Title of Invention

"RECOMBINANT BCG VACCINE"

Abstract The present invention relates to a recombinant BCG vaccine being transformed with an expression vector that has a polynucleotide of SEQ ID NO. 3 encoding an immunodeficiency virus antigenic polypeptide wherein the polynucleotide is a modified one in which third position of each codon is substituted with G or C without changing the amino acid.
Full Text Technical Field
The present invention relates to a recombinant BCG vaccine. More particularly, the present invention relates to a recombinant BCG vaccine capable of inducing a sufficient immune response against a foreign antigen protein at low doses.
Background Art
A bovine tubercle bacillus attenuated BCG strain (Mycobacterium boms BCG, hereinafter referred to as "BCG") has been known as the most common live bacteria vaccine because of its safety.
On the other hand, as gene recombinant technologies have been keenly developed and improved for these ten and several years, there have been many studies for modifying microorganisms such as viruses and bacteria to produce a foreign antigen protein and using them as vaccine vectors for preventing and treating various kinds of infectious diseases and cancers. Regarding BCG, for example, recombinant BCG vaccines targeted to human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) have been also reported (J. Immunol. 164: 4968-4978, 2000, J. Virool. 71: 2303-2309, 1997, and Infect Immun. 57: 283-288, 1989).
The BCG strain is considered as a candidate for providing an excellent
recombinant vaccine because of its safety and easy supply. However, the conventional recombinant BCG vaccine has not always been sufficient in its capability of inducing immunity to infection, cancer, or the like to be provided as a target. For example, in the case of immunizing a guinea pig with a recombinant BCG vaccine targeted at HIV-1, it should be dosed 10 to 100 times higlier than a typical dosage (0.05 to 0.1 mg) of BCG vaccine generally used for human (Proc. Natl. Acad. Sci. USA. 92: 10698-10697, 1995).
On the other hand, in the recombinant vaccine, as means for providing a foreign antigen with high immunogenicity, the optimization of codon is attempted. Those are, the codon optimizations, such as losteriolysin O of Listeria monocytogenes (J. immunol 161: 5594-5599, 1998), HIV-1 Gag (J. Virol. 75: 10991-11001, 200; J. Virol. 74: 2628-2635, 2000), Env (J. Virol. 72: 1497-1503, 1998), tetanus toxin (Vaccine 19: 810-815, 2000), LI protein of human papilloma virus (J. Virol. 75: 9201-9209, 2001), merozoite surface protein 1 of falciparum malaria protozoan {Plasmodium falcipparum) (Infect. Immun. 69: 7250-7253, 2001). However, these codon optimizations are those obtained by humanized codons for each amino acid of antigens. In addition, those recombinant vaccines are also DNA vaccines (naked DNA), so that there is no report at all about effects of the codon optimization in vaccine predominantly composed of other recombinant vector of BCG strain or the like.
The invention of the present application has performed in consideration of circumstances described above, and addresses to provide a recombinant BCG vaccine which is excellent in the expression amount of an antigenic protein and, as a consequence, capable of inducing a sufficient immune response to the target infectious disease, cancer, or the like even though the dosage thereof is almost equal to that of typical BCG vaccine.
Disclosure of the Invention
As an invention to solve the above problem, the invention of the present application is to provide a recombinant BCG vaccine being transfonned with an expression vector that has a polynucleotide encoding a foreign antigenic protein, wherein the polynucleotide is a modified one in which a third position of each codon is substituted with G or C without a change of an amino acid.
In this recombinant BCG vaccine, as one of preferred modes, the triplets of each codon in the modified polynucleotide are substituted so as to include G and C as much as possible without a change in type of an amino acid.
In this invention, the term "polypeptide" means a molecule constructed of phosphoric esters of the respective nucleosides (ATP, GTP, CTP, UTP; or dATP, dGTP, dCTP, dTTP) being bonded together, in which purine or pyrimidine is in P-N-glycoside linkage with a sugar. In addition, the term 'protein" or "peptide" means a molecule constructed of a plurality of amino acid residues bonded with each other through amide bonds (peptide bonds).
Other terms and concepts in the present invention will be defined concretely in the description of embodiments and examples of the invention. In addition, various kinds of techniques to be vised for carrying out. the invention can be easily and reliably conducted by a person skilled in the art in accordance with known publications or the like, except for particular techniques cited the sources thereof. For instance, genetic engineering and molecular biological techniques are described in Sambrook and Maniatis, in Molecular Cloning - A Laboratoiy Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel, F. M. et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., 1995, and so on.
Brief Description of Drawings
Fig. 1 shows nucleotide sequences and deduced amino acid sequence alignments of p24 gene from pNL4-3 and synthetic p24 gene with mycobacterial optimal codons (optimized). For cloning to pUC-hspK vector, the BamHl and ApaL restriction sites were attached at both 5'- and 3'-terminus of each DNA fragments. Asterisks indicated identical sequences to pNL4-3 p24 gene. Ter. termination codon.
Fig. 2 shows structure of expression vectors pSO-p24Mu and -p24Wt. (A) Schematic representation of expression units of HIV-1 p24. Each arrow and solid square exhibits transcriptional direction of hsp60 promoter and terminator. Grey, solid and open bars show DNA fragment of mycobacteria, synthetic p24 gene, and PCR fragment of p24 gene, respectively. (B) Details of expression vectors pSO-p24Mu and -p24Wt. On-M and Km1 indicate mycobacterial replication origin and kanamycin resistance genes, respectively.
Fig. 3 shows comparison of p24 expression level and growth rate between rBCG-p24Mu and -p24Wt. (A) Anti-p24 monoclonal antibody (V107) reactive proteins were visualized by western blot. Lanes: 1, lysate of rBCG-p24Wt; 2, lysate of rBCG-p24Mu; 3, lysate of harboring pS0246 (negative control). (B) Comparison of p24 concentration in whole cell lysates of rBCG-p24Mu and -p24Wt. rBCG cells were harvested from one ml of each culture periodically, sonicated and applied to commercial p24 antigen EIA. Solid and open squares were indicated rBCG-p24Mu and -p24Wt respectively. The data were represented as mean ± s.d. of different clones. (Q Kinetics of growth rates in recombinant clones. One ml of each culture was collected periodically, measured O.D. at 470 nm and calculated cell densities from the absorbance, described below; Density (jug/ml) = Absorbance at 470 nm x 1412.3 + 73.063. The cfu were translated from densities, and plotted. Solid square,
open square, and open circle were indicated rBCG-p24Mu, -p24Wt, and -pS0246, respectively. The data were represented as mean ± s.d. of different clones.
Fig. 4 shows cellular and humoral immune responses in mice immunized with rBCGs. (A) Lymphocyte proliferation against Gag p24 overlapping peptides. The proliferative activity was showed by stimulation index (SI). Solid and open columns indicate SI values of rBCG-p24Mu and -p24Wt-immunized mice. The data were represented as mean SI + s.d. of groups of mice. Asterisks indicated statistical significance (*, p Best Mode for Carrying Out the Invention
The recombinant BCG vaccine of this invention contains a recombinant BCG as an active ingredient, where the recombinant BCG is transformed with an expression vector that has a polynucleotide encoding a foreign antigenic protein. The polynucleotide encoding the foreign antigenic protein is characterized in that it is a modified polypeptide in which the third position of the codon encoding each of amino acid residues is substituted with G (guanine) or C (cytosine) under the conditions of which the amino acid residues in the amino acid sequence of the
antigenic protein being coded are not changed.
The substitutions in the respective codons are shown in Table 1 in a concretive manner (the column of "optimal codon"). That is, for example, there are four codons for encoding glycine (Gly): GGT, GGC, GCA, and GGG. The Gly codon agreed with the above criteria is GGC or GGG. Therefore, the Gly codon in the amino acid sequence of some antigenic protein is GGT or GGA, the third T (thymine) or A (adenine) is substituted with C or G.
Table 1

