Title of Invention

A PURIFIED PROTEIN COMPRISING PHOSPHODIESTE-RASE(PDE) CATALYTIC DOMAIN OR LEISHMANIA-PED-B1 AND USES THEREOF

Abstract The present invention relates to novel amino acid and nucleric amino acid add nucleic acid sequences of cyclic nuclentide-Specific phos-phodiesterses from the parsite Lelskmmifa major. The invention also relales let nucleic acid consumers, vectors, and host cells comprising the nucleic acid sequences as we'll as method for producing and using the amino acid and nucleic and sequences. The invention further relates to the use of these sequences , and of antibodies directed against these.sequences, in the diagnosis treat-ment of disoorders to the infection of Lalstmonio major; including the identification of compounds than form complexes with the polypeptides and nuclelc acids of the present invention.
Full Text WO 2005/023856 PCT/TB2004/003990
Cyclic Nucleotide-Specific Phosphodiesterases
from Leishmania and Uses Thereof
FIELD OF THE INVENTION
[001] We claim priority to U.S. Provisional Application Nos.
60/500,244 (filed September 5,2003). 60/504,070 (filed September 19, 2003),
and 60/582,584 (filed June 25, 2004), which are incorporated herein by
reference.
[002] The present invention relates to novel amino acid and nucleic
acid sequences of cyclic nucleotide-specific phospnodiesterases from a
parasite in the Leishmania family, such as Leishmania major. The invention
also relates to nucleic acid constructs, vectors, and host cells, comprising the
nucleic acid sequences as well as methods for producing and using the amino
acid and nucleic acid sequences. The invention further relates to the use of
these sequences, and of antibodies directed against these sequences, in the
diagnosis end treatment of disorders related to the infection of Leishmania,
such as Leishmania major, including the identification of compounds that form
complexes with the polypeptides and nucleic acids of the present invention.
BACKGROUND OF THE INVENTION
[003] Leishmania major is one of several Leishmania parasites that,
when introduced into a host organism, is the causative agent of leishmaniasis.
Leishmania major is a species of the Leishmania tropica complex. Other
complexes (comprising species and subspecies) include Leishmania
donovani, Leishmania mexicana, and Leishmania viannia. According to the
World Health Organisation, leishmaniasis is among the most infectious
diseases worldwide and is endemic in 85 countries in Africa, Asia, Europe,
and in North and South America. It has been estimated that over 12 million
people suffer from Leishmanial infections worldwide, where serious public
-1-

WO 2005/023856 PCT/TB2004/003990
health problems exist particularly in countries such as Iran, Iraq, Afghanistan,
Algeria, Brazil, India, Peru, and Syria, Leishmaniasis most commonly
manifests itself as either cutaneous (i.e. skin) leishmanlasis (CL) or visceral
(i.e. internal organs) leishmaniasis (VL). CL is the most common form of
leishmaniasis and is the result of transmission of the parasite Leistimania
msjor via the bite of an infected female phlebotomine sandfly. Symptoms of
CL include large skin legions or ulcers on exposed parts of the body, which
cause senous disability and permanent scarring.
[004] Methods of treating leishmaniasis have typically been limited to
administering pentavalent antimony (Sbv) (Sundar et al. (2002) Curr. Opin.
Infect. Dis. 15, 593-598). Due to the recent emergence of large-scale
resistance to Sbv, however, the effectiveness of this treatment is becoming
increasingly limited. Furthermore, Sbv treatment has several side effects
including nausea, vomiting, diarrhea, and convulsions. In addition, HIV co-
infection with Leishmania species presents further challenges since such co-
infection can dramatically alter the epidemiology, diagnosis, and response of
leishmamasis to therapy (Lee et al. (2003) Int. J. Infect. Dis. 7,86-93).
SUMMARY OF THE INVENTION
[005] The invention provides novel Leishmania cyclic nucleotide-
specific phosphodiesterase (LmPDE) polypeptides and nucleic acid molecules
thereof that are useful in the diagnosis and treatment of leishmaniasis. The
polypeptides of the present invention also include antibodies that recognize
and bind to LmPDE polypeptides. The nucleic acid molecules of the invention
also include peptide nucleic acids (PNA), and antisense molecules that react
with the nucleic acid molecules of the invention.
[006] In one embodiment, the invention provides full-length, novel
phosphodiesterases (PDEs) from the parasite Leishmania major, designated
LmPDE-A, LmPDE-B1, and LmPDE-B2, including the polypeptide molecules,
corresponding nucleic acid molecules, and fragments thereof.
-2-

WO 2005/023856 PCT/TB2004/003990
[007] The present invention also encompasses various nucleotide and
amino acid sequences that represent different forms and fragments of the
LmPDE genes, transcripts, and proteins, such as conservatively mutated
proteins, different allelic forms, polymorphic forms, alternative precursor
transcripts and mature transcripts. Additionally, recombinant nucleic acid
molecules that are codon usage variants of the novel LmPDE sequences are
provided. The invention encompasses LmPDE from Leishmania major, as
well as other Leishmania species and subspecies of the complexes
Leishmania lropica, Lelshmania dohovani, Leishmania mexicana, and
Leishmania viannia.
[008] The present invention further provides recombinant nucleic acid
molecules that encode wild type or mutant sequences of LmPDE polypeptides
that maintain PDE biological activity. These include naturally-occurring and
synthetic mutants, as well as semi-synthetic and recombinant polypeptides.
[009] The present invention also includes the polynucleotides
encoding LmPDEs in recombinant expression vectors and host-vector
systems that include the expression vectors. One embodiment provides
various host cells transformed with recombinant vectors that include the
LmPDE nucleotide sequences of the invention. The invention also provides
genetically modified organisms comprising a vector containing a recombinant
LmPOE sequence wherein at least one endogenous LmPDE gene has been
disabled.
[010] The present invention further provides methods for using
substantially purified LmPDE polypeptides to identify compounds that
modulate the expression or activity of LmPDEs.
[011] The present Invention also provides methods for using LmPDE
nucleotide sequences as nucleic acid probes and primers, and for using
LmPDE polypeptides as anligens for the production of novel anti-LmPDE
antibodies. The LmPDE probes and primers, and the anti-LmPDE antibodies
are useful in diagnostic assays and kits for the detection of naturally occurring
LmPDE nucleotide and protein sequences present in biological samples.
-3-

WO 2005/023856 PCT/TB2004/003990
[012] Additional objects and advantages of the invention will be set
forth in part in the description which follows, and in part will be obvious from
the description, or may be learned by practice of the invention. The objects
and advantages of the invention will be realized and attained by means of the
elements and combinations particularly pointed out in the appended claims.
Moreover, advantages described in the body of the specification, if not
included in the claims, are not per se limitations to the claimed invention.
[013] The publications discussed herein are provided solely for their
disclosure prior to the filing date of the present application. Nothing herein is
to be construed as an admission that the present invention is not entitled to
antedate such publication by virtue of prior invention. Further, the dates of
publication provided may be different from the actual publication dates which
may need to be independently confirmed.
BRIEF DESCRIPTION OF THE DRAWINGS
[014] Figure 1 shows the deduced amino acid sequence of a full-
length LmPDE-A polypeptide (SEQ ID NO: 1).
[015] Figures 2A-2S show the DNA sequence (SEQ ID NO: 2) for the
full-length gene of LmPDE-A. The open reading frame begins with adenine at
position 530 and ends with guanine at position 2425.
[016] Figures 3A-3B show the deduced amino acid sequence of a full-
length LmPDE-B1 polypeptide (SEQ ID NO: 3).
[017] Figures 4A-4L show the DNA sequence (SEQ ID NO: 4) for the
full-length gene of LmPDE-B1. The open reading frame begins with adenine
at position 1267 and ends with adenine at position 4059.
[018] Figures 5A-B show the deduced amino acid sequence of a full-
length LmPDE-B2 polypeptide (SEQ ID NO: 5).
[019] Figures SA-6L show the DNA sequence (SEQ ID NO: 6) for the
full-length gene of LmPDE-B2. The open reading frame begins with adenine
at position 2182 and ends with adenine at position 5004.
-4-

WO 2005/023856 PCT/TB2004/003990
[020] Figures 7A, 7B, and 7C show the location of conserved domains
that are found in the LmPDE-A, LmPDE-B1, and LmPDE-B2 polypeptide
sequences, respectively.
[021] Figure 8 shows the results of a Southern blot analysis for
LmPDE-B1 using a conserved region of the LmPDE-B1 sequence as the
hybridization probe.
[022] Figure 9 shows the results of a Southern blot analysis for
LmPDE-B2 using a conserved region of the LmPDE-B2 sequence as the
hybridization probe.
[023] Figure 10 shows the results of a Southern blot analysis using a
conserved region that was specific to both LmPDE-B1 and LmPDE-B2 as the
hybridization probe.
[024] Figure 11 shows a schematic drawing of the location of the
LmPDE-B1 and LmP0E-B2 loci and their approximate relative locations on
chromosome 15.
[025] Figures 12A, 12B, 12C, and 12D show the heat-shock test
results of PDE-deficient Sacctiaromyces cerevisiae cells that have been
transfected with LmPDE-B1 and LmPDE-A.
[026] Figures 13A, 13B, and 13C show the Michaelis-Menten kinetics
of recombinant LmPDE-B1-mediated hydrolysis of cAMP. Figures 13A and
13B show the hydrolysis of cAMP in the absence and presence of a 100-fold
excess of cGMP, respectively. Figure 13C shows the effect of a 50-fold
excess of AMP. The figure insets depict the corresponding Eadie-Hofstee
plots.
[027] Figures 14A and 14B show the effect of various PDE inhibitors
on LmPDE-B1 and LmPDE-B2, respectively, in the presence of 1 mM cAMP
and 100 mM of cilostamide (A), zaprinasl (B), etazolate (C), dipyridamole (D).
Ro-20-1724 (E), rolipram (F), isobutylmethylxanthine (IBMX) (G), B-
methoxymethyl-1BMX (H), trequinsin (1), papaverine (K), milrinone (L),
petoxifylline (M), and erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA) (N).
Figures 14C and 14D show representative dose-response profiles of
trequinsin against LmPDE-B1 and LmPDE-B2, respectively.
-5-

WO 2005/023856 PCT/TB2004/003990
[023] Figure 15 shows the inhibition of L major promastigote
proliferation in the presence of increasing concentrations of dipyridamote (A),
etasolats (B), and trequinsin (C).
DEFINITIONS
[029] The term "amino acid sequence" refers to amino acids
encoding an ollgopeptide, peptide, polypeptide, or protein sequence, and
fragments thereof, and includes naturally occurring or synthetic molecules.
[030] The term "antibody" refers to intact molecules as well as
fragments thereof (e.g., Fab), which can bind an antigenic determinant on an
antigen (e.g., an antigenic determinants) on a LmPDE). The antibody can be
"polyclonal", "monoclonal', "chimeric", "humanized", or human.
[031] The term "anligenic determinant" refers to that fragment of a
molecule (i.e., an epitcpe) that induces an antibody and which thereafter
makes contact with a particular antibody. When a protein or fragment of a
protein is used to immunize a host animal, numerous regions of the protein
may induce the production of antibodies which bind specifically to a given
region or three-dimensional structure on the protein; these regions or
structures are referred to as antigenic determinants. An antigenic determinant
may compete with the intact antigen (i.e., the immunogen used to elicit the
immune response) for binding to an antibody.
[032] The term "antisense" refers to any composition containing
nucleotide sequences which are complementary to a specific DNA or RNA
sequence.
[033] The term "antisense strand' is used in reference to a nucleic
acid strand that is complementary to the "sense" strand. Antisense molecules
include nucleic acids (that can include modified nucleotide base and modified
sugar moieties) and may be produced by any method including synthesis or
transcription. Once introduced into a cell, the complementary nucleotides
combine with natural sequences produced by the cell to form duplexes and
block either transcription or translation of the sequences.
-6-

WO 2005/023856 PCT/TB2004/003990
[034] The term "biological sample" ia ussd in its broadest sense. A
biological sample is suspected of containing LmPDE nucleic acid molecules,
or fragments thereof, or a LmPDE polypeptide. The suitable biological
sample can be from an animal or a human. The sample can be a cell sample
or a tissue sample, including samples from spleen, lymph node, thymus, bone
marrow, liver, heart, testis, brain, placenta, lung, skeletal muscle, kidney, and
pancreas. The sample can be a biological fluid, including urine, blood sera,
blood plasma, phlegm, or lavage fluid. Alternatively, the sample can be a
swab from the nose, ear, or throat.
[035] The term "biologically active" refers to a polypeptide having
structural, regulatory, or biochemical functions of a naturally occurring
molecule. Likewise, "immunologically active" refers to the capability of the
natural, recombinant, or synthetic LmPDEs of the invention, or any fragment
thereof, to induce a specific immune response in appropriate animals or cells
and to bind with specific antibodies. For example, the polypeptides of the
invention can elicit antibodies that specifically bind an epitope associated with
a LmPDE polypeptide of the invention. Accordingly, a LmPDE polypeptide is
capable of inducing a specific Immune response in appropriate animals or
cells, and/or binding with ligands such as specific antibodies.
[036] The term "catalytic domain" refers to a conserved subset of
amino acids within a PDE sequence that is responsible for catalyzing the
hydrolysis reaction of the bound substrate.
[037] The term "chimeric antibody" refers to an antibody in which the
variable regions derived from one species are combined with the constant
regions of an antibody derived from a different species. Chimeric antibodies
are useful, as they are less likely to be antigenic to a human subject than
antibodies with non-human constant regions and variable regions. The
antigen combining region (variable region) of a chimeric antibody can be
derived from a non-human source (e.g. murine) and the constant region of the
chimeric antibody, which confers biological effector function to the
immunoglobulin, can be derived from a human source (Morrison et al. (1985)
Proc. Nalt. Acad. Sci. U.S.A. 81,6851; Takeda et al. (1985) Nature 314,452;
-7-

WO 2005/023856 PCT/TB2004/003990
Cabilly et a., U.S. Pal. No. 4,816,567; Boss et al., U.S. Pat No. 4,816,397).
The chimeric antibody may have the antigen binding specificity of the
nonhuman antibody molecule and the effector function conferred by the
human antibody molecule.
[038] The term "complementary" refers to nucleic acid molecules
having purine and pyrimidine nucleotides which have the capacity to
associate through hydrogen bonding to form double stranded nucleic acid
molecules. The following base pairs are related by complementarity: guanine
and cytosine; adenine and thymine; and adenine and uracil. The term
"complementary" applies to all base pairs comprising two single-stranded
nucleic acid molecules, or to all base pairs comprising a single-stranded
nucleic acid molecule folded upon itself. Complementarity between two
single-stranded molecules may be partial, in which only some of the nucleic
acids bind, or it may be complete when total complementarity exists between
the single stranded molecules. The degree of complementarity between
nucleic acid strands has significant effects on the efficiency and strength of
hybridization between nucteic acid strands.
[039] The term "control cell" is a cell that is generally the same, e.g.,
genotypically and phenotypically, as the cell to which it is being compared
(e.g., the cells can be sister cells), but which is not exposed to a test
compound.
[040] The term "expression control sequence" or "expression
control element" refers to a regulatory polynucleotide sequence that can
direct the transcription and translation of an open reading frame. Expression
control elements are known in the art and include, but are not limited to,
inducible promoters, constitutive promoters, splice donor and acceptor sites,
secretion signals, enhancers, transcription terminators, and other
transcriptional regulatory elements. Other expression control elements that
are involved in translation are known in the art, and include the Shine-
Dalgarno sequence, and initiation and termination codons.
[041] The term "fragment" of a LmPOE polypsptide refers to a portion
of a LmPDE polypeplide. For example, a LmPDE fragment can be a
-6-

