Title of Invention

A PROCESS FOR THE PRODUCTION OF RECOMBINANT SOLUBLE TUMOR NECROSIS FACTOR RECEPTOR

Abstract The present invention provides a method for producing tumor necrosis factor (TN F) binding receptors that can be used to suppress TNF mediated inflammatory diseases. In brief the present invention provides the DNA nucleotide sequence encoding the extracellular domain of the human tumor necrosis factor receptor (TNFRII or p75) fused to the Fc portion of the human immunoglobulin IgG 1. In addition the present invention also provides a method for the development of a stable mammalian cell line over-expressing the recombinant TNFR:Fc fusion protein comprising of the extracellular domain of the human tumor necrosis factor receptor superfamily, member IB (p75) and the Fc domain of human IgGI. The present invention also provides recombinant expression vectors comprising the DNA sequences defined above, produced using the recombinant expression vectors and processes for producing the recombinant TNFR:Fc fusion protein using the specified expression vectors. The present invention also provides methods to obtain purified TNFR:Fc fusion protein from cell-culture supernatants of mammalian cell lines transfected with. the recombinant expression vectors encoding the recombinant TNFR:Fc fusion' protein. The present invention also provides therapeutic compositions comprised of effective quantities of the recombinant TNFR:Fc fusion protein that has been prepared according to the foregoing processes.
Full Text TNF polypeptides initiate their biological effects by binding to specific Tumor necrosis factor receptor (TNFR) proteins expressed on plasma membrane of nearly every cell. Two distinct forms of TNFR are known to exist with molecular weights of 55 kDa and 75 kDa respectively. A description of the isolation and characterization of the cDNA clones of the TNFRs can be obtained from Loetscher et al. The two TNFR types TNFRI (75 kDa) and TNFRII (55 kDa) can bind to both TNF-a and TNF-p. Historically, based on the chronological order of discovery, the 75 kDa receptor had been referred to as TNFRI and the 55kDa receptor had been designated as TNFRII. According to the present nomenclature system that is widely followed in the relevant literature, the 55 kDa receptor is referred to as TNFRI and the 75kDa receptor is designated as TNFRII.
The ubiquitous expression, in conjunction with cell-specific effector molecules that are triggered by the TNF-R, explains the variety of effects of TNF, which include apoptosis, the de novo synthesis of transcription factor proteins and lipid-related inflammatory molecules. Inappropriate production of TNF or sustained activation of TNF signaling has been implicated in the pathogenesis of a wide spectrum of human diseases, including sepsis, cerebral malaria, diabetes, cancer, osteoporosis and autoimmune diseases such as rheumatoid arthritis, multiple sclerosis and inflammatory bowel diseases (Chen and Goeddel, 2002).
Several lines of evidence implicate TNF-[alpha] and TNF-[beta] as major inflammatory cytokines. These known TNFs have important physiological effects on a number of different target cells which are involved in inflammatory responses to a variety of stimuli such as infection and injury. The proteins cause both fibroblasts and synovial cells to secrete latent coUagenase and prostaglandin E2 and cause osteocyte cells to stimulate bone resorption. These proteins increase the surface adhesive properties of endothelial cells for neutrophils. They also cause endothelial cells to secrete coagulant activity and reduce their ability to lyse clots. In addition they redirect the activity of adipocytes away from the storage of lipids by inhibiting expression of the enzyme lipoprotein lipase. TNFs also cause hepatocytes to synthesize a class of proteins known as "acute phase reactants," which act on the hypothalamus as pyrogens (Selby et al. (1988), Lancet, 1(8583):483; Starnes, Jr. et al. (1988), J. Clin. Invest., 82:1321; Oliff et al. (1987), Cell, 50:555; and Waage et al. (1987), Lancet, 1(8529):355). Additionally, preclinical results with various predictive animal models of inflammation, including rheumatoid arthritis, have suggested that inhibition of TNF can have a major impact on disease progression and severity (Dayer et al. (1994), European Cytokine Network, 5(6):563-57I and Feldmann et al. (1995), Annals Of The New York Academy Of Sciences, 66:272-278). Moreover, recent preliminary human clinical trials in rheumatoid arthritis with inhibitors of TNF have shown promising results (Rankin et al. (1995), British Journal Of Rheumatology, 3(4): 4334-4342; Elliott et al. (1995), Lancet, 344:1105-1110; Tak et al. (1996), Arthritis and Rheumatism, 39:1077-1081; and Paleolog et al. (1996), Arthritis and Rheumatism, 39:1082-1091).
RA is an autoimmune disease in which the immune system attacks normal tissue components as if they were invading pathogens. This illness affects about 1% percent of the world's population. The inflammation associated with rheumatoid arthritis primarily attacks the linings of the joints. However, the membranes lining the blood