(Table Removed)
In this invention, a preferable mode is that all positions in each codon is substituted so as to include G or C as much as possible under the conditions in which the type of an amino acid residue encoded by such a codon is not changed. Such a kind of the substitution can be applied on leucine (Lue) and arginine (Arg). That is, among the optimal codons shown in Table 1, CTC or CTG is preferably selected as a Leu codon rather than the codon (TTG) containing two "T's. In
addition, CGC or CGG is preferably selected as an Arg codon rather than the codon (AGG) containing "A".
The codon substitution as described above is based on the following findings. That is, it is known that the BCG genome consists of DNA with a high G + C contents and the third position of the codon strongly prefers GC pair (J. Virol. 75: 9201-9209, 2001; Infect. Immun. 57: 283-288, 1989). Furthermore, from the accumulated information on BCG genes (Nucl. Acids Res. 28: 292, 2000), it is also known that the AGA codon for Arg and the TTA codon for Leu are less frequently used (0.9% and 1.6% of total codons, respectively). On the other hand, for instance, it is known that HIV-1 prefers an AT pair at the third position of the codon. In other words, in the coding sequence of the HIV-1 p24 gene, 9 out of 11 Arg codons use AGA and 6 out of 18 Leu codons use TTA. It is generally known that the preference of frequency in codon usage is correlated with the amount of corresponding aminoacyl tRNA in unicellular organisms (Nature 325: 728-730, 1987; Mol. Biol. Evol. 2: 13-34, 1985). It is considered that the amount of the aminoacyl tRNA for the Arg codon (AGA) and the Leu codon (TTA), which are preferred for the HIV-1 p24 gene, would be quite low in the BCG cell.
Accordingly, the present invention is designed to substitute a foreign antigenic polypeptide so as to become a base sequence agreed with the frequency of codon usage particularly preferable for the BCG cell (i.e., the third position of the codon is G or C, and furthermore the codon contains G or C as much as possible).
For introducing a preferable base substitution corresponding to each codon into the polynucleotide, the well-known Kunkel method (Proc. Natl. Acad. Sci. USA 82: 488, 1985 and Methods in Enzymology 154: 367, 1987), well-known methods such as one using a mutation kit, a mutation-inducing type PCR method, and so on may be applied.
For the BCG strain, one well-known in the art used in a vaccination against tuberculosis can be targeted. In addition, the expression vector to be introduced into the BCG strain may be one used for the conventional preparation of recombinant BCG vaccine, such as a BCG vector (e.g., plasmid pS0246). An expression vector can be constructed by inserting a polynucleotide that encodes any foreign antigenic protein (i.e., other than BCG) into a cloning site of this vector. Furthermore, in the following description, the foreign antigenic protein may be described as a "foreign polypeptide", the polypeptide that encodes such an foreign protein may be described as "foreign polynucleotides". Furthermore, the foreign polypeptide may be designed so as to be connected with any promoter and terminator sequences derived from the BCG strain (e.g., promotor and terminator sequence of heat shock protein derived from the BCG strain) to favorably express the foreign polypeptide.
The foreign polynucleotide is a polynucleotide (e.g., cDNA fragment) that encodes an antigenic protein, except for the BCG strain. The foreign polypeptide may be any of those capable of inducing an antigen-antibody reaction in vitro. Concretely, the targets may include a gag precursor p55 or p24 protein, an env protein gpl20 or gp 160, a pol precursor protein, an nef protein, and a tat protein of the human immunodeficiency virus (HIV) which is a causative virus of the acquired immunodeficiency syndrome (AIDS). In addition, it may be also used in a similar antigenic polypeptide derived from the simian immunodeficiency virus (SIV). Alternatively, polypeptides that encode antigenic proteins of other pathogens (other pathogenic viruses and bacteria), or tumor cells may be used.
As a method of preparing a foreign porynucleotide, a polynucleotide, which is a substantial sequence of a cloned plasmid in which a genomic gene or a cDNA thereof that encodes a foreign polypeptide, may be cut off from such a cloned plasmid by means of an appropriate enzyme, or it may be obtained by
A
means of amplification with the polymerase chain reaction (PCR) using a primer having an appropriate sequence. If it is not cloned, in the case of virus, bacterial or animal genomic DNA having the gene can be obtained by amplifying a DNA fragment by the above PCR using DNA or RNA as a template, which is originated from an animal cell infected with the virus.
The expression vector constructed as described above is introduced into the BCG strain by a well-known method such as a calcium chloride method or an electroporation, and then the expression of a foreign polypeptide from a transformed bacterium is confirmed by the western blotting or a well-known immunoassay (e.g., ELISA) to prepare the recombinant BCG of the present invention.
The recombinant BCG constructed as described above is suspended in a liquid carrier just as in the case of the typical BCG vaccine to prepare the recombinant BCG vaccine.
Examples
Hereinafter, the invention of the present application will be described in more detail and concretely by representing examples thereof. However, this application is not limited by the following examples.
1. Materials and Methods 1.1. Reagent
All enzymes and Escherichia coli HB101 competent cell for recombinant DNA procedure were purchased from Takara Bio Inc. (Tokyo, Japan). Primers for wild-type p24 gene amplification were from ESPEC Oligo Service Co. Ltd. (Tsukuba, Japan). Anti-HIV-1 Gag p24 monoclonal antibody, V107 was kindly
provided by Dr. Ikuta, Osaka University, Osaka, Japan. Alkaline
phosphatase-conjugated anti-mouse IgG for western immunoblot assay was purchased from New England Biolabs, Inc. (Beverly, MA).
1.2. Construction of HIV Antigen-expression Vector and Transformation of BCG Gene manipulation was done using E. coli HB101 competent cell. Mycobacterial strain used in this study was BCG-Tokyo vaccine strain. Culture media for rBCG were Middlebrook 7H9 broth containing albumin dextrose complex (7H9-ADC; BBL Microbiology Systems, Cockeyville, MD). A DNA fragment encoding hsp60 gene of BCG (Infect. Immun. 55:1466-75, 1987) was cloned into Smcd-SaR sites of pUC18 (pUC-hsp60). A synthetic DNA fragment which corresponds to multi-cloning site and terminator region of hsp60 gene was cloned into Munl-Kpnl sites of pUC-hsp60 and then inserted KprH linker at EcoRI site giving rise to pUC-hspK vector. The gag p24 gene of subtype B virus was amplified by PCR from pNL4-3 plasmid (J. Virol. 59:284-291, 1986) by using primers as follows: AATGGATCCTATAGTGCAGAACCTC (SEQ ID No. 1; forward, with underlined BamHl site) and AATGGGCCCTTACAAAACTCTTGCTTTATGG (SEQ OID No. 2; reverse, with underlined Apal site). The PCR product was cloned to BamHl-Apal sites of pUC-hspK in frame (pUC-hspK-p24Wt).
On the other hand, the whole p24 gene was chemically synthesized with preferable codons in BCG (SEQ ID No. 3) and then cloned to the same sites of pUC-hspK vector (pUC-hspK-p24Mu). Alignment of wild-type p24 sequence from pNL4-3 and synthesized p24 sequence are shown in Figure 1. These vectors were digested with KpriL and a small fragment containing p24 expression unit named hsp-p24Wt and hsp-p24Mu (Fig. 2 A), were subcloned into a Kpnl site of the stable E. co/j'-mycobacteria shuttle vector pS0246 (FEMS Microbiol. Lett. 135:237-243, 1996). Resulting plasmids were named pSO-p24Wt and -p24Mu, respectively. Schematic outline of expression vector construction is shown in Figure 2 B. These plasmids and pS0246 were transformed into BCG using Gene-Pulser (Bio-Rad Laboratories Inc., Hercules, CA) according to Proc. Natl.
Acad. Sci. USA 85:6987-6991, 1988 and transformants were selected on Middlebrook 7H10 agar supplemented with OADC enrichment (BBL Microbiology Systems) plate containing 20 pg/ml of kanamycin. The resulting recombinant clones harboring pSO-p24Wt, -p24Mu and pS0246 were designated as rBCG-p24Wt, -p24Mu and -pS0246 respectively.
1.3. Western Blot Analysis
Transformants of rBCGs were grown in 7H9-ADC broth for 2 weeks. A portion of culture media were collected, sonicated and applied to sodium dodecyl sulphate-polyacrylamide gel electrophoresis using Multi Gel 4/20 (Daiichi Pure Chemical Co. Ltd., Tokyo, Japan). Fractionated proteins were electroblotted onto a nitrocellulose membrane filter (Bio-Rad Laboratories Inc.), reacted with V107 monoclonal antibody (J. Gen. Virol. 73:2445-2450, 1992), and then probed with anti-mouse IgG conjugated with alkaline phosphatase and developed NBT (nitro blue tetrazolium chloride) /BOP (5-bromo-4-chloro-3-indolyl phosphate, toluidine salt) substrate (Roche Diagnostics GmbH, Penzberg, Germany).
1.4. Detection of Gag p24 Antigen in rBCGs
Transformants of rBCGs were grown in 7H9-ADC broth. A portion of culture media were periodically collected and sonicated. P24 antigen concentration in cell extract was determined by commercial antigen ELA (HIVAG-1MC, Abbott Laboratories, Abbott Park, IL). Expression of HIV Gag p24 protein was represented as p24 protein concentrations (ng) per 108 colony-forming units (cfu) of bacilli.
1.5. Delayed-type hypersensitivity (DTH) reaction in guinea pig
Hartley strain female guinea pigs (body weight: ca. 350 g) were immunized with 0.1 0.5 5 mg of rBCG subcutaneously in 0.1 ml of saline) (n=3). To investigate DTH skin reactions, 0.1 |.ig of the purified protein derivative of tuberculin (PPD), 10 |iig or l(.ig of the recombinant HlVme Gag p24 protein (rp24;
Immuno Diagnostics, Inc. Woburn, MA) per 100 (.d of saline were injected intradermally into the rBCG-immunized guinea pigs, respectively. Saline was used for the negative control. After 24 hours, a skin reactions were measured.
1.6. Mice and Immunization
Female BALB/c (H-2d) mice, 6-8 weeks of age were purchased from Charles River Japan Inc. (Yokohama, Japan). Mice were acclimated to the experimental animal facility for more than 1 week before using experiment and maintained in the facility under pathogen-free conditions and were maintained according to the institutional animal care and use guidelines of the National Institute of Infectious Diseases (NIID), Japan. The study was conducted in a biosafety level 2 facility under the approval of an institutional committee for biosafety and in accordance with the requirements of the World Health Organization.
1.7. Preparation of Single-cell Suspension
All mice were sacrificed at 10 weeks post inoculation (p.i.). Single-cells from spleen were isolated by gently teasting the tissue through a cell strainer (Becton Dickinson, Franklin Lakes, NJ). After hemolytication, the cells were resuspended in complete medium (CM; RPMI 1640 supplemented with 10% heat-inactivated FCS, 5.5 x_ 10 5 M 6-mercaptoethanol, 50 U/ml penicillin and 50 Hg/ml streptomycin).
1.8. Lymphocyte Proliferation
Single-cell suspensions were adjusted to 2 x 106 cells/ml in CM. Equal volume of cells and CM or CM with HIV-HXB2 Gag overlapping peptide (NIH AIDS Research & Reference Reagent Program) at 50 Mg/ml were mixed to give a final concentration of 1 * 106 cells/ml in media alone or media with peptide at 25 fig/ml. Used overlapping peptides were pi 1 (LERFAVNPGLLETSE; SEQ ID No. 4) through p35 (NIQGQMVHQAISPRT; SEQ ID No. 5) that covered Gag p24 region, pooled five
peptides each or all of them for stimulation. Then cell suspension with or without the peptides were added to round-bottom 96-well plates (Corning Inc., Corning, NY) in triplicate and incubated at 37°C, 5% CO2 in air humidified environment for 48 h. The final 6 h before harvesting, 1.0 jaCi of [3H]Thymidine were added and harvested onto grass-fiber filters (GF/C; PerkinElmer Life Science Inc., Boston, MA), and wells were counted by liquid scintillation counter (TopCount; PerkinElmer Life Science Inc.).
1.9. ELISPOT Assay
HIV Gag p24- and PPD-specific IFN-. secreting cells were assessed by Mouse IFN-. Development Module and ELISpot Blue Color Module (R&D Systems Inc., Minneapolis, MN). Briefly, single-cell suspensions from spleen were cultured in CM with or without 25 Mg/ml of pooled Gag overlapping peptide (pi 1-35), 5 |ig/ml of rp24 or 2.5 fig/ml of tuberculin purified protein derivatives (PPD) for 48 h at 37°C, 5% CO2 in air humidified environment. After incubation, cells were washed once with RPMI 1640 medium, and resuspended in CM. For detection, 96-well nitrocellulose plates (Millititer HA; Millipore Co., Bedford, MA) were coated with capture antibody at 4°C overnight and washed with PBS. After blocking with CM for 3 h, 100 ^l of pre-stimulated cells were added at varying concentrations into each well and incubated for 16 h at 37°C, 5% CO2 in air humidified environment. Then plates were washed with PBS containing 0.05% Tween 20 (PBS-T) and incubated with detection antibody. After incubation overnight at 4°C, the plates were washed with PBS-T and incubated with alkaline phosphatase-conjugated streptavidin for 2 h at room temperature. After washing with PBS-T, the plates were developed at room temperature with NBT/BCIP substrate. Then plates were washed with water and dried, and then spot forming cells (SFCs) were quantified. Wells were imaged and SFCs were counted using the KS ELISPOT compact system (Carl Zeiss, Berlin, Germany). A SFC was defined as a dark blue spot with a fuzzy border (J. Virol. 76:875-884, 2002). To determine significant levels, a baseline for each stimulant was established using
the average and standard deviation of the number of SFC for each stimulant. A threshold significance value corresponding to this average plus two standard deviations was then determined. A response was considered positive if the number of SFC exceeded the threshold significance level of the sample with no stimulant.
1.10. ELISA
Plasma was obtained by centrifugation of blood at 10,000 g for 5 minutes. All samples were store at -80°C until use. PPD- and p24-specific IgG titers in plasma were determined by an endpoint ELISA. 96-well microliter plates (MaxiSorp™; Nunc A/S, Roskilde, Denmark) were coated with 1 Mg/ml of rp24 or PPD in carbonate-bicarbonate buffer (35 mM NaHC03, 15 mM Na2C03) 0.02% NaN3, pH9.6) and incubated at 4°C overnight. The wells were blocked with PBS-1% BSA at 4°C overnight and then plates were washed 3 times with PBS-T. The dilutions of plasma starting at 1/24 were made with PBS-1% BSA, and duplicate diluents were then added at 100 pl/well into antigen-coated wells. After incubation at 4°C overnight, the plates were washed and incubated with 1/2000 PBS-T dilution of horse radish peroxidase-conjugated goat anti-mouse IgG (H+L) (Southern Biotechnology Associates, Inc., Birmingham, AL). After 2 h incubation at 37°C, the plates were washed and developed at room temperature with tetramethyl-benzidine substrate (TMB+; DakoCytomation A/S, Copenhagen, Denmark) for 15 min in the dark. Then reactions were terminated by addition of 1 M HC1, 0.5 M H2SO4. Endpoint titers were expressed as the reciprocal log2 of the highest dilution, which gave an optical density at 450 nm (OD450) of > 0.100 OD unit above OD450 of negative controls.
2. Results
2.1. Mycobacterial Codon-optimization of HIV-1 Gene and Construction of Its
Expression Vector
The synthetic modified p24 gene was designed as shown in Fig. 1. The
total G+C content of a coding region was 67.4%, which was higher than 43.4% of the wild-type p24 gene originated from pNL4-3. These two genes were cloned to the pUC-hspK vector (Fig. 2 A) and they were subcloned into pS0246 (Fig. 2 B). Each of the expression vectors was transformed into the BCG-Tokyo vaccine strain with the hsp60 promoter, and the rBCG-p24Mu with optimal codon usage of HIV gene and rBCG-p24Wt with wild-type codon usage were selected, respectively.
2.2. rBCG Significantly Enhances HIV Gene Expression by Insertion of
Codon-optimized HIV Gene In Vitro
To compare the expression level of HIV-1 gag p24 gene between the two types of the BCG-HIV recombinants, we studied kinetics of both growth curve of the cultured rBCG cells and production ability of the HIV antigen by detecting p24 antigen protein (Fig. 3). At 2-wk culture periods, recombinant p24 protein in each of the lysates of rBCG-p24Mu and -p24Wt were detected to be a single band at the same approximately 24 kDa by Western blot analysis (Fig. 3 A). The p24 antigen expression level of rBCG-p24Mu was markedly elevated to be 175.0 ± 25.1 ng/ 108 cfu of bacilli at more than 37.0-fold higher in rBCG-p24Mu than that (4.7 ± 0.3 ng/ 108 pfu of bacilli) in rBCG-p24Wt (Fig. 3 B). Both rBCG-p24Wt and -p24Mu draws normal BCG growth curve compared with that of rBCG-pS0246 control transformant and peaked at 21 days of the cell culture (Fig. 3 C), suggested that the p24 antigen generation was correlated with the growth rate in the culture of rBCG-p24Mu. Thus, the BCG recombinant inserted with the codon-optimized HIV gag p24 gene was successfully generated to be capable of remarkably high expression at almost 200 ng of p24 antigen/ 108 cfu bacilli or 200ng of p24 antigen/ lmg of bacilli.
2.3. DTH reaction in guinea pig
To evaluate effect of improved p24 expression to immune responses, at first, the DTH skin reaction in quinea pig was tested. In the previous report (Proc.
Natl. Sci. USA 92: 10693-10697, 1995), it was necessary to inject 5 mg for
detecting a rBCG-V3Jl to detect V3 epitope-specific DTH reaction. However, as
shown in Table 2, in the case of using rBCG-p24Mu that produces the improved
p24, a remarkable DTH reaction against p24 was detected by 0.1 mg amount
injection just as in the case of the injection of 5 mg rBCG-V3Jl. By the way, any
differential reactivity between rBCG-p24Mu-immunized and
rBCG-p24Wt-immunized guinea pigs could not be observed.
Table 2
Sensitivity of HIV-1 Gag antigen-specific DHT induction in rBCG-p24-immunized
guinea pig