WO 2005/023856 PCT/TB2004/003990
polypeptide with fewer amino acids than a full-length LmPDE, but having the
biological activity of a full-length LmPDE-A, LmPDE-B1, or LmPDE-B2
polypeptide, e.g., the ability to hydrolyze cAMP. A fragment can also be a
portion of a LmPDE polypeptide that elicits an immune response, or that
possesses any other biological or diagnostic property of the full-length
LmPDEs of the invention.
[042] The term "fragment" of a LmPDE nucleic acid molecule refers to
a portion of a full-length LmPDE nucleotide sequence. For example, such a
nucleic acid fragment can encode a LmPDE polypeptide fragment that
maintains the biological activity of a full-length LmPDE-A, LmPDE-B1, or
LmPDE-B2 polypeptide, e.g., the ability to hydroiyze cAMP (as determined by
methods known in the art, e.g., Schilling et al. (1994) Anel. Biochem. 216,
154-158).
[043] The term "GAF domain" refers to a highly conserved domain
that binds smalt molecular weight ligands. The GAF domain in some PDEs is
known to bind cGMP.
[044] The term "humanized antibody" refers to an antibody molecule
in which amino acids have been repiaced in the non-antigen binding regions
in order to more closely resemble a human antibody, while still retaining the
original binding ability. As used herein, a humanized LmPDE antibody is an
irnmunogiochulin molecule that is capable of binding to a LmPDE polypeptide
and has variable regions with substantially the same amino acid sequence as
a human immunoglobulin, and has a hyper-variable region with substantially
the same armino acid sequence as a non-human immunoglobutin.
[045] The term "hybridization" or "hybridize" refers to any process by
which a sequence of nucleic acids binds with a complementary strand through
base pairing.
[046] The term "hydrolyze" refers to a chemical reaction wherein a
chemical bond is cleaved via a water molecule. The catalytic function of
LmPDEs of the invention, as with all PDEs, involves the hydrolysis of cAMP
(as determined by methods known in the art, e.g., Schilling et al. (1994) Anal.
Biochem. 216, 154-158).
-9-

WO 2005/023856 PCT/TB2004/003990
[047] As used herein, a first amino acid of nucleotide sequence is said
to be "identical" to a second reference amino acid or nucleotide sequence,
respectively, when a comparison of the first and the second sequences are
exactly alike. Two sequences are said to be "X% identical" when a
comparison of the first and second sequences have X% of nudeotides or
amino acids that are exactly alike. Percent identity can be determined
electronically, e.g., by using the MEGALIGH program (DNASTAR) which
creates alignments between two or more sequences according to methods
selected by the user, e.g., the clustal method e.g., Higgins et al. (1938) Gene
73:237-244). Percent identity between sequences can also be counted or
calculated by other methods known in the art (e.g., Hein (1990) Methods
Enzymol. 183:626-645). Identity between sequences can also be determined
by other methods Known in the art, e.g., by varying hybridization conditions.
[048] The term "incubate" refers to a process of contacting a cell or a
cell culture with the compound of interest, or otherwise introducing the
compound of interest into a cell.
[049] The term "inhibitor" refers to an agent which, when bound to a
LmPDE, or to some other polypeptide or nucleic acid, decreases the amount
(expression) or the biological activity of a LmPDE. Inhibitors may include
proteins, nucleic acids, carbohydrates, antibodies of any other molecules
which decrease the amount (expression) or biological activity of LrnPDEs
present in a sample. The preferred inhibitor will selectively inhibit the
biological activity of a LmPDE, while not affecting any other cellular proteins.
[050] The term "isolated" or "purified" refers to a specific nucleic
acid, protein, or polypeptide, or a fragment thereof, in which contaminants
(i.e., substances that differ from the specific nucleic acid, protein, or
polypeptide molecule) have been separated or substantially separated from
the specific nucleic acid, protein, or polypeptide.
[051] The term "LmPDE" means any of LmPDE-A, LmPDE-B1, or
LmPDE-B2, and cars refer to the polypeptide or nucleic acid sequences,
LmPDE porypeplides can be natural, synthetic, semi-synthetic, or
recombinant. LmPDE includes polypeptides from Leishmania major, as well
-10-

WO 2005/023856 PCT/TB2004/003990
as other Leishmania species and subspecies from the complexes Leishmania
tropica, Leishmania donovani, Leishmania mexicana, and Leishmania viannia
including Leishmania aethiopica, Leishmania brasiliensis, Leishmania d.
donovani, Leishmania d. infantum, Leishmania d. enagasi, Leishmanis
gamhaipi, Leishmania m. mexicana, Leishmania m. amazonensis, and
Leishmania pifanot.
[052] The term "LmPDE-A nucleic acid molecule" refers to a nucleic
acid molecule that encodes a LmPDE-A polypeptide.
[053] The term "LmPDE-B1 nucleic acid molecule" refers to a
nucleic acid molecule that encodes a LmPDE-B1 polypeptide.
[054] The term "LmPDE-B2 nucleic acid molecule" refers to a
nucleic acid molecule that encodes a LmPDE-B2 polypeptide.
[055] The term "LmPDE expression" refers to the process whereby a
RNA transcript or translated polypeptide is produced from a LmPDE
nucleotide sequence.
[056] The term "modulates" refers to a change in the activity of ihe
LmPDEs of the present invention. For example, modulation may cause an
increase or a decrease in protein amount (expression) or activity, binding
characteristics, or any other biological, functional or immunological properties
of the LmPDEs of the invention.
[057] The term "nucleic acid sequence" or "nucleic acid molecule"
refers to an oligonucleotide, nucleotide, or polynucleotide, and fragments
thereof; to DNA or RNA of genomic or synthetic origin, which may be single-
or double-stranded; and represents the sense or antisense strand.
[058] The term "operably linked" refers to functionally related nucleic
acid sequences. For example, a promoter is operably linked with a coding
sequence if the promoter controls the translation of the encoded polypeptide.
While operably linked nucleic acid sequences can be contiguous and in the
same reading frame, certain genetic elements, e.g., represser genes, are not
contiguously linked to the sequence encoding the polypeptide but still bind to
operator sequences that control expression of the polypeptide.
-11-

WO 2005/023856 PCT/TB2004/003990
[059] The term "PDEase domain" refers to the conserved catalytic
domain of PDES.
[060] The term "stringent conditions" refers to conditions which
permit hybridization between complementary polynucleotide sequences.
Suitably-stringent conditions can be defined by, for example, the
concentrations of salt and/or formamide in the pre-hybridization and
hybridization solutions, or by the hybridization temperature, which are well
known in the art. In particular, stringency can be increased by reducing the
concentration of salt, increasing the concentration of formamide, or raising the
hybridization temperature.
[061] The term "substantially purified' refers to nucleic acid or
polypeptide sequences that are removed from their natural environment and
are isolated or separated, and are at least 60% free, 65% free, 70% free, 75%
free, 80% free, 85% free, 90% free, 95% free, 96% free, 97% free, 98% free,
or 99% free from other components with which they are naturally associated.
[062] The term "variants and mutants" refers to changes in a
polypeptide or nucleic acid sequence such as amino acid or nucleotide
substitutions, insertions, deletions, conservative amino acid changes,
polymorphic changes, alletic changes, frame shift changes, truncations, or the
lite, wherein the variant or mutant protein maintains its native function (here,
at least the hydrolysis of cAMP) and wherein the variant or mutant nucleic
add molecule encodes a protein that maintains its native function.
[063] The term "vector" includes, but is not limited to, plasmids,
cosmids, and phagemids.
DETAILED DESCRIPTION OF THE INVENTION
[064] Second messengers such as cyclic adenosine mono-phosphate
(cAMP) and cyclic guanosine mono-phosphate (cGMP) play important
biological roles in modulating the effects of a wide variety of first messengers.
For example, cAMP and cGMP are involved in the propagation of a variety of
extracellular signals that originate from first messengers such as hormones,
-12-

WO 2005/023856 PCT/TB2004/003990
light, and neurotransmitters. The steady stale intracellular levels of cAMP and
cGMP are controlled by their rates of synthesis by cyclases and by their rate
of degradation by cyclic nucleotide-specific phosphodiesterases (PDEs).
[065] PDEs are typically composed of a catalytic domain
(approximately 270 amino acids), an N-terminal regulatory domain
responsible for binding cofactors, and, in some cases, a C-terminal domain of
unknown function. A conserved motif, HDXXHXGXXN, has been found in the
catalytic domain of all PDEs. Several families of PDEs have been identified
(Beavo (1995) Physiol. Rev. 75, 725-748; Soderling et al. (1998) J. Biol.
Chem. 273,15553-15558; and Fisher et al. (1998) J. Biol. Chem. 273, 15559-
15564). PDE families display roughly 35% amino acid sequence identity
within their catalytic domain. Isozymes within the same family typically
display 75-95% sequence identity in this region. Within a family, there is often
greater than 60% sequence identity outside the catalytic domain, whereas
across different PDE families, there is little or no sequence similarity.
[066] In eukaryotes, two distinct classes of PDEs have been identified.
Class I enzymes all show significant smino acid sequence conservation within
their catalytic domains. Class t PDEs include all currently known families of
mammalian PDEs as well as several PDEs from lower eukaryotes such as
PDE2 from Saccharomyces cerevisiae and the regA gene product from
Dictyoslelium discoideum. Class II PDEs, however, share very little amino
acid sequence identity with class I PDEs, and thus likely have a different
evolutionary origin. Furthermore, class II PDEs are often distinguished by
their generally higher KM values (Zoraghi et al. (2001) J. Biol. Cham. 276,
11559-11566). Class II PDEs have been Identified in yeast (Nikawa et al.
(1987) Mol. Cell Biol. 7, 3629-3636), the slime mold Dictyostelium discoideum
(Lacombe et al. (1986) J. Biol. Chem. 261, 16811-16617). Vibrio fisheri
(Dunlap et al. (1993) J. Bactenol. 175, 4615-4624), and Candida albicans
(Hoyer et al. (1994) Microbiology 140, 1533-1542).
[067] A variety of diseases are thought to result from decreased levels
of cyclic nueleotides due to increased PDE activity. Accordingly, PDEs have
become highly attractive drug targets over the last several years. A growing
-13-

WO 2005/023856 PCT/TB2004/003990
number of family-specific and subtype-specific PDE inhibitors are being
developed as therapeutic agents for a wide range of diseases such as
autoimmune disease (Bielekova et al. (2000) J. Immunol, 164,1117-1124),
arthritis (Kiely et al. (1395) Eur. J. Immunol. 25, 2889-2906), asthma (Bametie
(1999) Prog. Drug Res. 53, 133-229), inflammatory diseases [Barnes (2001)
Novartis found. Symp. 234, 255-267) impotency (Langtry et al. (1999) Drugs
57, 967-S89) and cancer (Marko et al. (2000) Chem. Res. Toxicol. 10. 944-
948). So far, there is limited information about PDEs in kinetoplastids such as
Leishmania major.
Polypeptides of the Invention
[068] One aspect of the present invention is directed to novel, isolated
PDF polypeptides from the parasite Leishmanis major, designated LmPDE-A
(SEQ ID NO: 1). LmPDE-B1 (SEQ ID NO: 3), and LmPDE-B2 (SEQ ID NO:
5). Particular embodiments of the LmPDE polypeplides of the invention
include full-tength LmPDE-A, LmPDE-Bl, and LmPDE-B2 from Leishmania
major. In another aspect, the invention relates to fragments of LmPDEs. The
invention also provides polypeptides comprising biologically and/or
immunologically active fragments of LmPDEs.
[069] The present invention also relates to variants and mutants of
LmPDEs. Mutant alleles of LmPDEs encode mutant forms of LmPDE
polypeptides having at least one amino acid substitution, insertion, deletion,
truncation, or frame shift. Such mutant forms of polypeptides may not exhibit
the same biological activity as witd-type proteins (e.g., they may have less
PDE activity or an activity not normally found in LmPDE polypeptides, such
as, for example, not functioning as a PDE).
[070] Another variant of LmPDE polypeptides may have amino acid
sequences that differ by one or more amino acid substitutions. The variant
may have conservative amino acid changes, where a substituted amino acid
has similar structural or chemical properties. Amino acid residues that can be
conservatively substituted for one another include, but are not limited to:
-14-

WO 2005/023856 PCT/TB2004/003990
glycine/alanine; valine/isateucine/leucine; asparagine/glutamine; aspartic
acid/glutamic acid; serine/threonine; lysine/arginine; and
phenylalanine/tyrosine. Other substitutions can also be considered
conservative, depending on the environment of the particular amino acid and
its role in the three-dimensional structure of the protein. For example,
methionine, which is relatively hydrophobic, can frequently be interchanged
with leucine and isoleucine, and sometimes with valine.
[071] Alternatively, a variant may have nonconservative amino acid
changes, such as, for example, replacement of a glycine with a tryptophan, or
alanine with lysine. Similar minor variations may also include amino acid
deletions and insertions. Any amino acid substitution that does not
significantly affect the biological and/or chemical properties of LmPDE
polypeptides is encompassed by the present invention. Guidance in
determining which and how many amino acid residues may be substituted,
inserted and deleted may be found using computer programs well known in
the art such as the DNASTAR software package.
[072] The present invention also encompasses various amino acid
sequences that represent different forms and fragments of the LmPDE
potypeptides such as polypeptides with conservative mutations and fragments
containing the PDEase domain. The LmPDE polypeptides may be from
Leishmania major, or other Leishmania species and subspecies of the
complexes Leishmenia tropics, Leishmania donovani, Leishmania mexicana,
and Leishmania viannia including Leishmania eethiopica, Leishmania
brasiliensis, Leishmania d. donovani, Leishmania d. infantum, Leishmania d.
chagasl, Leishmania gamhami, Leishmania m. mexicana, Leishmania m.
amazonensis, and Leishmania pifanol.
[073] The LmPDEs of this invention may be embodied in many forms,
such as in isolated form or in purified form. A skilled artisan can readily
employ standard isolation and purification methods to obtain isolated LmPDE
polypeptides (see, e.g., Marchak et al. (1996) Strategies for Protein
Purification and Characterization, Cold Spring Harbor Press, Plainview, NY).
The nature and degree of isolation and purification will depend on the
-15-

WO 2005/023856 PCT/TB2004/003990
intended use. For example, purified LmPDE protein mclecules will be
substantially free of other proteins or molecules that impair the binding of
LmPDE proteins to antibodies or other ligands. Embodiments of LmPDE
polypeptides include purified LmPDE polypeptides having the biological
activity of a LmPDE protein. In one form, such purified LmPDE polypeptides
retain the ability to bind antibody or other ligand.
[074] Various forms of a particular LmPDE polypeptide of the
invention may be produced as a result of processes such as post-translational
modifications. For example, various forms of isolated LmPDE polypeptides
may include precursor forms and different mature forms of a LmPDE protein
or polypeotide that result from posttranslational events, such as glycosytation,
phosphorylation, and intramolecular cleavage.
[075] The present invention provides isolated and purified
polypeptides having an amino acid sequence identical to the predicted
LmPDE polypeptide sequences disclosed herein. Accordingly, the amino acid
sequences of the present invention may be identical to LmPDE-A (SEQ ID
NO: 1), LmPDE-B1 (SEQ ID NO: 3) or LmPDE-B2 (SEQ ID NO: 5). LmPDE
polypeptides of the invention may also comprise at least one sequence that is
identical to a fragment of a full-length LmPDE polypeptide sequence. The
present invention also provides isolated and purified polypeptides with at least
about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%
identity to the sequences disclosed herein.
Nucleic Acid Molecules of the Invention
[076] The present invention provides LmPDE nucleic acid molecules
corresponding to the full length genes of LmPDE-A (SEQ ID NO: 2), LmPDE-
B1 (SEQ ID NO: 4), and LmPDE-82 (SEQ ID NO: 6). The present invention
also provides nucleic acid molecules that encode the LmPDE polypeptides
discussed previously. The present invention also encompasses various
nucleotide sequences that represent different forms and fragments of LmPDE
genes and transcripts, such as different allelic forms, polymorphic forms,
-16-

