hybrid alpha-amylases include those disclosed in U.S. patent application no. 60/638,614 including Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28 herein and SEQ ID NO: 100 in U.S. application no. 60/638,614), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29 herein and SEQ ID NO: 101 in U.S. application no. 60/638,614) and Mehpilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO: 30 herein and SEQ ID NO: 102 in U.S. application no. 60/638,614).
Other specific examples of contemplated hybrid alpha-amylases include those disclosed in U.S. Patent Publication no. 2005/0054071, including those disclosed in Table 3 on page 15, such as Aspergillus niger alpha-amylase with Aspergillus kawachii linker and starch binding domain.
Commercial Alpha-Amylase Products
Preferred commercial compositions comprising alpha-amylase include MYCOLASE from DSM (Gist Brocades), BAN™, TERMAMYL™ SC, FUNGAMYL™, LIQUOZYME™ X and SAN™ SUPER, SAN™ EXTRA L (Novozymes A/S) and CLARASE™ L-40,000, DEX-LO™, SPEZYME™ FRED, SPEZYME™ AA, and SPEZYME™ DELTA AA (Genencor Int.), and the acid fungal alpha-amylase sold under the trade name SP288 (available from Novozymes A/S, Denmark).
An acid alpha-amylases may according to the invention be added in an amount of 0.1 to 10 AFAU/g DS, preferably 0.10 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS.

Production of syrup
The present invention also provides a process of using a glucoamyiase of the invention for producing syrup, such as glucose and the like, from starch-containing material. Suitable starting materials are exemplified in the "Starch-containing materials"-section above. Generally, the process comprises the steps of partially hydrolyzing starch-containing material (liquefaction) in the presence of alpha-amylase and then further saccharifying the release of glucose from the non-reducing ends of the starch or related oligo- and polysaccharide molecules in the presence of glucoamyiase of the invention.
Liquefaction and saccharification may be carried our as described above for fermentation product production.
The glucoamyiase of the invention may also be used in immobilized form. This is suitable and often used for producing speciality syrups, such as maltose syrups, and further for the raffinate stream of oligosaccharides in connection with the production of fructose syrups, e.g., high fructose syrup (HFS).
Consequently, this aspect of the invention relates to a process of producing syrup from starch-containing material, comprising
(a) liquefying starch-containing material in the presence of an alpha-amylase,
(b) saccharifying the material obtained in step (a) using a glucoamyiase of the invention.
A syrup may be recovered from the saccharified material obtained in step (b). Details on suitable conditions can be found above.
Brewing
A glucoamyiase of the invention can also be used in a brewing process. The glucoamylases of the invention is added in effective amounts which can be easily determined by the skilled person in the art. For instance, in the production of "low carb" or super attenuated beers, a higher proportion of alcohol and a lower amount of residual dextrin are desired. These beers are formulated using exogenous enzymes compositions comprising enzyme activities capable of debranching the limit dextrins. A glucoamyiase of the invention, preferably Trametes cingulata, may be applied to reduce the content of limit dextrins as well as hydrolyzing the alpha-1,4 bonds.
The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be withirr the scope of this invention. Indeed, various modifications of the invention in

addition to those shown and de-scribed herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.
Various references are cited herein, the disclosures of which are incorporated by reference in their entireties. The present invention is further described by the following examples which should not be construed as limiting the scope of the invention.
Materials & Methods
Glucoamvlases:
* Glucoamylase derived from Trametes cingulata disclosed in SEQ ID NO: 2 and available from Novozymes A/S.
* Glucoamylase derived from Pachykytospora papyraceae disclosed in SEQ ID NO: 5 and available from Novozymes A/S.
* Glucoamylase derived from Leucopaxillus giganteus disclosed in SEQ ID NO: 24 and available from Novozymes A/S.
* Glucoamylase derived from Aspergillus niger disclosed in (Boel et al. (1984), EMBO J. 3 (5) p. 1097-1102) and available from Novozymes A/S.
* Glucoamylase derived from Talaromyces emersonii disclosed in W099/28448 and
available from Novozymes A/S.
Enzymes for DNA manipulations (e.g. restriction endonucleases, ligases etc.) are obtainable from New England Biolabs, Inc. and were used according to the manufacturer's instructions.
Alpha-Amvlase:
Hybrid Alpha-Amylase A: Rhizomucor pusillus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD disclosed in U.S. patent application no. 60/638,614 and SEQ ID NO: 29.
Yeast: Red Star™ available from Red Star/Lesaffre, USA
Microbial strains
- £ colt DH12alpha (GIBCO BRL, Life Technologies, USA)
- Aspergillus oryzae IFO 4177 is available from Institute for Fermentation, Osaka (IFO) Culture Collection of Microorganisms, 17-85, Juso-honmachi, 2-chome, Yodogawa-ku, Osaka 532-8686, Japan.

- Aspergillus oryzae BE'Ch-2 is described in WO 2000/39322 (Novozymes). It is a mutant of JaL228 (described in WO 98/12300) which is a mutant of IFO 4177.
- Aspergillus niger strain Mbin119 is described in WO 2004/090155 (see Example 11).
Other materials
Pullulan available from Wako Pure Chemical (Japan).
Deposit of Biological Material
The following biological material has been deposited under the terms of the Budapest Treaty at Deutshe Sammmlung von Microorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 Braunschweig DE, and given the following accession number:
Deposit Accession Number Date of Deposit
Escherichia coli NN049798 DSM17106 2 February 2005
Escherichia coli NN049797 DSM 17105 2 February 2005
The strain has been deposited under conditions that assure that access to the culture will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. §1.14 and 35 U.S.C. §122. The deposit represents a substantially pure culture of the deposited strain. The deposit is available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
Media and reagents:
Chemicals used as buffers and substrates were commercial products of at least reagent grade.
PDA2: 39 g/L Potato Dextrose Agar, 20 g/L agar, 50 ml/L glycerol
Cove: 342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10mM Acetamide, 30 g/L noble agar. Cove salt solution: per liter 26 g KCI, 26 g MgS04-7aq, 76 g KH2P04, 50ml Cove trace metals.
Cove trace metals: per liter 0.04 g NaB4O7-10aq, 0.4 g CuS04-5aq, 1.2 g FeS04-7aq, 0.7 g MnS04-aq, 0.7 g Na2Mo02-2aq, 0.7 g ZnS04-7aq.
YPG: 4 g/L Yeast extract, 1 g/L KH2P04, 0.5 g/L MgS04-7aq, 5 g/L Glucose, pH 6.0. STC: 0.8 M Sorbitol, 25 mM Tris pH 8, 25 mM CaCI2. STPC: 40 % PEG4000 in STC buffer.

Cove top agarose: 342.3 g/L Sucrose, 20 mi/L COVE salt solution, 10mM Acetamide, 10 g/L
low melt agarose.
MS-9: per liter 30 g soybean powder, 20 g glycerol, pH 6.0.
MDU-pH5: per liter 45 g maltose-1aq, 7 g yeast extract, 12 g KH2P04, 1 g MgS04-7aq, 2 g
K2SO4, 0.5 ml AMG trace metal solution and 25 g 2-morpholinoethanesutfonic acid, pH 5.0.
Methods
Unless otherwise stated, DNA manipulations and transformations were performed using standard methods of molecular biology as described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.) "Current protocols in Molecular Biology", John Wiley and Sons, 1995; Harwood, C. R.f and Cutting, S. M. (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990.
Glucoamylase activity
Glucoamylase activity may be measured in AGI units or in Glucoamylase Units (AGU).
Glucoamylase activity (AGO
Glucoamylase (equivalent to amyloglucosidase) converts starch into glucose. The amount of glucose is determined here by the glucose oxidase method for the activity determination. The method described in the section 76-11 Starch—Glucoamylase Method with Subsequent Measurement of Glucose with Glucose Oxidase in "Approved methods of the American Association of Cereal Chemists". Vol. 1-2 AACC, from American Association of Cereal Chemists, (2000); ISBN: 1-891127-12-8.
One glucoamylase unit (AGI) is the quantity of enzyme which will form 1 micro mole of glucose per minute under the standard conditions of the method.
Standard conditions/reaction conditions:
Substrate: Soluble starch, concentration approx. 16 g dry matter/L.
Buffer: Acetate, approx. 0.04 M, pH=4.3
pH: 4.3
Incubation temperature: 60°C
Reaction time: 15 minutes
Termination of the reaction: NaOH to a concentration of approximately 0.2 g/L (pH~9)
Enzyme concentration: 0.15-0.55 AAU/mL

The starch should be Lintner starch, which is a thin-boiling starch used in the laboratory as colorimetric indicator. Lintner starch is obtained by dilute hydrochloric acid treatment of native starch so that it retains the ability to color blue with iodine.
Glucoamvlase activity (AGIO
The Novo Glucoamylase Unit (AGU) is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions 37°C, pH 4.3, substrate: maltose 23.2 mM, buffer, acetate 0.1 M, reaction time 5 minutes.
An autoanalyzer system may be used. Mutarotase is added to the glucose dehydrogenase reagent so that any alpha-D-glucose present is turned into beta-D-glucose. Glucose dehydrogenase reacts specifically with beta-D-glucose in the reaction mentioned above, forming NADH which is determined using a photometer at 340 nm as a measure of the original glucose concentration.

A folder (EB-SM-0131.02/01) describing this analytical method in more detail is available on request from Novozymes A/S, Denmark, which folder is hereby included by reference.