vessels, heart, and lungs may also become inflamed. The hands and feet are most often affected, but any joint lined by a membrane may be involved.
While a T cell mediated, antigen-specific process is held critical to the initiation of RA, sustained inflammation is at least equally dependent on cytokine production by synovial macrophages and fibroblasts which may act on each other in an autocrine or paracrine manner. TNF-a and interleukin-1 (IL-1) are the major macrophage-derived cytokines present in the rheumatoid joint and both induce the synthesis and secretion from synovial fibroblasts of matrix-degrading proteases, prostanoids, interleukin-6 (IL-6), interleukin-8 (lL-8) and granulocyte-macrophage colony stimulating factor (GM-CSF). Consequently, attention has focused on inhibition of TNF-a as a way to treat RA,
It is estimated that 10 million people in India suffer from RA, which makes 1% of the total population. The cost of existing treatment for RA using protein-based drugs in India is 13.7 lakhs per annum with no known import substitute.
Protein inhibitors of TNF are disclosed in the art. EP 308 378 reports that a protein derived from the urine of fever patients has a TNF inhibiting activity. The effect of this protein is presumably due to a competitive mechanism at the level of the receptors. EP 308 378 discloses a protein sufficiently pure to be characterized by its N-terminus. The reference, however, does not teach any DMA sequence or a recombinantly-produced TNF inhibitor.
Recombinantly produced TNF inhibitors have also been taught in the art. For example, EP 393 438 and EP 422 339 teach the amino acid and nucleic acid sequences of a mature, recombinant human "30 kDa TNF inhibitor" (also known as a p55 receptor and as sTNFR-I) and a mature, recombinant human "40 kDa inhibitor" (also known as a p75 receptor and as sTNFR-II) as well as modified forms thereof, e.g., fragments, functional derivatives and variants. EP 393 438 and EP 422 339 also disclose methods for isolating the genes responsible for coding the inhibitors, cloning the gene in suitable vectors and cell types, and expressing the gene to produce the inhibitors. Mature recombinant human 30 kDa TNF inhibitor and mature recombinant human 40 kDa TNF inhibitor have been demonstrated to be capable of inhibiting TNF (EP 393 438, EP 422 339, PCT Publication No. WO 92/16221 and PCT Publication No. WO 95/34326).
Soluble TNF Receptor I and Soluble TNF Receptor 11 are members of the nerve growth factor/TNF receptor superfamily of receptors which includes the nerve growth factor receptor (NGF), the B cell antigen CD40, 4-lBB, the rat T-cell antigen MRC OX40, the Fas antigen, and the CD27 and CD30 antigens (Smith et al. (1990), Science, 248:1019-1023). The most conserved feature amongst this group of cell surface receptors is the cysteine-rich extracellular ligand binding domain, which can be divided into four repeating motifs of about forty amino acids and which contains 4-6 cysteine residues at positions which are well conserved (Smith et al. (1990), supra).
EP 393 438 further teaches a 40 kDa TNF inhibitor [Delta]51 and a 40 kDa TNF inhibitor [Delta]53, which are truncated versions of the full-length recombinant 40 kDa TNF inhibitor protein wherein 51 or 53 amino acid residues, respectively, at the