(Table Removed)
2.4. High Virus-Specific Immune Responses Were Elicited by Immunization with Low- dose of the Codon-optimized rBCG
The possibility of the low-dose immunization of BCG recombinant with the codon-optimized gene expression was tested. Thirty BALB/c mice were divided 3 groups with ten mice for each 3 groups of animals were immunized with rBCG-p24Mu, rBCG-p24Wt and rBCG-pS0246 at concentration of 0.01 and 0.1 mg of rBCG intrademally (i.d.) with 5 animals per each dose, respectively. Five more mice were received saline alone and used as normal healthy control. At 10 weeks p.i., lymphocyte proliferation and IFN-y ELISPOT cell generation in immunized animals were examined. Same study was repeated three times and all the three results were summarized.
In the lymphocyte proliferative response, significant activities (stimulation index was 5.04 and 4.02) were obtained with pooled peptides #2 (p 16-20) and pooled total p24 peptides #1-5 (pi 1-35) in rBCG-p24Mu immunized mice. With 0.1 mg of the rBCG-p24Mu immunization, the lymphocyte proliferative responses to pool #2 and pool #1-5 increased to 10.08 and 8.05, respectively. In contrast, any significant virus-specific proliferation in 0.01 mg and 0.1 mg of rBCG-p24Wt immunized mice could not be detected (Fig. 4 A). These in vivo differences of proliferative responses between rBCG-p24Mu and -p24Wt were statistically significant comparing pool #2 and pool #1-5 [p = 0.0102 and 0.0014) respectively. Any proliferation activities were not detected in rBCG-pS0246-immunized mice (data not shown).
In addition, p24-specific IFN- . secreting cells were determined by ELISPOT assay. Both pooled p24 peptides (pool #1-5) and rp24-specific SFCs were detected in 0.1 mg of rBCG-p24Mu and -p24Wt-immunized mice, but not in similar dosage of rBCG-pS0246 immunized mice (Fig. 4 B). These responses from rBCG-p24Mu-imrnunized mice were 375 ± 202 SFC/ 106 splenocytes by stimulation with peptides and 483 ±138 SFC/ 106 splenocytes by stimulation with rp24, that were much higher than those from rBCG-p24Wt did (93 ± 25 and 227 ± 120 SFC/106 splenocytes, respectively). These differences between rBCG-p24Mu and -p24Wt were statistically significant comparing also peptides and rp24 (p = 0.0327 and 0.0313) respectively. The PPD-specific SFCs were highly detected in all the mice tested (670 ± 180 SFC/106 splenocytes).
Sera from all animals immunized with 0.1 mg of rBCG-p24Mu, rBCG-p24Wt and rBCG-pS0246 were assessed for HIV Gag p24 antigen-specific anubody generation at 10 weeks p.i. by endpoint antibody-ELISA against ip24 and PPD (Fig. 4 Q. The antibodies against rp24 were generated generally low in animals immunized with the rBCG-p24Mu and -p24Wt: the anti-p24 antibody titer in sera of rBCG-p24Mu-immunized mice and rBCG-p24Wt were at titers of 28 and 2675, respectively. Moreover, PPD-specific antibody titers were similarly detected in immunized animals around the titer of 210. Thus, virus-specific
cell-mediated immunity was significantly induced on the initial immune response, whereas its antibody response was low.
Industrial Applicability
As described above in detail, the invention of this application provides a recombinant BCG vaccine having an excellent expression rate of antigen protein and, as a result, capable of inducing a sufficient immune response against target infectious disease, cancer, or the like at the same dose as that of the typical BCG vaccine.