Alpha-amylase actfvity (KNU)
The alpha-amylase activity may be determined using potato starch as substrate. This method is based on the break-down of modified potato starch by the enzyme, and the reaction is followed by mixing samples of the starch/enzyme solution with an iodine solution. Initially, a blackish-blue color is formed, but during the break-down of the starch the blue color gets weaker and gradually turns into a reddish-brown, which is compared to a colored glass standard.
One Kilo Novo alpha amylase Unit (KNU) is defined as the amount of enzyme which, under standard conditions (i.e., at 37°C +/- 0.05; 0.0003 M Ca2+; and pH 5.6) dextrinizes 5260 mg starch dry substance Merck Amylum solubile.
A folder EB-SM-0009.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
Acid alpha-amylase activity
When used according to the present invention the activity of any acid alpha-amylase may be measured in AFAU (Acid Fungal Alpha-amylase Units). Alternatively activity of acid alpha-amylase may be measured in AAU (Acid Alpha-amylase Units).
Acid Alpha-amylase Units (AAU)
The acid alpha-amylase activity can be measured in AAU (Acid Alpha-amylase Units), which is an absolute method. One Acid Amylase Unit (AAU) is the quantity of enzyme converting 1 g of starch (100% of dry matter) per hour under standardized conditions into a product having a transmission at 620 nm after reaction with an iodine solution of known strength equal to the one of a color reference. Standard conditions/reaction conditions:
Substrate: Soluble starch. Concentration approx. 20 g DS/L.
Buffer: Citrate, approx. 0.13 M, pH=4.2
Iodine solution: 40.176 g potassium iodide + 0.088 g iodine/L
City water 15°-20°dH (German degree hardness)
pH: 4.2
Incubation temperature: 30°C
Reaction time: 11 minutes
Wavelength: 620 nm

Enzyme concentration: 0.13-D. 19 AAU/mL
Enzyme working range: 0.13-0.19 AAU/mL
The starch should be Lintner starch, which' is a thin-boiling starch used in the laboratory as colorimetric indicator. Lintner starch is obtained by dilute hydrochloric acid treatment of native starch so*that it retains the ability to color blue with iodine. Further details can be found in EP 0140410 B2. which disclosure is hereby included by reference.
Acid alpha-amylase activity (AFAU)
Acid alpha-amylase activity may be measured in AFAU (Acid Fungal Alpha-amylase Units), which are determined relative to an enzyme standard. 1 AFAU is defined as the amount of enzyme which degrades 5.260 mg starch dry matter per hour under the below mentioned standard conditions.
Acid alpha-amylase, an endo-alpha-amyiase (1,4-alpha-D-glucan-glucanohydrolase, E.C. 3.2.1.1) hydrolyzes alpha-1,4-glucosidic bonds in the inner regions of the starch molecule to form dextrins and oligosaccharides with different chain lengths. The intensity of color formed with iodine is directly proportional to the concentration of starch. Amylase activity is determined using reverse colorimetry as a reduction in the concentration of starch under the specified analytical conditions.
ALPHA - AMYLASE
STARCH + IODINE 40. pH25 > DEXTRINS + OLIGOSACCHARIDES
A = 590nm
blue/violet t = 23 sec. decoloration
Standard conditions/reaction conditions:
Substrate: Soluble starch, approx. 0.17 g/L
Buffer: Citrate, approx. 0.03 M
Iodine (12): 0.03 g/L
CaCI2: 1.85 mM
pH: 2.50 ±0.05
Incubation temperature: 40°C
Reaction time: 23 seconds
Wavelength: 590nm
Enzyme, concentration: 0.025 AFAU/mL
Enzyme working range: 0.01-0.04 AFAU/mL

A folder E3-SM-0259.02/01 describing this analytical method in more detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
EXAMPLES Example 1
Molecular screening of alucoamvtase genes
Trametes cinguiata was grown on PDA2 medium and genome DNA was isolated from 0.2 g mycelium using FastDNA SPIN Kit for Soil (Qbiogene, USA) according to the manufacturer's instructions.
PCR reaction was done on genome DNA with the degenerated primers ArAF1 and ArAR3
ArAF1 5'-CRTRCTYDVCAACATYGG-3' (SEQ ID NO: 7)
ArAR3 5' GTCAGARCADGGYTGRRASGTG-3, (SEQ ID NO: 8)
wherein D = A or G or T; R = A or G; S = C or G; V = A or C or G; Y = C or T
The amplification reaction (13 microL) was composed of 1 microL genome DNA solution, 1 micro M primer ArAF1, 1 micro M primer ArAR3, 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94°C for 2 minutes; 20 cycles each at 94°C for 30 seconds, 65°C for 45 seconds, with an annealing temperature decline of 1°C per cycle, and 72°C for 1 minute 30 seconds; followed by 20 cycles each at 94°C for 30 seconds, 45°C for 45 seconds and 72°C for 1 minute 30 seconds; 1 cycle at 72°C for 7 minutes; and a hold at 4°C. The PCR product was purified using ExoSAP-IT (USB, USA) according to the manufacturer's instructions and sequenced. The sequence was subsequently compared to the Aspergillus niger giucoamylase gene, showing that the PCR product encoded a part of a giucoamylase.
Example 2
Molecular screening of giucoamylase genes
Pachykytospora papyracea was grown on PDA2 medium and genome DNA was isolated from 0.2 g mycelium using FastDNA SPIN Kit for Soil (Qbiogene, USA) according to the manufacturer's instructions.
PCR reaction (PCR 1) was done on genome DNA with the degenerated primers AM2F and AM4R2:
AM2F 5'-TGGGGIMGNCCNCARMGNGAYGG-3' (SEQ ID NO: 9)
AM4R2 5' RTCYTCNGGRTANCKNCC-3' (SEQ ID NO: 10)

wherein i = hosine; K = G or T; M = A or C; K = A or C or G or T; R = A or G; Y = C or T
The amplification reaction (25 microL) was composed of 1 microL genome DNA solution, 2 micro M primer AM2F, 2 micro M primer AM4R2, 22 microL Reddy PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94°C for 2 minutes; 20 cycles each at 94°C for 1 minute, 55°C for 1 minute, with an annealing temperature decline of 1°C per cycle, and 72°C for 1 minute; followed by 20 cycles each at 94°C for 1 minute, 40°C for 1 minute and 72°C for 1 minute; 1 cycle at 72°C for 7 minutes; and a hold at 4°C.
Subsequently a PCR reaction was done on an aliquot of the first PCR reaction (PCR
1) with the degenerated primers AM3F and AM4R2:
AM3F 5'-TAYGAYYTNYGGGARGA-3' (SEQ ID NO: 11)
AM4R2 5'-RTCYTCNGGRTANCKNCC-3' (SEQ ID NO: 10)
wherein K = G or T; N = A or C or G or T; R = A or G; Y = C or T
The amplification reaction (13 microLI) was composed of 1 microL of the first PCR reaction (PCR 1), 1 microM primer AM3F, 1 micro M primer AM4R2, 11 microL Reddy PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94°C for 2 minutes; 5 cycles each at 94°C for 45 seconds, 45°C for 45 seconds and 72°C for 1 minute; followed by 30 cycles each at 94°C for 45 seconds, 40°C for 45 seconds and 72°C for 1 minute; 1 cycle at 72°C for 7 minutes; and a hold at 4°C. A 0.5 kb amplified PCR band was obtained. The reaction product was isolated on a 1.0% agarose gel using TBE buffer and "rt was excised from the gel and purified using GFX PCR DNA and Gel band Purification Kit (Amersham Biosciences, UK). The excised band was sequenced and subsequently compared to the Aspergillus niger glucoamylase gene, showing that the PCR product encoded a part of a glucoamylase.
Example 3
Cloning of glucoamylase gene from Trametes cinaulata
From the partial sequence of the Trametes cingulata glucoamylase more gene sequence was obtained with PCR based gene walking using the Vectorette Kit from SIGMA-Genosys. The gene walking was basically done as described in the manufacturer's protocol. 0.15 micro g genomic DNA of Trametes cingulata was digested with EcoRI, BamHI and Hindlll, independently. The digested DNA was ligated with the corresponding Vectorette units supplied by the manufacturer using a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 16°C for 60 minutes; 4 cycles each at 37°C for 20 minutes, 16°C for 60 minutes, 37°C for 10 minutes; followed by 1 cycle at 16°C for 60

minutes and a hold at 4°C. The ligation reactions were subsequent diluted 5 times with sterile water.
PCR reactions with iinker-ligated genome DNA of the Trametes cinguiata as template was performed with a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94°C for 2 minutes; 40 cycles each at 94°C for 15 seconds, 72°C for 1 minute, 72°C for 1 minute, 1 cycle at 72°C for 7 minutes; and a hold at 4°C using the supplied Vectorette primer and primer TraF1 as shown below. TraF1: 5'- TAGTCGTACTGGAACCCCACC -3' (SEQ ID NO: 12)
The amplification reactions (12.5 microL) were composed of 0.5 microL of Iinker-ligated genome DNAs, 400 nM Vectorette primer, 400 nM TraF1 primer, 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK).
A 0.5 kb amplified band was obtained by the PCR reaction from Hindlll digested genome DNA. The reaction product was isolated on a 1.0% agarose gel using TBE buffer and was excised from the gel. 100 microL sterile water was added to the excised agarose gel fragment and it was melted by incubation at 95°C for 5 minutes to release the DNA. The DNA band was reamplified by repeating the PCR reaction described above using 0.5 microL of the isolated DNA fragment instead of Iinker-ligated genome DNA.
After the PCR reaction the DNA was purified using ExoSAP-IT (USB, USA) according to the manufacturer's instructions and sequenced and subsequently compared to the Aspergillus niger glucoamylase gene, showing that it encoded a further 250 bp part of the glucoamylase gene.
In order to clone the missing parts of the glucoamylase gene from Trametes cinguiata, PCR based gene walking was carried out using LA PCR™ in vitro Cloning Kit (TAKARA, Japan) according to the manufacturer's instructions.
Five micro g of genome DNA of Trametes cinguiata was digested with BamHI, EcoRi, Hindlll, Pstl, Sail and Xbal, independently. 200 ml of ice-cold ethanol was added to the reaction mixture (50 microL) and then digested DNA was recovered by centrifugation at 15,000 x g for 30 minutes at 4°C. The recovered DNA was ligated with a corresponding artificial linkers supplied by manufactures. The linker ligated DNA was recovered by adding 200 ml of ice-cold ethanol to the reaction mixture (50 microL) followed by centrifugation at 15,000 x g for 30 minutes at 4°C.
PCR reactions with Iinker-ligated genome DNA of the Trametes cinguiata as template was performed with a LA PCR system (TAKARA, Japan) using primer C1 and TC5' for cloning of missing 5'-glucoamylase gene and primer C1 and TC3' for cloning of missing 3'-glucoamylase gene, as shown below. C1: 5'-gtacatattgtcgttagaacgcgtaatacgactca-3' (SEQ ID NO: 13)

TC5!: 5'-cgtataigtcagcgct3ccatgt-3: (SEQ ID NO: 14) TC31: S'-aaacgtgagcgaccattttctgt-S1 (SEQ ID NO: 15)
The amplification reactions (50 microL) were composed of 1 ng of template DNA per microL, 250 mM dNTP each, 250 nM primer, 250 nM primer, 0.1 U of LA Taq polymerase per microL in 1X buffer (TAKARA, Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 0.5 minute, 55°C for 2 minutes, and 72°C for 2 minutes; 1 cycle at 72°C for 10 minutes; and a hold at 4°C. .
0.4 kb and 1.0 kb amplified bands were obtained from Sail digested genome DNA with primer C1 and TC5' and Xbal digested genome DNA with primer C1 and TC3\ respectively. These reaction products were isolated on a 1.0% agarose gel using TAE buffer and was excised from the gel and purified using a QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
The amplified DNA fragments were ligated into pTTBlue (Invitrogen, Netherlands), independently. The ligation mixture was then transformed into E. coli DH12alpha (GIBCO BRL, Life Technologies, USA) to create pHUda438 and pHUda439 for a 0.4 kb amplified band and a 1.0 kb amplified band, respectively. The resultant piasrnids were sequenced and compared to the Aspergillus niger glucoamylase gene, showing that clones encode the missing parts of the glucoamylase.
Example 4
Construction of pHUda440 expression vector
Expression vector pHUda440 was constructed for transcription of the glucoamylase gene from Trametes cingulata. A PCR reaction with the genome DNA of the Trametes cingulata as template was performed with an ExpandTM PCR system (Roche Diagnostics, Japan) using primers TFF to introduce a BamH I site and primer TFR to introduce an Xho I site, as shown below.
TFF: 5'-tttggatccaccatgcgtttcacgctcctcacctcc -3' (SEQ ID NO: 16) TFR: 5'-mctcgagtfae^ccaggtgtcattctg-3' (SEQ ID NO: 17)
The amplification reactions (50 microL) were composed of 1 ng of template DNA per microL, 250 mM dNTP each, 250 nM primer TFF, 250 nM primer TFR, 0.1 U of Taq polymerase per microL in 1X buffer (Roche Diagnostics, Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94°C for 2 minutes; 30 cycles each at 92°C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes; 1 cycle at 72°C for 10 minutes; and a hold at 4°C.