carboxyl terminus of the mature protein are removed. Accordingly, a skilled artisan would appreciate that the fourth domain of each of the 30 kDa TNF inhibitor and the 40 kDa inhibitor is not necessary for TNF inhibition. In fact various groups have confirmed this understanding. Domain-deletion derivatives of the 30 kDa and 40 kDa TNF inhibitors have been generated, and those derivatives without the fourth domain retain full TNF binding activity while those derivatives without the first, second or third domain, respectively, do not retain TNF binding activity (Corcoran et al. (1994), Eur. J. Biochem., 223:831-840; Chih-Hsueh et al. (1995), The Journal of Biological Chemistry, 270(6):2874-2878; and Scallon et al. (1995), Cytokine, 7(8):759-770). [0010] Due to the relatively low inhibition of cytotoxicity exhibited by the 30 kDa TNF inhibitor and 40 kDa TNF inhibitor (Butler et al. (1994), Cytokine, 6(6):616-623), various groups have generated dimers of TNF inhibitor proteins (Butler et al. (1994), supra; and Martin et al. (1995), Exp. Neurol., 131:221-228). However, the dimers may generate an antibody response (Martin et al. (1995), supra; and Fisher et al. (1996), The New England Journal of Medicine, 334(26):1697-1702).
References
1. ChaddHE, ChamovSM: CurrentOpinBiotechnol, 2001; 12:188-194.
2. Gertu, Yan G, Zhang G: Biophys Biochem Res Commun, 1996; 229: 295-298.
3. KozakM, Nucleic Acid Res, 1984; 12: 857
4. Source: http://www.fda.gov
5. WeikertSetal Nature Biotechnol 1999; 17: 176-180.
6. Chen K etai. Biotechnol Bioeng, 2001; 72: 55-61.
7. Irani Netal. Biotechnol Bioeng, 1999; 66: 238-246
8. Fussenegger Metal Nature Biotechnol, 1998; 16: 468-472.
9. Koster Metal. Cytotechnology, 1995; 18: 65-75.
10. Josic D etal J.chromatol. B Biomed. Appl, 1994; 662: 181-190.
BRIEF DESCRIPTION OF THE DRAWINGS:
Figure 1 shows the nucleotide sequence encoding the extra-cellular domain of the TNFRI (p75). The sequence is 771 bp long. The underlined region encodes the leader peptide which will facilitate the secretion of the protein into the culture medium
ATGGCGCCCGTCGCCGTCTGGGCCGCGCTGGCCGTCGGACTGGAGCTCTGGGCTGCGGCGCACGCCTTG CCCGCCCAGGTGGCATTTACACCCTACGCCCCGGAGCCCGGGAGCACATGCCGGCTCAGAGAATACTAT GACCAGACAGCTCAGATGTGCTGCAGCAAATGCTCGCCGGGCCAACATGCAAAAGTCTTCTGTACCAAG ACCTCGGACACCGTGTGTGACTCCTGTGAGGACAGCACATACACCCAGCTCTGGAACTGGGTTCCCGAG TGCTTGAGCTGTGGCTCCCGCTGTAGCTCTGACCAGGTGGAAACTCAAGCCTGCACTCGGGAACAGAAC CGCATCTGCACCTGCAGGCCCGGCTGGTACTGCGCGCTGAGCAAGCAGGAGGGGTGCCGGCTGTGCGCG CCGCTGCGCAAGTGCCGCCCGGGCTTCGGCGTGGCCAGACCAGGAACTGAAACATCAGACGTGGTGTGC AAGCCCTGTGCCCCGGGGACGTTCTCCAACACGACTTCATCCACGGATATTTGCAGGCCCCACCAGATC TGTAACGTGGTGGCCATCCCTGGGAATGCAAGCATGGATGCAGTCTGCACGTCCACGTCCCCCACCCGG AGTATGGCCCCAGGGGCAGTACACTTACCCCAGCCAGTGTCCACACGATCCCAACACACGCAGCCAACT CCAGAACCCAGCACTGCTCCAAGCACCTCCTTCCTGCTCCCAATGGGCCCCAGCCCCCCAGCTGAAGGG AGCACTGGCGAC

Figure 2 shows the nucleotide sequences encoding the hinge, CH2 and the CH3 domains of the human IgGl antibody sequence. The nucleotides in bold and underlined are the residues that were changed by site-directed mutagenesis. All the changes lead to an amino acid change, making it a total of five changes from the consensus human IgGl sequence.
GAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCG TCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGC GTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTG CATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACC GTCCTGCACCAGGACTGGCTGAATGGCAAGGACTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCC CCCATGCAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAGCCACAGGTGTACACCCTGCCCCCA TCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGGCAC ATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGAC TCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTC TTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCG GGTAAATGA

Figure 3 shows the nucleotide sequence of the full length TNFR:Fc fusion protein. The fusion protein was generated by splice overlap extension PCR. The residues in bold depict the leader peptide for secretion of the fusion protein. The underlined nucleotides represent the Fc portion of the fusion protein.






Figure 6 shows the in vitro bioactivity of the recombinant TNFR:Fc fusion protein produced and secreted into the cell-culture supernatant by a mammalian (CHO Kl) cell line that was stably transformed using the mammalian cell specific expression vector containing the cDNA encoding the full-length TNFR:Fc fusion protein. The cytotoxicity-rescue assay depicted in the figure displays the level of the rescue efficiency of the TNFR:Fc fusion protein produced in this invention wherein the degree of cytotoxicity-rescue efficiency is a measure of the recombinant TNFR;Fc fusion protein to quench the cytotoxic nature of TNF-alpha ligand on TNF-alpha sensitive L929 cells. The cell viability was measured using the MTT assay. The degree of cytotoxicity rescue by different stable transformants is shown wherein the cell culture supernatant from each of these stable transformants was used to assay for the bioactivity of the recombinant TNFR:Fc fusion protein. The "cells alone" depicts the absorbance of the well where there is complete viability. "Actd" refers to the absorbance of those samples where actinomycin D was added to serve as an internal control. "TNF alpha" depicts the absorbance of the samples where recombinant TNF alpha was added to the cells. The standards (std 10, std5 and std2.5) show the absorbance of the samples to which recombinant TNFR was added in varying " concentrations as a positive control.