CLAIMS
1. A load lock arrangement for a vacuum treatment installation with lock chambers (EKl, EK2) and a first pump device (P1) for evacuating a first lock chamber and a second pump device (P2,P3) for evacuating a second lock chamber, characterised in that the load lock arrangement is provided for a continuously operating, continuous coating installation with at least two lock chambers arranged behind one another for carrying out a two-or multi-stage locking process, wherein the first pump device (1I) is connected by means of closable conduits (1,2) both to the first (EKl) and also the second (EK2) lock chamber so that the first pump device can evacuate either the first or the second lock chamber or both lock chambers together.
2. A load lock arrangement is claimed in Claim 1, characterised in that a third pump device (P4a, b) is provided, which is connected by means of appropriately closable conduits (6, 7) to the first (P1) and the second (P2) pump device so that the third pump device can be cormected downstream in series with either the first or the second pump device or both pump devices.
3. A load lock device is claimed in Claim 1, characterised in that the first pump device (P1) is connected by means of closable conduits (3) to the second pump device (P2, P3) so that the first pump device can be connected in series downstream of the second pump device.
4. A load lock arrangement is claimed in Claim 3, characterised in that a third pump de-vice(P4) is provided, which is connected by means of appropriately closable conduits (6) to the second pump device (P2, P3) so that the third pump device can be connected in series downstream of the second pump devices.
5. A load lock device as claimed in one of the preceding claims, characterised in that the pump devices include a plurality of pumps connected in parallel and/or in series.