WO 2005/023856 PCT/TB2004/003990
alternative precursor transcripts, and mature transcripts. Additionally,
recombinant nucleic acid molecules that are codon usage variants of novel
LmPDE sequences are provided.
[077] In one embodiment, the present invention provides a nucleic
acid encoding a LmPDE-A polypeptide of the present invention comprising the
nucleotide sequence shown in SEQ ID NO: 2, beginning with adenine at
position 530 and ending with guanine at position 2425 (which corresponds to
amino acids 1-631 of SEQ ID NO: 1). Another embodiment comprises a
nucleotide sequence found in SEQ ID NO: 2, beginning with thymine at
position 1679 and ending with cytosine at position 2356, which corresponds to
the PDEase domain of a LmPDE-A polypeptide (amino acids 384-609 of SEQ
ID NO:1). Due to the degeneracy of the genetic code, the present invention
also provides any nucleic acid molecule that encodes a polypeptide
comprising the LmPDE-A polypeptide sequence set forth in SEQ ID NO: 1,
beginning with methionine at amino acid position 1 and ending with serine at
amino acid position 631. Tha invention also provides nucleic acids that
encode fragments of a LmPDE-A, for example a nucleic acid that encodes the
PDEase domain comprising amino acids 384-609 as set forth in SEQ ID NO:
1.
[078] A specific embodiment of a nucleic acid encoding a LmPDE-B1
polypeptide of the present invention comprises the nucleotide sequence of
SEQ ID NO: 4, beginning with adenine at position 1267 and ending with
adenine at position 4059 (which corresponds to amino acids 1-930 of SEQ ID
NO: 3). Another embodiment comprises a nucleotide sequence found in SEQ
ID NO: 4, beginning with thymine at position 3205 and ending with cytosine at
position 3906, which corresponds to the PDEase domain of LmPDE-B1
(amino acids 647-880 of SEQ ID NO: 3). Due to the degeneracy of the
genetic code, the present invention also provides any nucleic acid molecule
that encodes a polypeptide comprising the LmPDE-B1 polypeptide sequence
set forth in SEQ ID NO: 3, beginning with methionine at amino acid position 1
and ending with valine at amino acid position 930. The invention also
provides nucleic acids that encode fragments of a LmPDE-B1 polypeptide, for
-17-

WO 2005/023856 PCT/TB2004/003990
example a nucleic acid that encodes the PDEase domain comprising amino
acids 647-880 as set forth in SEQ ID NO: 3.
[079] A specific embodiment of a nucleic acid encoding a LmPDE-B2
polypeptide of the present invention comprises the nucleotide sequence of
SEQ ID N0: 6, beginning with adenine at position 2182 and ending with
adenine at position 5004 (which corresponds to amino acids 1-840 of SEQ ID
NO: 5). Another embodiment comprises a nucleotide sequence found in SEQ
ID NO: 6, beginning with thymine at position 4150 and ending with cytosine at
position 4851, which corresponds to the PDEase domain of LmPQE-B2
(amino acids 657-890 of SEQ ID NO: 5). Due to the degeneracy of the
genetic code, the present invention also provides any nucleic acid molecule
that encodes a polypeptide comprising the LmPDE-B2 polypeptide sequence
set forth in SEQ ID NO: 5, beginning with methionine at amino acid position 1
and ending with valine at amino acid position 940. The Invention also
provides nucleic acids that encode fragments of a LmPDE-B2 polypeptide, for
example a nucleic acid that encodes the PDEase domain comprising amino
acids 657-890 as set forth in SEQ ID NO: 5.
[080] One of skill in the art will appreciate that nucleic acids of the
present invention can encode domains or portions of LmPDE polypeptides
other that those specifically mentioned above.
[081] The present invention contemplates alternative alletic forms of
LmPDE nucleotide sequences that are isolated from different subjects of the
same species. Typically, isolated allelic forms of naturally-occurring gene
sequences include wild-type and mutant alleles. A wild-type LmPDE gene
sequence will encode a LmPDE protein having normal PDE biological activity,
such as, for example, a phosphodiesterase function. A mutant of a LmPDE
gene sequence may encode a LmPDE polypeptide having an activity not
normally found in LmPDE polypeptides, such as, for example, not functioning
as a phosphodiesterase. Alternatively, a mutant of a LmPDE gene sequence
may encode a LmPDE polypeptide having normal activity. Accordingly, the
present invention provides wild-type and mutant allelic forms of LmPDE
nucleotide sequences.
-18-

WO 2005/023856 PCT/TB2004/003990
[082] The present invention further contemplates polymorphic forms of
LmPDE nucleotide sequences. Typically, isolated polymorphic forms of
naturally-occurring gene sequences are isolated from different subjects of the
same species. The polymorphic forms include sequences having one or more
nudeotide substitutions that may or may not result in changes in the amino
acid codon sequence. These substitutions may result in a wild-type LmPDE
gene that encodes a protein having the biological activity of wild-type LmPDE
proteins, or encodes a mutant polymorphic form of the LmPDE protein having
a different or null activity.
[083] The present invention further provides isolated codon-usage
variants (see Table 1) that differ from the disclosed LmPDE nucleotide
sequences, yet do not after the predicted LmPDE protein sequence or
biological activity. The codon-usage variants may be generated by
recombinant DNA technology. Codons may be selected to optimize the level
of production of the LmPDE transcript or LmPDE protein in a particular
prokaryolic or eukaryotic expression host, in accordance with the frequency of
codens utilized by the host cell. Alternative reasons for altering the nucleotide
sequence encoding a LmPDE protein include the production of RNA
transcripts having more desirable properties, such as an extended half-life or
increased stability.
-19-

WO 2005/023856 PCT/TB2004/003990

[084] The present invention further provides novel purified and
isolated polynucleotides (i.e. DNA sequences and fragments thereof), which
can be in isolated form, including DNA and RNA transcripts (both sense and
complementary antisense strands) encoding LmPDEs, DNA/RNA hybrids,
and related molecules. The nucleic acid molecules of the present invention
include nucleotide sequences substantially identical to or complementary to
the LmPDE nuclotide sequences disclosed herein.
[085] The invention encompasses genomic, cDNA, ribozyme, and
antisense molecules, as well as nucleic acids based on alternative backbone
and inducing alternative bases and modified sugar moieties, whether derived
from natural sources or wholly or partially synthesized. As used herein,
"wholly" synthesized DNA means that the DNA is produced entirely by
chemical means, and "partially" synthesized means that only portions of the
-20-

WO 2005/023856 PCT/TB2004/003990
resulting DNA are produced by chemical synthesis. Antisense molecules can
be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-
nucleic acid molecules such as phosphorathioate derivatives (described in
greater detail below) that specifically bind DNA or RNA in a base-pair
dependent manner. A skilled artisan can readily obtain these classes of
nucleic acid molecules using the sequences described herein.
[086] The present invention further provides nucleotide sequences
that selectively hybridize to LmPDE nucleotide sequences under high
stringency hybridization conditions. Typically, hybridization under standard
high stringency conditions will occur between two complementary nucleic acid
molecules that differ in sequence complementarity by about 70% to about
100%. It is readily apparent to one skilled in the art that the high stringency
hybridization between nucleic acid molecules depends upon, for example, the
degree of identity, the stringency of hybridization, and the length of the
hybridrzirg strands. The methods and formulas for conducting nigh stringency
hybridizations are well known in the art, and can be found, for example, in
Sambrook, et al. (2001) Molecular Cloning: A Laboratory Manual (Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY).
[087] In general, stringent hybridization conditions are those that (1)
employ low ionic strength and high temperature for washing, for example,
0.015 M NaCl. 0.0015 M sodium citrate, and 0.1% SDS at 50°C; or (2) employ
a denaturing agent during hybridization such as formamide, for example, 50%
(vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1%
polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM
NaCl, and 75 mM sodium citrate at 42°C.
[088] Another example of stringent conditions is the use of 50%
formamide, 5x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium
phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5x Denhardt's solution,
sonicated salmon sperm DNA (50 mg/ml), 0.1% SDS, and 10% dextran
sulfate at 42°C, with washes at 42°C in 0.2x SSC and 0.1% SDS. A skilled
artisan can readily determine and vary the stringency conditions appropriately
to obtain a clear and detectable hybridization signal. Typical ranges of
-21-

WO 2005/023856 PCT/TB2004/003990
stringency conditions include: (1) low stringency (2x SSC/0.1% (w/v) SDS.
room temperature), (2) moderate stringency (0.2x SSC/0.1% (w/v) SDS,
42°C), and (3) high stringency (0.1x SSC/0.1% (w/v) SDS, 68°C).
[089] The present invention provides RNA molecules that encode
LmPDE polypeptides. In particular, the RNA molecules of the invention may
be isolated full-length or partial mRNA molecules or RNA oligomers that
encode a LmPDE polypeptide.
[090] The nucleic acid molecules of the invention also include
derivative nucleic acid molecules which differ from DNA or RNA molecules,
and anti-sense molecules. Derivative molecules include peptide nucleic acids
(PNAs), and non-nucleic acid, molecules including phosphorothioate,
phosphotriester, phosphoramidate, and methylphosphonate molecules, that
bind to single-stranded DNA or RNA in a base pair-dependent manner
(Zamecnik et al. (1878) Proc. Natl. Acad. Sci. USA 75, 280-284; Goodchild et
al. (1966) Proc. Natl. Acad. Sci. USA 83, 4143-4146).
[091] Peptide nucleic acid molecules comprise a nucleic acid oligomer
to which an amino acid residue, such as lysine, and an amino group have
been added. These small molecules (also known as anti-gene agents) stop
transcript elongation by binding to their complementary (template) strand of
nucleic acid (Nielsen et al., (1993) Anlicancer Drug Des. 8, 53-63). Reviews
of methods for synthesis of DNA, RNA, and their analogues can be found in
Oligonucleotides and Analogues (ed. F. Eckstein (1991) IRL Press, New
York) and Oligonucleotide Synthesis [ed. M. J. Gait (1984) IRL Press, Oxford,
England). Additionally, methods for antisense RNA technology are described
in U.S. patent Nos. 5,194,428 and 5,110,802. A skilled artisan can readily
obtain these classes of nucleic acid molecules using the LmPDE nucleotide
sequences described herein (see, for example. Innovative and Perspectives
in Solid Phase Synthesis (1992) Eghoim, el al. pp. 325-328, or U.S. Patent
No. 5,539,082).
[092] Embodiments of the LmPDE nucleic acid molecules of the
invention include DNA and RNA primers, which allow the specific amplification
of LmPDE sequences, or of any fragments thereof, and probes that
-22-

WO 2005/023856 PCT/TB2004/003990
selectively or specifically hybridize to LmPDE sequences or to any fragments
thereof. As used herein, amplification refers to the production of additional
copies of a nucleic acid sequence and is generally carried out using
polymerase chain reaction (PCR) technologies that are well known in the art
(Dieffenbach et al, (1995) PCR Primer, a Laboratory Manual, Cold Spring
Harbor Press, Plainview, NY). The nucleic acid probes can be labeled with a
detectable marker. Examples of a detectable marker include, but are not
limited to, a radioisotope, a fluorescent compound, a bioluminescent
compound, a chemiluminescent compound, a metal chelator, or an enzyme.
Technologies for generating labeled DNA and RNA probes are well known in
the art (see, for example, Sambrook et al. (1989) in Molecular Cloning).
Recombinant Nucleic Acid Molecules Encoding LmPDES
[093] The invention also includes recombinant nucleic acid molecules
encoding LmPDE polypeptides. Such molecules may have regulatory
sequences operatively linked to the LmPDE nucleotide sequences of the
invention.
[094] The present invention also encompasses recombinant nucleic
acid molecules, such as tecombinant DNA molecules (rDNAs) that comprise
nucleotide sequences encoding LmPDE polypeptides. As used herein, a
rDNA molecule is a DNA molecule that has been subjected to molecular
manipulation in vitro. Methods for generating rDNA molecules are well known
in the art (see, for example, Sambrook el al. (1989) Molecular Cloning, supra).
In one embodiment of the present invention, the rDNA sequences that encode
a LmPDE polypeptide, or fragments thereof, are operably linked to one or
more expression control sequences and/or vector sequences.
Vectors Comprising Novel LmPDEs
[095] The nucleic acid molecules of the present invention may be
recombinant molecules, each comprising the sequence, or portion thereof, of
-23-

WO 2005/023856 PCT/TB2004/003990
a LmPDE nucleotide sequence linked to a non-LmPDE nucleotide sequence.
For example, the LmPDE sequence may be operatively linked to a vector to
generate a recombinant molecule.
[096] One possible vector for expression is an autonomously
replicating vector comprising a replicon that directs the replication of the rDNA
within the appropriate host cell. Alternatively, the vector directs integration of
the recombinant vector into a host cell. Various viral vectors may also be
used, such as a number of well known retroviral, adenoviral, and adeno-
associated viral (AAV) vectors (Berkner (1988) Biotechniques 6, 616-629).
[097] Vectors of the present invention may permit expression of a
LmPDE transcript or polypeptide sequence in prokaryotic or eukaryotic host
cells. Such vectors include expression vectors comprising an expression
control element, described above. Vectors used for expression of the LmPDE
nucleotide sequences in eukaryotic host cells can includa expression control
elements, such as the baculovirus polyhedrin promoter for expression in
insect cells. Other possible expression control elements include promoters or
enhancers derived from the genomes of plant cells (e. g., heat shock,
RUBISCO, storage protein genes), viral promoters or leader sequences from
plant viruses, and promoters or enhancers from the mammalian genes or from
mammalian viruses.
[098] Specific initiation signals may also be required for efficient
translation of LmPDE nucleotide sequences. These signals include the ATG-
initiation codon and adjacent sequences. In cases where a LmPDE initiation
codon and upstream sequences are inserted into the appropriate expression
vector, no additional translation control signals may be needed. However, in
cases where only the coding sequence (or a portion thereof) is inserted,
exogenous translalional control signals including the ATG-initiation codon
must be provided. Furthermore, the initiation codon must be in the correct
reading frame to ensure translation of the entire insert. Exogenous
translational elements and initiation codons can be of various origins, both
natural and synthetic. The efficiency of expression may be enhanced by the
inclusion of enhancers appropriate to the cell system in use (Scharf et al
-24-