DETAILED DESCRIPTION OF THE INVENTION
Definitions
As used herein, the term recombinant TNFR:Fc receptor protein or TNFR:Fc refers to a protein having amino acid sequence similar to the extracellular domain of the human TNFRII (p75) protein and which can bind to its native ligand TNF-alpha in turn inhibiting the TNF-alpha from binding to the cell membrane bound TNFRI or TNFRII. Of the two distinct forms of TNFR known to exist, the preferred TNFR of the present invention is the TNFRII (p75). Soluble TNFR constructs are devoid of the transmembrane region for facilitating secretion out of the cell. The soluble part of the TNFRII which is the extracellular domain is fused in frame to the Fc region of the human IgGl.The fusion protein of the present invention is biologically active, i.e. it can bind TNF in solution.
The term "isolated" or "purified" when used in this specification describes the purity of the TNFR protein or protein composition, means that the protein or its composition is substantially free of other proteins of natural or endogenous origin and contains less than 1% by mass of protein contaminants residual of production processes.
"Recombinant", as used in this application means that a protein is derived from recombinant expression systems, which in this specification is a mammalian cell based expression system.
"Biologically active" as used in this specification as a characteristic of TNFR:Fc fusion protein, means a recombinant TNFR:Fc fusion protein that can bind TNF-alpha in standard binding assays like ELISA or mammalian cell based biological assays.
"Isolated DNA sequence" refers to a DNA polymer in the form of a separate fragment or as a part of a larger DNA construct. Such sequences would be cloned in expression vectors and would enable isolation of the sequence in large amounts for identification, manipulation and recovery of the DNA fragment. Such sequences will be provided in an open reading form without any interruptions by non-translated DNA regions or by introns.
"Nucleotide sequence" refers to a heteropolymer of deoxyribonucleotides. DNA sequences encoding the proteins provided by this invention can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic gene which is capable of being expressed in a recombinant transcriptional unit.
PROCEDURE:
Isolation of cDNAs encoding TNFRs
The coding sequence of TNFR is obtained by isolating a complementary DNA (cDNA) sequence encoding TNFR from a cDNA or genomic DNA library. The

cDNA library is constructed by isolating mRNA from a cell line expressing mammalian TNFR example WI-26 VA4 or from human lymphocyte tissue and using the mRNA as a template for synthesizing double stranded cDNA. TNFR sequences contained in the library can be isolated by hybridization protocols where the cDNA clones are probed with labeled nucleic acid probes that specifically hybridize to TNFRI.
Alternatively, DNA encoding the whole fusion protein - the extracellular portion of the TNFR fused to the Fc portion of the human IgGl can be codon optimized for high expression in mammalian cell line of choice and synthesized de novo.
The human TNFR:Fc fusion protein in this invention was isolated by both the above methods. The TNFRI cDNA isolated from the cDNA library was sequenced and the region of the full-length TNFRI cDNA encoding the extracellular domain was fused in frame to the Fc of IgGl by splice-overlap-extension PCR to generate a recombinant transcriptional unit.
Construction of cDNAs encoding soluble TNFR:Fc fusion protein
Receptors of the TNF-R family are generally type-1 membrane proteins containing a secretion signal peptide at their N-terminus. The design of mammalian expression vector for the expression of recombinant TNF-R chimeric proteins can be based on available vector systems such as pcDNA 3.1, modified to include the following features: a multiple cloning site for insertion of the extra-cellular domain of receptor of interest, including its natural signal peptide; a cassette encoding the hinge, CH2 and CH3 domains of human IgGl which allows easy detection and purification of the recombinant protein and its secretion; the design of the expression vector can also accommodate independent (bi-cistronic) IRES-mediated co-expression of the green fluorescent protein which would allow rapid screening of highly expressing transfectants using fluorescence assisted cell sorting.
The cloning of the desired receptor: Fc fusion cDNA construct requires the presence of suitable restriction sites flanking the cDNA of interest, which can be introduced by PCR amplification using suitable oligonucleotide primers. In the case of the receptor(s), the cDNA fragment spanning the entire extra-cellular domain, starting at the initiation codon (ATG) and extending into or upto the trans-membrane region is generally preferred.
The 5' forward primer for TNF receptors should contain the following features (5' to 3'):
• Three "protecting" nucleotides,
• The suitable restriction site,
• A Kozak consensus sequence (GCCACC)3, and
• 14-17 nucleotides matching the N-terminal sequence of the receptor(s),
including the ATG.
The 3' reverse primer should contain (5' to 3'):
• Three "protecting" nucleotides,
• The suitable restriction site, and