6. A load lock arrangement as claimed in Claim 1 of the preceding claims, characterised in that the pump devices include oil sealed and/or dry vacuum pumps, particularly vane pumps, disc piston pumps, locking slide pumps, rotary piston pumps, dry-operating pumps, particularly screw pumps, Roots pumps, particularly inlet pre-cooled Roots pumps.
7. A load lock arrangement as claimed in one of the preceding claims, characterised in that the pumps connected in parallel in a pump device have a closable bypass (8), by means of which at least one of the pumps can be connected in series with respect to the others to form a multistage pump stand.
8. A load lock arrangement as claimed in one of the preceding claims, characterised in that one or more high vacuum pumps (PH1, PH2, PHS) are arranged on the lock chamber adjacent to the process chamber by means of closable conduits.
9. A load lock arrangement as claimed in one of the preceding claims, characterised in that connected in parallel with one pump device, particularly the second pump device, there is a differential pressure-controlled bypass flap (K2), which, in the event of high pressure on the outlet side, particularly in the second lock chamber (EK2) constitutes a bypass from the outlet side to the inlet side of the pump device (P2, P3, P5), so that a preferably adjustable, critical maximum differential pressure across the parallel connected pump device is not exceeded and the vacuum capacity of the pump device is used continuously in pressure-dependant manner.
10. A load lock arrangement as claimed in one of Claims 1 or 3 to 9, characterised in that the first pump device (PI) with one or more single- or multi-stage vacuum pumps connected in parallel, particularly of the type usable in the atmosphere, is connected by means of a first conduit (1), which includes a first valve (1), to the first lock chamber (EKl) and by means of a second conduit, which includes a second valve, to the second lock chamber (EK2) and by means of a third conduit (3), which includes a third valve (V5), to the second pump device (P2, P3), wherein the second pump device includes