WO 2005/023856 PCT/TB2004/003990
(1994) Results Probl. Cell. Differ. 20, 125-162; Bittner et al. (1987) Methods in
Enzymol. 153, 516-544).
[099] One possible vector includes at least one selectable marker
gene that encodes a gene product that confers drug resistance such as
resistance to amplcillin or tetracyline. The vector may also comprise multiple
endonuclease restriction sites that enable convenient insertion of exogenous
DNA sequences. Methods for generating a recombinant expression vector
encoding a LmPDE protein of the invention are well known in the art (see, for
example, Sambrook et al. (2001) Molecular Cloning. A Laboratory Manual,
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel (1989)
Current Protocols in Molecular Biology, John Wiley & Sons, New York NY).
[0100] Vectors of the present invention for generating LmPDE
transcripts and/or the encoded LmPDE polypeptides can be expression
vectors that are compatible with prokaryotic host cells. Prokaryotic cell
expression vectors are well known in the art and are available from several
commercial sources. For example, pET vectors (e.g., pET-21, Novagen
Corp.). pQE vectors (Qiagen, Chatsworth, CA), BLUESCRIPT phagemid
(Stratagene, LaJolla, CA), pSPORT (Gibco BRL), or ptrp-lac hybrids may be
used to express LmPDE polypeptides in bacterial host calls.
[0101] Alternatively, the expression vectors of the present invention for
generating LmPDE transcripts and/or the encoded LmPDE polypeptides can
be expression vectors which are compatible with eukaryotic host cells, such
as vertebrate cells. Eukaryotic cell expression vectors are well known in the
art and ana available from several commercial sources. Such vectors can
contain convenient restriction sites for insertion of the desired DNA segment.
Typical of such vectors are PSVL and pKSV-10 (Pharmacia), pBPV-1/pML2d
(international Biotechnologies, Inc.), pTDT1 (ATCC, #31255), and similar
eukaryotic expression vectors.
-25-

WO 2005/023856 PCT/TB2004/003990
Host-Vector Systems Comprising LmPDEs
[0102] The invention further provides a host-vector system comprising
a vector, plasmid, phagemid, or cosmid comprising a LmPDE nucleotide
sequence, or a fragment thereof, introduced into a suitable host cell. A variety
of expression vector/host systems may be utilized to cany and express
LmPDE nucleotide sequences. The host-vector system can be used to
express (e.g., produce) LmPDE polypeptides encoded by LmPDE nucleotide
sequences. The host cell can be either prokatyotic or eukaryotic. Examples
of suitable prokaryotic host cells include bacterial strains from genera such as
Escherichia, Bacillus, Pseudomonas, Streptococcus, and Streptomyces.
Examples of suitable eukaryotic host cells include yeast cells, plant cells, or
animal cells such as mammalian cells and insect cells. Several possible
embodiments provide a host-vector system comprising the pcDNA3 vector
(Invitrogen, Carlsbad, CA) in COS-7 mammalian cells, pGEX vector
(Promega, Madison, Wl) in bacterial cells, pLT1 vector (S. Kunz, unpublished)
in Saccharomyces cerevisiae cells, or pFastBac HT baculovirus vector
(Gibco/BRL) in Sf9 insect cells (ATCC, Manassas, VA).
[0103] The introduction of the recombinant DNA molecules of the
present invention into an appropriate host cell may be accomplished by well-
known methods that depend on the type of vector and host system employed.
For example, prokaryotic host cells are introduced (e.g., transformed) with
nucleic acid molecules by electroporation or salt treatment methods (see, for
example. Cohen et a). (1972) Proc Nalt Acad Sci USA 69. 2110; Sambrook et
al. (1989) Molecular Cloning supra). Vertebrate cells can be transformed with
vectors containing recombinant DNAs by various methods, including
electroporation, or cationic lipid or salt treatment (Graham et al. (1973) Virol.
52, 456; Wigler et al. (1979) Proc. Natl. Acad. Sci. USA 76, 1373-1376).
[0104] Successfully transformed cells, i.e., cells that contain a rDNA
molecule of the present invention, can be identified by techniques well known
in the art. For example, cells resulting from the introduction of recombinant
ONA of the present invention are selected and cloned to produce single
-26-

WO 2005/023856 PCT/TB2004/003990
colonies. Cells from those colonies are harvested, lysed and their DNA
content examined for the presence of the rONA using a method such as that
described by Southern (1975) J. Mol. Biol. 98, 503, or Berent et al. (1985)
Biotech. 3, 208. The proteins produced from the cell may also be assayed via
a biochemical assay or immunological method.
[0105] In bacterial systems, a number of expression vectors may be
selected cepending upon the use intended for the LmPDE polypeptides. For
example, when large quantities of LmPDEs are needed for the induction of
antibodies, vectors that direct high level expression of fusion proteins that are
soluble end readily purified may be desirable. Such vectors include, but are
not limited to, the multifunctional E. coli cloning and expression vectors such
as BLUESCRIPT (Stratagene, San Diego, CA), into which a LmPDE
nucleotide sequence may be ligated in-frame with sequences for the amino-
terminal Met and the subsequent 7 residues of b-galactosidase so that a
hybrid prolein is produced; pIN vectors (Van Heeke & Schuster (1989) J. Biol.
Chem. 264, 5503-5509); and the like. The pGEX vectors (Promega, Madison,
Wl) may also be used to express LmPDE polypeptides as fusion proteins with
glutathione S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption to glutathione-
agarose beads followed by elution in the presence of free glutattione.
Proteins made in such systems are designed to include heparin, thrombin, or
factor XA protease cleavage sites so that the cloned protein of interest can be
released from the GST moiety at will.
[0106] In yeast (Sacctiaromyces cerevisiae) a number of vectors
containing constitutive or inducible promoters such as beta-factor, alcohol
oxidase and PGH may be used. For reviews, see Ausubel et al, (supra) and
Grant et al. (1987) Methods in Enzymology 153, 516-544.
[0107] In cases where plant expression vectors are used, the
expression of a sequence encoding a LmPDE polypeptide can be driven by
several different promoters. For example, viral promoters such as the 35S
and 19S promoters of CaMV (Brisson et al. (1984) Nature 310, 511-514) may
be used alone or in combination with the omega leader sequence from TMV
-27-

WO 2005/023856 PCT/TB2004/003990
(Takamatsu et al. (1987) EMB0 J 6, 307-311). Alternatively, plant promoters
such as the small subunit of RUBISCO (Coruzzi et al (1984) EMBO J 3, 1671-
1680; Broglie et al. (1984) Science 224, 838-843), or heat shock pramoters
(Winter et al. (1991) Results Probl. Cell Differ. 17, 85-105) may be used.
These ccnstructs can be introduced into plant cells by direct DNA
transformation or pathogen-mediated transfection. For reviews of such
techniques, see Hobbs (1992) McGraw Yearbook of Science and Technology,
McGraw Hill New York N.Y., pp. 191-156; or Weissbach and Weissbach
(1988) Method for Plant Molecular Biology, Academic Press, New York N.Y.,
pp. 421-463.
[0108] An alternative expression system that can be used to express
LmPDE polypeptides is an insect system. In one such system, Autographa
califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express
foreign genes in Spodoptera Irugiperda cells or in Trichoplusia larvae (Smith
et al. (1933) J. Virol. 46, 584; Engelhard el al. (1994) Proc. Nat. Acad. Sci.
USA 91, 3224-3227). The sequence encoding a LmPDE polypeptide may be
cloned into a nonessential region of the virus, such as the polyhedrin gene,
and placed under control of the polyhedrin promoter. Successful insertion of
a LmPDE -lucleotide sequence will render the polyhedrin gene inactive and
produce recombinant virus lacking coat protein. The recombinant viruses are
then used io infect S. frugiperda cells or Trichoplusia larvae in which a
LmPDE polypeptide is expressed.
[0109] In mammalian host cells, a number of viral-based expression
systems are utilized. In cases where an adenovirus is used as an expression
vector, a LmPDE nucleotide sequence is ligated into an adenovirus
transcription/translation vector consisting of the late promoter and tripartite
leader sequence. Insertion in a nonessential E1 or E3 region of the viral
genome results in a viable virus (Logan et al. (1984) Proc Nutl. Acad. Sci.
USA B1, 3655-3659) capable of expressing a LmPDE protein in infected host
cells. In addition, transcription enhancers, such as the rous sarcoma virus
(RSV) enhancer, can be used to increase expression in mammalian host
cells.
-28-

WO 2005/023856 PCT/TB2004/003990
[0110] A host cell strain may also be chosen for its ability to modulate
the expression of the inserted LmPDE nucleotide sequences or to process the
expressed LmPDE polypeptide in a particular manner. Such modifications of
LmPOE polypeptides include, but are not limited to, scetylation, carboxylation,
glycosylation, phosphorylation, lipidation and acylation. Post-translational
processing which cleaves a precursor form of the protein may also be
important for correct insertion, folding and/or function. Different host cells
such as CHO. HeLa, MDCK, 293, WI38, etc. have specific cellular machinery
and characteristic mechanisms for such post-translational activities and may
be chosen to ensure the correct modification and processing of the
introduced, foreign protein.
[0111] For long-term, high-yield production of recombinant proteins,
stable expression is preferred. For example, cell lines that stably express
LmPDE polypeptides are transformed using expression vectors that contain
viral origins of replication or endogenous expression elements and a
selectable marker gene. Following the introduction of the vector, cells are
grown in an enriched media before they are switched to selective media. The
purpose of the selectable marker is to confer resistance to selection, and its
presence allows growth and recovery of cells which successfully express the
introduced sequences. Resistant clumps of stably transformed cells can be
proliferated using tissue culture techniques appropriate for the cell type used.
[0112] Any number of selection systems may be used to recover
transformed cell lines. These include, but are not limited to, the herpes
simplex virus thymidine kinase (tk) (Wigler et al. (1977) Ceil 11, 223-232) and
adenine phosphoribosyltransferase (aprt)(Lowy et al. (1980) Cell 22, 817-
823) genes which can be employed in tk-minus or aprt-minus cells,
respectively. Also, antimetabolite, antibiotic or herbicide resistance can be
used as the basis for selection. Examples include: dhfr which confers
resistance to methotrexate (Wigler et al. (1950) Proc Natl Acad Sci USA 77,
3567-3570): npt, which confers resistance to the aminoglycosides neomycin
and G-418 (Colbere-Garapin et al. (1981) J. Mol. Biol. 150, 1-14) and als or
-29-

WO 2005/023856 PCT/TB2004/003990
pat, which confer resistance to chlorsulfaron and phosphinotricin
acetyltransferase, respectively (Murry, supra).
[0113] Additional selectable genes have been described, for example,
UpB, which allows cells to utilize indole in place of tryptophan, or hisD, which
allows cells to utilize histinol in place of histidine (Hartman et al. (1988) Proc.
Natl Acad. Sci. USA 85, 8047-8051). Recently, the use of visible markers
has gained popularity. Such markers include anthocyanins, b-glucuronidase
and its substrate", GUS, and luciferese and its substrate, luciferin. These
markers are widely used not only to identify transformants, but also to quantify
the amount of transient or stable protein expression attributable to a specific
vector system (Rhodes et al. (1995) Methods Mol. Biol. 55, 121-131).
Antibodies Reactive Against LmPDE Polypeptides
[0114] The present invention also provides antibodies that bind to the
LmPDEs of the invention. These antibodies may be used for both diagnostic
and therapeutic purposes.
[0115] The invention provides antibodies, such as polyclonal,
monoclonal, chimeric, humanized, and human antibodies, as well as
fragments thereof (e.g., Fab), that bind to LmPDE polypeptides. Such
antibodies may selectively bind to a LmPDE polypeptide but will not bind (or
will bind weakly) to a non-LmPDE protein. These antibodies can be from any
source, e.g., rabbit, sheep, rat, dog, cat, pig, horse, mouse and human.
[0116] As will be understood by those skilled in the art, the epitopes of
a LmPDE polypeptide to which an antibody is directed may vary with the
intended application. LmPDE polypeptides may be targets for therapeutic
methods such as targeted antibody therapy and immunotherapy to treat
conditions associated with the presence or absence of a LmPDE of the
invention. Additionally, some of the antibodies of the invention may be
internalizing antibodies, which internalize (e.g., enter) into the cell upon or
after binding. Internalizing antibodies are useful for inhibiting cell growth
-30-

WO 2005/023856 PCT/TB2004/003990
and/or inducing cell death and for detecting or targeting LmPDEs within
damaged or dying cells.
[0117] The invention also encompasses antibody fragments that
specifically recognize a LmPDE polypeptide. As used herein, an antibody
fragment is defined as at least a portion of the variable region of the
immunoglobulin molecule that binds to its target, i.e., the antigen-binding
region. Some of the constant region of the immunoglobulin may be included.
Fragments of the monoclonal antibodies or the polyclonal antisera include
Fab, F(ab')2, Fv fragments, single-chain antibodies, and fusion proteins which
include the immunologically significant portion (i.e., a portion that recognizes
and binds a LmPDE).
[0118] The chimeric antibodies of the invention may be immunoglobulin
molecules that comprise at least two antibody portions from different species,
for example a human and non-human portion. The invention also provides
chimeric antibodies having different effector functions (Neuberger et al. (1984)
Nature 312, 604), immunoglobulin constant regions from another species, and
constant regions of another immunoglobulin chain (Sharon et al. (1984)
Nature 309, 364; Tan et al. (1985)
J. Immunol. 135, 3565-3567). Additional procedures for modifying antibody
molecules and for producing chimeric antibody molecules using homologous
recombination to target gene modification have been described (Fell et al.
(1989) Proc Natl. Acad. Sci. USA 86, 8507-8511).
[0119] Humanized antibodies directed against LmPDE polypeptides are
also useful. Humanized antibodies can be made according to several
methods known in the art (Teng et al. (1983) proc. Natl. Acad. Sci. USA 80,
7308-7312; Kozbor et al. (1983) Immunology Today 4, 7279; Olsson et al.
1982) Meth. Enzymol. 92, 3-16).
[0120] Various methods for the preparation of antibodies are well
known in the art. For example, antibodies may be prepared by immunizing a
suitable mammalian host with an immunogen such as an isolated LmPDE
bolypeptide (Harlow (1939) Anybodies, Cold Spring Harbor Press, NY). In
addition, fusion proteins of LmPDEs may also be used as immunogens, such
-31-

WO 2005/023856 PCT/TB2004/003990
as a LmPDE fused to GST, human lg, or His-tagged fusion proteins. Cells
expressing or over-expressing LmPDE polypeptides may also be used for
immunizations. This strategy may result in the production of monoclonal
antibodies with enhanced capacities for recognizing endogenous LmPDE
polypeptides (Harlow et al. (1988) Antibodies: A Laboratory Manual, Cold
Spring Harbor Press).
[0121] The invention also provides for human antibodies. There are a
number of well-known strategies one of ordinary skill in the art may use to
produce human recombinant antibodies. One is the generation of antibodies
using phage display technologies (Low et al. (1096). J Mol Biol 260(3):359-
368; Winter et al. (1994). Annu Rev Immunol 12:433-455). Specifically,
human RMA is used to produce a cDNA library of antibody heavy and light
chain fragments expressed on the surface of bacteriophage. These libraries
can be used to probe against the antigen of interest. The phage that bind,
because of the antibody expressed on the surface, can then be isolated. The
DNA encoding the variable regions is sequenced and cloned for antibody
expression.
[0122] Another method of producing human antibodies employs
"humanized" mice. These transgenic mice have had their own antibody
genes replaced with a portion of the human antibody gene complex so that
upon inoculation with antigen, they produce human antibodies (Green et al.
(1994) Nat. Genet. 7:13-21: Low et al. (1996). J Mol Biol 260(3):359-368;
Wagner et al. (1994) Eur. J. Immunol. 24(11):2672-2681; Wagner et al. (1994)
Nuc. Acids Res. 22(8): 1389-1393; Winter et al. (1994) Annu Rev. Immunol.
12:433-455). The antibody producing cells that result can then be
incorporated into the standard hybridoma technology for the establishment of
specific monoclonal antibody producing cell lines.
[0123] Recombinant human antibodies are also produced by isolating
antibody-producing B cells from human volunteers that have a robust
response against the antigen of interest. Using fluorescence activated cell
sorting (FACS) and fluorescently labeled antigen, cells producing the
antibodies directed against the antigen can be separated from the other cells.
-32-