The reaction products were isolated on a 1.0% agarose gel using TAE buffer where a 2.2 kta product band was excised from the gel and purified using a QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
The 2.2 kb amplified DNA fragment was digested with BamHI and Xhol, and ligated into the Aspergillus expression cassette pCaHj483 digested with BamH i and Xhol. The ligation mixture was transformed into E. coli DH12aIpha (GIBCO BRL, Life Technologies, USA) to create the expression plasmid pHUda440. The amplified plasmid was recovered using a QIAprep® Spin Miniprep kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
Plasmid pCaHj483 comprised an expression cassette based on the Aspergillus niger neutral amylase II promoter fused to the Aspergillus nidulans those phosphate isomerase non translated leader sequence (Na2/tpi promoter) and the Aspergillus niger glucoamylase terminator (AMG terminator), the selective marker amdS from Aspergillus nidulans enabling growth on acetamide as sole nitrogen source.
Example 4
Cloning of the qlucoamvlase gene from Pachvkvtospora papyraceae
In order to clone the missing parts of the glucoamylase gene from Pachykytospora papyraceae, PCR based gene walking was carried out using LA PCR™ in vitro Cloning Kit (TAKARA, Japan) according to the manufacturers instructions.
Five micro g of genome DNA of Pachykytospora papyraceae was digested with BamHI, EcoRI, Hindlll, Pstl, Sail and Xbal, independently. 200 mL of ice-cold ethanol was added to the reaction mixture (50 microL) and then digested DNA was recovered by centrifugation at 15,000 x g for 30 minutes at 4°C. The recovered DNA was ligated w'rth a corresponding artificial linkers supplied by manufactures. The linker ligated DNA was recovered by adding 200 mL of ice-cold ethanol to the reaction mixture (50 microL followed by centrifugation at 15,000 x g for 30 minutes at 4°C.
PCR reactions with linker-ligated genome DNA of the Pachykytospora papyraceae as template was performed with a LA PCR system (TAKARA, Japan) using primer C1 and PP5' for cloning of missing S'-glucoamylase gene and primer C1 and PP3" for cloning of missing 3'-glucoamylase gene, as shown below. C1: S'-gtacatattgtcgttagaacgcgtaatacgactca-S' (SEQ ID NO: 13) PP5': 5'-cctccctgagtgagcgatgctgc-3' (SEQ ID NO: 18) PP3': S'-caactccggcctctcctccagcg-S1 (SEQ ID NO: 19)
The amplification reactions (50 microL) were composed of 1 ng of iemplate DNA per microL, 250 mM dNTP each, 250 nM primer, 250 nM primer, 0.1 U of LA Taq polymerase

per microL in 1X buffer (TAKARA: Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 0.5 minute, 55°C for 2 minutes, and 72°C for 2 minutes; 1 cycle at 72°C for 10 minutes; and a hold at 4°C.
0.5 kb and 0.9 kb amplified bands were obtained from Xbal digested genome DNA with primer C1 and PP5' and EcoRI digested genome DNA with primer C1 and PP3\ respectively. These reaction products were isolated on a 1.0% agarose gel using TAE buffer and was excised from the gel and purified using a QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
The amplified DNA fragments were ligated into pT7Blue (Invitrogen, Netherlands), independently. The ligation mixture was then transformed into E. colt DH12alpha (GIBCO BRL, Life Technologies, USA) to create pHUda448 and pHUda449 for a 0.5 kb amplified band and a 0.9 kb amplified band, respectively. The resultant plasmids were sequenced and compared to the Aspergillus niger glucoamylase gene, showing that clones encode the missing parts of the glucoamylase.
Example 5
Construction of pHUda450 expression vector
Expression vector pHUda450 was constructed for transcription of the glucoamylase gene from Pachykytospora papyraceae. A PCR reaction with the genome DNA of the Pachykytospora papyraceae as template was performed with an ExpandTM PCR system (Roche Diagnostics, Japan) using primers PPF to introduce a BamH I site and primer PPR to introduce an Xho I site, as shown below. PPF: 5'-tttggatccaccatgc^cttcaccctcctctcctcc-3' (SEQ ID NO: 20) PPR: 5'-tttctcgagtcaccgccaggtgtcgttctg-3' (SEQ ID NO: 21)
The amplification reactions (50 microL) were composed of 1 ng of template DNA per microL, 250 mM dNTP each, 250 nM primer PPF, 250 nM primer PPR, 0.1 U of Taq polymerase per microL in 1X buffer (Roche Diagnostics, Japan). The reactions were incubated in a DNA Engine PTC-200 (MJ-Research, Japan) programmed as follows: 1 cycle at 94°C for 2 minutes; 30 cycles each at 92°C for 1 minute, 55°C for 1 minute, and 72°C for 2 minutes; 1 cycle at 72°C for 10 minutes; and a hold at 4°C.
The reaction products were isolated on a 1.0% agarose gel using TAE buffer where a 2.2 kb product band was excised from the gel and purified using a QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
The 2.2 kb amplified DNA fragment was digested with BamHI and Xhol, and ligated into the Aspergillus expression cassette pCaHj483 digested with BamH I and XhoL The

ligation mixture was transformed into £ coli DH12aipha (GiBCO BRL; Life Technologies, USA) to create the expression piasmid pHUda450. The amplified plasmid was recovered using a QIAprep® Spin Miniprep kit (Q1AGEN Inc., Valencia, CA) according to the manufacturer's instructions.
Example 6
Expression of glucoamvlase genes derived from Trametes cinaulata and Pachvkvtospora papvraceae in Aspergillus orvzae.
Aspergillus oryzae strain BECh-2 was inoculated to 100 ml_ of YPG medium and incubated for 16 hours at 32°C at 80 rpm. Pellets were collected and washed with 0.6 M KCI, and resuspended 20 ml 0.6 M KCI containing a commercial beta-glucanase product (GLUCANEX™, Novozymes A/S, Bagsvaerd, Denmark) at a final concentration of 600 microL per mL The suspension was incubated at 32°C and 80 rpm until protoplasts were formed, and then washed twice with STC buffer. The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x107 protoplasts/ml. Approximately 3 micro g of pHUda440 or pHUda450 was added to 100 microL of the protoplast suspension, mixed gently, and incubated on ice for 20 minutes. One mL of SPTC was added and the protoplast suspension was incubated for 30 minutes at 37°C. After the addition of 10 mL of 50°C COVE top agarose, the reaction was poured onto COVE agar plates and the plates were incubated at 32°C. After 5 days transformants were selected from the COVE medium.
Four randomly selected transformants were inoculated into 100 mL of MS-9 medium and cultivated at 32°C for 1 day. Three ml of MS-9 medium was inoculated into 100 mL of MDU-pH5 medium and cultivated at 30°C for 3 days. Supematants were obtained by centrifugation at 3,000 x g for 10 minutes.
Glucoamylase activity in the supernatant samples was determined as an increase in NADH production by glucose dehydrogenase and mutarotase reaction with generating glucose and measured the absorbance at 340 nm. Six microL of enzyme samples dissolved in 100 mM sodium acetate pH 4.3 buffer was mixed with 31 microL of 23.2 mM of maltose in 100 mM sodium acetate pH 4.3 buffer and incubated at 37°C for 5 minutes. Then, 313 microL of color reagent (430 U of glucose dehydrogenase per liter, 9 U mutarotase per liter, 0.21 mM NAD, and 0.15 M NaCI in 0.12 M phosphate pH 7.6 buffer) was added to the reaction mixture and incubated at 37°C for 5 minutes. Activity was measured at 340 nm on a spectrophotometer. Six microL of distilled water was used in place of the enzyme samples as controls.

Tables 1 and 2 show the giucoamyiase activities of the selected transformants, relative to the activity of the host strain, Aspergillus oryzae BECh-2. which was normalized to 1.0.
Table 1. Shake flask results of the selected transformants expressing Trametes cingulata giucoamyiase

Example 7
Evaluation of Trametes cinaulata giucoamyiase in One-Step Fuel Ethanol Fermentations
The relative performance of Trametes cingulata giucoamyiase to Aspergillus niger giucoamyiase and Talaromyces emersonii giucoamyiase was evaluated via mini-scale fermentations. About 380 g of milled com (ground in a pilot scale hammer mill through a 1.65 mm screen) was added to about 620 g tap water. This mixture was supplemented with 3 mL 1 g/L penicillin. The pH of this slurry was adjusted to 5.0 with 40% H2S04. The dry solid (DS) level was determined in triplicate to be about 32%. Approximately 5 g of this slurry was added to 15 mL tubes.

A two dose dose-response was conducted with each enzyme. Dosages used were 0.3 and 0.6 nmol/ g DS. Six replicates of each treatment were run.
After dosing the tubes were inoculated with 0.04 mL/g mash of yeast propagate (RED STAR™ yeast) that had been grown for 22.5 hours on corn mash. Tubes were capped with a screw on top which had been punctured with a small needle to allow gas release and vortexed briefly before weighing and incubation at 32°C. 70 hours fermentations were carried out and ethanol yields were determined by weighing the tubes. Tubes were vortexed briefly before weighing. The result of the experiment is shown in Table 1.
It can be seen from Table 1 the ethanol yield per gram DS is significantly higher when using the Trametes cingulata glucoamylase compared to yields for the wild-type Aspergillus niger and Talaromyces emerson/Zglucoamylases.