one or more single- or multi-stage vacuum pumps, which are connected in parallel and are connected by means of a fourth or further conduits (4), each of which includes a fourth valve (V3,V4), to the second lock chamber (EK2) and wherein the pumps, which are connected in parallel, of the second pump device are connected together by means of fifth conduits (5) with a respective fifth valve (V7).
11. A load lock arrangement as claimed in Claim 10, characterised in that at the outlet side of the second pvimp device, (P2,P3), particularly at the fifth conduit (5) connecting the pumps (P2,P3) of the second pump device, the third pump device (P4) is connected to one or more single- or multi-stage vacuum pumps, which are connected in parallel, by means of a sixth conduit (6) with a sixth valve (V6), which is preferably provided.
12. A load lock arrangement as claimed in Claim 10 or 11, characterised in that the first pump device includes rotary disc pumps, the second pump device includes Roots pumps and the third pump device includes two-stage Roots pump stands or a single-stage pump stand with rotary disc pumps.
13. A load lock arrangement as claimed in one of Claims 10 to 12, characterised in that provided between the fourth (14) and the fifth (5) conduit there is a seventh conduit (8) with a seventh valve (VI1) so that a pump (P5), which is connected in parallel, of the second pump device can be connected in series with respect to the other pumps.
14. A load lock arrangement for a vacuum treatment installation with lock chambers (EKl, EK2) and a first pump device (PI) for evacuating a first lock chamber (EKl) as claimed in one of the preceding claims, characterised in that the load lock arrangement is provided for a continuously operating continuous coating installation with at least two lock chambers (EKl, EK2) arranged behind one another for carrying out a two- or multistage locking process and a buffer device (EBl) is provided, which is connected to the first lock chamber (EKl) by means of closable conduits (1,8).