WO 2005/023856 PCT/TB2004/003990
The RNA can then be extracted and the sequence of the reactive antibody
variable regions determined (Kantor et al. (1985) Ann. N.Y. Acad. Sci.
764:224-227. Wang et al. (2000) J. Immunol. Methods 244:217-225). The
DNA sequence of the functional variable regions can be synthesized or
cloned into mammelian expression vectors for large-scale human
recombinant antibody production.
[0124] The amino acid sequence of LmPDE polypeptides may be used
to select specific regions of a LmPDE protein for generating antibodies. For
example, hydrophobicity and hydrophilicity analyses of a LmPDE amino acid
sequence may be used to identify hydrophilic regions in a LmPPE protein
structure. Regions of a LmPDE polypeptide that show immunogenic
structure, as well as other regions and domains, can readily be identified
using various other methods known in the art such as Chou-Fasman, Gamier-
Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson. Wolf analysis
(Rost et al. (1994) Protein 19, 55-72).
[0125] Methods for preparing a protein for use as an immunogen and
for preparing immunogenic conjugates of a protein with a carrier such as BSA,
KLH, or other carrier proteins are well known in the art. Techniques for
conjugating or joining therapeutic agents to antibodies are well Known (Amon.
et al. (1985) "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer
Therapy", Monoclonal Antibodies And Cancer Therapy, Relsfeid el al. (eds.)
pp. 243-56, Alan R. Liss, Inc; Hellstrom et al. (1987) "Antibodies For Drug
Delivery", Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.) pp. 623-
53, Marcel Dekker, Inc.; Thorpe (1965) "Antibody Carriers Of Cytotoxic
Agents In Cancer Therapy: A Review", Monoclonal Antibodies '84 - Biological
And Clinical Applications, Pincnera el al. (eds.) pp. 475-506. Thorpe et al.
(1982) The Preparation And Cytotoxic Properties Of Antibody-Toxin
Conjugates", Immunol. Rev. 62. 119-158; and Sodee et al. (1997), Clin. Nuc.
Med. 21, 759-766). In some circumstances, for example, direct conjugation
using carbedimide reagents may be used; in other instances linking reagents
such as these supplied by Pierce Chemical Co., Rockford, IL, may be
effective.
-33-

WO 2005/023856 PCT/TB2004/003990
[0126] Administration of a LmPDE immunogen is conducted generally
by injection over a suitable time period and with use of a suitable adjuvant, as
is generally understood in the art. (Harlow et al. (1988) Antibodies: A
Laboratory Manual, Cold Spring Harbor Press). During the immunization
schedule, tilers of antibodies can be taken to determine the adequacy of
antibody formation.
[0127] While the polyclonal anlisera produced in this way may be
satisfactory for some applications, monoclonal antibody preparations are
preferred for pharmaceutical compositions. Immortalized cell lines which
secrete a desired monoclonal antibody may be prepared using the standard
method of Kohler and Milstein (Nature 256, 495-497) or modifications which
effect immortalization of lymphocytes or spleen cells, as is generally known in
the art. The immortalized cell lines secreting the desired antibodies are
screened by immunoassay in which the antigen is a LmPDE polypeptide.
When the appropriate immortalized cell culture secreting the desired antibody
is identified; the cells can be cultured either in vitro or by production in ascites
fluid. The desired monoclonal antibodies are then recovered from the culture
supernatant or from the ascites supernatant.
[0128] The antibodies or fragments may also be produced by
recombinanl means. The antibody regions that bind specifically to the desired
regions of a LmPDE polypeptide can also be produced in the context of
chimeric antibodies of multiple species origin.
[0129] The antibodies of the invention can bind specifically to LmPDE
polypeptides. In one embodiment, the LmPDE antibodies may specifically
bind to the GAF domain of a LmPDE protein. In another embodiment, the
antibodies of the invention may specifically bind to the C-terminal domain of a
LmPDE protein. In a further embodiment, the antibodies may specifically bind
to the PDE catalytic domain of a LmPDE polypeptide. In other embodiments,
the antibodies of this invention may bind to other domains of a LmPDE
polypeptide, for example the antibodies may bind to the N-terminal domain of
a LmPDE polypeptide.
-34-

WO 2005/023856 PCT/TB2004/003990
Use of Antibodies Against LmPDEs
[0130] LmPDE polypeptides can be used to elicit the generation of
antibodies, including fragments, that specifically bind an epitope associated
with a LmPDE polypeptide, using methods described herein (Kohler et al.
supra). The antibodies which are immunoreactive with selected domains or
regions of a LmPDE polypeptide are particularly useful. In one embodiment,
LmPDE antibodies are used to screen expression libraries in order to obtain
polypeptides related to LmPDE polypeptides (e.g., homologues).
[0131] In another embodiment, LmPDE antibodies are used to enrich or
purify LmPDE palypeptides from a sample having a heterologous population
of polypeptides. The enrichment and purifying methods include conventional
techniques, such as immuno-affinity methods. In general, the immuno-affinity
methods include the following steps: preparing an affinity matrix by linking a
solid support matrix with a LmPDE antibody, wherein the linked affinity matrix
specifically binds with a LmPDE polypeptide; contacting the linked affinity
matrix with the sample under conditions that permit a LmPDE polypeptide in
the sample to bind to the linked affinity matrix; removing the non-LmPDE
polypeptides that did not bind to the linked affinity matrix, thereby enriching for
or purifying a LmPDE polypeptide. A further step may include eluting a
LmPDE polypeptide from the affinity matrix. The general steps and conditions
for affinity enrichment for a desired protein or protein complex can be found in
Anibodies: A Laboratory Manual (Harlow et al. (1988) CSHL, Cold Spring,
NY).
[0132] Furthermore, there are multiple diagnostic uses of the antibodies
of the invention. The invention provides methods for diagnosing in a subject,
e.g., an animal or human subject, a disease associated with the presence or
deficiency of at least one LmPDE polypeptide. In one embodiment, the
method comprises quantitatively determining the amount of at least one
LmPDE polypeptide in the sample (e.g., cell or biological fluid sample) using
any one or a combination of the antibodies of the invention. The amount so
determined can then be compared with the amount in a sample from a normal
-35-

WO 2005/023856 PCT/TB2004/003990
subject. The presence of a measurably different amount in the sample (i.e.,
the amount of a LmPDE polypeptide in the test sample exceeds or is reduced
from the amount of a LmPDE polypeptide in a normal sample) indicates the
presence of the disease.
[0133] The anti-LmPDE antibodies of the invention may also be useful
in diagnostic imaging methodologies, where the antibodies have a detectable
label. The invention provides various immunological assays useful for the
detection of LmPDE polypeptides in a suitable biological sample. Suitable
detectable markers include, but are not limited to, a radioisotope, a
fluorescent compound, a bioluminescent compound, a chemiluminescent
compound, a chromophore, a metal chelator, biotin, or an enzyme. Such
assays generally comprise one or more labeled LmPDE antibodies that
recognize and bind a LmPDE polypeptide, and include various immunological
assay formats well known in the art, including but not limited to various types
of precipitation, agglutination, complement fixation, radioimmunoassays (RIA),
enzyme-linked Immunosorbent assays (ELISA), enzyme-linked
immunofluorescert assays (ELIFA) (H. Liu et al. (1998) Cancer Research 58,
4055-4060), immunohistochemical analyses, and the like.
Methods for Generating LmPDE Polypeptides
[0134] The LmPDE polypeptides of the present invention may be
generated by chemical synthesis or by recombinant methods. If a high yield
is desired, recombinant methods may be used, as set forth above. The
LmPDE polypeptides of the invention can also be generated by chemical
synthetic methods. The principles of solid phase chemical synthesis of
polypeptides are well known in the art and may be found in general texts
relating to this area (see, e.g., Dugas et al. (1981) Bioorganic Chemistry, pp.
54-92, Springer-Verlag, New York).
[0135] The present invention also provides derivative polypeptide
molecules, such as chemically modified LmPDE polypeptides. Illustrative of
such modifications is replacement of hydrogen by an alkyl, acyl, or amino
-36-

WO 2005/023856 PCT/TB2004/003990
group. The LmPDE polypeptide derivatives retain the biological activities of
naturally occurring LmPDEs.
Screening for Compounds that Modulate LmPDE Activity/Expression
[0136] The LmPDE polypeptides of the present invention are
phosphodiesterases from Leisbmania, such as Lsishmania major, that
function as key components in the regulation of intracellular levels of cAMP by
catalyzing its hydrolysis. Together with the adenylyl cyclases, these
phosphotiesterases ultimately control the biological responses mediated by
the messenger cAMP. Regulation of intracellular levels of cAMP is crucial in
the processes of cell transformation and proliferation. Thus. LmPDE
polypeptides are important targets for compounds that modulate their
biological activity, or that modulate their expression. Compounds that
effectively modulate the biological functions of LmPDEs may serve as
important therapeutics for the treatment of parasitic diseases such as
leishmaniesis. The invention also provides a method for obtaining
compounds that modulate either the activity or the expression of LmPDEs.
[0137] The present invention relates to screening methods for
identifying compounds that bind to LmPDE polypeptides (e.g., ligands) and
modulate the biological activity of LmPDE polypeptides. These screening
melhods may also identity compounds that do not necessarily bind directry to
LmPDEs, but nevertheless modulate LmPDE activity. Such screening
methods can also be used to identify compounds that modulate the
expression of LmPDE polypeptides.
[0138] Typically, the goal of screening methods is to identify
compounds that bind to the target LmPDEs and cause changes in the
biological activity of the larget polypeptide or nucleic acid molecule. The
compounds of interest are identified from a population of candidate
compounds. For example, a compound that effectively binds the target
nucleic acid molecule can decrease expression of the LmPDE polypeptide,
and thereby decrease proliferation of cells that express LmPDE polypeptides.
-37-

WO 2005/023856 PCT/TB2004/003990
Decreasing the proliferation of cells that express LmPDE polypeptides can be
an effective method of treating diseases associated with the infection of
parasites such as Leishmania major.
[0139] Several assays and screens can be used to identify compounds
that modulate LmPDE activity and/or expression. The compounds identified
in the assays and screens may modulate the activity of LmPDEs in a variety
of ways. For example, the compounds may bind directly to a LmPDE
polypeplide or it may bind to intracellular proteins that bind to a LmPDE. The
compounds may also modulate the activity of a LmPDE gene, or modulate the
expression of s LmPDE gene or a LmPDE polypeptide. For example, such
compounds may bind to a LmPDE regulatory sequence and thus modulate
gene expression (see, e.g. Plate (1994) J. Biol. Chem. 269, 28558-28562).
[0140] Compounds that can be screened by the methods described in
the present invention include, but are not limited to, peptides and derivatives
thereof (e.g. peptidomimetics) that bind to a LmPDE polypeptide or otherwise
modulate its activity in any way. Such compounds may include peptides,
such as soluble peptides, including members of random peptide libraries (Lam
et al. (1991) Nature 354, 82-84; Houghten et al. (1991) Nature 354, 84-86),
and combinatorial chemistry-derived molecular libraries made of D-and/or L-
amino acids, phosphopeptides (including, but not limited to, members of
random or partially degenerate, directed phosphopeptide libraries; see, e.g.,
Songyang et al. (1993) Cell 72, 767-778), carbohydrates, and small organic or
inorganic molecules. Compounds that can be screened include, but are not
limited to, natural and synthetic products. A skilled artisan can readily
recognise that there is no limit as to the structural nature of the compounds
tested for binding to LmPDE polypeptides.
[0141] Candidate compounds that are tested for binding with LmPDE
polypeptides and/or modulating the activity of LmPDE polypeptides can be
randomly selected or rationally selected. As used herein, a compound is said
to be randomly selected when the compound is chosen randomly without
considering the specific sequences of the LmPDE polypeptide or nucleic acid.
-38-

WO 2005/023856 PCT/TB2004/003990
Examples of randomly selected agents are members of a chemical library, a
peptide combinatorial library, a growth broth of an organism, or plant extract
[0142] As used herein, a compound is said to be rationally selected
when the compound is chosen on a nonrandom basis that is based on the
sequence of the target site and/or its conformation in connection with the
compound's action. Compounds can be rationally selected by utilizing the
peptide sequences that make up the LmPDE polypeplide or by analyzing the
nucleotide sequence that encodes a LmPDE polypeptide.
[0143] Methods for rationally selecting a compound that modulates the
activity and/or expression of a LmPDE polypeptide include compuler modeling
or searching techniques. For example, compounds likely to interact with the
active site of a LmPDE polypeptide are identified. The active site of a LmPDE
polypeptide can be identified using methods known in the art including, for
example, analysis of the amino acid sequence of a molecule, and from a
study of complexes formed by a LmPDE polypeptide and a native substrate
(e.g. cAMP), Methods such as X-ray crystallography and NMR can be used
to solve the three-dimensional structure of a protein in order to identify
possible binding sites, including the active site of the natural substrate.
[0144] Computer-based modeling can be used to complete an
incomplete or insufficiently accurate structure. Modeling methods that can be
used are, for example, parameterized models specific to particular
biopolymers such as proteins or nucleic acids, molecular dynamics modeling
based on computing molecular motions, statistical mechanics models based
on thermal ensembles, or combined models. For most types of models,
standard molecular force fields, representing the forces between constituent
atoms and groups are necessary, and can be selected from force fields
known in the art. Information on incomplete or less accurate structures
determined as above can be incorporated as constraints on the structures
computed by these modeling methods.
[0145] Once the structure of the active site of a LmPDE polypeptide
has been determined, candidate modulating compounds can be identified by
searching databases containing compounds along with information on their
-39-

WO 2005/023856 PCT/TB2004/003990
molecular structure. The compounds identified in such a search are those
that have structures that match the active site structure, fit into the active site,
or interact with groups defining the active site. The compounds identified by
the search are potential LmPDE modulating compounds.
[0146] These methods may be used to identify improved modulating
compounds based on compounds that are known to modulate other PDEs.
The structure of the known compound is modified and modulating effects are
determined using experimental and computational methods as described
herein. The altered structure is compared to the active site structure of a
LmPDE polypeptide to determine or predict how a particular modification to
the compound will effect its interaction with that protein. Systematic variations
in composition, such as by varying side groups, can be evaluated to obtain
modified modulating compounds of preferred specificity or activity.
[0147] Examples of molecular modeling systems are the QUANTA
programs, e.g., CHARMm, MCSS/HOOK, and X-LIGAND (Molecular
Simulations, Inc., San Diego, Ca.). QUANTA provides a modeling
envinment for simulation and analysis of macromolecules and small organic
molecules.
[0148] The process of using experimental or predicted structural
information in a computer simulation to predirf the interactions of potential
modulating compounds is well known in the art. For example, see Rotivinen
et. al. (1998) Acta Pharm. Fenn. 97, 159-166; and McKinaly et al. (1989) Ann.
Rev. Pharmacol. Toxicol. 29, 111-122. Computer programs designed to
screen and cepict chemicals are available from companies such as MSI,
Allelix, Inc., and Hypercube, Inc. These applications are largely designed for
drugs specific to particular proteins; however, they may be adapted to the
design of drugs specific to identified regions of DNA or RNA. Commercial
sources of chemical libraries can be used as sources of candidate
compounds. Such chemical libraries can be obtained from, for example,
ArQule, Inc.
[0149] Compounds that modulate the activity and/or expression of a
LmPDE polypeptide may also be based on antisense constructs. Therapeutic
-40-