14-17 nucleotides complementary to the 3' portion of the extracellular domain of the receptor.
In this specification SOE-PCR is used to generate the full-length TNFR:Fc fusion protein. In such a PCR a 771 bp cDNA fragment encoding the signal peptide and ECD (extra cellular domain) region of the human TNFRII (p75) protein is spliced with a 699 bp cDNA fragment encoding the hinge, CH2 and CH3 domains of the Fc region of human IgG 1.
Expression of recombinant TNFR
The present invention provides recombinant expression vectors to amplify or express DNA encoding TNFR:Fc fusion protein. Recombinant expression vectors are replicable DNA constructs in which the DNA encoding for the protein of interest in linked to certain gene elements that drive its expression. An assembly of such a transcription unit generally comprises of - transcriptional promoters or enhancers, appropriate transcription and translational initiation and termination sites, a coding sequence that encodes for the protein of interest and a selection marker that can help to differentiate between the transfected and the non-transfected mammalian cell line clones. The DNA sequences encoding the TNFR:Fc fusion protein that are described as part of this invention will not contain any introns.
The cDNA sequence that encodes for the full-length fusion protein, in this specification will also contain a leader peptide at the N terminal of the gene, to allow for secretion of the protein into the culture medium. The leader peptide is linked in a way that it is in the correct reading frame with TNFR:Fc, contiguous with the gene at its 5 prime terminal.
The expression of recombinant proteins in mammalian cells is particularly preferred as part of this invention since such proteins are known to be correctly folded thereby resuUing in a fully functional conformation. The cell line that will be used for recombinant gene expression, which in this specification is the CHO-Kl cells, will be a homogenous population of cells. The transfected colony of CHO-Kl containing the stably integrated transcriptional unit encoding for the recombinant protein will be a monoculture, i.e. the cells will be the progeny of a single ancestral transformant.
The transformed host cells will be transfected with expression vectors containing the complete transcriptional unit. The expressed TNFR:Fc fusion protein will be secreted into the culture supernatant. Elevated levels of expression product is achieved by selecting for cell lines using a selection marker such as a gene coding for antibiotic (neomycin) resistance.
Purification of recombinant TNFR: Fc
The present invention also entails the establishment of an optimal downstream process for the complete purification of TNFR:Fc fusion protein from a stable highly expressing host cell system cultured finally in animal-component free defined media to express the recombinant protein, a translational product of the DNA of the present invention. Single high expressing clones could be used at this stage to build a viable

and robust purification process. This would involve an effective integration of filtration trains and downstream chromatographic procedures. In addition, virus and endotoxin removal steps can be built into the overall operation.
For example, cell culture supernatants containing the recombinant protein can be clarified and concentrated using normal and tangential flow filtrations, respectively. In this context, commercially available protein clarification / prefiltration tools and concentrators can be utilized. A range of diatomaceous / cellulosic dual layered depth filters of graded pore structures, tailored to maximize the yield, product consistency and reproducibility can be explored. Subsequently, the concentrate can be applied to suitable protein A based affinity matrices. The eluted protein can be further purified by ion exchange / hydrophobic interaction / size exclusion chromatography. Finally reverse-phase chromatography can be employed to evaluate the homogeneity of the purified material. Some or all of the above mentioned steps could be used to obtain a homogenous recombinant protein fraction. The pure protein fraction can then be subjected to viral clearance using filters for the removal of retroviruses and parvoviruses and endotoxin removal using specific filtrations and chromatographic steps. The final product can be sterile filtered and bottled into fill vials with appropriate excipients and stabilizers and lyophilized thereafter in quantities defined for therapeutic dosage.
Therapeutic administration of recombinant TNFR: Fc fusion protein
The present invention also provides methods for using therapeutic compositions containing an effective amount of the soluble TNFR:Fc fusion protein along with suitable diluents and excipients and methods for suppressing TNF-alpha mediated inflammatory responses in humans that will comprise of the administration of an effective amount of the TNFR:Fc fusion protein. For therapeutic purpose, the purified and formulated TNFR:Fc fusion protein can be administered to patient, preferably human, for treatment in a manner appropriate to the indication.
Typically, the TNFR:Fc fusion protein based therapeutic will contain the purified protein in conjunction with physiologically acceptable excipients and diluents wherein such carriers will be non-toxic to the recipients at the dosages and concentrations employed. Preferably, the product described in the present invention will be formulated as a lyophilizate using appropriate excipients solutions as diluents. The appropriate dosages of administrations will be determined during trials and the amount and frequency of dosage will depend on factors such as the nature and severity of the indication being treated, the desired response and the condition of the patient etc.
The following examples are offered by way of illustration and not by way of limitation.