Example 8
Evaluation of Pachvkvtosoora paovracea glucoamylase in One Step Fuel Ethanol Fermentations
The relative performance of Pachykytospora papyracea glucoamylase to Aspergillus niger glucoamylase and Talaromyces emersonii glucoamylase was evaluated via mini-scale fermentations. About 380 g of milled corn (ground in a pilot scale hammer mill through a 1.65 mm screen) was added to about 620 g tap water. This mixture was supplemented with 3 mL 1 g/L penicillin. The pH of this slurry was adjusted to 5.0 with 40% H2S04. The dry solid (DS) level was determined in triplicate to be about 32%. Approximately 5 g of this slurry was added to 15 mL tubes.
A two dose dose-response was conducted with each enzyme. Dosages used were 0. 3 and 0. 6 nmol/ g DS. Six replicates of each treatment were run.
After dosing the tubes were inoculated with 0.04 mL/g mash of yeast propagate (RED STAR™ yeast) that had been grown for 22.5 hours on com mash. Tubes were capped with a screw on top which had been punctured with a small needle to allow gas release and vertexed briefly before weighing and incubation at 32°C. 70 hours fermentations

were carried out and ethanol yields were determined by weighing the tubes. Tubes were vortexed briefly before weighing. The result of the experiment is shown in Table 2.
It can be seen from Table 2 the ethanol yield per gram DS is significantly higher when using the Pachykytospora papyracea glucoamylase compared to yields for the wild-type Aspergillus niger and Talaromyces emersonii giucoamylases.

Example 9
Trametes cinoulata glucoamylase in combination with hybrid Alpha-Amvlase A from Rhizomucor pusillus for One Step Fermentation
All treatments were evaluated via mini-scale fermentations. 410 g of ground corn was added to 590 g tap water. This mixture was supplemented with 3.0 ml 1g/L penicillin and 1g of urea. The pH of this slurry was adjusted to 4.5 with 5N NaOH (initial pH, before adjustment was about 3.8). Dry Solid (DS) level was determined to be 35%. Approximately 5 g of this slurry was added to 20 ml vials. Each vial was dosed with the appropriate amount of enzyme followed by addition of 200 micro liter yeast propagate/5 g fermentation. Actual dosages were based on the exact weight of corn slurry in each vial. Vials were incubated at 32(C. 9 replicate fermentations of each treatment were run. Three replicates were selected for 24 hour, 48 hour and 70 hour time point analysis. Vials were vortexed at 24, 48 and 70 hours. The time point analysis consisted of weighing the vials and prepping the sample for HPLC. The HPLC preparation consisted of stopping the reaction by addition of 50 micro titers of 40% H2S04l centrifuging, and filtering through a 0.45 micro m filter. Samples awaiting HPLC analysis were stored at 4°C.


Note: T. cingulata glucoamylase, 49 AGU/ml) and hybrid Alpha-Amylase A from Rhbomucor pus///i/s_(17 AFAU/ml) are purified enzymes from Novozymes Japan. DS=dry solid.
Results
The synergistic effect of alpha-amylase and glucoamylase is presented in a Table below. When T. cingulata glucoamylase was used alone in one step fermentation, it produced 54.1, 81.2 and 99.0 g/l ethanol after 24, 48, and 70 hours fermentation, respectively. When the hybrid alpha-amylase A from Rhizomucor pusillus is used alone in fermentation, it produced 90.5, 124.6, and 138.1 g/l ethanol after 24, 48, and 70 hours fermentation, respectively. „


The optimal ratio of T. cingulata glucoamylase to hybrid Alpha-Amylase A from Rhizomucor pusillus alpha-amylase is about 6.5 AGU/AFAU (Table above). Essentially similar performance in term of ethanol yield after 70 hours fermentation was observed in the range of 0.76-38.7 AGU/AFAU ratio, indicating robust performance for a broad activity ration range of the mixtures of T. cingulata glucoamylase to hybrid Alpha-Amylase A.
Examples 10
DNA extraction and PCR amplification of Leucopaxillus gioanteus:
0.2 -2 g of the spore forming layer (lamellas) of the fresh fruit-bodies of
Leucopaxillus giganteus were used for genomic DNA extraction using FastDNA SPIN Kit for
Soil (Qbiogene, USA) according to the manufacturer's instructions.
PCR reaction was done on genome DNA with the degenerated primers ArAF1 and
ArAR3
ArAF1 5'-CRTRCTYDVCAACATYGG-3' (SEQ ID NO: 7)
ArAR3 5' GTCAGARCADGGYTGRRASGTG-3' (SEQ ID NO: 8)
i
wherein D = A or G or T; R = A or G; S = C or G; V = A or C or G; Y = C or T
The amplification reaction (13 microL) was composed of 1 microL genome DNA solution, 1 micro M primer ArAF1 (25 pmol/microL), 1 micro M primer ArAR3 (25 pmol/microL), 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK). The reaction was incubated in a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 94°C for 2 minutes; 20 cycles each at 94°C for 30 seconds, 65°C for 45 seconds, with an annealing temperature decline of 1°C per cycle, and 72°C for 1 minute 30 seconds; followed by 20 cycles each at 94°C for 30 seconds, 45°C for 45 seconds and 72°C

for 1 minute 30 seconds; 1 cycle at 72°C for 7 minutes; and a hold at 4°C. The PCR product was purified using ExoSAP-IT (USB, USA) according to the manufacturer's instructions and sequenced using the primers as used in the amplification reaction. The sequence was subsequently compared to the Aspergillus n/ger glucoamyiase gene, showing that the PCR product encoded a part of a glucoamyiase.
From the partial sequence of the Leucopaxillus giganteus glucoamyiase more gene sequence was obtained with PCR based gene walking using the Vectorette Kit from SIGMA-Genosys. The gene walking was performed as described in the manufacturer's protocol. 0.15 micro g genomic DNA of Leucopaxillus giganteus was digested with EcoRl, BamHI and Hindlll, independently. The digested DNA was ligated with the corresponding Vectorette units supplied by the manufacture using a DNA Engine Dyad PTC-0220 (MJ Research, USA) programmed as follows: 1 cycle at 16°C for 60 minutes; 4 cycles each at 37°C for 20 minutes, 16°C for 60 minutes, 37°C for 10 minutes; followed by 1 cycle at 16°C for 60 minutes and a hold at 4°C. The ligation reactions were subsequent diluted 5 times with
sterile water.
»
PCR reactions with linker-ligated genome DNA of the Leucopaxillus giganteus as
template was performed with a DNA Engine Dyad PTC-0220 (MJ Research, USA)
programmed as follows: 1 cycle at 94°C for 2 minutes; 40 cycles each at"94°C for 15
seconds, 72°C for 1 minute, 72°C for 1 minute, 1 cycle at 72°C for 7 minutes; and a hold at
4°C using the supplied Vectorette primer and the specific Leucopaxillus giganteus AMG
primers Nc1R2 and NC1F0, respectively, as shown below.
Nc1R2: 5'- GGTAGACTAGTTACCTCGTTGG -3' (SEQ ID NO: 31)
NdFO: 5- GCTTCCCTAGCCACTGCCATTGG -3' (SEQ ID NO: 32)
The amplification reactions (12.5 microL) were composed of 0.5 microL of linker-ligated genome DNAs, 400 nM Vectorette primer, 400 nM Leucopaxillus giganteus specific primer, 11 microL Extensor Hi-Fidelity PCR Master Mix (ABgene, UK).
After the PCR reaction the PCR products were purified using ExoSAP-IT (USB, USA) according to the manufacturer's instructions and sequenced and subsequently compared to the Aspergillus niger glucoamyiase gene.
A 1.7 kb amplified band was obtained by the PCR reaction from Hindlll digested genome DNA amplified with the primer Nc1R2. Sequencirvg of the PCR product using this primer showed that it encoded the remaining 600 base pairs of the glucoamyiase gene in the 51 direction.
A 1.8 amplified band was obtained by the PCR reaction from Hindlll digested genome DNA amplified with the primer NdFO. Sequencing of the PCR product using this primer showed that it encoded further approximately 530 base pairs of the glucoamyiase

gene, however not reaching the end of the gene. Tnerefore, an additional sequencing primer Nc1F2, were designed based on the newly obtained additional sequence of the giucoamytase gene. Using Nc1F2 as a downstream primer of NdFO on the same PCR product showed that it encoded the remaining approximately 520 base pairs of the glucoamylase gene in the 3' direction. Nc1F2 5' GTTGATTTAACTTGGAGCTATGC (SEQ ID NO: 33)
Example 11
Cloning and expression of Leucooaxillus gioanteus alucoamvlase
From the partial sequence of Leucopaxillus giganteus glucoamylase more gene sequence was obtained.
The following PCR cloning primers were used: Forward primer: 5' TCCCTTGGATCCAGGATGCATTTCTCTGTCCTCTC 3' (SEQ ID NO: 34)
Bam HI Reverse primer 5' CTTATCCTCGAGCTACTTCCACGAGTCATTCTGG 3' (SEQ ID NO: 35)
Xhol
PCR was made with gDNA from Leucopaxillus giganteus as template using Phusion as polymerase and the above primers introducing respectively BamHI and Xhol. 5 micro L of the PCR product was tested in a 1% agarose gel, and showed a band at about 2.2 kb. The PCR product was purified on a QIAquick column.
The purified product and Aspergillus vector pENI2516 Leucopaxillus giganteus (see WO 2004/069872) were digested with BamHI and Xhol. The vector and insert fragments were purified from a 1% preparative agarose gel using the QIAquick method. The 2.2 kb fragment was ligated into the vector pENI2516 and transformed into TOP10 E.coli competent cells. The resulting plasmid was termed as pENI3372.
Transformation in Aspergillus nioer
Protoplasts of the Aspergillus niger strain Mbin1T9 (see WO 2004/090155) were made. About 5 micro g of pENI3372 was transformed into the protoplasts. The resulting Aspergillus niger transformants were tested for glucoamylase activity.
Example 12
Debranchinq activity toward oullulan of Trametes cinoulata alucoamvlase
The alpha-1,6-debranching activity of giucoamylases derived from Trametes cingulata, Athelia rolfsii, Aspergillus niger and Talaromyces emersonii was investigated.