WO 2005/023856 PCT/TB2004/003990
techniques based on an antisense approach involve the design of
oligonucleotides that are complementary to LmPDE mRNAs. These
oligonucleotides bind the complementary transcripts and prevent translation.
Absolute (or total) complementarity is not required. An oligonucleotide may
function as an effective antisense construct as long as its sequence is
sufficiently complementary to be able to hybridize with RNA and form a stable
duplex. In the case of a double-stranded antisense nucleic acid molecule, a
single strand of the duplex may be tested, or triplex formation may be
assayed. The ability to hybridize will depend on both the degree of
complementarity and the length of the antisense nucleic acid. In general, the
longer the hybridizing nucleic acid, the more base mismatches with an RNA it
may contain and still form a stable duplex (or triplex, as the case may be).
One skilled in the art can determine a tolerable degree of mismatch by use of
standard procedures to determine the melting point of the hybridized complex.
[0150] Furthermore, several in vitro assays can be used to identify
compounde the modulate the expression and/or the activity of a LmPDE
polypeptide. Such assays typically involve preparation of a reaction mixture
comprising a LmPDE polypeptide and a test compound under conditions
sufficient to allow the two components to interact and bind, thus forming a
complex that can be detected and/or isolated. The binding of a compound
with a LmPDE polypeptide can be assayed using a shift in the molecular
weight or a change in biological activity of the unbound LmPDE polypeptide,
or the expression of a reporter gene in a yeast two-hybrid system (Fields et al.
(1989) Nature 340, 245-246). The method used to identify whether a
compound binds to a LmPDE polypeptide will be based primarily on the
nature of the LmPDE polypeptide used. For example, a gel retardation assay
can be used to determine whether a compound binds to a LmPDE
polypeptide. Alternatively, immunodetection and biochip (e.g., U.S. Patent
No. 4,777,019) technologies can be adopted for use with a LmPDE
polypeptide. An alternative method for identifying compounds that bind with a
LmPDE polypaptide employs TLC overlay assays using glycolipid extracts
from immune-type cells (Abdullah et al. (1992) Infect. Immunol. 60, 56-62).
-41-

WO 2005/023856 PCT/TB2004/003990
Furthermore, a decrease in LmPDE cAMP hydrolytic activity can be measured
to determine whether of not a particular compound is inhibiting a LmPDE. A
skilled artisan can readily employ numerous techniques known in the art for
determining whether a particular compound binds to a LmPDE polypeptide of
the invention. Such assays will typically make use of a control cell.
[0151] It is also possible to use cell-based assays to identify
compounds that interact with LmPDE polypeptides. Cell lines that naturally
express LmPDEs or that have been genetically engineered to express
LmPDEs can be used. For example, test compounds may be added to cell
cultures after which the hydrolysis of cAMP can be measured using standard
techniques known in the art. A decrease in the amount of hydrolysis in the
presence of a test compound compared to control cells that do not contain the
test compound indicates that the test compound is an inhibitor of LmPDE
activity.
[0152] Inhibitors of LmPDE expression may be identified by using a
chimeric gene in which a LmPDE nucleotide sequence is fused with a
reporter, such as firefly luciferase. Cultured cells that have been transformed
with the chimeric gene can be screened for the expression of luciferase
activity in the presence of test compounds. Compounds that inhibit luciferasa
activity in this high throughput assay can also be confirmed by direct
measurement for the presence of the endogenous LmPDE polypeptide (e.g.
by Western blotting) and LmPDE mRNA (e.g. by Northern blotting) using
methods that are well known in the art (see, e.g., Ausubel et at. (1994)
Current Protocols in Molecular Biology, Jonn Wiley & Sons). Candidate
compounds can be further tested in cell or tissue cultures as well as in animal
models. Cells expressing a LmPDE polypeptide, for example, can be
incubated with a test compound, after which cell lysates are prepared and
probed for the presence of the LmPDE polypeptide (e.g. using Western
blotting techniques). A decrease in the amount of LmPDE expression in
cultures treated with the test compound compared to control cultures without
the test compound indicates that the test compound is an inhibitor of LmPDE
expression.
-42-

WO 2005/023856 PCT/TB2004/003990
[0153] In vivo assays can also be used to test these compounds in
animal models of Leishmaniaa infection. Test compounds predicted to inhibit
LmPDE activity and/or expression are administered to the animals. The
treated animals can then be assayed for inhibition of LmPDE activity. Such
assays may be indirect or inferential. Improved health, for example, may
indicate the efficacy of a lest compound. Direct assays may also be
performed where a decrease in LmPDE expression can be measured by a
Northern blotting analysis. A decrease in the amount of LmPDE mRNA
present in the sample from treated animals compared to untreated control
animals indicates that the test compound inhibits LmPDE expression. A direct
assay may also be performed that measures the hydrolytic activity of a
LmPDE on cAMP. A decrease in hydrolysis of cAMP in the sample from
treated aninals compared to the untreated control animals indicates that the
test compound inhibits LmPDE activity.
[0154] LmPDE polypeptides which are used in the screening assays
described herein include, but are not limited to, an isolated LmPDE
polypeptide, a host cell that expresses a LmPDE polypeptide, or a fraction of
a host cell that expresses a LmPDE polypeptide.
[0155] The cellular extracts to be tested for binding with LmPDE
polypeptides and or modulating the activity of LmPDE polypeptides can be, as
examples, aqueous extracts of cells or tissues, organic extracts of cells or
tissues or partially purified cellular fractions. A skilled artisan can readily
recognize that there is no limit as to the source of the cellular extracts used in
the screening methods of the present invention.
[0156] Compounds that are identified as candidates for inhibiting the
activity and/or expression of a LmPDE polypeptide, when administered in a
therapeutically effective amount, may be useful for treating diseases and
reducing symptoms associated with the infection of Leishmania, such as
leishmsniasis. Toxicity and therapeutic efficacy of identified compounds that
modulate the activity and/or expression of a LmPDE polypeptide can be
determined by standard pharmaceutical procedures. For example, using
either cells in culture or experimental animals, the dose lethal to 50% of the
-43-

WO 2005/023856 PCT/TB2004/003990
population (LD50) can be determined. The dose ratio between toxic and
therapeutic effects is the therapeutic index and can be expressed as the ratio
LD50/ED50). Compounds with a large therapeutic index are preferred. While
compounds that have toxic side effects may be used, care should be taken to
design a celivery system that targets such compounds to the site of affected
tissue to minimize potential damage to uninfected cells and thus reduce side-
effects.
[0157] The data obtained from cell culture assays and animal studies
can be used in formulating a range of dosage for use in humans. The dosage
of such compounds lies preferably within a range of circulating concentrations
that include the ED50 with little or no toxicity. The dosage may vary within this
range depending upon the dosage form employed and the route of
administrations used. For any compound used in the method of the present
invention, the therapeutically effective dose can be estimated initially from cell
culture assays. A dose may be formulated in animal models to achieve a
circulating plasma concentration range that includes the IC50 as determined in
cell culture. Such information can be used to more accurately determine
useful doses in humans. Levels in plasma can be measured, for example, by
high performance liquid chromatography.
Generation of Transgenic Organisms
[0158] Another aspect of the invention provides transgenic organisms
comprising LmPDE nucleic acids. As used herein, a genetically modified
organism refers to an organism that has been altered from its natural state by
manipulation of the native nucleic acid sequences. For example, in one
application, PDE-deficient organisms can be generated using standard knock-
out procedures to inactivate an endogenous PDE. Alternatively, inducible
PDE anti-sense molecules can be used to regulate the activity and/or
expression of the endogenous PDE. An organism can also be produced so
as to contain a LmPDE-encoding nucleic acid molecule or an antisense-
LmPDE expression unit that directs the expression of a LmPDE polypeptide
-44-

WO 2005/023856 PCT/TB2004/003990
or the antisense molecule. In such cases, an organism is generated in which
the expression of the endogenous PDE gene is altered by inactivation and/or
replaced by a LmPDE gene. This can be accomplished using a variety of
procedures known in the art such as targeted recombination. Once
generated, the endogenous PDE-deficient organism that expresses a LmPDE
polypeptide can be used to (1) identify biological and pathological processes
mediated by LmPDE polypeptides, (2) identify proteins and other genes that
interact with LmPDE polypeptides, (3) identify compounds that can be
exogenously supplied to inhibit a LmPDE polypeptide, and (4) serve as an
appropriate screen for identifying mutations within LmPDE genes that
increase or decrease activity.
[0159] For example, in one embodiment, the endogenous PDE genes
in S. cerevisiae can be deleted, which results in intracellular accumulation of
cAMP. Organisms that accumulate high levels of intracellular cAMP cease to
grow when exposed to a heat shock, LmPDE nucleic acid molecules can
then be ctoned into a yeast expression vector and transfected into the PDE-
deficient strain of S. cerevisiae. Restoration of heat-insensitive growth is thus
a marker for LmPDE activity. Observing whether or not heat-insensitive
growth is restored to the transfected strain under various conditions can
indicate the effects these conditions have on LmPDE activity.
Uses of LmPDE Polypeptides
[0160] As discussed previously, the present invention provides cAMP-
specific PDEs from Leishmania, such as Leishmania major, including LmPDE-
A, LmPDE-B1, and LmPDE-B2 and fragments, variants, and mutants thereof.
It is known that cAMP plays a key role in cell growth and differentiation in this
parasite and that PDEs are responsible for the hydrolysis of this messenger.
Therefore, as discussed above, LmPDEs are targets for drug screening
assays and are useful in accomplishing selective drug design.
[0161] Additionally, the invention provides methods for monitoring the
course of disease or disorders associated with the presence of LmPDEs in a
-45-

WO 2005/023856 PCT/TB2004/003990
test subject by measuring the amount of a LmPDE polypeptide in a sample
from the test subject at various points in time. This is done for purposes of
determining a change in the amount of a LmPDE in the sample over time.
Monitoring the course of a disease or disorder over time may optimize the
timing, dosage, and type of treatment. In one embodiment, the method
comprises quantitativety determining in a first sample from the subject the
presence of a LmPDE polypeptide and comparing the amount so determined
with the amount present in a second sample from the same subject taken at a
different point in time, a difference in the amounts determined being indicative
of the course of the disease. Measuring the amount of LmPDE polypeptide
present in a sample can be performed using a variety of techniques well
known in the art, for example by using immunoassays as discussed below.
[0162] The present invention further provides methods for using
isolated and substantially purified LmPDE polypeptides as antigens for the
production of novel anti-LmPDE antibodies, and for using LmPDE
polypeptides for obtaining and detecting novel LmPDE ligands. The anti-
LmPDE antibodies are useful in diagnostic assays and kits for the detection of
naturally occurring LmPDE protein sequences present in biological samples.
Uses Of Nucleic Acid Molecules Encoding LmPDEs
[0163] The nucleic acid molecules encoding LmPDE polypeptides of
the invention are useful for a variety of purposes, including their use in
diagnosis and/or prognostic methods. The nucleic acid molecules and
polypeptides of the invention may be used to test for the presence and/or
amount of LmPDE nucleotide sequences and LmPDE polypeptides in a
suitable biological sample.
[0164] The nucleic acid molecules of this invention can be used in
various hybridization methods to identify and/or isolate nucleotide sequences
related to LMPDE nucleotide sequences, such as different polymorphic forms
and genom c sequences. Sequences related to a LmPDE nucleotide
sequence are useful for developing additional ligands and antibodies. The
-46-

WO 2005/023856 PCT/TB2004/003990
hybridization methods are used to identify/isolate DNA and RNA sequences
that are at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, or 99% identical to LmPDE nucleotide sequences, such as novel
LmPDE homologues, allelic variants, and mutant forms.
[0165] Nucleotide sequences that encode LmPDE polypeptides
described herein can be used as nucleic acid probes to retrieve nucleic acid
molecules having sequences related to LmPDEs.
[0166] In one embodiment, a LmPDE nucleic acid probe is used to
screen genomic libraries, such as libraries constructed in lambda phage or
BACs (bacterial artificial chromosomes) or YACs (yeast artificial
chromosomes), to isolate a genomic clone of a LmPDE gene. The LmPDE
nucleotide sequences from genomic libraries are useful for isolating upstream
or downstream non-coding sequences, such as promoter, enhancer, and
transcription termination sequences. The upstream sequences from a
LmPDE gene may be joined to non-LmPDE sequences in order to construct a
recombinant, DNA molecule that expresses the non-LmPDE sequence upon
introduction into an appropriate host cell. In another embodiment, a LmPDE
probe is used to screen cDNA libraries to isolate cDNA clones expressed in
certain tissues or cell types.
[0167] Additionally, pairs of oligonucleotide primers can be prepared for
use in a polymerase chain reaction (PCR) to selectively amplify or clone
nucleic acid molecules encoding LmPDE proteins, or fragments thereof. PCR
methods (U.S. Patent No. 4,965,188) that include numerous cycles of
denature/anneal/polymerize steps are well known in the art and can be readily
adapted for use in isolating LmPDE-encoding nucleic acid molecules.
[0168] In addition, the nucleic acid molecules of the invention may also
be empioyed in diagnostic embodiments, using LmPDE nucleic acid probes to
determine the presence and/or the amount of LmPDE sequences present in a
biological sample. One embodiment encompasses determining the amount of
LmPDE nudeotide sequences present within the suitable biological sample
such as in specific cell types, tissues, or body fluids, using a LmPDE probe in
a hybridizet on procedure. The amount of LmPDE nucleic acid molecules in
-47-

WO 2005/023856 PCT/TB2004/003990
the test sample can be compared with the amount of LmPDE nucleic acid
molecules in a reference sample from a normal subject. The presence of a
measurably different amount of LmPDE nucleic acid molecules between the
test and reference samples may correlate with the presence or with the
severity of a disease associated with abnormal levels (high or low) of LmPDE
nucleic acid molecules as compared to normal levels.
[0169] In another embodiment, monitoring the amount of LmPDE RNA
transcripts over time is effected by quantitatively determining the amount of
LmPDE RNA transcripts in test samples taken at different points in time. A
difference in the amounts of LmPDE RNA transcripts in the various samples is
indicative of the course of the disease associated with expression of a
LmPDE transcript.
[0170] To conduct such diagnostic methods, a suitable biological
sample from a test subject is contacted with a labeled LmPDE probe, under
conditions effective to allow hybridization between the sample nucleic acid
molecules and the probe. In a similar manner, a biological sample from a
normal subject is contacted with a LmPDE probe and hybridized under similar
conditions. The presence of the nucleic acid molecules hybridized to the
probe is detected. The relative and/or quantified amount of the hybridized
molecules may be compared between the test and reference samples. The
LmPDE probes can be labeled with any of several known detectable labels,
including radioactive, enzymatic, fluorescent, or chemiluminescent labels.
[0171] Many suitable variations of hybridization technology are
available for use in the detection of nucleic acids that encode LmPDE
polypeptides. These include, for example, Southern and Northern
procedures. Other hybridization techniques and systems are known that can
be used in connection with the detection aspects of the invention, including
diagnostic assays such as those described in Falkow et al. (U.S. Pat No.
4,358,535). Another hybridization procedure includes in situ hybridization,
where the target nucleic acids are located within one or more cells and are
contacted with the LmPDE probes. As is well known in the art, the cells are
prepared for hybridization by fixation, e.g. chemical fixation, and placed in
-48-