■ {
Example 1
Isolation of Human TNFR cDNA
The cDNA of TNFRII was isolated from cDNA libraries constructed using mRNA isolated from the WI-26 VA4 cell line and from the human lymphatic tissue. The DNA encoding the extracellular domain (ECD) of the human TNFRII was cloned from the full-length TNFRI cDNA clone isolated from the library. The ECD of TNFRII was PCR amplified using the following primers:
Forward Primer: 5' ATTCCGGGATCCACCATGGCGCCCGTCGCCGTC 3'
Reverse Primers: 5' TGTCACAAGATTTGGGCTCGTCGCCAGTGCTCCCTTCAGCTG 3'
A fragment of 771 bp was amplified encoding the signal peptide and ECD (extra cellular domain) region of the human TNFRII (p75). The forward primer has a BamHI site for cloning into the expression vector while the reverse primer has a homologous region to the 5' of the CH2 domain of the human IgGl for splice overlap PCR reaction (Figure 1).
Example 2
Isolation of hinge. CH2 and CH3 regions of human IgGI
The PCR amplified fragment in example 1 was fused in frame with the human IgGl Hinge4-CH2+CH3 regions. The cDNA of the human IgGl Hinge-K:H2+CH3 regions was isolated by PCR using a previously available recombinant construct containing a full length IgGl gene. The primers used for amplification were:
Forward Primer: 5' CTGAAGGGAGCACTGGCGACGAGCCCAAATCTTGTGACA 3' Reverse Primer: 5' ATTCCGCTCGAGTCATTTACCCGGAGACAGGGA 3'
The reverse primer has the Xhol site for cloning into the expression vector. The forward primer has a region that is homologous to the 3' end of the ECD of TNFRII. The PCR amplification of the full-length human IgGl gene with these two primers yielded an amplification product of size 699 bp.
Five amino acid residues were mutated by site-directed mutagenesis in the isolated Fc region. The changes are as follows:
Position 309: GA© - GA| (Glu - Asp)
Positions 351 and 352: ATHAG - Al^AG (He / Glu - Met / Gin)
Positions 480 and 481: AG^AC - AGi!^l|AC (Ser / Asp - Arg / His)
The primers used for site directed mutagenesis were the following:
5'-GGCTGAATGGCAAGGAcTACAAGTGCAAGGTCTC-3'

5'-GAGACCTTGCACTTGTAGTCCTTGCCATTCAGCC-3'
5'-CCTCCCAGCCCCCATGCAGAAAACCATCTCCA-3'
5*-TGGAGATGGTTTTCTGCATGGGGGCTGGGAGG-3'
5'-GGCTTCTATCCCAGGCACATCGCCGTGGAG-3'
5'-CTCCACGGCGATGTGCCTGGGATAGAAGCC-3'
The final sequence of the Fc domain with the five changes is depicted in Figure 2,
Examples
Construction of cDNA encoding soluble huTNFRiFc fusion protein
For generation of the full-length fusion protein, it was required to mix PCR amplified BCD of TNFRI (771 bp) and the Fc domain of IgGl (699 bp) in equimolar amounts and add end-primers i.e. primers annealing to the 5' of the BCD of TNFRI and the 3' end of the Fc domain of IgGl for amplification of the fusion product (Figure 3).
Forward Primer: 5' ATTCCGGGATCCACCATGGCGCCCGTCGCCGTC 3'
Reverse Primer: 5' ATTCCGCTCGAGTCATTTACCCGGAGACAGGGA 3'
The fusion product generated from such a PCR is of the size of 1470 bp. The fusion product was restriction digested with BamHI and Xhol and cloned into similarly digested mammalian expression vector pcDNA3.1 (Figure 4).
Example 4
De novo synthesis of the full-length codon optimised TNFR:Fc fusion protein
The full-length TNFRiFC fusion protein was codon-optimised for high expression in the hamster cell line CHO-Kl (Figure 5). The codon-optimised sequence contained appropriate restriction enzyme sites for cloning into a mammalian expression vector, which in this specification is the pcDNA3.1.
Example 5 Expression of soluble TNFRiFC fusion protein in CHO cells
The cDNA sequences encoding for the fusion protein TNFR:FC of examples 3 and 4 cloned in pcDNA3.1 were transfected into CHO-Kl cells (Ref). All transfections were performed in a separate facility. Only mycoplasma free cell lines were used and allowed in this facility.
Transfection was performed by mixing 3 |ig DNA dissolved in TE buffer pH 7 to pH 8 with 15 |,il SuperFect Transfection Reagent. Mix by pipetting up and down 5 times, or by vortexing for 10 s. This DNA and Superfect reagent mix was added to CHO