15. A load lock arrangement as claimed in Claim 14, characterised in that the buffer device (EBl) includes a fifth pump device (P6), which evacuates the buffer volume.
16. A load lock arrangement as claimed in one of Claims 14 or 15, characterised in that the first pump device (PI) is connected to the buffer device (EBl).
17. A load lock arrangement as claimed in one of Claims 14 to 16, characterised in that the buffer device (EBl) is connected to the second lock chamber (EK2) by means of clos-able conduits (2,8).
18. A load lock arrangement as claimed in one of the preceding claims, characterised in that a second buffer device (EB2) is present, which is connected to the second lock chamber (EK2) by means of closable conduit.
19. A load lock arrangement as claimed in Claim 18, characterised in that associated with the second buffer device (EB2) there is a sixth pump device (P7), which evacuates the buffer volume of the second buffer device (EB2).
20. A load lock arrangement as claimed in one of Claims 1,2 or 5 to 9 or 14 to 19, characterised in that the first pump device (PI) with one or more single- or multi-stage vac-uimi pumps, particularly of the type usable in the atmosphere, which are connected in parallel is connected to the first lock chamber (EKl) by means of a first conduit (1), which includes a first valve (VI), and to the second lock chamber (EK2) by means of a second conduit (2), which includes a second valve (V2), wherein the second pump device (P2,P3) includes one or more single- or multi-stage vacuum pvumps, which are connected in pzu'allel and are connected to the second lock chamber (EK2) by means of a fourth or further conduits (4), which include a respective fourth valve (V3,V4), and wherein the outlet side of the second pump device (P2,P3) and the first pump device (PI) are connected by meeins of a sixth conduit (6) with a sixth valve and by means of an eighth conduit (7) with an eighth valve (V8), respectively to the third pump device