WO 2005/023856 PCT/TB2004/003990
conditions that permit hybridization of a LmPDE probe with nucleic acids
located within the fixed cell.
[0172] The nucleic acid molecules of this invention further provide anti-
sense-molecules that recognize and hybridize to a LmPDE nucleic acid.
Antisense polynucleotides are particularly useful in regulating the expression
of a LmPDE protein in those cells expressing a LmPDE mRNA. One
embodiment useful for this approach is an anti-sense molecule corresponding
to the N-terminal sequence ot the gene. The present invention includes such
full length and fragment anti-sense polynucleotides.
[0173] The polynucleotides of this invention further provide reagents to
develop animal models using "knock-out" strategies through homologous
recombination. Methods for generating knock-out animals that fail to express
a functional protein molecule are well known in the art (Capecchi (1989)
Science 244, 1288-1292), and may be used in studying the in vivo functions
of LmPDEs.
[0174] It is to be understood that both the foregoing general description
and the following examples are exemplary and explanatory only and are not
restrictive of the invention, as claimed. Moreover, it must be understood that
the invention is not limited to the particular embodiments described. Further,
the terminology used to describe particular embodiments is not intended to be
limiting, since the scope of the present invention will be limited only by its
claims.
[0175] The following examples are presented to illustrate the present
invention and to assist one of ordinary skill in making and using the same.
The methodology and results may vary depending on the intended goal of
treatment and the procedures employed. The examples are not intended in
any way to otherwise limit the scope of the invention.
-49-

WO 2005/023856 PCT/TB2004/003990
EXAMPLES
Example 1
[0176] The following example provides the methods used to identify
three cyclic nucleotide-specific phosphodiesterases from Leishmania major.
[0177] Two families of cAMP-specific PDEs from the protozoal parasite
Trypanosoma brucei had been previously characterized and identified
(Zoraghi et al. (2001) J. Biol. Chem. 276, 11559-11566; Zoraghi et al. (2002)
Proc. Natl. Acad. Sci. USA 99, 4343-4348; Gong et al. (2001) Mol. Biochem.
Parasitol. 116, 229-232); and Rascon et al, (2002) Proc. Natl. Acad. Sci.
U.S.A. 99, 4714-4719. Sequences representing each family were then used
to screen the Leishmania genome database
(http://www.genedb.org/genedb/leish). A BLAST search was performed using
the nucleotide sequence corresponding to the trypanosomal enzyme
TbPDE1, which identified a nucleotide sequence in Leishmania major that
shares 45.1% amino acid sequence identity (determined using the BESTFIT
utility of the GCG program suite with default parameters). This novel
sequence was labeled LmPDE-A. The gene for LmPDE-A is located within a
sequence cluster consisting of chromosomes 18, 20, and 22. A BLAST
search was also performed using the nucleotide sequence corresponding to
the trypanosomal enzyme TbPDE2C, which identified two closely related
sequences that were subsequently labeled LmP0E-B1 and LmPDE-B2.
LmPDE-B1 shares 70.2% amino acid identity with the query sequence
TbPDE2C, while LmPDE-B2 shares 69.8% overall sequence identity with
TbPDE2C. Overall amino acid sequence identity between LmPDE-B1 and
LmPDE-B2 is 84.5%. According to the Leishmania genome database, the
identified LmPDE-B1 and LmPDE-B2 loci are located on chromosome 15.
-50-

WO 2005/023856 PCT/TB2004/003990
Example 2
[0178] The following example provides the methods used to clone and
sequence the novel sequences identified in the Leishmania genome
database.
[0179] Based on the sequences identified in the Leishmania genome
database (as discussed in Example 1), PCR primers were designed to amplify
all three full-length genes from the genomic DNA of Leishmania major, PCR
primers were also designed to amplify only the open reading frame portion of
the three full-length genes. The primers were designed to contain a Sall site
for in-frame cloning into the pLT1 vector (where the ATG-initiation codon is
provided by the vector) and to code for a C-terminal hemagglutinin tag. For
LmPDE-A, the forward and reverse primers were designed as follows:
forward-5"-gtggtcgactcgacttfcttgagcag-3 (nucleotides 4-21 of the open
reading frame, which correspond to nucleotides 533-550 in Figure 2):
reverse-5'-cigggaatcctaagcataatctggaacatcatatggatacgagtcgtcgtggttgg-3
(nucleotide 1896-1877 of the open reading frame-which correspond to
nucleotides 2425-2406 in Figure 2 - and HA-tag). For LmPDE-B1, the
forward and reverse primers were designed as follows: forward -5'-gatgtcga
ctggcatatttcacggcca-3' (nucleotides 2-19 of the open reading frame, which
correspond to nucteotides 1268-1286 in Figure 4); reverse-5'-ctgggaatccta
agcataatctggaacatcatatggataaacaatcgagggtcggatg-3'(nucleotides 2792-2772
of the open reading frame-which correspond to nucleotides 4058-4038 in
Figure 4 - end HA-tag). For LmPDE-B2 the forward and reverse primers
were designed as follows: forward-5'-gatgtcgacattcagcggtcttttcc-3'
(nucleotides 3-21 of the open reading frame, which correspond to nucleotides
2184-2202 in Figure 6); reverse-5'-ctgggaatcctaagcataatctggaacatcatatggat
aaacaatcgaggatcggaig-3' (nucleolides 2822-2803 of the open reading frame-
which correspond to nucleotides 5003-4984 in Figure 6-and HA tag). The
genes of Leishmania major, as with other kinetoplastids, do not contain
introns. Accordingly, amplification of open reading frames directly from
genomic DNA is routinely performed (Beverlay (2003) Nat. Rev. Genet 4, 11-
-51-

WO 2005/023856 PCT/TB2004/003990
19). Both strands of all three PCR fragments (LmPDE-A, LmPDE-B1, and
LmPDE-B2) were then cloned via the TA-overhang into the vector pCR2.1-
TOPO following the instructions of the kit supplied by invitrogen. The clones
were then sequenced using the ABI PRISM Big Dye Terminator v3.0 Cycle
Sequencing Ready Reaction Kit (Applied Biosystems). Both strands of each
clone were sequenced at least two times for verification.
[0180] The full-length LmPDE-A nucleotide sequence, with a length of
10,966 nucleotides, is shown in Figure 2 where the open reading frame
begins with adenine at position 530 and ends with guanine at position 2425.
The corresponding amino acid sequence is set forth in Figure 1. The full-
length nucleotide sequence of LmPDE-B1, which is 7,095 nucleotides in
length, is shown in Figure 4, where the open reading frame begins with
adenine at position 1267 and ends with adenine at position 4059, and the
corresponding amino acid sequence is set forth in Figure 3. The full-length
nucleotide sequence of LmPDE-B2, which is 6,945 nucleotides in length, is
shown in Figure 6, where the open reading frame begins with adenine at
position 2182 and ends with adenine at position 5004. The amino acid
sequence that corresponds to this sequence is set forth in Figure 5.
[0181] The sequence of the cloned LmPDE-A coincided 100% with the
sequence present in the Leishmanie database. The predicted amino acid
sequence of LmPDE-A (Figure 1) shares 45.1% overall sequence identity with
the amino acid sequence of trypanosomal TbPDE1. The predicted amino
acid sequence of LmPDE-B1 (Figure 3) shares 70.2% overall sequence
identity with the trypanosomal TbPDE2C amino acid sequence, while the
predicted amino acid sequence of LmPDE-B2 (Figure 5) shares 69.8% overall
sequence identity with TbPDE2C. Using the Conserved Domain Search
Service provided by NCBI (see http://www.ncbi.nlm.nih.gov/Structure/ccd/
cdd.shtml) several conserved domains were identified in the LmPDE amino
acid sequences. As indicated in Figure 7, LmPDE-A contains a highly
conserved catalytic domain (PDEase) beginning with tyrosine at amino acid
position 384, and ending with praline at amino acid position 609. LmPDE-81
and LmPDE-82 also each contain a highly conserved PDEase domain,
-52-

WO 2005/023856 PCT/TB2004/003990
beginning with phenylalanine at amino acid position 647, and ending with
phenylalanine at amino acid position 880 (LmPDE-B1) and beginning with
phenylalanine at amino acid position 657, and ending with phenylalanine at
amino acid position 890 (LmPDE-B2). In addition to the PDEase domain.
LmPDE-B1 and LmPDE-B2 both have two GAF domains as shown in Figures
7B and 7C.
Example 3
[0182] The following example describes the methods used to evaluate
the genome organization of LmPDE-B1 and LmPDE-B2.
[0183] When the nucleotide sequences of the cloned LmPDE-B1 and
LmPDE-B2 genes were compared to the sequences present in the
Leishmania genome database, it was evident that the sequences in the
database had been assembled incorrectly. The 3'-untranslated regions of the
two genes liad inadvertently been swapped. The correct organization of
these two genes was then established by Southern biot analysis of a series of
restriction digests of L. major genomic DNA (as shown in Figures 8 and 9).
Lane 8 of each hybridization (Notl/Scal double digest) shall be used as an
example for the analytical reasoning. If the sequence assembly in the
database ware correct, a Notl/Scal double digest should yield a fragment of at
least 8 kb when hybridized with a LmPDE-B2-specific probe (since no Scal
restriction site is present in the immediate 3'-region of LmPDE-B2 gene). In
contrast to this prediction, the data show a 4 kb fragment is generated,
demonstrating the presence of a Seal restriction site close to the 3'-end of the
LmPDE-B2 gene. All additional digests shown in Figures 8 and 9 support, or
are compatible with this conclusion. In addition to establishing the genomic
organization of the LmPDE-B1 and LmPDE-B2 genes, these experiments
demonstrated that each is a single-copy gene. The hybridization probes used
in the Southern blotting analysis were as follows: LmPDE-A-specific:
nucleotides 462-910 of the open reading frame (corresponding to nucleotides
991-1439 in Figure 2); LmPDE-B1 -specific: nucleotides 96-489 of the open
-53-

WO 2005/023856 PCT/TB2004/003990
reading frame (corresponding to nucleotides 1362-1755 in Figure 4); LmPDE-
B2-specific; 106-417 of the open reading frame (corresponding to 2287-3936
in Figure 6). This analysis also confirmed that LmPDE-B1 and LmPDE-B2
are tandemly arranged and separated by about 5 kb on chromosome 15 as
shown in Figure 11.
Example 4
[0184] The following example provides the methods used to produce a
transgenic yeast strain, containing a LmPDE-A and a LmPDE-B1, wherein the
endogenous PDE activity was deleted.
[0185] The verified open reading frames of LmPDE-A and LmPDE-B1
were cloned into a yesst expression vector (pLT1, S. Kunz, unpublished) and
transfected into a Saccharomyces cerevisiae strain wherein both endogenous
PDE genes had previously been deleted (strain PP5: MATa leu2-3 leu2-112
ura3-52 his3-532 his4 cam pde1::URA3 pde2::HIS3; Coliceili et al. (1983)
Proc. Natl. Acad. Sci. U.S.A. 90, 11970-11974). The pLT1 expression vector
is a 2m-based yeast vector carrying a LEU2 selector gene. The cloning site is
flanked by a strong TEF2 promoter followed by an optimized Kozak box, and
by a Cyc1 terminator. PDE-deficient S, cerevisiae accumulate intracellular
cAMP which results in a heat-sensitive phenofype. In particular, no growth is
observed after a 15 minute heat shock at 55ºC. As shown in Figure 12, both
LmPDE-A and LmPDE-B1 fully complemented this phenotype and restored
heat-shock insensitive growth. For a heat-shock assay, patches were
streaked onto SC-met-ura plates and grown for 2 days at 30ºC. The patches
were then replicated onto a plate pre-warmed to 55ºC. The plate was
incubated fur an additional 15 min at 55ºC, let cool to room temperature and
was then incubated for 1-2 days at 30ºC. These findings demonstrate that
both LmPDE-A and LmPDE-B1 constructs produce active enzymes and that
both enzymes are capable of hydrolyzing cAMP. Subsequent experiments
demonstrated that LmPDE-B2 also fully complemented the heat-sensitive
-54-

WO 2005/023856 PCT/TB2004/003990
phenotype and restored heat-shock resistance (Johner et al. (submitted) J.
Biol. Chem.).
[0185] The open reading frames of LmPDE-A, LmPDE-B1, and;
LmPDE-B2 were cloned independently into a yeast expression vector (pLT1,
S. Kunz, unpublished) and transfected into a Saccharomyces cerevisiae strain
wherein the endogenous PDE genes had previously been deleted (strain PP5:
MATa leu2-3 leu2-112 ura3-52 his3-532 his4 cam pde1::URA3 pde2::HIS3;
Colicelli et al. (1993) Proc. Natl. Acad Sci. U.S.A. 90, 11970-11974). These
strains were deposited at the American Type Culture Collection (ATCC) on
August 25,2004, and have been assigned numbers PTA-6167.
and-, respectively.
Example 5
[0187] The following example provides the methods used to
characterize the catalytic activities of recombinant LmPDE-A, LmPDE-B1, and
LmPDE-B2. The example also provides the methods used to evaluate the
sensitivity of recombinant LmPDE-B1 and LmPDE-B2 to commercially
available PDE inhibitors.
Example 5.1: Preparation of Yeast Lysates
[0188]PP5 yeast cells expressing LmPDE-A, LmPDE-B1, and LmPDE-
B2, were lysed as described previously (Zoraghi et al. (2001) J. Biol. Chem.
276, 11559-11566). The cells were grown to mid-log to end-log phase in SC-
leu medium, collected, resuspended in the original volume of prewarmed YPD
medium, and incubated for an additional 3.5 hours at 30ºC to maximize
protein exprsssion. The cells were then harvested, washed twice in H2O,
pelleted by centrifugation, and stored overnight at -70ºC. The cell pellet was
thawed on Ice and resuspended in ice-cold extraction buffer (50 mM Hepes
pH 7.5,100 mM NaCl, 1X Complete protease inhibitor cocktail without EDTA
(Roche)). Cells were lysed by grinding with glass beads (0.45-0.50 mm) in 2
-55-

WO 2005/023856 PCT/TB2004/003990
ml Sarstedt tubes using a FastPrep FP120 cell disrupter (3 x 45 seconds at
setting 4). The lysed cells were centrifuged and glycerol was added to the
resulting supernatant to a final concentration of 15% (v/v). Aliquots were
snap-frozen in liquid nitrogen and were stored at -70ºC.
Example 5.2: Assay of PDE Activity in Yeast Lysates
[0189] PDE activity was determined in 50 mM HEPES, pH 7.5, 0.5 mM
EDTA, 10 mM MgCl2 and 50 mg/ml BSA in a final assay volume of 100 ml.
Each assay contained 50,000 cpm of 3H-labeled cAMP, with unlabeted cAMP
added to adjust the desired total substrate concentration. Reactions were
performed at 30ºC and were linear for at least 60 minutes. The standard
reaction time was set to 15 minutes, and the amount of enzyme was always
chosen so that no more than 15% of the substrate was hydrolyzed. Inhibitor
studies were done at a cAMP concentration of 1 mM. Inhibitors were
dissolved in DMSO, but the final DMSO concentration in the assays never
exceeded 1%. Control reactions with DMSO alone were always included.
Reactions were stopped by the addition of 25 ml of 0.5 N HCI. For the
subsequent dephosphorylation of the AMP, the stopped reactions were
neutralized with 20 ml of 1 M Tris base, followed by the addition of 10 ml of
alkaline phosphstase (Roche Diagnostics; 1 unit/10 ml). The
dephosphorylation reactions were incubated for 15 minutes at 37ºC and were
then applied to 1 ml columns of QAE-Sephadex A25 in 30 mM ammonium
formiate, pH 6.0. The 3H-adenosine formed ss a reaction product was eluted
with 1.6 ml of 30 mM ammonium formiate, pH 6.0 and was collected into 3.5
ml of Water-soluble scintillation fluid (Packard Ultima Flo). Assays were
performed in triplicate, and data were analyzed using the Graph Pad Prism
software package.
-56-