cells growing in a 6 well plate. The cells were incubated with the transfection complexes for 3 hours under their normal growth conditions after which medium containing the remaining complexes from the cells was removed by gentle aspiration, and cells washed with 4 ml PBS. Fresh cell growth medium (containing serum and antibiotics) was then added. The cells were assayed for expression of the transfected gene after an appropriate incubation time.
For selection of stable trasfected cell lines appropriate selection medium was added to the cells and the cells were allowed to grow under normal growth conditions. The cells were maintained in the selection medium until distinctive colonies appeared.
Example 6
In vitro neutralization of rTNFalpha by soluble TNFR-II
In vitro neutralization of recombinant TNF-alpha ligand (ref) was tested in a cell-based assay. TNF-alpha responsive L929 cells were seeded at a concentration of 2 x
104 cells/well in 90 |xl culture medium in a 96 well plate.
The cells were incubated overnight at 37°C and 5% C02. The cell culture supernatants collected from single-cell derived transfected populations of the CHO Kl cell lines stably expressing the recombinant TNFR:Fc fusion protein were incubated with lOng/ml TNF-alpha for 30min at RT. The standard rhTNF-alpha dilutions were made in complete medium. Then lOul of lOOug/ml actinomycin was added to each sample. 10 ul of each sample was added to an L929 seeded well, with final concentration of TNF-alpha ranging from 1 ng/ml and 1 ug/ml actinomycin D. After the incubation period (20 hrs at 37°C and 5% C02), 20 ^1 of the MTT/PMS labeling reagent was added to each well. The microplate was incubated for 4 h in a humidified atmosphere (e.g. ^TC, 5% C02 incubator). After the incubation, the absorbance was measured at 490nm on the plate reader. Based on the % rescue obtained, the bioactivity of the cell culture supernatants from TNFR:Fc transfected cells (CHO Kl) was screened (Fig 6).
Example 7 Purification of soluble TNFR: FC fusion protein in CHO cells
The culture supernatant harvested from the CHO Kl cell lines transfected with the recombinant TNFR:Fc fusion protein, post clarification and concentration was affinity purified using ultra affinity matrix (eg. Prosep VA,Millipore) as per standard laboratory protocol. Fig.7. illustrates the elution profile of the affinity purified material. The elution pattern shows a single eluate peak and unbound contaminant proteins in the flow through peak. The eluates from the affinity column were evaluated for the presence of the target TNFR:Fc fusion protein by western analysis using antibodies specific to either TNFR II or IgGl Fc region of the TNFR: Fc fusion protein. Western analysis (Fig.8) revealed immunogenicity with both antibodies thus establishing the identitity of the purified material as TNFR:Fc. Silver staining of the