Pultulan. (MW 50.00D-100.000) was dissolved in MilliQ water and added into a reaction mixture to a 3% final concentration containing 50 mM NaAc buffer, pH 4.0, with enzyme dosage of 0.42 micro g enzyme/mg puliulan at 37°C. Oligosaccharide profile was analyzed periodically by HPLC.
The result of the test is displayed in Figure 1.
The invention described and.claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.
Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.









































Claims
1, A polypeptide having giuooamylase activity, selected from the group consisting of;
(a) a polypeptide having an amino acid sequence which has at least 75% identity
with amino acids for mature polypeptide amino acids 1 to 556 of SEQ ID NO: 2; or
(a1) a polypeptide having an amino acid sequence which has at least 75% identity with amino acids for mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii)
which hybridizes under at least medium stringency conditions with the cDNA sequence
contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i)
or (ii); or
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1737 of SEQ ID NO: 38, or (iii) a complementary strand of (i) or (ii); and
(c) a variant comprising a conservative substitution, deletion, and/or insertion of
one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 2, or
(d) a variant comprising a conservative substitution, deletion, and/or insertion of one
or more amino acids of amino acids 1 to 561 of SEQ ID NO: 37.
2. A polypeptide having glucoamylase activity selected from the group consisting of:
(a) . a polypeptide having an amino acid sequence which has at least 70% identity
with amino acids for mature polypeptide amino acids 1 to 575 of SEQ ID NO: 5; or
(a1) a polypeptide having an amino acid sequence which has at least 70% identity with amino acids for mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii)
which hybridizes under at least medium stringency conditions with the cDNA sequence
contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i)
or (ii); or
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2182 of SEQ ID NO: 39, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence

contained in nucleotides 55 to 1749 of SEQ ID'NO: 41, or (iii) a complementary strand of (i) or (if); and
(c) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 575 of SEQ ID NO: 5f or
(d) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 565 of SEQ ID NO: 40.
3. A polypeptide having glucoamylase activity selected from the group consisting of:
(a) a polypeptide having an amino acid sequence which has at least 60% identity
with amino acids for mature polypeptide amino adds 1 to 556 of SEQ ID NO: 26; or
(a1) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or
(a2) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or
(ii) which hybridizes under at least low stringency conditions with the cDNA sequence
contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i)
or (ii)
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42 or (iii) a complementary strand of (i) or (ii); and
(c) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 26, or
(d) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 548 of SEQ ID NO: 24; or
(c2) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 523 of SEQ ID NO: 43.
4. The polypeptide of claim 1, which consists of the mature part of SEQ ID NOS: 2 or 37, respectively, or a fragment thereof, having glucoamylase activity.
5. The polypeptide of claim 2, which consists of SEQ ID NOS: 5 or 40, respectively, or a fragment thereof having glucoamylase activity.

6. ihe polypeptide of claim 3. which consists of SEQ ID NOS: 24: 25, or 43, or 3
fragment thereof having giucoamylase activity.
7. The polypeptide of claim 1, wherein the polypeptide is a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37.
8. The polypeptide of claim 2, wherein the polypeptide is a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 575 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40.
9. The polypeptide of claim 3, wherein the polypeptide is a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 26 or amino acids 1 to 548 of SEQ ID NO: 24 or amino acids 1 to 523 of SEQ ID NO: 43.
10. The polypeptide of claim 1, which comprises a catalytic region from amino acids 1 to 455 in SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37.
11. The polypeptide of claim 2, which comprises a catalytic region located from amino acids 1 to 475 in SEQ ID NO: 5 or amino acids 1 to 561 of SEQ ID NO: 40.
12. The polypeptide of claim 3, which comprises a catalytic region located from amino acids 1 to 451 in SEQ ID NO: 26 or amino acids 1 to 455 of SEQ ID NO: 24 or amino acids 1 to418ofSEQIDNO:43.
13. The polypeptide of claim 1, which comprises a binding domains Jocated from amino acid 466 to 556 of SEQ ID NO: 2. or amino acids 471 to 561 of SEQ ID NO: 37.
14. The polypeptide of claim 2, which comprises a binding domain located from amino acid 485 to 575 is SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40.
15. The polypeptide of claim 2, which comprises a binding domain located from amino acid 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids430 to 523of SEQ ID NO: 43.-

16. she polypeptide of ciairn 1, which is encoded by the polynucleotide contained in
piasmid pHUda595 harbored in £ coli DSM 17106.
17. The polypeptide of claim 2, which is encoded by the polynucleotide contained in
piasmid pHUda594 harbored in £ coii DSM 17105.
18. .A polypeptide having carbohydrate-binding affinity, selected from the group
consisting of:
(a) i) a polypeptide comprising an amino acid sequence which has at least 60% identity
with amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37,
respectively;
ii) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively;
iii) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively;
(b) a polypeptide which is encoded by a nucleotide sequence which hybridizes under low
stringency conditions with a polynucleotide probe selected from the group consisting of
(i) the complementary strand of nucleotides 1420 to 1725 of SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively;
(ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively;
(iii) the complementary strand of nucleotides 1438 to 1719 of SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively;
(c) a fragment of (a) or (b) that has carbohydrate binding affinity.
19. A polypeptide of claim 18, wherein the carbohydrate-binding affinity is starch-binding affinity.
20. The polypeptide of claim 18 or 19, comprising an amino acid sequence which has at
least 60% identity with amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561

of SEQ ID NO: 37, respectively, preferably at least 70% identity, preferably at least 80% identity, at least 85% identity, at least 90% identity, at least 95%, preferably at least 96%, more preferably at least 97%, more preferably at least 98% identity, or more preferably at

least 99% identity with amino acids 466 tc 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively.
21. The polypeptide of claim 17, which comprises the amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively.
22. The polypeptide of claim 18 or 19, comprising an amino acid sequence which has at least 60% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, preferably at least 70%.identity, preferably at least 80% identity, at least 85% identity, at least 90% identity, at least 95%, preferably at least 96%, more preferably at least 97%, more preferably at least 98% identity, or more preferably at least 99% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively.
23. The polypeptide of claim 22, which comprises the amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively.
24. The polypeptide of claim 18 or 19, comprising an amino acid sequence which has at least 60% identity with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively, preferably at least 70% identity, preferably at least 80% identity, at least 85% identity, at least 90% identity, at least 95%, preferably at least 96%, more preferably at least 97%, more preferably at least 98% identity, or more preferably at least 99% identity with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively.
25. The polypeptide of claim 24, which comprises the amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively.
26. The polypeptide of any of claims 18-25 where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion, and/or insertion of an amino acid as compared to amino acids 485 to 575 of SEQ ID NO: 2 or amino iacids 471 to 561 of SEQ ID NO: 37, respectively; or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively; or amino acids 463 to

556 of SEQ ID NO: 26 or amino acids 457 to 548 of SirQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively.
27. The polypeptide of any of claims 18-26, where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion of an amino acid as compared to the amino acid sequence encoded by the carbohydrate-binding domain encoding part of the polynucleotide sequences shown in position 1420 to 1725 in SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively; or position 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively; or position 1438 to 1719 in SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively.
28. The polypeptide according to any of claims 18-27, which is encoded by a nucleotide sequence which hybridizes under low stringency conditions, preferably medium stringency conditions, preferably under high stringency conditions, with a polynucleotide probe selected from the group consisting of
(i) the complementary strand of nucleotides 1420 to 1725 in SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively;
(ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively;
(iii) the complementary strand of nucleotides 1438 to 1719 in SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively.
29. A hybrid polypeptide having glucoamylase activity consisting of a polypeptide of any of claims 1-28, wherein the linker region has been replaced with the linker shown in SEQ ID NO: 22.
30. A polynucleotide having a nucleotide sequence which encodes for the polypeptide of any of claims 1-29.
31. A nucleic acid construct comprising the polynucleotide of claim 30 operably linked to one or more control sequences that direct the production of the polypeptide in an expression host.
r
32. A recombinant expression vector comprising the nucleic acid construct of claim 31.

33. A recombinant host cell composing the nucleic acid construct of claim 31 or recombinant expression vector of claim 32.
34. A method for producing a polypeptide of any of claims 1-29, comprising

(a) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide; and
(b) recovering the polypeptide.

35. A method for producing a polypeptide of any of claims 1-29, comprising (a) cultivating a host cell comprising a nucleic acid construct comprising a nucleotide sequence encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
36. A polynucleotide encoding a polypeptide having glucoamylase activity, selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 75% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID
NO: 2; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;
(b) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of
SEQ ID NO: 1; or
(b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of SEQ ID NO: 36;
(c) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of SEQ ID NO: 3; or
(d) a polynucleotide having at least 60% identity with nucleotides 55 to 1737 of SEQ ID NO: 38;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i) or (ii) or

(dl) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1737 of SEQ ID NO: 38, or (iii) a complementary strand of (i) or (ii).
37. A polynucleotide encoding polypeptides having glucoamylase activity, selected from
the group consisting of:
(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 75% identity with the mature polypeptide amino acids 1 to 575 of SEQ ID
NO: 5; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;
(b) a polynucleotide having at least 60% identity with nucleotides 55 to 2189 of
SEQ ID NO: 4; or
(b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2182 of SEQ ID NO: 39;
(c) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of SEQ ID NO: 6; or
(d) a polynucleotide having at least 60% identity with nucleotides 55 to 1749 of SEQ ID NO: 41;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i) or (ii); or
(d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2182 of SEQ ID NO: 39, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii).
38. A polynucleotide encoding polypeptides having glucoamylase activity, selected from
the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 60% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID
NO: 26; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or
(a2) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;
(b) a polynucleotide having at least 60% identity with nucleotides 117 to 2249 of SEQ ID NO: 23; or
(c) a polynucleotide having at least 60% identity with nucleotides 52 to 1719 of SEQ ID NO: 25; or
(d) a polynucleotide having at least 60% identity with nucleotides 52 to 1620 of SEQ ID NO: 42;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42, or (iii) a complementary strand of (i) or (ii), or
(d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i) or (ii).
39. A process for producing a fermentation product from starch-containing material
comprising the steps of:
(a) liquefying starch-containing material in the presence of an alpha-amylase;
(b) saccharifying the liquefied material obtained in step (a) using a glucoamylase of any of claims 1-29;
(c) fermenting the saccharified material using a fermenting organism.

40. The process of claim 39, wherein the fermentation product is recovered after fermentation, preferably by distillation.
41. The process of claim 39 or 40, wherein the step (b) and (c) are carried out sequentially or simultaneously (i.e., SSF process).

42. i he process of any of claims 39-41, wherein the fermentation product is ethanol
43. The process of any of claims 39-42, wherein the starch-containing starting material is whole grains, preferably whole corn or wheat grains.
44. The process of any of claims 39-43, wherein the fermenting organism is a strain of Saccharomyces.
45. The process of any of daims 39-44, further comprising, prior to the step (a), the steps of:
x) reducing the particle size of starch-containing material;
y) forming a slurry comprising the starch-containing material and water.
46. The process of claim 45, wherein the slurry is heated to above the gelatinization temperature.
47. The process of claim 45, wherein the slurry is jet-cooked at a temperature between 95-140°C, preferably 105-125°C, for 1-15 minutes, preferably for 3-10 minute, especially around 5 minutes.
48. A process for producing a fermentation product from starch-containing material comprising:
(a) saccharifying starch-containing material with a glucoamylase of any of claims 1-29, and/or having
i) the sequence shown as amino acids 1 to 556 in SEQ ID NO: 2 or amino
acids 1 to 561 in SEQ ID NO: 37, or a glucoamylase having at least 75% identity thereto, and/or
ii) the sequence shown as amino acids 1 to 575 in SEQ ID NO: 5 or amino acids 1 to 565 in SEQ ID NO: 40, or a glucoamylase having at least 70% identity thereto, and/or
iii) the sequence shown as amino acids 1 to 548 in SEQ ID NO: 24 or amino acids 1 to 556 in SEQ ID NO: 26 or amino acids 1 to 523 in SEQ ID NO: 43, or a glucoamylase having at least 60% identity thereto,
at a temperature below the initial gelatinization temperature of said starch-containing material.