WO 2005/023856 PCT/TB2004/003990
Example 5.3: Activity and Specificity of LmPDEs
[0190] Lysates prepared from yeast expressing LmPDE-A consistently
showed no measurable PDE activity. This observation is consistent with the
finding that LmPDE-A is less efficient than LmPDE-B1 and LmPDE-B2 at
complementing the PDE deficiency of the host strain PP5. In addition, these
findings are very similar to the observations made with the trypanosomal
homologueTbPDE1. For example, TbPDE1 complemented the PDE
deficiency of PP5 cells but its effect was less than that of other trypanosomal
or human PDEs, and no enzymatic activity was detectable in the
corresponding yeast cell lysates (Kunz et al. (2004) Eur. J. Biochem. 271,
637-647).
[0191] In contrast to lysates from LmPDE-A expressing cells, lysates
from yeast strains expressing LmPDE-B1 and LmPDE-B2 showed strong
PDE activities. Both enzymes exhibited very similar KM values for eAMP that
were within the range of other class 1 PDEs (Zoraghl et al. (2001) J. Biol.
Chem. 276.11555-11566; Rascon et al. (2002) Proc. Natl. Acad. Sci. USA
99, 4714-4719; Zoraghi et al. (2002) Proc. Natl. Acad. Sci. USA 99, 4343-
4348; Francis et al. (2001) Prog. Nucleic Acid Res. Mol. Biol. 65, 1-52; Mou
and Cote (2001) J. Biol. Chem. 276, 27527-27534)._ In addition, the presence
of a 100-fold excess of cGMP did not affect the rate of hydrolysis of cAMP by
LmPDE-B1 (compare Figure 13B with Figure 13A). A 50-fold excess of the
reaction product 5'-AWP also had no effect on KM (nor Kcat,) (Figure 13C).
Similar results were obtained with LmPDE-B2 (data not shown). Therefore,
LmPDE-B1 and LmPDE-B2 are cAMP-specific PDEs.
[0192] These data are in good agreement with the finding that no
cGMP-hydrolyzing activity is detectable in whole cell extracts from Leishmania
major (data not shown). Because PDE-catalyzed hydrolysis is the only
mechanism by which a cell can dispose of its cyclic nucleotides (except for
possible export mechanisms; Guo et al. (2003) J. Biol. Chem. 278, 29509-
29514), the sbsence of a cGMP-hydrolyzing PDE activity from Leishmanial
cells suggests that cGMP signaling may not exist in Leishmania major.
-57-

WO 2005/023856 PCT/TB2004/003990
Example 5.4: Activity of LmPDEs in the Presence of PDE inhibitors
[0193] Figure 14 shows the effects of several commercially avaijable
PDE inhibitors (100 mM) on LmPDE-B1 and LmPDE-B2 activity in the
presence of 1 mM CAMP. Both enzymes were insensitive to the broad
spectrum PDE inhibitor IBMX but were psrtiy sensitive to trequinsin,
dipyridamole, and etszolate. Trequinsin and dipyridamote inhibited LmPDE-
B1 activity with IC50 values of 96.6 and 22.6 mM, respectively.
[0194] The observed inhibitor profile, including the fact that
dipyridamcle and trequinsin were the most potent compounds, closely
corresponcs to that reported previously for trypanosomal PDEs (Zoraghi et al.
(2001) J. Biol. Chem, 276, 11559-11566; Zoraghi et al. (2002) Proc. Natl.
Acad. Sci. USA 99, 4343-4348; Rascon et al. (2002) Proc. Natl. Acad. Sci.
USA 99, 4714-719). The fact that several potent and specific innibitors of
different human PDEs had no effect on the Leishmanial PDEs strongly
suggests that the development of Leishmania-specific PDE inhibitors is
feasible.
Example 6
[0195] The following example describes the methods used to determine
the effect of the PDE inhibitors dipyridamole, etazolate, and trequinsin on the
proliferation of L. major promastigotes in vitro.
[0196] L. major MHRO/IR/75/ER or LV39 promastigote forms were
cultured at 27ºC in SDM medium containing 5% heat-inactivated fetal bovine
serum (R. Brun and M. Schonenberger (1979) Acta Trop. 36.289-292). Cell
proliferation was assayed in 5 ml cultures containing various concentrations of
dipyridamole, etazolate, or trequinsin dissolved in DMSO (final concentration
of 1%v/v) or 1% v/v DMSO as a control. At various times, 150 mM anquots
were withdrawn and absorbance was measured at 600 nm in a microtiter
plate reader. Ths correlation between OD600 and cell number was strictly
linear over at east the range of 3 x 105 to 4 x 107 cells/ml.
-56-

WO 2005/023856 PCT/TB2004/003990
[0197] As shown in Figure 15, all three PDE inhibitors strongly inhibited
promasfigote proliferation with IC50 values of about 50 mM. The extent of
inhibition was independent of cell density, and the effect of the inhibitors was
not reduced by prolonged incubation of the cultures.
[0198] These results are consistent with the ability of dipyridamole,
etazolale, and trequinsin to inhibit the activity of recombinant LmPDE-B1 (see,
e.g., Figute 14). In addition, the data strongly suggest that LmPDE-B1 and
LmPDE-E2 are involved in the growth of L. major, and they further support the
development of Leishrnania-specific PDE inhibitors for the therapy of
leishmaniasis.
[0199] With respect to ranges of values, the invention encompasses
each intervening value between the upper and lower limits of the range to at
least a fenh of the lower limit's unit, unless the context clearly indicates
otherwise. Further, the invention encompasses any other stated intervening
values. Moreover, the invention also encompasses ranges excluding either or
both of the upper and lower limits of the range, unless specifically included in
the stated range.
[0200] Unless defined otherwise, the meanings of all technical and
scientific terms used herein are those commonly understood by one of
ordinary skill in the art to which this invention belongs. One of ordinary skill in
the art will also appreciate that any methods and materials similar or
equivalent to those described herein can also be used to practice or test the
invention. Further, all publications mentioned herein are incorporated by
reference.
[0201] It must be noted that, as used herein and in the appended
claims, the singular forms "a," "or," and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example, reference to "a
subject polypeptide" includes a plurality of such polypeptides and reference to
"the agent" includes reference to one or more agents and equivalents thereof
known to those skilled in the art, and so forth.
-59-

WO 2005/023856 PCT/TB2004/003990
[0202] Further, all numbers expressing quantities of ingredients,
reaction conditions, % purity, polypeptide and polynucleotide lengths, and so
forth, used in the specification and claims, are modified by the term "about."
unless otherwise indicated. Accordingly, the numerical parameters set forth in
the specification and claims are approximations that may vary depending
upon the desired properties of the present invention. At the very least, and
not as an attempt to limit the application of the docirine of equivalents to the
scope of the claims, each numerical parameter should at least be construed in
light of the number of reported significant digits, applying ordinary rounding
techniques. Nonetheless, the numerical values set forth in the specific
examples are reported as precisely as possible. Any numerical value,
however, inherently contains certain errors from the standard deviation of its
experimantal measurement.
[0203] Although the foregoing invention has been described in some
detail by way of illustrations and examples for purposes of clarity of
understanding, it will be apparent to those skilled in the art that certain
changes and modification may bs practiced. Therefore, the description and
examples of the disclosure should not be considered as limiting the scope of
the invention, which is defined by the scope of the appended claims. Other
aspects, advantages, and modifications are within the scope of the following
claims.

WE CLAIM:
1. A substantially purified protein comprising a phosphodiesterase (PDE) catalytic
domain of Leishmania-PDE-B1 comprising amino acids 647-880, as set forth in SEQ ID
NO: 3 or variants and mutants of the catalytic domain that are at least 80% identical to
amino acids 647-880 of SEQ ID NO: 3 and that hydrolyze cAMP.
2. A substantially purified protein comprising a PDE catalytic domain of
Leishmania-PDE-B2 comprising amino acids 657-890, as set forth in SEQ ID NO: 5 or
variants and mutants of the catalytic domain that are at least 80% identical to amino acids
657-890 of SEQ ID NO: 5 and that hydrolyze cAMP.
3. The substantially purified protein as claimed in claim 1, comprising the amino
acid sequence set forth in SEQ ID NO: 3 or variants and mutants thereof that are at least
80% identical to SEQ ID NO: 3 and that hydrolyze cAMP.
4. The substantially purified protein as claimed in claim 2, comprising the amino
acid sequence set forth in SEQ ID NO: 5 or variants and mutants thereof that are at least
80% identical to- SEQ ID NO: 5 and that hydrolyze cAMP.
5. A substantially purified nucleic acid molecule comprising a nucleic acid sequence
that encodes a protein as claimed in claim 1 or 2.
6. The nucleic acid molecule as claimed in claim 5, comprising a nucleic acid
sequence that encodes a protein as claimed in claim 3.
7. A nucleic acid molecule as claimed in claim 6, wherein the nucleic acid molecule
comprises the nucleotide sequence set forth in SEQ ID NO: 4 beginning with adenine at
position 1267 and ending with adenine at position 4059.
8. The nucleic acid molecule as claimed in claim 5, comprising a nucleic acid
sequence that encodes a protein as claimed in claim 4.

9. A nucleic acid molecule as claimed in claim 8, wherein the nucleic acid molecule
comprises the nucleotide sequence set forth in SEQ ID NO: 6 beginning with adenine at
position 2182 and ending with adenine at position 5004.
10. The nucleic acid molecule of claim 6 or 8, wherein the nucleic acid molecule is a
DNA molecule.
11. The protein as claimed in claim 3 or claim 4, or the nucleic acid as claimed in
claim 6 or 8, wherein the protein has a KM value from 1 to 2 μM for cAMP.
12. The protein as claimed in claim 3 or claim 4, or the nucleic acid as claimed in
claim 6 or 8, wherein the protein does not hydrolyze cGMP.
13. The protein as claimed in claim 3 or 4, or the nucleic acid as claimed claim 6 or 8,
wherein the protein substantially hydrolyzes cAMP in the presence of up to about 100
μM of a phosphodiesterase inhibitor chosen from cilostamide, zaprinast, etazolate, Ro-
20-1724, rolipram, isobutylmethyixanthine (IBMX), 8-methoxymethyl-IBMX,
papaverine, milrinone, petoxifylline, and erythro-9-(2-hydroxy-3-nonyl)adenine.
14. A vector comprising the nucleic acid molecule as claimed in claim 6 or 8.
15. The vector as claimed in claim 14, wherein the nucleic acid molecule is operably
linked to at least one expression control sequence.
16. A host vector system comprising the vector as claimed in claim 14, in a suitable
microbial host cell.
17. The host vector system as claimed in claim 16, wherein the suitable host cell is a
bacterial cell.
18. The host vector system as claimed in claim 16, wherein the microbial host cell is
Saccharomyces cerevisiae.

19. An antibody, or antibody fragment comprising an antigen-binding site that
recognizes and selectively binds a protein as claimed in any of claims 1, 2, 3, or 4.
20. An antibody as claimed in claim 19, wherein the antibody is a monoclonal
antibody or a polyclonal antibody.
21. An antibody as claimed in claim 20, wherein the antibody is chimeric, humanized,
or human.
22. A method of producing a PDE protein comprising culturing the host vector system
as claimed in claim 16, under suitable conditions so as to produce the PDE protein in the
host and recovering the PDE protein so produced.
23. A method for identifying a compound that modulates the expression of a protein
as claimed in claim 3 or 4, the method comprising:

(a) incubating a cell that can express said protein with a compound under
conditions and for a time sufficient for the cell to express said protein
absent the compound;
(b) incubating a control cell under the same conditions and for the same time
absent the compound;
(c) measuring expression of said protein in the cell in the presence of the
compound;
(d) measuring expression of said protein in the control cell; and
(e) comparing the amount of expression of said protein in the presence and
absence of the compound, wherein a difference in the level of expression
indicates that the compound modulates expression of said protein.
24. The method as claimed in claim 23, wherein the compound decreases the
expression of said protein.

25. A method of identifying a compound that modulates the activity of a protein as
claimed in claim 3 or 4, the method comprising:
(a) contacting a sample that has Leishmania-PDE activity with a compound
under conditions and for a time sufficient for the sample to express PDE
activity absent the compound;
(b) incubating a control sample under the same conditions and for the same
time absent the compound;
(c) measuring PDE activity in the cell in the presence of the compound;
(d) measuring PDE activity in the control sample; and
(e) comparing the amount of PDE activity in the presence and absence of the
compound, wherein a difference in the level of activity indicates that the
compound modulates PDE activity.
26. The method as claimed in claim 23 or 25, wherein the compound decreases PDE
activity.

Documents:

00773-kolnp-2006-abstract.pdf

00773-kolnp-2006-claims.pdf

00773-kolnp-2006-description complete.pdf

00773-kolnp-2006-drawings.pdf

00773-kolnp-2006-form 1.pdf

00773-kolnp-2006-form 3.pdf

00773-kolnp-2006-form 5.pdf

00773-kolnp-2006-international publication.pdf

00773-kolnp-2006-international search report.pdf

00773-kolnp-2006-pct others.pdf

00773-kolnp-2006-pct request.pdf

00773-kolnp-2006-priority document.pdf

00773-kolnp-2006-sequence listing.pdf

773-KOLNP-2006-ABSTRACT.pdf

773-kolnp-2006-amanded claims.pdf

773-KOLNP-2006-CLAIMS.pdf

773-KOLNP-2006-CORRESPONDENCE 1.1.pdf

773-KOLNP-2006-CORRESPONDENCE.pdf

773-KOLNP-2006-DESCRIPTION (COMPLETE).pdf

773-KOLNP-2006-OTHERS 1.1.pdf


Patent Number 245235
Indian Patent Application Number 773/KOLNP/2006
PG Journal Number 02/2011
Publication Date 14-Jan-2011
Grant Date 10-Jan-2011
Date of Filing 30-Mar-2006
Name of Patentee UNIVERSITY OF BERN
Applicant Address 2-9 KANDA TSUKASA-MACHI, CHIYODA-KU, TOKYO 101-8535,JAPAN.
Inventors:
# Inventor's Name Inventor's Address
1 JOHER, ANDREA BRUEGGBUEHLSTRASSE 28 G,CH-3172 NIEDERWANGEN, SWITZERLAND.
2 SHAKUR, YASMIN 2206 KING'S GARDEN WAY, FALLS CHURCH, VA 22043, UNITED STATES OF AMERICA.
3 SEEBECK, THOMAS PANORAMAWEG 17 CH-3042 ORTSCHW ABEN, SWITZERLAND.
PCT International Classification Number C07K 14/44
PCT International Application Number PCT/IB2004/003990
PCT International Filing date 2004-09-03
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 60/582,584 2003-06-25 U.S.A.
2 60/500,244 2003-09-05 U.S.A.
3 60/504,070 2003-09-19 U.S.A.