Claims:
1. A novel process for preparing a recombinant soluble TNFR:Fc receptor, useful for
protecting humans from the deleterious inflammatory effects of TNF-alpha.
2. A novel method for preparing a recombinant soluble TNF receptor, comprising the
steps of:
Construction / verification of transfection ready recombinant expression
vectors encoding the TNFR:Fc fusion protein.
Establishment of transient expression of recombinant TNFR:Fc fusion protein
in mammalian cell lines
Establishment of stable expression of recombinant TNFR:Fc fusion protein in
mammalian cell lines
Establishment of a single, high expressing cell line, stably expressing the
recombinant protein
Establishment of a mammalian cell line over-expressing TNFR:Fc in serum
(animal component) free media
Purification of the TNFR:Fc fusion protein from cell culture supernatants of
the single high expressing mammalian cell line
Production of the bioactive protein for use in animal studies followed by
therapeutic studies in human patients
3. The use of the recombinant soluble TNFR:Fc fusion protein receptor according to claim 1, for treating any indication associated with TNF-alpha mediated inflammatory response.
4. A process for preparing a recombinant soluble TNFRtFc fusion protein, useful in the treatment of adult respiratory distress syndrome; cachexia/anorexia; cancer (e.g., leukemias); chronic fatigue syndrome; graft versus host rejection; hyperalgesia; inflammatory bowel disease; neuroinflammatory diseases; ischemic/reperfusion injury, including cerebral ischemia (brain injury as a result of trauma, epilepsy, hemorrhage or stroke, each of which may lead to neurodegeneration); diabetes (e.g., juvenile onset Type 1 diabetes mellitus); multiple sclerosis; ocular diseases; pain; pancreatitis; pulmonary fibrosis; rheumatic diseases (e.g., rheumatoid arthritis, osteoarthritis, juvenile (rheumatoid) arthritis, seronegative polyarthritis, ankylosing spondylitis, Reiter's syndrome and reactive arthritis, psoriatic arthritis, enteropathic arthritis, polymyositis, dermatomyositis, scleroderma, systemic sclerosis, vasculitis, cerebral vasculitis, Sjogren's syndrome, rheumatic fever, polychondritis and polymyalgia rheumatica and giant cell arteritis); septic shock; side effects from radiation therapy; systemic lupus erythematous; temporal mandibular joint disease; thyroiditis and tissue transplantation.
5. A process for preparing a recombinant TNFR:Fc fusion protein, or a functional derivative thereof which is capable of binding to TNF-alpha, comprising cultivating the host organism and isolating the expressed protein.

6. A vector comprising a polynucleotide of recombinant TNFR:Fc fusion receptor
protein, as in claim 1, operatlvely linked to an expression control sequence.
7. A prokaryotic or eukaryotic host cell containing a polynucleotide of recombinant
TNFR:Fc fusion protein, as in claim 1.
8. A method comprising growing host cells of claim 7, in a suitable nutrient medium
and, optionally, isolating said soluble TNFR:Fc fusion protein from said cells or said nutrient medium.
9. A method comprising the steps of:
(a) Culturing a prokaryotic or eukaryotic host cell of claim 1;
(b) Maintaining said host cell under conditions allowing the expression of
soluble TNFR: Fc fusion protein by said host cell; and
(c) Optionally isolating the soluble TNFR: Fc fusion protein expressed by
said host cell.
10. A pharmaceutical composition comprising of purified, lyophilized TNFR: Fc
fusion protein, or a functional derivative or fragment thereof, and a combination
of pharmaceutically acceptable diluents and excipients.

10
The Controller of Patents The Patent Office Chennai

Documents:

586-CHE-2004 CORRESPONDENCE OTHERS 09-04-2012.pdf

586-CHE-2004 AMANDED CLAIMS 01-12-2009.pdf

586-CHE-2004 AMANDED PAGES OF SPECIFICATION 01-12-2009.pdf

586-CHE-2004 CORRESPONDENCE OTHERS.pdf

586-CHE-2004 EXAMINATION REPORT REPLY RECIEVED 01-12-2009.pdf

586-CHE-2004 FORM-1 01-12-2009.pdf

586-CHE-2004 FORM-18.pdf

586-che-2004 correspondence others 24-12-2010.pdf

586-CHE-2004 CORRESPONDENCE OTHERS 22-10-2009.pdf

586-CHE-2004 CORRESPONDENCE OTHERS.pdf

586-CHE-2004 CORRESPONDENCE PO.pdf

586-CHE-2004 FORM 18.pdf

586-CHE-2004 OTHER DOCUMENT 20-07-2004.pdf

586-che-2004-abstract.pdf

586-che-2004-correspondnece-others.pdf

586-che-2004-description(complete).pdf

586-che-2004-description(provisional).pdf

586-che-2004-form 1.pdf


Patent Number 241924
Indian Patent Application Number 586/CHE/2004
PG Journal Number 32/2010
Publication Date 06-Aug-2010
Grant Date 30-Jul-2010
Date of Filing 18-Jun-2004
Name of Patentee CIPLA LTD
Applicant Address MUMBAI CENTRAL, MUMBAI - 400 008
Inventors:
# Inventor's Name Inventor's Address
1 DR. VILLOO MORAWALA PATELL "DISCOVERER", 9th floor, unit 3, international tech park, whitefield road, Bangalore - 560 066
PCT International Classification Number C12P 21/00
PCT International Application Number N/A
PCT International Filing date
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 NA