(b) fermenting using a fermenting organism.
49. The process of claim 48, wherein the process is carried out for a period of 1 to 250 hours, preferably is from 25 to 190 hours, more preferably from 30 to 180 hours, more preferably from 40 to 170 hours, even more preferably from 50 to 160 hours, yet more preferably from 60 to 150 hours, even yet more preferably from 70 to 140 hours, and most preferably from 80 to 130 hours.
50. The process of claim 48 or 49, wherein the process is carried out at a pH in the range between 3 and 7, preferably from 3.5 to 6, or more preferably from 4 to 5.
51. The process of any of claims 48-50, wherein the dry solid content (DS) lies in the range from 20-55 wt.-%, preferably 25-40 wt.-%, more preferably 30-35 wt-%.
52. The process of claims 48-51, wherein the sugar concentration is kept at a level below about 6 wt. % during saccharification and fermentation.
53. The process of any of claims 48-52, wherein a slurry comprising water and starch-containing material is prepared before step (a).
54. The process of any of claims 48-53, wherein the starch-containing material is prepared by reducing the particle size of starch-containing material to a particle size of 0.1-0.5 mm.
55. The process of any of claims 48-53, wherein the reduction of particle size of the starch-containing material is done by milling.
56. The process of any of claims 48-55, wherein the starch-containing material is granular starch.
57. The process of any of claims 48-55, wherein the starch-containing material is whole grains.
58. The process of any of claims 48-57, wherein the saccharification and fermentation is carried out simultaneously.

59. The process of ciaim 58, wherein the temperature during simultaneous saccharification and fermentation, or fermentation in step (b) is between 28°C and 36°C, such as between 29°C and 35°C, such as between 30CC and 34CC, such as around 32°C.
60. The process of any of claims 48-59, wherein the glucoamylase is present in an amount of 0.001 to 10 AGU/g DS, preferably from 0.01 to 5 AGU/g DS, especially 0.1 to 0.5 AGU/g DS.
61. The process of any of claims 48-60, wherein an alpha-amylase is present.
62. The process of claim 61, wherein the alpha-amylase is a fungal alpha-amylase, preferably derived from the genus Aspergillus, especially a strain of A niger, A. oryzae, A. awamori, or Aspergillus kawachii, or of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
63. The process of claim 62, wherein the fungal alpha-amylase is a hybrid enzyme comprising an alpha-amylase catalytic domain (CD) and a carbohydrate-binding module/domain (CBM) and optionally linker or a wild-type fungal acid alpha-amylase catalytic domain (CD) and a carbohydrate-binding module (CBM) and optionally a linker.
64. The process of claim 63, wherein the hybrid alpha-amylase is selected from the group of Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29), Meripilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO: 30).
65. The process of claim 63, wherein the hybrid alpha-amylase is Aspergillus niger alpha-amylase with Aspergillus kawachii linker and starch binding domain (SBD).
66. The process of any of claims 61-64, wherein the alpha-amylase is present in an amount of 0.01 to 10 AFAU/g DS, preferably 0.1 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS.
67. The process of any of claims 48-66, wherein the alpha-amylase and glucoamylase is added in a ratio of-between 0.1 and 10 AGU/AFAU, preferably 0.30 and 5 AFAU/AGU, especially between 0.5 and 3 AFAU/AGU.

68. The process of any of claims 48-67, wherein another glucoamyiase is also added.
69. The process of claim 68, wherein the other glucoamyiase is selected from the group consisting of Aspergillus niger glucoamyiase, Athelia rolsii glucoamyiase, and Talaromyces emersonii glucoamyiase, or a mixture thereof.
70. The process of any of claims 48-69, wherein the fermentation product is recovered after fermentation.
71. The process of any of claims 48-70, wherein the fermentation product is an alcohol, preferably ethanol, especially fuel ethanol, potable ethanol and/or industrial ethanol.
72. The process of any of claims 48-71, wherein the starch-containing material is obtained from tubers, roots, stems, fruits, seeds or whole grain.
73. The process of any of claims 48-72," wherein the starch-containing material is obtained from com, cobs, wheat, barley, rye, milo, sago, cassava, manioc, tapioca, sorghum, rice or potatoes.
74. The process of any of claims 48-73, wherein the starch-containing material is granular starch.
75. The process of any of claims 48-74, wherein the temperature during saccharification in step (a) is from 30°C to 75°C, preferably between 45 and 60°C.
76. The process of any of claims 48-75, wherein step (a) and (b) is carried out sequentially or simultaneously (i.e., one-step fermentation)
77. A process of producing syrup from starch-containing material, comprising

(a) liquefying starch-containing material in the presence of an alpha-amylase,
(b) saccharifying the material obtained in step (a) using a glucoamyiase of any of claims 1 to 29.
78. The process of claim 77, further comprising refining, conversion and/or recovery of
the syrup.

79. Use of a giucoamylase of any of claims 1-29 for production of syrup and/or a fermentation product.
80. Use of claim 79, wherein the starting material is gelatinized or un-geiatinized starch-containing material.
81. . Use of a giucoamylase of any of claims 1-29 for brewing.
82. A composition comprising a giucoamylase of any of claims 1-29.
83. The composition of claims 82, further comprising an alpha-amylase.
84. The composition of claims 83, wherein the alpha-amylase is an acidic alpha-amylase, preferably a fungal acidic alpha-amylase.
85. The composition of claim 83 or 84, wherein the alpha-amylase is of fungal origin.
86. The composition of any of claims 83-85, wherein the alpha-amylase is derived from the genus Aspergillus, preferably a strain of'A. niger, A. oryzae, Aspergillus awarnori, or A. kawachii, of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
87. The composition of any of claims 83-85, wherein the alpha-amylase is a hybrid, preferably Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO; Sty* Meripilus giganteus alpha-amylase with Athelia rolfsii giucoamylase linker and SBD (SEQ ID NO: 30).
88 The composition of any of claims 82-87, further comprising another giucoamylase.
89. The composition of claim 88, wherein the giucoamylase is derived from the genus Aspergillus, preferably a strain of Aspergillus niger, Aspergillus oryzae, Aspergillus awarnori, or the genus Athelia, preferably a strain of Athelia rolfsii, the genus Talaromyces, preferably a strain the Talaromyces emersonii, or the genus Rhizopus, such as a strain of Rhizopus nivius, or of the genus Humicola, preferably a strain of Humicola grisea var. thermoidea.

90. The composition of claim 88 or 89, comprising glucoamyiase derived from Trametes
cingulata glucoamyiase, alpha-amylase derived from Rhizomucor pusillus alpha-amylase
with Athelia rolfsii AMG linker and SBD, and glucoamyiase derived from Talaromyces
emersonii.
91. The composition of claim 88 or 89, comprising glucoamyiase derived from Trametes
cingulata, alpha-amylase derived from Rhizomucor pusillus alpha-amylase with Athelia rolfsii
AMG linker and SBD, and glucoamyiase derived from Aspergillus niger.























Claims
1, A polypeptide having giuooamylase activity, selected from the group consisting of;
(a) a polypeptide having an amino acid sequence which has at least 75% identity
with amino acids for mature polypeptide amino acids 1 to 556 of SEQ ID NO: 2; or
(a1) a polypeptide having an amino acid sequence which has at least 75% identity with amino acids for mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii)
which hybridizes under at least medium stringency conditions with the cDNA sequence
contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i)
or (ii); or
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1737 of SEQ ID NO: 38, or (iii) a complementary strand of (i) or (ii); and
(c) a variant comprising a conservative substitution, deletion, and/or insertion of
one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 2, or
(d) a variant comprising a conservative substitution, deletion, and/or insertion of one
or more amino acids of amino acids 1 to 561 of SEQ ID NO: 37.
2. A polypeptide having glucoamylase activity selected from the group consisting of:
(a) . a polypeptide having an amino acid sequence which has at least 70% identity
with amino acids for mature polypeptide amino acids 1 to 575 of SEQ ID NO: 5; or
(a1) a polypeptide having an amino acid sequence which has at least 70% identity with amino acids for mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii)
which hybridizes under at least medium stringency conditions with the cDNA sequence
contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i)
or (ii); or
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2182 of SEQ ID NO: 39, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence

contained in nucleotides 55 to 1749 of SEQ ID'NO: 41, or (iii) a complementary strand of (i) or (if); and
(e) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 575 of SEQ ID NO: 5f or
(f) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 565 of SEQ ID NO: 40.
3. A polypeptide having glucoamylase activity selected from the group consisting of:
(a) a polypeptide having an amino acid sequence which has at least 60% identity
with amino acids for mature polypeptide amino adds 1 to 556 of SEQ ID NO: 26; or
(a1) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or
(a2) a polypeptide having an amino acid sequence which has at least 60% identity with amino acids for mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;
(b) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes
under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or
(ii) which hybridizes under at least low stringency conditions with the cDNA sequence
contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i)
or (ii)
(b1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42 or (iii) a complementary strand of (i) or (ii); and
(e) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 26, or
(f) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 548 of SEQ ID NO: 24; or
(c2) a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 523 of SEQ ID NO: 43.
6. The polypeptide of claim 1, which consists of the mature part of SEQ ID NOS: 2 or 37, respectively, or a fragment thereof, having glucoamylase activity.
7. The polypeptide of claim 2, which consists of SEQ ID NOS: 5 or 40, respectively, or a fragment thereof having glucoamylase activity.