(P4) with one or more single- or multi-stage vacuum pumps (P4a, P4b), which are connected in parallel.
21. A load lock arrangement as claimed in Claim 20, characterised in that the first pump device and the second pump device include Roots pumps and the third pump device includes dry running pumps, particularly screw pumps.
22. A load lock arrangement as claimed in one of the preceding claims, characterised in that the first and second lock chambers are arranged adjacent to one another and, in particular, are the first and second lock chambers of a two-stage or three-stage lock or the second and third lock chambers of a three-stage lock.
23. A load lock arrangement as claimed in one of the preceding claims, characterised in that the lock chambers are provided in the charging or discharging region.
24. A load lock arrangement as claimed in one of the preceding claims, characterised in that the closable conduits include valves, by means of which the conduits may be sealed in gas-tight manner.
25. A method of operating a multi-stage load lock arrangement as claimed in one of the preceding claims, characterised in that the method of operating a multi-stage load lock arrangement with two lock chambers (EK1,EK2) arranged behind one emother is for carrying out a two- or multi-stage process, wherein a first pump device (PI) is used not only for evacuating a first lock chamber (EKl) but also for evacuating a second lock chamber (EK2), wherein within a cycle firstly only the first lock chamber, subsequently the first and second lock chambers and then only the second lock chamber are evacuated.
26. A method is claimed in Claim 25, characterised in that a second pump device, (P2,P3) is additionally and/or alternatively used for evacuating the second lock chamber (EK2)

wherein the first pump device (PI) is also used as a downstream pump stage of the second pump device for the second lock chamber.
27. A method is claimed in Claim 25, characterised in that a second pump device (P2,P3) is used additionally and/or alternatively for evacuating the second lock chamber, wherein a third pump device (P4a,P4b), is connected dovmstream of the first and second pump device, which forepumps the first or the second pump device alternately or both of them.
28. A method is clamed in Claim 25 to 27 of operating a multi-stage load lock arrangement as claimed in one of Claims 14 to 24, characterised in that a first lock chamber (EKl) experiences an abrupt pressure reduction as a result of pressure equalisation with an evacuated buffer device.
29. A method is claimed in Claim 24 to 28, characterised in that a second lock chamber (EK2) serves as an internal buffer so that the pressure in the first lock chamber (EKl) is reduced abruptly as a result of abrupt pressure equalisation between the evacuated second lock chamber (EK2) and the first lock chamber (EKl).
30. A method is claimed in one of Claims 24 to 29, characterised in that a multi-stage, particularly two-stage, pressure equalisation occurs as a result of a successive sequence of pressure equalisation with external and/or internal buffer devices, particularly a pressure equalisation as a result of a direct sequence of the steps in accordance with the characterising portion of Claims 28 and 29.
31. A method is claimed in one of Claims 24 to 30, characterised in that the pressure in the second lock chamber (EK2) is abruptly reduced as a result of pressure equalisation between an evacuated second buffer device (EB2) and the second lock chamber (EK2).

Documents:

576-delnp-2005-abstract.pdf

576-DELNP-2005-Assignment-(28-06-2012).pdf

576-delnp-2005-assignment.pdf

576-DELNP-2005-Claims-(19-01-2009).pdf

576-DELNP-2005-Claims.pdf

576-delnp-2005-complete specification (as-files).pdf

576-delnp-2005-complete specification (granted).pdf

576-DELNP-2005-Correspondence Others-(28-06-2012).pdf

576-DELNP-2005-Correspondence-Others-(19-01-2009).pdf

576-delnp-2005-correspondence-others.pdf

576-delnp-2005-correspondence-po.pdf

576-DELNP-2005-Description (Complete).pdf

576-DELNP-2005-Drawings.pdf

576-delnp-2005-form-1.pdf

576-delnp-2005-form-13.pdf

576-DELNP-2005-Form-16-(28-06-2012).pdf

576-delnp-2005-form-18.pdf

576-DELNP-2005-Form-2.pdf

576-DELNP-2005-Form-3-(19-01-2009).pdf

576-delnp-2005-form-3.pdf

576-delnp-2005-form-5.pdf

576-delnp-2005-form-6.pdf

576-delnp-2005-gpa.pdf

576-DELNP-2005-Other Documents-(19-01-2009).pdf

576-delnp-2005-pct-210.pdf

576-delnp-2005-pct-306.pdf

576-delnp-2005-pct-308.pdf


Patent Number 243283
Indian Patent Application Number 576/DELNP/2005
PG Journal Number 41/2010
Publication Date 08-Oct-2010
Grant Date 01-Oct-2010
Date of Filing 15-Feb-2005
Name of Patentee JAPAN SCIENCE AND TECHNOLOGY AGENCY,
Applicant Address 1-8, HONCHO 4-CHOME, KAWAGUCHI-SHI, SAITAMA, JAPAN
Inventors:
# Inventor's Name Inventor's Address
1 MITSUO HONDA 5-11, SHIMORENJAKU 2-CHOME, MITAKA-SHI, TOKYO, JAPAN
2 KAZUHIRO MATSUO 403, 29-3, NAKANOSHIMA 6-CHOME, TAMA-KU, KAWASAKI-SHI, KANAGAWA, JAPAN
3 MASARU KANEKIYO 25-12, CHUO 3-CHOME, NAKANO-KU, TOKYO, JAPAN,
PCT International Classification Number A61K 39/04
PCT International Application Number PCT/JP2003/010303
PCT International Filing date 2003-08-13
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 2002-237610 2002-08-16 Japan