6. ihe polypeptide of claim 3. which consists of SEQ ID NOS: 24: 25, or 43, or 3
fragment thereof having giucoamylase activity.
16. The polypeptide of claim 1, wherein the polypeptide is a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37.
17. The polypeptide of claim 2, wherein the polypeptide is a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 575 of SEQ ID NO: 5 or amino acids 1 to 565 of SEQ ID NO: 40.
18. The polypeptide of claim 3, wherein the polypeptide is a variant comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of amino acids 1 to 556 of SEQ ID NO: 26 or amino acids 1 to 548 of SEQ ID NO: 24 or amino acids 1 to 523 of SEQ ID NO: 43.
19. The polypeptide of claim 1, which comprises a catalytic region from amino acids 1 to 455 in SEQ ID NO: 2 or amino acids 1 to 561 of SEQ ID NO: 37.
20. The polypeptide of claim 2, which comprises a catalytic region located from amino acids 1 to 475 in SEQ ID NO: 5 or amino acids 1 to 561 of SEQ ID NO: 40.
21. The polypeptide of claim 3, which comprises a catalytic region located from amino acids 1 to 451 in SEQ ID NO: 26 or amino acids 1 to 455 of SEQ ID NO: 24 or amino acids 1 to418ofSEQIDNO:43.
22. The polypeptide of claim 1, which comprises a binding domains Jocated from amino acid 466 to 556 of SEQ ID NO: 2. or amino acids 471 to 561 of SEQ ID NO: 37.
23. The polypeptide of claim 2, which comprises a binding domain located from amino acid 485 to 575 is SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40.
24. The polypeptide of claim 2, which comprises a binding domain located from amino acid 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24 or amino acids430 to 523of SEQ ID NO: 43.-

16. she polypeptide of ciairn 1, which is encoded by the polynucleotide contained in
piasmid pHUda595 harbored in £ coli DSM 17106.
17. The polypeptide of claim 2, which is encoded by the polynucleotide contained in
piasmid pHUda594 harbored in £ coii DSM 17105.
18. .A polypeptide having carbohydrate-binding affinity, selected from the group
consisting of:
(a) i) a polypeptide comprising an amino acid sequence which has at least 60% identity
with amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37,
respectively;
ii) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively;
iii) a polypeptide comprising an amino acid sequence which has at least 60% identity with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively;
(b) a polypeptide which is encoded by a nucleotide sequence which hybridizes under low
stringency conditions with a polynucleotide probe selected from the group consisting of
(i) the complementary strand of nucleotides 1420 to 1725 of SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively;
(ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively;
(iii) the complementary strand of nucleotides 1438 to 1719 of SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively;
(c) a fragment of (a) or (b) that has carbohydrate binding affinity.
21. A polypeptide of claim 18, wherein the carbohydrate-binding affinity is starch-binding affinity.
22. The polypeptide of claim 18 or 19, comprising an amino acid sequence which has at
least 60% identity with amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561

of SEQ ID NO: 37, respectively, preferably at least 70% identity, preferably at least 80% identity, at least 85% identity, at least 90% identity, at least 95%, preferably at least 96%, more preferably at least 97%, more preferably at least 98% identity, or more preferably at

least 99% identity with amino acids 466 tc 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively.
27. The polypeptide of claim 17, which comprises the amino acids 466 to 556 of SEQ ID NO: 2 or amino acids 471 to 561 of SEQ ID NO: 37, respectively.
28. The polypeptide of claim 18 or 19, comprising an amino acid sequence which has at least 60% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively, preferably at least 70%.identity, preferably at least 80% identity, at least 85% identity, at least 90% identity, at least 95%, preferably at least 96%, more preferably at least 97%, more preferably at least 98% identity, or more preferably at least 99% identity with amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively.
29. The polypeptide of claim 22, which comprises the amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively.
30. The polypeptide of claim 18 or 19, comprising an amino acid sequence which has at least 60% identity with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively, preferably at least 70% identity, preferably at least 80% identity, at least 85% identity, at least 90% identity, at least 95%, preferably at least 96%, more preferably at least 97%, more preferably at least 98% identity, or more preferably at least 99% identity with amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively.
31. The polypeptide of claim 24, which comprises the amino acids 463 to 556 of SEQ ID NO: 26 or amino acids 467 to 548 of SEQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively.
32. The polypeptide of any of claims 18-25 where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion, and/or insertion of an amino acid as compared to amino acids 485 to 575 of SEQ ID NO: 2 or amino iacids 471 to 561 of SEQ ID NO: 37, respectively; or amino acids 485 to 575 of SEQ ID NO: 5 or amino acids 475 to 565 of SEQ ID NO: 40, respectively; or amino acids 463 to

556 of SEQ ID NO: 26 or amino acids 457 to 548 of SirQ ID NO: 24, or amino acids 430 to 523 of SEQ ID NO: 43, respectively.
29. The polypeptide of any of claims 18-26, where the polypeptide is an artificial variant which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion of an amino acid as compared to the amino acid sequence encoded by the carbohydrate-binding domain encoding part of the polynucleotide sequences shown in position 1420 to 1725 in SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively; or position 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively; or position 1438 to 1719 in SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively.
30. The polypeptide according to any of claims 18-27, which is encoded by a nucleotide sequence which hybridizes under low stringency conditions, preferably medium stringency conditions, preferably under high stringency conditions, with a polynucleotide probe selected from the group consisting of
(i) the complementary strand of nucleotides 1420 to 1725 in SEQ ID NO: 3 or nucleotides 1465 to 1737 of SEQ ID NO: 38, respectively;
(ii) the complementary strand of nucleotides 1423 to 1725 of SEQ ID NO: 6 or nucleotides 1477 to 1749 of SEQ ID NO: 41, respectively;
(iii) the complementary strand of nucleotides 1438 to 1719 in SEQ ID NO: 25 or nucleotides 1854 to 2249 of SEQ ID NO: 23 or nucleotides 1339 to 1620 of SEQ ID NO: 42, respectively.
32. A hybrid polypeptide having glucoamylase activity consisting of a polypeptide of any of claims 1-28, wherein the linker region has been replaced with the linker shown in SEQ ID NO: 22.
33. A polynucleotide having a nucleotide sequence which encodes for the polypeptide of any of claims 1-29.
34. A nucleic acid construct comprising the polynucleotide of claim 30 operably linked to one or more control sequences that direct the production of the polypeptide in an expression host.
r
32. A recombinant expression vector comprising the nucleic acid construct of claim 31.

35. A recombinant host cell composing the nucleic acid construct of claim 31 or recombinant expression vector of claim 32.
36. A method for producing a polypeptide of any of claims 1-29, comprising

(c) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide; and
(d) recovering the polypeptide.

37. A method for producing a polypeptide of any of claims 1-29, comprising (a) cultivating a host cell comprising a nucleic acid construct comprising a nucleotide sequence encoding the polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
38. A polynucleotide encoding a polypeptide having glucoamylase activity, selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 75% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID
NO: 2; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 561 of SEQ ID NO: 37;
(b) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of
SEQ ID NO: 1; or
(b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2166 of SEQ ID NO: 36;
(e) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of SEQ ID NO: 3; or
(f) a polynucleotide having at least 60% identity with nucleotides 55 to 1737 of SEQ ID NO: 38;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 1, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 3, or (iii) a complementary strand of (i) or (ii) or

(dl) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2166 of SEQ ID NO: 36, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1737 of SEQ ID NO: 38, or (iii) a complementary strand of (i) or (ii).
37. A polynucleotide encoding polypeptides having glucoamylase activity, selected from
the group consisting of:
(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 75% identity with the mature polypeptide amino acids 1 to 575 of SEQ ID
NO: 5; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 75% identity with the mature polypeptide amino acids 1 to 565 of SEQ ID NO: 40;
(b) a polynucleotide having at least 60% identity with nucleotides 55 to 2189 of
SEQ ID NO: 4; or
(b1) a polynucleotide having at least 60% identity with nucleotides 55 to 2182 of SEQ ID NO: 39;
(e) a polynucleotide having at least 60% identity with nucleotides 55 to 1725 of SEQ ID NO: 6; or
(f) a polynucleotide having at least 60% identity with nucleotides 55 to 1749 of SEQ ID NO: 41;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2189 of SEQ ID NO: 4, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1725 of SEQ ID NO: 6, or (iii) a complementary strand of (i) or (ii); or
(d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 55 to 2182 of SEQ ID NO: 39, or (ii) which hybridizes under at least medium stringency conditions with the cDNA sequence contained in nucleotides 55 to 1749 of SEQ ID NO: 41, or (iii) a complementary strand of (i) or (ii).
38. A polynucleotide encoding polypeptides having glucoamylase activity, selected from
the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence
which has at least 60% identity with the mature polypeptide amino acids 1 to 556 of SEQ ID
NO: 26; or
(a1) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 548 of SEQ ID NO: 24; or
(a2) a polynucleotide encoding a polypeptide having an amino acid sequence which has at least 60% identity with the mature polypeptide amino acids 1 to 523 of SEQ ID NO: 43;
(e) a polynucleotide having at least 60% identity with nucleotides 117 to 2249 of SEQ ID NO: 23; or
(f) a polynucleotide having at least 60% identity with nucleotides 52 to 1719 of SEQ ID NO: 25; or
(g) a polynucleotide having at least 60% identity with nucleotides 52 to 1620 of SEQ ID NO: 42;
(d) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with nucleotides 117 to 2249 of SEQ ID NO: 23, or (ii) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1620 of SEQ ID NO: 42, or (iii) a complementary strand of (i) or (ii), or
(d1) a polypeptide which is encoded by a nucleotide sequence (i) which hybridizes under at least low stringency conditions with the cDNA sequence contained in nucleotides 52 to 1719 of SEQ ID NO: 25, or (iii) a complementary strand of (i) or (ii).
39. A process for producing a fermentation product from starch-containing material
comprising the steps of:
(d) liquefying starch-containing material in the presence of an alpha-amylase;
(e) saccharifying the liquefied material obtained in step (a) using a glucoamylase of any of claims 1-29;
(f) fermenting the saccharified material using a fermenting organism.

46. The process of claim 39, wherein the fermentation product is recovered after fermentation, preferably by distillation.
47. The process of claim 39 or 40, wherein the step (b) and (c) are carried out sequentially or simultaneously (i.e., SSF process).

48. i he process of any of claims 39-41, wherein the fermentation product is ethanol
49. The process of any of claims 39-42, wherein the starch-containing starting material is whole grains, preferably whole corn or wheat grains.
50. The process of any of claims 39-43, wherein the fermenting organism is a strain of Saccharomyces.
51. The process of any of daims 39-44, further comprising, prior to the step (a), the steps of:
x) reducing the particle size of starch-containing material;
y) forming a slurry comprising the starch-containing material and water.
49. The process of claim 45, wherein the slurry is heated to above the gelatinization temperature.
50. The process of claim 45, wherein the slurry is jet-cooked at a temperature between 95-140°C, preferably 105-125°C, for 1-15 minutes, preferably for 3-10 minute, especially around 5 minutes.
51. A process for producing a fermentation product from starch-containing material comprising:
(a) saccharifying starch-containing material with a glucoamylase of any of claims 1-29, and/or having
i) the sequence shown as amino acids 1 to 556 in SEQ ID NO: 2 or amino
acids 1 to 561 in SEQ ID NO: 37, or a glucoamylase having at least 75% identity thereto, and/or
ii) the sequence shown as amino acids 1 to 575 in SEQ ID NO: 5 or amino acids 1 to 565 in SEQ ID NO: 40, or a glucoamylase having at least 70% identity thereto, and/or
iii) the sequence shown as amino acids 1 to 548 in SEQ ID NO: 24 or amino acids 1 to 556 in SEQ ID NO: 26 or amino acids 1 to 523 in SEQ ID NO: 43, or a glucoamylase having at least 60% identity thereto,
at a temperature below the initial gelatinization temperature of said starch-containing material.

(b) fermenting using a fermenting organism.
78. The process of claim 48, wherein the process is carried out for a period of 1 to 250 hours, preferably is from 25 to 190 hours, more preferably from 30 to 180 hours, more preferably from 40 to 170 hours, even more preferably from 50 to 160 hours, yet more preferably from 60 to 150 hours, even yet more preferably from 70 to 140 hours, and most preferably from 80 to 130 hours.
79. The process of claim 48 or 49, wherein the process is carried out at a pH in the range between 3 and 7, preferably from 3.5 to 6, or more preferably from 4 to 5.
80. The process of any of claims 48-50, wherein the dry solid content (DS) lies in the range from 20-55 wt.-%, preferably 25-40 wt.-%, more preferably 30-35 wt-%.
81. The process of claims 48-51, wherein the sugar concentration is kept at a level below about 6 wt. % during saccharification and fermentation.
82. The process of any of claims 48-52, wherein a slurry comprising water and starch-containing material is prepared before step (a).
83. The process of any of claims 48-53, wherein the starch-containing material is prepared by reducing the particle size of starch-containing material to a particle size of 0.1-0.5 mm.
84. The process of any of claims 48-53, wherein the reduction of particle size of the starch-containing material is done by milling.
85. The process of any of claims 48-55, wherein the starch-containing material is granular starch.
86. The process of any of claims 48-55, wherein the starch-containing material is whole grains.
87. The process of any of claims 48-57, wherein the saccharification and fermentation is carried out simultaneously.

88. The process of ciaim 58, wherein the temperature during simultaneous saccharification and fermentation, or fermentation in step (b) is between 28°C and 36°C, such as between 29°C and 35°C, such as between 30CC and 34CC, such as around 32°C.
89. The process of any of claims 48-59, wherein the glucoamylase is present in an amount of 0.001 to 10 AGU/g DS, preferably from 0.01 to 5 AGU/g DS, especially 0.1 to 0.5 AGU/g DS.
90. The process of any of claims 48-60, wherein an alpha-amylase is present.
91. The process of claim 61, wherein the alpha-amylase is a fungal alpha-amylase, preferably derived from the genus Aspergillus, especially a strain of A niger, A. oryzae, A. awamori, or Aspergillus kawachii, or of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
92. The process of claim 62, wherein the fungal alpha-amylase is a hybrid enzyme comprising an alpha-amylase catalytic domain (CD) and a carbohydrate-binding module/domain (CBM) and optionally linker or a wild-type fungal acid alpha-amylase catalytic domain (CD) and a carbohydrate-binding module (CBM) and optionally a linker.
93. The process of claim 63, wherein the hybrid alpha-amylase is selected from the group of Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO: 29), Meripilus giganteus alpha-amylase with Athelia rolfsii glucoamylase linker and SBD (SEQ ID NO: 30).
94. The process of claim 63, wherein the hybrid alpha-amylase is Aspergillus niger alpha-amylase with Aspergillus kawachii linker and starch binding domain (SBD).
95. The process of any of claims 61-64, wherein the alpha-amylase is present in an amount of 0.01 to 10 AFAU/g DS, preferably 0.1 to 5 AFAU/g DS, especially 0.3 to 2 AFAU/g DS.
96. The process of any of claims 48-66, wherein the alpha-amylase and glucoamylase is added in a ratio of-between 0.1 and 10 AGU/AFAU, preferably 0.30 and 5 AFAU/AGU, especially between 0.5 and 3 AFAU/AGU.

97. The process of any of claims 48-67, wherein another glucoamyiase is also added.
98. The process of claim 68, wherein the other glucoamyiase is selected from the group consisting of Aspergillus niger glucoamyiase, Athelia rolsii glucoamyiase, and Talaromyces emersonii glucoamyiase, or a mixture thereof.
99. The process of any of claims 48-69, wherein the fermentation product is recovered after fermentation.
100. The process of any of claims 48-70, wherein the fermentation product is an alcohol, preferably ethanol, especially fuel ethanol, potable ethanol and/or industrial ethanol.
101. The process of any of claims 48-71, wherein the starch-containing material is obtained from tubers, roots, stems, fruits, seeds or whole grain.
102. The process of any of claims 48-72," wherein the starch-containing material is obtained from com, cobs, wheat, barley, rye, milo, sago, cassava, manioc, tapioca, sorghum, rice or potatoes.
103. The process of any of claims 48-73, wherein the starch-containing material is granular starch.
104. The process of any of claims 48-74, wherein the temperature during saccharification in step (a) is from 30°C to 75°C, preferably between 45 and 60°C.
105. The process of any of claims 48-75, wherein step (a) and (b) is carried out sequentially or simultaneously (i.e., one-step fermentation)
106. A process of producing syrup from starch-containing material, comprising

(c) liquefying starch-containing material in the presence of an alpha-amylase,
(d) saccharifying the material obtained in step (a) using a glucoamyiase of any of claims 1 to 29.
78. The process of claim 77, further comprising refining, conversion and/or recovery of
the syrup.

81. Use of a giucoamylase of any of claims 1-29 for production of syrup and/or a fermentation product.
82. Use of claim 79, wherein the starting material is gelatinized or un-geiatinized starch-containing material.
81. . Use of a giucoamylase of any of claims 1-29 for brewing.
88. A composition comprising a giucoamylase of any of claims 1-29.
89. The composition of claims 82, further comprising an alpha-amylase.
90. The composition of claims 83, wherein the alpha-amylase is an acidic alpha-amylase, preferably a fungal acidic alpha-amylase.
91. The composition of claim 83 or 84, wherein the alpha-amylase is of fungal origin.
92. The composition of any of claims 83-85, wherein the alpha-amylase is derived from the genus Aspergillus, preferably a strain of'A. niger, A. oryzae, Aspergillus awarnori, or A. kawachii, of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
93. The composition of any of claims 83-85, wherein the alpha-amylase is a hybrid, preferably Fungamyl variant with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 28), Rhizomucor pusillus alpha-amylase with Athelia rolfsii AMG linker and SBD (SEQ ID NO; Sty* Meripilus giganteus alpha-amylase with Athelia rolfsii giucoamylase linker and SBD (SEQ ID NO: 30).
88 The composition of any of claims 82-87, further comprising another giucoamylase.
89. The composition of claim 88, wherein the giucoamylase is derived from the genus Aspergillus, preferably a strain of Aspergillus niger, Aspergillus oryzae, Aspergillus awarnori, or the genus Athelia, preferably a strain of Athelia rolfsii, the genus Talaromyces, preferably a strain the Talaromyces emersonii, or the genus Rhizopus, such as a strain of Rhizopus nivius, or of the genus Humicola, preferably a strain of Humicola grisea var. thermoidea.

90. The composition of claim 88 or 89, comprising glucoamyiase derived from Trametes
cingulata glucoamyiase, alpha-amylase derived from Rhizomucor pusillus alpha-amylase
with Athelia rolfsii AMG linker and SBD, and glucoamyiase derived from Talaromyces
emersonii.
91. The composition of claim 88 or 89, comprising glucoamyiase derived from Trametes
cingulata, alpha-amylase derived from Rhizomucor pusillus alpha-amylase with Athelia rolfsii
AMG linker and SBD, and glucoamyiase derived from Aspergillus niger.


Documents:

2714-CHENP-2007 AMENDED CLAIMS 18-03-2011.pdf

2714-CHENP-2007 AMENDED PAGES OF SPECIFICATION 18-03-2011.pdf

2714-CHENP-2007 EXAMINATION REPORT REPLY RECEIVED 18-03-2011.pdf

2714-chenp-2007 form-3 18-03-2011.pdf

2714-chenp-2007 form-3 24-03-2011.pdf

2714-CHENP-2007 OTHER PATENT DOCUMENT 18-03-2011.pdf

2714-CHENP-2007 POWER OF ATTORNEY 18-03-2011.pdf

2714-chenp-2007 power of attorney 25-03-2011.pdf

2714-CHENP-2007 CORRESPONDENCE 27-09-2010.pdf

2714-chenp-2007 correspondence others 25-03-2011.pdf

2714-chenp-2007 correspondence others 24-03-2011.pdf

2714-chenp-2007-abstract.pdf

2714-chenp-2007-claims.pdf

2714-chenp-2007-correspondnece-others.pdf

2714-chenp-2007-description(complete).pdf

2714-chenp-2007-drawings.pdf

2714-chenp-2007-form 1.pdf

2714-chenp-2007-form 3.pdf

2714-chenp-2007-form 5.pdf

2714-chenp-2007-pct.pdf


Patent Number 248453
Indian Patent Application Number 2714/CHENP/2007
PG Journal Number 29/2011
Publication Date 22-Jul-2011
Grant Date 15-Jul-2011
Date of Filing 21-Jun-2007
Name of Patentee NOVOZYMES NORTH AMERICA, INC.
Applicant Address 77 PERRY CHAPEL CHURCH ROAD, FRANKLINTON, NORTH CAROLINA 27525, USA
Inventors:
# Inventor's Name Inventor's Address
1 UDAGAWA, HIROAKI 1-2-5, ISEZAKI-CHO, NAKOHAMA-SHI, YOKOHAMA-SHI 231-0045, JAPAN
2 LANDVIK, SARA PLANTAGEKROGEN 8, DK-2950VEDBAEK, DENMARK
3 IHARA, MICHIKO #201, 4-9-43, MAKUHARIHONGO, HANAMIGAWA-KU, CHIBA 262-0033, JAPAN
4 LIU, JIYIN 9520 CANDOR OAKS DRIVE, RALEIGH, NC 27615, USA
5 SOONG, CHEE-LEONG 2510 GARDEN HILL DRIVE, APT. 303, RALEIGH, NORTH CAROLINA 27614, USA
6 ALLAIN, ERIC 873 FAIRWAY DRIVE, BOONE, NORTH CAROLINA 28607, USA
7 FUKUYAMA, SHIRO FUJISAKI 5-11-4, NARASHINO-SHI, CHIBA 275-0017, JAPAN
PCT International Classification Number C12P 7/06
PCT International Application Number PCT/US05/46724
PCT International Filing date 2005-12-22
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 60/638,614 2004-12-22 U.S.A.
2 60/650,612 2005-02-07 U.S.A.